JPH11507235A - Linked linear amplification of nucleic acids - Google Patents

Abstract

  (57) [Summary] The extended synthesis ("amplification") of the nucleic acid sequence of interest is achieved by a series of linked multi-cital primer extension reactions (LLAs). The primer used in the primer extension reaction of the above method contains a non-replicable element that terminates nucleic acid synthesis, preventing the synthesized molecule from serving as a template in subsequent cycles. The synthesized molecules accumulate mathematically linearly during primer extension, rendering the method relatively insensitive to contaminating nucleic acids. Multiple primers are used to ensure that multiple copies of the nucleic acid sequence of interest are accumulated. The present invention also provides a reagent kit for detecting the amplified target nucleic acid sequence and performing the above reaction.

Description

Description: TECHNICAL FIELD The present invention relates to in vitro replication of nucleic acids. The invention particularly relates to the step of replicating the nucleic acid sequence of interest. According to this step, the ligation of multiple primer extension reactions in which the sequence of interest is produced mathematically linearly will ultimately result in a large amount of the desired sequence. 2. Brief Description of the Background Art Mass replication of nucleic acids, now known as nucleic acid "amplification methods" (herein so-called), is widely used practically and theoretically in various situations. H. G. Khorana and colleagues describe an in vitro DNA amplification reaction to increase the practical amount of double-stranded DNA (part of the sequence of the major yeast alanine tRNA gene) produced by enzymatic ligation of synthetic DNA. For the first time (see K. Kleppe et al., J. Mol. Biol. 56: 341-361 (1971)). Subsequently, in vitro amplification, a technique now known as the polymerase chain reaction or "PCR", was applied to the amplification of genomic DNA (Saiki et al., Science 230: 1350-1354 (1985)). The widespread use of synthetic oligonucleotide primers, thermostable DNA polymerases, and automated temperature cycling equipment has made PCR a widely used tool for molecular biologists. This PCR step is referred to in the literature as a "logarithmic amplification" reaction. Each time, or "cycle", of the primer extension reaction, the primer binding site of one primer is synthesized. That is, any of the synthetic DNA molecules produced in any cycle performed can be used as a template for primer-dependent replication. By combining this aspect of the process with the presence of a sufficiently large number of primer molecules, synthetic DNA molecules accumulate mathematically logarithmically as the reaction proceeds. Although PCR has proven to be a useful technique for molecular biologists and has been used extensively in human genetic research, diagnostics, and forensic science, as well as in the detection of antibodies, its shortcomings have also been recognized. The course of the PCR reaction can be difficult to quantify in nature, mainly because the amplification products increase logarithmically with each round of the amplification reaction. PCR products, i.e., double-stranded DNA molecules, are difficult to analyze or sequence as is. Generally, DNA strand separation must be performed prior to sequencing or subsequent steps that require single-stranded nucleic acid (eg, hybridization to a probe capable of detecting the sequence of interest). The PCR reaction process has also been shown to be extremely sensitive to impurities resulting from the introduction of previously amplified DNA sequences into subsequent reactions. This problem is thought to be caused by the fact that (1) very large amounts of DNA are produced in each reaction cycle, and (2) all DNA strand products are used as templates in successive cycles in the reaction. Even small amounts of impure DNA are amplified logarithmically and produce erroneous results (see Kwok and Higuchi, Nature 339: 237-238 (198 9)). The problem of such contamination is widely recognized, and various methods of reducing impurities have been reported in the literature (eg, chemical impurity removal, physical treatment, enzymatic treatment, and the use of closed systems). " Genetic Recognition ", Nov. 20, 1992, San Diego, CA, John B. Findlay," Development of PCR for in vitro Diagnostics "). There is still a need for new nucleic acid (DNA) amplification methods that provide large amounts of DNA, amplify only specific sequences of interest, and avoid the problems associated with "PCR" reactions. In particular, there is a need for a nucleic acid amplification method that ultimately produces large quantities of a nucleic acid molecule of interest, or a large quantity of molecules containing a nucleic acid sequence of interest, and is relatively insensitive to the presence of contaminating nucleic acids. There is also a need for nucleic acid amplification methods that produce single-stranded products. SUMMARY OF THE INVENTION The above and other needs are satisfied by the present invention. The present invention, in one embodiment, provides a step of amplifying a specific nucleic acid sequence of interest in a complementary nucleic acid strand contained in a sample. This process includes the following steps. (A) When the first-generation primer extension product is synthesized using the above-mentioned strand as a template and the generated first-generation primer extension product is dissociated from the strand, the second-generation primer extension product of the primer for the complementary strand is synthesized. Contacting the strand with a primer containing a non-replicable element under conditions where the primer for the strand is selected to act as a template for: (b) separating the first generation primer extension product from the template (C) combining the first generation primer extension product with the primer of step (a) under conditions such that the second generation primer extension product is synthesized using the first generation primer extension product as a template. Let react. In this case, the second-generation primer extension product contains at least a part of the target nucleic acid sequence, and cannot be a template for synthesis of the extension product of the primer extended to synthesize the template. In another embodiment of the present invention, the product of step (c) is separated to produce a single-stranded molecule and the whole process is repeated at least once. Step (c) is preferably repeated a number of times, the process being performed in an automated manner under the control of a programmable temperature cycling instrument. With the increase in second generation primer extension products that cannot be templated for the primers that have been extended to prepare the first generated template, new primer pairs containing non-replicable elements can be used. This new primer pair conveniently binds to the second product synthesis and ensures amplification of the sequence of interest. The linear replication process is again performed for several cycles. Such "ligation" of a multi-cycle primer extension reaction ultimately amplifies the original nucleic acid sequence of interest by a factor of 1000 or 1 million. For this reason, the present invention is referred to as "concatenated linear amplification" or "LLA". In another aspect of the present invention, there are provided a plurality of (plug-in) primer pairs comprising non-replicable elements in a single reaction. These pairs are selected so that they can bind to the individual templates under conditions of decreasing stringency. That is, all the elements necessary to perform several linked linear amplification reactions can be provided in a single reaction. In yet another embodiment of the present invention, a primer for a specific polymorphic site on a template that is known to exhibit a genetic disease or deficiency (such as sickle cell disease) is utilized according to the present invention. An allele-specific nucleic acid replication reaction is performed. Allele-specific primers containing non-replicable elements are designed to be primers for template-only nucleic acid synthesis containing the desired allele. The synthetic nucleic acid molecules produced by this step can be used, for example, in the diagnosis of genetic diseases or disorders, as reagents in further techniques such as gene cloning, or for forensic identification. The steps described herein can also be performed using single-stranded nucleic acids as a starting material. Such a process consists of: (A) contacting the strand with a first primer containing a non-replicatable element under conditions where the first generation primer extension product is synthesized using a single-stranded nucleic acid as a template; (b) a first generation primer Separating the extension product from the template to produce a single-stranded molecule, and (c) generating the first-generation primer extension product under the condition that the second-generation primer extension product is synthesized using the first-generation primer extension product as a template. Contacting with a second primer containing a non-replicable element. In this case, the primers are selected such that the second generation primer extension product cannot be a template for extension of the first primer. Steps (a) to (c) can be repeated many times, and a large number of nucleic acids are synthesized. Subsequently, this reaction is linked to the next reaction using the new primer pair. The steps described herein can also be performed using primers that include the factor to be cleaved. This step consists of the following. (A) contacting a strand of a nucleic acid template with a first primer containing a factor to be cleaved under conditions where the first generation primer extension product is synthesized using a nucleic acid as a template; (b) a first generation primer extension product (C) treating the single-stranded molecule such that the first-generation primer extension product is cleaved at the position of the factor to be cleaved; The first-generation primer extension product is brought into contact with the second primer under conditions where the second-generation primer extension product is synthesized using the primer extension product as a template. In this case, the primers are selected such that if the first primer extension product is cleaved at the position of the factor to be cleaved, the second generation primer extension product cannot serve as a template for extension of the first primer. You. Steps (a) to (c) can be repeated many times, and a large number of nucleic acids are synthesized. Subsequently, this reaction is linked to the next reaction using the new primer pair. In addition, the second primer may include a factor to be cleaved so that a ligated linear amplification reaction can be performed based on double-stranded or single-stranded starting material. The present invention also relates to a reagent kit used for amplifying a specific nucleic acid sequence. Such kits include, for example, a DNA polymerase, two or more primers for each sequence to be amplified, in which case each of the above primers contains a non-replicable element or has a factor to be cleaved. And may also include control nucleic acid sequences that can be replicated by those primers and DNA polymerase. The kit can also include a nucleic acid probe that can indicate the presence or absence of an amplification product of a particular sequence. When the kit includes a primer containing a cleavage factor, the kit may further include a reagent for cleaving the primer at the cleavage factor. BRIEF DESCRIPTION OF THE DRAWINGS FIGS. 1 to 4 are schematic diagrams of the nucleic acid amplification step of the present invention. FIGS. 5 to 6 are schematic diagrams of the nucleic acid amplification steps linked to the steps shown in FIGS. FIG. 7 is a more detailed schematic diagram of the nucleic acid amplification step performed using two primers according to the present invention. 8 to 10 are detailed schematic diagrams of a ligated linear nucleic acid amplification step performed using four primers according to the present invention. FIG. 11 is a schematic diagram of a nucleic acid molecule prepared by the PCR step and the step according to the present invention. FIG. 12 is a schematic diagram of the sequence of the human β globulin gene (Genbank locus HUMHBB) and some of the primers described herein. FIG. 13 shows the sequence of the human growth hormone sequence amplified in Example 7. The relative positions of the oligonucleotides used in the experiments are underlined. Oligonucleotide GH1 hybridizes to the complement of the indicated human growth hormone sequence. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS The nucleic acid replication process of the present invention can produce large amounts of a specific nucleic acid sequence of interest. The preferred format for this process consists of a series of linked multi-cycle primer extension reactions. In each multi-cycle primer extension reaction, primer-dependent nucleic acid replication is performed by a large number of cycles, and the primer extension product accumulates linearly in each cycle. Specific primers, or primer pairs, are provided for each nucleic acid strand in the starting sample containing the sequence to be amplified. Linear accumulation of primer extension products with each cycle is assured by the use of primers containing non-replicable elements (factors that prevent nucleic acid polymerase from replicating the entire primer sequence and stop the primer extension reaction). Is done. Alternatively, linear accumulation of the desired primer extension product is assured by the use of primers containing the factor to be cleaved. In this case, cleavage of the first primer extension product results in a second primer extension product that does not have an effective binding site for the first primer. By selecting appropriate primers containing such non-replicable elements or cleavage factors, and appropriate primer pairing conditions, primer extension products that accumulate in large quantities (herein "second generation primer extension products" ), But does not itself serve as a template in subsequent primer extension cycles using the same primers. That is, unlike a nucleic acid amplification reaction (such as "PCR") in which primer extension products from each cycle are used as templates in subsequent cycles, "logarithmic amplification" does not occur between each cycle. The process of the present invention utilizes and takes advantage of a number of important properties of oligonucleotide hybridization and primer extension reactions. The present invention takes advantage of the following advantages. -DNA polymerase can replicate template DNA by successive cycles of denaturation and primer-dependent extension reactions. -Even if the primers are not completely complementary, a primer-dependent extension reaction can occur under appropriate conditions. -The template produced in the previous primer extension cycle can be used for the primer extension reaction. -The primer extension reaction is inhibited by non-basic sites or non-nucleotide residues, if present in the template nucleic acid. Alternatively, the primer extension reaction is inhibited by physically removing a portion of the generated primer extension product by cleaving the molecule at the site to be cleaved introduced into the primer used in the primer extension reaction. -The length and composition of the primers affect the conditions (eg, temperature, etc.) at which the primers initiate a polymerase-induced extension reaction on the template by known mechanisms. -The primer extension reaction is performed in a rapid cycle by a temperature cycling instrument. The process conveniently utilizes a series of linear amplification reactions that can be performed (ligated) sequentially or in parallel (ie, simultaneously) to generate a large number of copies of the nucleic acid sequence of interest. The nucleic acid sequence of interest can include substantially the entire length of the template strand, or can consist of only a small portion thereof. The template strand containing the sequence of interest can be present in a substantially homogeneous sample or as part (even very partially) of the nucleic acid mixture. In accordance with the invention, there is provided a primer containing a non-replicating or cleaving factor for each strand containing the sequence to be amplified. In the case of double-stranded templates, the primer is added before or after denaturing the template. Primers are paired with each starting template and extended in the presence of a polymerase enzyme under conditions appropriate for the function of the enzyme to form a first primer extension product. This process is repeated by denaturing the resulting double-stranded nucleic acid, pairing the primer with the strand, and performing the primer extension reaction again. A second generation primer extension product is produced by a primer extension reaction using the first generation primer extension product. Since this product has non-replicatable elements, it cannot be a template for the same primer in subsequent cycles. Alternatively, if the primer contains a factor to be cleaved, the first generation primer extension product is cleaved at the location of the factor to be cleaved, and if this first generation primer extension product is paired with an appropriate primer and extended, the second generation The primer extension product does not have a binding site for the primer used to produce the first generation primer extension product. 1 to 5 are schematic diagrams of a series of primer extension reactions (ie, one linear amplification reaction) performed on a DNA template according to the steps of the present invention. As shown, the process begins with step (a) using double-stranded DNA molecules with defined ends. 1 to 4, the starting DNA strand is indicated by a solid line. The starting duplex is preferably denatured by heating the buffer containing it, and the resulting single strand is contacted with a pair of primers (step (b)). Each primer is preferably provided in a substantially excess number of molecules over the starting template and contains a non-replicating or cleaved factor in the sequence (indicated here by (x) or (o) in the primer sequence). Under appropriate conditions, the primers are paired with the individual templates and are extended according to a primer extension reaction in the presence of DNA polymerase and four deoxyribonucleotides (step (c)). The synthesized DNA is indicated by the dashed lines in FIGS. 1 to 4, and the DNA synthesized using the starting double-stranded DNA as a template is referred to as “primary” DNA. The resulting template is further denatured and the primers are paired (step (d)). As shown in step (e) of FIG. 2, a secondary product DNA is prepared by a primer extension reaction using the primary product primer extension product as a template, but the reaction is carried out using the non-primary DNA introduced into the primary product synthetic DNA. It does not go beyond the replicable element. That is, the DNA molecules indicated by reference numerals 10 and 20 are synthesized. As shown in the figure, the molecule 10 or the molecule 20 does not have a binding site that functions as a primer containing a non-replicating or cleaved factor. Not involved. That is, as shown in steps (f) and (g), the secondary generated molecules are mathematically linearly accumulated by a series of subsequent primer extension reactions. After a desired number of cycles, the synthetic DNA is used as a starting material (ie, subsequently) for a series of secondary primer extension reactions using a second primer pair. As shown in FIGS. 5 to 6, primers containing the non-replicable elements shown in (a) and (b) can use the reaction products of FIGS. 1 to 4 as molecules 10 and 20 as a template for further DNA synthesis. To be selected. Similarly, as a result of this series of primer extension reactions, synthetic DNA molecules which cannot be used as templates for the primers used in these reactions and which are indicated by reference numerals 30 and 40 in step (e) of FIG. 6 accumulate. After a desired number of cycles, these synthetic molecules can be ligated to the next replication reaction, using appropriate primers, also containing non-replicating or cleaved factors. When the primer contains a factor to be cleaved, a reaction in which the primary primer extension product is cleaved at the position of the factor to be cleaved is performed after the primary primer extension reaction and prior to the secondary primer extension reaction. That is, it is clear that the synthetic nucleic acid product of any series of cycles can itself be a template for further amplification reactions, provided new primers or primer pairs are provided. That is, if the primary linear amplification reaction is run for 100 cycles, the 100 copies resulting from this reaction can be used as a template in a coupled linear amplification (LLA) reaction using a new primer pair that can hybridize to a synthetic template. With an additional 100 cycles of linear amplification, the amplification accumulates 10,000-fold (100 × 100). By repeating the process with a third primer pair, 1 × 10 ⁶ Are cumulatively amplified. Further amplification is achieved by using additional primers and additional primer extension cycles. FIG. 7 is a very detailed schematic diagram of the use of two primers in the amplification step according to the invention. As shown, two primers are utilized for a continuous primer extension reaction. Each primer is complementary to the target sequence but contains one non-replicable element (x) instead of one of the complementary nucleotides. There are four reactions to consider. In reaction 1, primer P1 produces a copy of the strand above the template (primary nucleic acid; product I). One copy of product I is produced for each cycle, with m cycles resulting in m copies. In reaction 2, primer P2 likewise produces the lower strand of the template (primary nucleic acid; product II). One copy of Product II is produced for each cycle, with n cycles resulting in n copies. In practice, m and n are the same. In reaction 3, primer P1 produces multiple copies (secondary nucleic acid; product III) of product II (represented as template II) from reaction 2, but template II has an internally introduced non-replicable After the element is not duplicated. That is, product III cannot be a template for primer P1 or P2. Similarly, in reaction 4, primer P2 produces multiple copies of template I (secondary nucleic acid; product IV), but template I is not replicated beyond the non-replicable element. That is, product IV cannot be a template for primer P1 or P2. Table 1 shows the accumulation of each product as a function of cycle number. As shown, to calculate the output of the reaction (n ^Two + N) / 2 equation may be used. If the efficiency of the reaction is less than 100%, amplification is less. If a third primer containing a non-replicatable element and complementary to product III or product IV is included in the reaction, new products that are shorter than product III or product IV accumulate. This product is present in larger amounts than any other strand in the reaction, and often remains single-stranded. The “ligation” of the reaction according to the invention and the linear amplification reaction is shown in FIGS. Four primers are used in this reaction, linking two two-primer reactions performed simultaneously. In this reaction, primers P1 and P3 are complementary to the upper strand of the target nucleic acid, and P2 and P4 are complementary to the lower strand. The site complementary to primer P3 is 5 '(relative to the template) of the P1 complementary site. Similarly, the site complementary to primer 4 is 5 ′ (relative to the template) of the P2 complementary site. The nucleic acid sequence of interest is conveniently located in the region between the two primer pairs. Six different reactions, each with a different template, as shown, can be considered. Reactions 1A, 1B, 2A and 2B each result in linear amplification of a primary synthetic nucleic acid (products IA, IB, IIA and IIB, respectively) complementary to each strand of the starting nucleic acid template. Each of reactions 3A, 3B, 4A and 4B produces a secondary product that cannot serve as a template for primer P1 or P2 due to the presence of non-replicable elements in the nucleic acids synthesized in reactions 1A, 1B, 2A and 2B. The synthetic nucleic acid is linearly amplified. However, as seen in reactions 5 and 6, primers P3 and P4 have the function of initiating DNA synthesis on the original template DNA and templates IVA and IIIA, respectively, due to the location of their complementary sites. The products IIIB and IVB naturally do not serve as templates for any of the primers in this reaction, but contain the nucleic acid sequence of interest. It will be apparent that variations can be made to the reactions described herein. For example, linear amplification reactions can be linked sequentially, instead of being performed simultaneously as described in connection with FIGS. That is, primers P3 and P4 can be added to the reaction after an n-ital primer extension reaction (n ranges from 2 to 100). In another variation, primers P1 and P2 are selected such that primers P3 and P4 can pair with template DNA and initiate DNA synthesis under conditions that do not initiate DNA synthesis (eg, temperature, etc.). Primers P1, P2, P3 and P4 are provided in the first reaction. The first linear amplification is performed under more stringent conditions such that only primers P1 and P2 are involved in primer extension. After the desired number of cycles, the reaction conditions are relaxed and all four primers are involved in nucleic acid synthesis. Primers P1 and P2 continue to generate primary product primer extension products using the starting template and secondary products using the primary product as template, and primers P3 and P4 are also secondary product primers of primers P1 and P2. The extension product is used as a template. Again, the nucleic acid sequence of interest is conveniently located in the region of the template strand sandwiched between both primer pairs. If a fifth primer containing non-replicable elements and complementary to product IIIB or IVB is included in the reaction, new products that are shorter than IIIB or IVB will accumulate. This product is present in larger amounts than any other DNA strand in the reaction, and often remains single-stranded. One skilled in the art of molecular biology will understand that accumulation of single-stranded DNA will occur whenever an odd number of primers is used in practicing the present invention. The use of primers containing non-replicating and / or cleavage factors ensures that none of the synthetic nucleic acids produced by this step can serve as templates in subsequent primer extension cycles (provided that they are present in the starting material). Primer extension products synthesized from the initial template nucleic acid strand (except for such primer extension products referred to herein as "primary primer extension products"). That is, the mathematically logarithmic accumulation of synthetic nucleic acid per cycle that occurs during PCR (Kleppe et al., And Saiki et al., Supra) is avoided. Scientists experienced in the fields of molecular biology and DNA chemistry can synthesize primers that include non-replicating or cleaved factors. For example, primers containing a 1,3-propanediol residue (which stops DNA synthesis) are described in Seela et al., Nucleic Acids Res. 15,3113-3129 (1987) and is commercially available from Glen Research, 44901 Falcon Plate, Sterling, VA. Primers containing residues of 1,4-anhydro-2-deoxy-D-ribitol (an example of an abasic site) can be found in Eritja et al., Nucleosides & Nucleotides 6, 803-814 (1987). Can be synthesized. The disclosed European patent application 416817 A2 (Imperial Chemical Industries PLC; March 13, 1991) includes a primer containing a 2 'deoxyribofuranosyl naphthalene molecule as a non-replicable element between the primer sequence and the polynucleotide tail. Synthesis has been described. The synthesis of oligonucleotides containing other factors that terminate polymerase-dependent replication of the template (eg, ribonucleosides or deoxyribonucleosides) will be apparent to those skilled in the art. The non-replicable element is preferably at the terminal residue of the primer. Scientists experienced in the fields of molecular biology and DNA chemistry can also synthesize primers containing the cleaved factor. For example, primers containing ribonucleosides can be obtained by introducing a protected ribonucleotide instead of a deoxyribonucleotide in an oligonucleotide synthesis reaction known to those skilled in nucleic acid chemistry using the basic methods of oligonucleotide synthesis. Can be routinely synthesized by those skilled in the art of nucleic acid chemistry. Primers containing suitable ribonucleosides are commercially available. One method of cleavage of the primary primer extension product takes advantage of the difference in reactivity between the phosphodiester bond adjacent to the ribonucleoside and the phosphodiester bond adjacent to the deoxyribonucleoside. Primer extension products containing ribonucleotides can be readily cleaved by treating the product with a ribonuclease (RNase) such as RNase A. If uridine triphosphate (UTP) is introduced into the primer, the enzyme uracil N-glycosylase (UNG) can also be used to cleave the primary primer extension product to remove its complementary primer hybridization site. Alternatively, primer extension products containing ribonucleosides can also be cleaved, preferably by treatment with 0.5N NaOH hydrogen peroxide. Preferred primers include one or more ribonucleosides present at a position in the primer such that cleavage disrupts one hybridization site of the primer used in a subsequent primer extension reaction. This ribonucleoside, unlike a non-replicatable element, does not prevent a DNA polymerase-dependent extension reaction, and thus is located at the 3 'end of the primer. Depending on the embodiment, a typical amplification reaction is performed starting from a double-stranded DNA molecule containing a replication target sequence present in a longer sequence. Oligonucleotide primers specific for each strand, each containing a non-replicating and / or cleaving factor as described herein, are paired with each strand. Primers are chosen to bind to each strand in a position flanking the sequence to be amplified. The first cycle of the primer extension reaction is performed in the presence of DNA polymerase and four deoxyribonucleotide bases under conditions appropriate for the selected enzyme. The resulting primary synthetic DNA incorporates an oligonucleotide primer at the 3 'end and downstream (5') the complete binding site of the other primer. When the primers include a factor to be cleaved, the resulting primary synthetic DNA incorporates an oligonucleotide primer containing one or more factors to be cleaved at the 3 'end. A second primer extension cycle is performed in which the primary synthetic DNA serves as a template for another primer (ie, a primer not incorporated at its 3 'end). DNA synthesis proceeds along the template, but stops when the polymerase molecule reaches a non-replicable element located in the template. The resulting synthetic DNA, referred to herein as "secondary synthetic DNA," has a specific end defined by the entire sequence of the primer at the 5 'end and a portion of the other primer (which reaches a non-replicable element). At the 3 'end, as defined by the portion where the DNA polymerase has replicated. Secondary synthetic DNA does not participate as a template in subsequent DNA synthesis. As described above, the secondary synthetic DNA contains only a portion of the required primer binding site. Under selected primer pairing and extension conditions, this portion of the primer binding site is insufficient for the primer to bind and to serve as a site for primer-dependent DNA synthesis. That is, when the third and subsequent primer extension cycles are performed, only the first template DNA and the primary synthetic DNA are involved as templates. Subsequent replication of these templates results in a "linear" amplification every cycle of the secondary synthetic DNA containing the sequence of interest. After the desired number of primer extension cycles, additional replication can be achieved by providing a second primer for each strand. This second primer is selected to bind in the region of the first template strand that is sandwiched between the first primer pair. The second primer also contains a non-replicating and / or cleaved factor in the second primer, ensuring that the primer extension product does not become a nucleic acid synthesis template using those primers in subsequent cycles. You. When the second primer contains a factor to be cleaved, the primary primer extension product produced using those primers is cleaved at the position of the factor to be cleaved, and the secondary primer extension product produced therefrom contains the primary primer It does not contain an effective binding site such that a new copy identical to the chain is generated. It is known that primer binding conditions, especially temperature, determine whether a specific primer binds to a specific template (Rychlik et al., Nucleic Acids Res. 18, 6409-6412 (1990). ); Wu et al., DNA Cell Biol. 10, 233-238 (1991)). That is, in reactions containing primers of various base compositions and / or lengths, the choice of primer binding temperature also serves to select which primer initiates DNA synthesis. For example, by providing the primary, secondary and tertiary primer pairs in one reaction that initiate reactions at 72 ° C., 62 ° C. and 52 ° C., respectively, by performing a first series of primer extension reactions at 72 ° C. It is guaranteed that only the primary primer pair will function to effect primer-dependent nucleic acid synthesis. After the desired number of cycles, the primer extension temperature is reduced to 62 ° C., and the primary and secondary primer pairs begin DNA synthesis. Reducing the primer extension reaction temperature to 52 ° C allows all three primer pairs to participate in primer-dependent DNA synthesis. By using a primer mixture in this step, the step can be performed efficiently without the need for an experimenter to add each primer separately as the step proceeds. By utilizing a useful, programmable temperature cycling instrument, all three primer pairs described above can be provided in one amplification reaction. Primers are chosen so that the primer that initiates DNA synthesis under the most stringent conditions binds to the 3 'template of the other primer. Similarly, a primer that initiates synthesis under the mildest conditions will bind 5 ′ to the other primer. The first series of primer extension reactions (Cital) is performed under the most stringent (highest temperature) primer pairing conditions such that only the first primer pair is involved in the synthesis of DNA containing the sequence of interest. After a preselected primer extension cycle, the primer pairing conditions are set loosely. By initiating linear replication of the secondary synthetic DNA produced by the first series of primer extension cycles under selected conditions, the secondary primer pair subsequently begins DNA amplification. When the conditions are further adjusted to allow the tertiary primer pair to perform primer-dependent DNA synthesis, the secondary synthetic DNA produced in the primary and secondary series of primer extension reactions serves as a template for DNA replication. The design of primers that bind at preselected temperatures is within the capabilities of a molecular biologist. The temperature at which a specific primer functions is determined by a general calculation method (Wu et al., DNA Cell Biol. 10, 233-238 (1991)), a computer program (Rychlik et al., Nucleic Acids Res. 1, 6409). -6412 (1990)) and can be predicted based on primer length and composition. Temperature cycling suitable for in vitro DNA amplification can be performed manually or with commercially available programmed temperature cycling equipment. Extremely rapid cycle times can be achieved using a hot air cycler (Wittwer et al., Nucleic Acids Res. 17, 4353-4357 (1989)). Short cycle times of up to 30 seconds are possible (Wittwer et al., Bioitechniques 10, 76-83 (1991)). That is, a primer extension reaction of 100 cycles can be achieved in a short time of up to 50 minutes. Appropriate temperature cycling to inactivate the reagents used to cleave the primary primer extension product can be incorporated into the program used with the programmed temperature cycling instrument to perform the desired amplification reaction. For example, many RNase activities are destroyed by heating a reaction containing Rase at 100 ° C. for 3 to 5 minutes. Allele-specific linear amplification reaction In one embodiment of the invention, primers are designed in which the 3 'nucleotide is complementary to a particular nucleotide that is capable of making a difference in the template (is polymorphic). Nucleotides that can make a difference can be nucleotides at other sites that are involved in genetic disorders, such as sickle cell disease, or are known to be polymorphic. Where there is a pseudopair between the primer and the 3 'nucleotide of the corresponding template, the design of the primer ensures that little or preferably no extension occurs (Petruska et al., PNAS USA 85 , 6252-6256 (1988)). That is, such primers are "allele-specific" and can determine the presence or absence of one base in the target nucleic acid sequence. The presence of synthetic DNA after the use of the allele-specific primer in the process according to the invention indicates that the allele of interest is present in the initial template DNA. The allele-specific properties of the oligonucleotide prime reaction have been used to perform allele-specific PCR (see, eg, Newton et al., Nucleic Acids Res. 17, 2503-2516 (1989)). However, like general PCR, the logarithmic behavior of allele-specific PCR reactions has created difficulties in performing the reactions (see Ugozzoli et al., Methods 2, 42-48 (1991)). However, the linear behavior between the cycles of this amplification step avoids such difficulties due to the presence of non-replicable elements in the allele-specific primer. Detection of Amplified Product The primary product of the amplification step of the present invention is a single-stranded synthetic DNA of a fixed length. The length of the product strand is determined by the position of the last used primer and is equal to the length of the primer itself plus the number of nucleotides incorporated from the 3 'end of the primer to the non-replicable element of the template. The product can be detected by known nucleic acid detection techniques including use of radiation, fluorescent molecules or primers or probes labeled with enzymes, electrophoresis, high pressure liquid chromatography, and the like. The present invention has important applications in the diagnosis of genetic disorders in humans or other animals. Many human genetic diseases are known to be caused by specific changes in genes of known sequence. For these specific mutations, hybridization or other allele-specific techniques (see above) were used to determine which of the various gene sequences in the individual's DNA were involved in the disease. Diagnosis by DNA is possible. Clearly, amplification of the target DNA was effective in developing these techniques. The main advantages of template amplification are that small amounts of sample can be used, the ratio of signal to background of the detection system is improved, there is a clear potential for automation, and the amplification system itself is the detection system. The process of the present invention provides all of the same advantages provided by other amplification reactions, as well as additional advantages. The product is single-stranded and does not need to be denatured prior to detection. If an odd number of primers are used, excess single-stranded molecules will be produced. These molecules are useful, for example, as hybridization probes and offer many advantages over other amplification techniques. The additional advantage that the appearance of "false positives" is reduced compared to the logarithmic step used in successive cycles using the newly synthesized DNA as a template and the same primers as the product can be accumulated linearly and accurately quantified. Is provided. EXAMPLES The solutions used in the following examples are described below: TE (Tris-EDTA): 10 mM Tris-HCl, 1 mM EDTA. PH 8.0 TBE (Tris-borate-EDTA): 89 mM Tris-HCl, 89 mM borane Acid, 2mM EDTA, pH 8.3. Klenow polymerase buffer: 50mM Tris-HCl, 10mM MgCl _Two , pH 7.6 Kinase buffer: 50 mM Tris-HCl, 10 mM MgCl2, 5 mM DTT, 0.1 mM spermidine hydrochloride, 0.1 mM EDTA, pH 7.6 DNA polymerase I buffer: 50 mM Tris-HCl, 10 mM MgSO _Four , 0.1 mM DTT, 50 μg / ml bovine serum albumin, pH 7.2 Sequence buffer: 40 mM Tris-HCl, 20 mM MgCl _Two , 50 mM NaCl, pH 7.5 Bst polymerase buffer: 20 mM Tris-HCl, 20 mM MgCl _Two , pH 8.5 Thermus Aquatic Polymerase Buffer: 50 mM KCl, 10 mM Tris-HCl, 1.5 mM M gCl _Two , 0.01% w / v gelatin, pH 8.3 10X Ficoll load buffer: 100 mM Tris-HCl pH7.5, 10 mM EDTA, 0.5% bromophenol blue, 0.5% xylene cyanol and 30% Ficoll 5X SSPE: 50 mM sodium phosphate pH 7.0, 0.9 mM NaCl and 5 mM EDTA 6X SSC: 0.9 M NaCl, 0.09 M sodium citrate The process of the invention is illustrated in the following examples, which do not limit the scope of protection claims. . Example 1-1 1,3 propanediol inhibits primer extension when present in a template To demonstrate that 1,3 propanediol molecules have the ability to function as non-replicatable factors and inhibit DNA synthesis A template complementary to the 3 'end of the template and a template with or without one nucleobase containing a 1,3 propanediol molecule (denoted as the non-replicatable factor "X") was synthesized. The synthesized sequence is as follows: The primer and template are annealed to form the following primer-template complex: The primer-template complex was then combined with various DNA polymerases (Klenow fragment of DNA polymerase I, AmpliTac polymerase (Perkin Elmer-Cetus Corp.), BST polymerase (Bio-Rad Laboratories, Hercules, Calif.) And Sequenase polymerase (United states Biochemical, Cleveland, Ohio) ³² The product was extended in the presence of [P] -dCTP, and the product was subjected to electrophoresis on a denaturing polyacrylamide gel. The primer and template were mixed such that the ratio of primer to template was 10, and a buffer suitable for the polymerase enzyme was used. 20 μl of the reaction solution contains 1 pmol of either 207 or 207-X, 10 pmol P12, 25 μM dNTP, 0.5 μCi α- [ ³² Includes P] -dCTP and either Amplitac buffer, BST buffer, Klenow buffer or Sequenase buffer. The sample was heated to 90 ° C. for 2 minutes, then cooled to 0 ° C. for 5 minutes, and then reacted by adding 1 unit of DNA polymerase at 37 ° C. for 10 minutes. The results showed that the propanediol residue inhibited primer extension for all four DNA polymerases as shown below: Example 2-PCR with primers containing bases containing propanediol is not performed. Four oligonucleotides were prepared, two containing a non-replicable 1,3-propanediol molecule. The sequence was synthesized with an MMT-propanediol phosphorylated amidine at position Z on an Eppendorf Ecosyn D300 automated DNA synthesizer. When the sequence is registered in the synthesizer, Z is introduced. The sequence is shown in the table below: The site complementary to the oligonucleotide of the human β-globin gene (HUMHBB at GenBank locus) is shown in FIG. In vitro amplification reactions were performed with various combinations of the four primers. Each reaction contained 100 ng of human genomic DNA, 6 pmol each of the two primers, in a standard PCR reaction buffer. The reaction was heated at 94 ° C. for 3 minutes using a thermal cycler (Ericomp), cooled to 55 ° C. for 30 seconds, heated to 72 ° C. for 30 seconds, and then 31 cycles of heating and cooling as follows: 94 ° C, 1 minute, 55 ° C, 30 seconds, 72 ° C, 30 seconds. After thermal cycling, the samples were incubated at 72 ° C. for an additional 3.5 minutes. An amplification product of 319 bp was obtained only from the reaction solution containing the primers (BGP-130 and BGP-222) without propanediol. Therefore, it was confirmed that the primer containing propanediol did not perform PCR. Example 3-Primers containing propanediol produce specific DNA fragments. Plasmid pHβ ^A Was mixed with primers containing propanediol (BGP-1 30X and BGP-2 22X) or control primers without propanediol molecules (BGP-1 30 and BGP-2 22). The primer / template mixture was subjected to a thermal cycle of 94 ° C for 20 seconds and then 48 ° C for 20 seconds to dissociate the duplex template. After the last cycle, the reaction was further incubated at 48 ° C. for 5 minutes and 40 seconds to complete the primer extension reaction and anneal the single-stranded DNA. Reaction mixtures using primers containing propanediol (according to the invention) went around 45 rounds of primer extension. The PCR reaction using the primer without the propanediol molecule involved 10 rounds of primer extension. The reaction product was subjected to electrophoresis on 1.5% agarose (TBE buffer). Primers containing propanediol create smaller DNA fragments than those generated by PCR. The small size is because primer extension did not extend to the end of the template strand, leaving a 5 'extension of the product. FIG. 11 is a comparison between the PCR reaction product and the LLA reaction product according to the present invention. The major product of the logarithmically accumulating PCR reaction is a complete duplex with defined ends corresponding to the ends of the primers used. However, the products of the process of the present invention are smaller than the corresponding PCR products because primer extension does not pass through non-replicable factors. Example 4-Primers containing propanediol perform DNA amplification. Amplification reactions according to the invention were performed using BGP-1 30X and BGP-2 22X at various cycles. The amplification products were subjected to dot blot hybridization and the hybridization signal was compared to the signal obtained from a known amount of plasmid DNA containing the sequence. Plasmid pHβ in standard PCR reaction buffer ^A A 15 μl reaction solution containing (including the complete human β-globin gene cloned into pBR322), 5 pmol BGP-1 30X, 5 pmol BGP-2 22X, 83 μM dNTPs, and 2.5 units amplitac DNA polymerase was prepared. Thermal cycling reactions were performed in a 45, 32 and 22 cycle Corbett Resarch FTS-1 thermal cycler using the following program: 94 ° C for 20 seconds, 48 ° C for 20 seconds. At the end of the cycle, the reaction was heated at 94 ° C for 20 seconds and then incubated at 48 ° C for 4 minutes. The reaction product (3 μl) was mixed with 10 μl 4N NaOH, 250 mM EDTA and blotted onto a zeta probe membrane (Bio-Rad Laboratories, Hercules, CA). 56,118 and 231 ng of plasmid pHβ similarly denatured ^A Was also placed on the membrane. 5'- membrane ³² Hybridization was carried out with P-CTGCAGTAACGGCAGACTTCTCCT at 55 ° C. for 3 hours in 5 × S SPE, 1% SDS, 5 mg / ml Blotto, 10 μg / ml homomixed IRNA. After hybridization, blots were washed with 6X SSC at room temperature and then analyzed on a Bio-Rad molecular imager. The reaction was amplified approximately 250-fold, indicating that the al nucleic acid sequence of interest was amplified by the process of the present invention. Example 5-Amplification of the human β-globin gene from genomic DNA The linear amplification reaction was carried out according to the present invention using a Thermus Aquatics polymerase buffer, template DNA (800 ng genomic DNA or plasmid pHβ). ^A Ten ^Four Molecule), dNTPs in 200 μM each (dATP, dTTP, dCTP, and dGTP), oligonucleotide primers BGP 5-22X and BGP4-22X in 2 pmol, and 15 μl containing 2 units of amplitac polymerase (Perkin-Elmer Cetus). went. Plasmid pHβ ^A Contains a 4.4 kb PstI fragment of the human β-globin gene at the PstI site of pBR322. As a negative control, a reaction solution containing all the components used in the above-described reaction solution except the template DNA was used (a "no template" control). After denaturing the template DNA for 3 minutes, amplification was performed for 99 cycles as follows: annealing at 55 ° C for 30 seconds, polymerase reaction at 72 ° C for 15 seconds, and denaturation at 94 ° C for 30 seconds. At the end of the last cycle, the sample was annealed at 55 ° C. for 30 seconds and finally subjected to a polymerase reaction at 72 ° C. for 4 minutes. At the end of the first step (100 cycles), 7.5 μl were taken from each sample (genomic DNA, plasmid DNA, and negative control), thermus Aquatic polymerase buffer, 5 pmol BGP1-35X and BGP2-35X, and It was mixed with 7.5 μl containing 2 units of Amplitac polymerase. The cycle program was similar to the program used in the first step except that the annealing temperature was 63 ° C. Two reactions were performed to control the size of the fragments generated by the amplification. One reaction was performed with Thermus Aquatic Polymerase Buffer, 5 pmol BGP5-22X and BGP4-22X, 1X10 ⁸ Molar plasmid pHβ ^A And 3 units of amplitac polymerase. The second control contained the same composition as the previous reaction, except that BGP1-35X and BGP2-35X were used as primers. The template DNA was denatured at 94 ° C for 4 minutes before being cycled 48 times using the following conditional program: annealing and polymerase reaction at 55 ° C for 30 seconds; denaturation at 94 ° C for 30 seconds. At the end of the last cycle, the sample was annealed at 55 ° C. for 30 seconds and finally subjected to a polymerase reaction at 72 ° C. for 4 minutes. Analysis of LLA product All reaction solutions (15 μl) were mixed with 1.6 μl of 10 × Ficoll load buffer, and electrophoresed on a 1.5% agarose gel (Bio-Rad Ultrapure agarose). Electrophoresis was performed at 110 volts for 90 minutes in TBE buffer. The gel was stained with ethidium bromide (1 μg / ml) for 30 minutes, destained for 15 minutes, and then photographed with an ultraviolet (UV) projector. The electrophoresed DNA was then transferred to a nylon membrane (zeta probe, zeta probe, lead, KC and DA Man, rapid DNA transfer from agarose gel to nylon membrane, Nucleic Acids Res. 13: 7207-7221 (1985)). Bio-Rad) and the membrane was fixed by UV irradiation (Church, GM and W. Gilbert, Genome Sequencing, Proc. Natl. Acad. Sci USA 81: 1991-1995 (1984)). Pre-hybridize the membrane in 5x SSPE, 1% SDS, 10 μg / ml formic RNA and 0.5% dehydrated powdered skim milk (Carnation, Los Angeles, CA) for 1 hour, then 2 hours at 55 ° C ³² Probe labeled 5 'end with P 5' CAGGAGTCAGGTGCACCATGGT2.5X10 ⁶ Hybridization was performed at cpm / ml. The membrane was washed twice with 6X SSC at room temperature for 30 minutes and autoradiographed at room temperature for 30 minutes. Genomic DNA produced the same fragment as the globin gene plasmid DNA control. Fragment size was the same as that produced by BGP1-35X and BGP2-35X. Example 6: LLA amplification products are more resistant to contamination than PCR. Amplification in vitro: The "LLA" amplification reaction of the present invention is performed by using a Thermus Aquatics polymerase buffer, template DNA (3.5 × 10 ⁹ Molecular plasmid pHβ ^A ), DNTPs were performed in 15 μl each containing 200 μM (dATP, dTTP, dCTP, and dGTP), 5 pmol of oligonucleotide primers BGP1-22X and BGP2-22X, and 1.25 units of amplitac polymerase (Perkin-Elmer Cetus). After denaturing the template DNA for 1 minute, amplification was performed 49 times with annealing at 48 ° C. for 30 seconds and denaturation at 94 ° C. for 30 seconds. At the end of the last cycle, the samples were incubated at 48 ° C for 4 minutes. The PCR reaction was performed for comparison purposes with the Thermus Aquatics polymerase buffer, template DNA (3.5X10 ⁹ Molecular plasmid pHβ ^A ), DNTPs were performed in 15 μl each containing 200 μM (dATP, dTTP, dCTP, and dGTP), 5 pmol of oligonucleotide primers BGP1-22 and BGP2-22, and 1.25 units of amplitac polymerase (Perkin-Elmer Cetus). . After denaturing the template DNA for 1 minute, amplification was performed 9 times with annealing at 48 ° C. for 30 seconds and denaturation at 94 ° C. for 30 seconds. At the end of the last cycle, the samples were incubated at 48 ° C for 4 minutes. Analysis of LLA and PCR products Serial dilutions of LLA and PCR products (1/64 μl, 1/32 μl, 1/16 μl, 1/8 μl, 1/4 μl, 1/2 μl, 1 μl, 2 μl, 4 μl, and 8 μl) After mixing with 1X Ficoll load buffer, electrophoresis was performed on a 1.5% agarose gel. Electrophoresis was performed at 110 volts for 90 minutes in TBE buffer. The electrophoresed DNA was transferred to a nylon membrane by alkaline transfer (Read and Man, 1985), cross-linked by UV irradiation (Church and Gilbert 1984), and neutralized with 2X SSC. Subsequently, the membrane was washed with 5x SSPE, 1% SDS, 10 μg / ml formic RNA, 0.5% dehydrated powdered skim milk and ³² Probe labeled with P 5 'CAGGAGTCAGGTGCACCATGGT2.5X10 ⁶ Hybridized in cpm / ml. Hybridization was performed at 55 ° C. for 2 hours. After hybridization, the membrane was washed twice with 6 × SSC at room temperature for 15 minutes, and then analyzed and quantified using a Bio-Rad GS-250 molecular imager. Amplicon contamination experiment LLA (1/26 μl) and PCR (1/16 μl) products were aliquoted (quantified with an imager (described above)) in 10 volumes of distilled water. ^Four ,Ten ^Five , And 10 ⁶ These dilutions were subsequently used as DNA templates in PCR reactions. Amplification reaction was performed using the Thermus Aquatics polymerase buffer, template DNA (LLA or PCR dilution product), 200 μM each of dNTPs (dATP, dTTP, dCTP, and dGTP), 5 pmol of oligonucleotide primers BGP1-22 and BGP2-22, And 15 μl containing 1 unit of amplitac polymerase. The reaction was performed twice and after the first step of high temperature denaturation at 94 ° C for 3 minutes, the sample was amplified for 25 or 30 cycles (55 ° C for 30 seconds, 72 ° C for 30 seconds, and 94 ° C for 30 seconds) and finally at 50 ° C. Incubated for 30 seconds and 72 ° C for 4 minutes. In addition, a negative control containing all reagents except template DNA was included. To control and quantify the relative amounts of LLA and PCR DNA templates, a second PCR reaction was performed using different primer sets (MD040 and PC04) corresponding to the inside of BGP1-22 and BGP2-22. went. Reaction compositions (other than primers) and reaction conditions were as described in the section above. 15 μl of the reaction solution was mixed with 1.6 μl of 10 × Ficoll load buffer, and electrophoresed on a 1.5% agarose gel (Bio-Rad Ultra Pure Agarose). Electrophoresis was performed at 110 volts for 90 minutes in 1XTBE buffer. The gel was stained with ethidium bromide (1 μg / ml) for 30 minutes, destained for 15 minutes, and photographed with an ultraviolet (UV) projector. The electrophoresed DNA was then transferred to a nylon membrane by alkali transfer (Lead and Mann (1985)) and the membrane was fixed by UV irradiation (Church (1984)). Pre-hybridize membrane in 5x SSPE, 1% SDS, 10μg / ml formitas RNA and 0.5% dehydrated skim milk for 1 hour, then 2 hours at 55 ° C ³² Probe labeled with P 5 'CAGGAGTCAGGTGCACCATG GT2.5X10 ⁶ Hybridization was performed at cpm / ml. The membrane was washed twice with 6X SSC at room temperature for 30 minutes and then analyzed and quantified on a Bio-Rad GS-250 molecular imager. Results Determine the ratio of hybridization of the reaction products amplified with the outer primer set (measured the amplicon ability amplified in the second reaction) to the inner primer set (measured the amount of amplicon present in the reaction solution) did. As can be seen in the table below, the LLA reaction produces amplicons that are very resistant to amplification from the outer primer and are therefore resistant to the effects of contamination. Example 7: Use of primers containing ribonucleosides to produce specific DNA fragments by LLA Oligonucleotides and ribonucleosides containing oligonucleotides of the following sequences were prepared using standard automated solid-phase synthesis methods. The uracil nucleosides in oligonucleotides GH1 and GH2 are ribonucleosides. In vitro amplification reactions were performed to amplify fragments of the human growth hormone gene from genomic DNA samples using primers GH1 and GH2 containing ribonucleosides or deoxy primers GH3 and GH4. Each reaction contained 500 ng of human genomic DNA in a standard PCR reaction buffer containing 1.5 units of tack polymerase (Perkin-Elmer) and 40 pmoles of each of the two primers. The amplification reaction was performed by placing the reaction mixture in a thermal cycler, heating at 95 ° C for 4 minutes, cooling at 52 ° C for 2 minutes, and then heating at 72 ° C for 1 minute. The amplification reaction was performed for 28 cycles as follows: 94 ° C for 4 minutes, 52 ° C for 2 minutes, and 72 ° C for 1 minute; then another cycle was performed for: 94 ° C for 1 minute, 52 ° C for 2 minutes, and 72 ° C for 6 minutes. Following the reaction, the growth products were separated on a 1.5% agarose gel and then purified using the "Prep-A-Gene" DNA purification kit (available from Bio-Rad). A reaction volume of 5.6 μl of the amplified product was treated with 1.4 μl of 0.5 M NaOH to cut the growth product at the phosphodiester bond adjacent to the uracil ribonucleoside incorporated into the first PCR product, and then 95 Heated at C for 15 minutes. These solutions were neutralized by the addition of 0.9 μl of 1 M HCl, then the product was further linearly amplified, and the first primer extension product was not an exact copy of the ribonucleotide containing the primer used in the PCR reaction It was shown that. The PCR product has a 5 ' ³² Primer extension was performed using P-labeled oligonucleotide Md114. The primer extension product generated using the PCR amplified fragment treated with NaOH was shorter than the primer extension product obtained from the PCR amplified fragment not digested with NaOH, depending on the primer used in the reaction. These results indicate that the incorporated ribonucleoside can be cleaved in subsequent PCR amplifications to prevent primer extension.

Claims (1)

[Claims] 1. A method for intensifying a target nucleic acid sequence contained in a complementary nucleic acid strand, comprising: The method consisting of floors: (A) using the above strand and a primer containing a non-replicatable element as a template And contacted under such conditions that the first generation primer extension product was synthesized. The primer for the first generation primer extension product synthesized on the Second generation primer extension of primers for complement of the above strands when separated from Selected so that it can serve as a template for the synthesis of the product; (B) Separating the above first generation primer extension product from each template to generate a single-stranded molecule And; (C) combining the first generation primer extension product and the primer of step (a) with a first generation A second generation primer extension product was synthesized using the primer extension product as a template. Treated under the conditions   Here, the second generation primer extension product comprises at least a part of the target nucleic acid sequence. Primer extension of primers containing It cannot serve as a template for product synthesis. 2. Further, the second-generation primer extension products generated from each of those templates were separated. 2. The method of claim 1, comprising producing a single chain molecule. 3. The method of claim 1, wherein step (c) is repeated at least once. 4. Claim that the non-replicable element is not present at any terminal residue of the primer Item 1. The method of Item 1. 5. 2. The method of claim 1, wherein the non-replicatable element is a derivative of deoxyribonucleotide. Law. 6. The method of claim 1, wherein the non-replicable element is a derivative of a ribonucleotide. 7. 6. The method of claim 5, wherein the non-replicable element is a residue of 1,3-propanediol. . 8. The non-replicable element is 1,4-anhydro-2-deoxy-D-ribitol 6. The method of claim 5, which is a residue. 9. Furthermore, the second-generation primer extension product is combined with the second-generation primer extension product. Second non-replicable under conditions synthesized using alternative primer extension products as template The method of claim 1 including the step of processing with the various elements. 10. A method for enhancing the target nucleic acid sequence contained in a complementary nucleic acid strand, comprising: Step-by-step method: (A) using the above strand and a primer containing a non-replicatable element as a template And contacted under such conditions that the first generation primer extension product was synthesized. The primer for the first generation primer extension product synthesized on the Second generation primer extension of primers for complement of the above strands when separated from Selected so that it can serve as a template for the synthesis of the product; (B) Separating the above first generation primer extension product from each template to generate a single-stranded molecule And; (C) combining the first generation primer extension product and the primer of step (a) with a first generation A second generation primer extension product was synthesized using the primer extension product as a template. Treated under the conditions   Here, the second generation primer extension product comprises at least a part of the target nucleic acid sequence. The second generation primer extension product of the first primer It can serve as a template for the production of primer extension products. 11. Further, the primer extension product generated in step (c) is separated to form a single-stranded molecule. 11. The method of claim 10, comprising generating 12. 11. The method of claim 10, wherein step (c) is repeated at least once. 13. Ensure that non-replicable elements are not present at any terminal residue of the primer. The method of claim 10. 14． The non-replicable element is a derivative of deoxyribonucleotide. the method of. 15. The method of claim 10, wherein the non-replicable element is a derivative of a ribonucleotide. 16. 15. The method of claim 14, wherein the non-replicatable element is a 1,3-propanediol residue. Law. 17． The non-replicatable element is 1,4-anhydro-2-deoxy-D-ribitol 15. The method of claim 14, which is a residue. 18. Further, the second generation primer extension product of the second primer is transferred to the third primer. The immersion extension product uses the second primer extension product of the second primer as a template. Treatment with the third primers under the conditions formed by using each of the third primers, 11. The method of claim 10, comprising a manufacturable element. 19. Each strand is a primer binding site for a first primer and a second ply A primer binding site for the primer, the primer for the first primer 11. The binding site is 3 'of the primer binding site for the second primer. the method of. 20. A method for enhancing the target nucleic acid sequence contained in a complementary nucleic acid strand, comprising: Step-by-step method: (A) using the above strand, a first primer and a second primer, The first generation primer extension product is used for the first primer instead of the second primer. Under the first set of conditions for primer extension reaction as synthesized from The first primer separates the first primer extension product from this step from its template. When released, second generation primer extension of the first primer for complement of the strand Selected so that it can serve as a template for the synthesis of the product; (B) Separating the above first generation primer extension product from each template to generate a single-stranded molecule And; (C) combining the first generation primer extension product and the primer of step (a) with a first generation A second generation primer extension product was synthesized using the primer extension product as a template. Treated under the conditions (D) separating the second generation primer extension products from those templates to produce single-stranded molecules Make; (E) repeating steps (c) and (d) at least once; and (F) separating the reaction mixture of step (e) from the second generation primer A second primer is used to synthesize a primer extension product using the primer extension product as a template. Of the set of primer extension reaction conditions. 21. The first set of primer extension reaction conditions is the same as the second set of primers. 21. The method of claim 20, which is more stringent than the extension reaction conditions. 22. The first set of reaction conditions is at a higher temperature than the second set of reaction conditions. The method of claim 20. 23. Non-replicable elements are those that are not present at any terminal residue of the primer. The method of claim 20. 24. 21. The non-replicable element is a derivative of deoxyribonucleotide. the method of. 25. 21. The method of claim 20, wherein the non-replicable element is a derivative of a ribonucleotide. 26. 25. The method of claim 24, wherein the non-replicable element is a 1,3-propanediol residue. Law. 27. The non-replicatable element is 1,4-anhydro-2-deoxy-D-ribitol 25. The method of claim 24, which is a residue. 28. Each strand is a primer binding site for a first primer and a second ply A primer binding site for the first primer and a primer for the first primer. The binding site is 3 'of the primer binding site for the second primer Item 20. The method according to Item 20. 29. The nucleic acid sequence comprises a polymorphic site associated with a genetic disease, and each of the above primers Initiates nucleic acid synthesis only in the presence of the condition or only in the absence of the condition. 2. The method of claim 1, wherein the method is selected to: 30. 30. The method of claim 29, wherein the genetic disease is sickle cell anemia. 31. It further includes detecting the presence or absence of the amplified target nucleic acid sequence. The method of claim 1. 32. It further includes detecting the presence or absence of the amplified target nucleic acid sequence. The method of claim 10. 33. It further includes detecting the presence or absence of the amplified target nucleic acid sequence. 21. The method of claim 20. 34. DNA polymerase, primer pair for each sequence to be amplified (where each primer Primers are composed of non-replicable elements) and the primers and DNA primers described above. Amplification of a specific nucleic acid sequence, consisting of a control nucleic acid sequence that can be replicated by rimase Reagent kit. 35. 35. The method of claim 34, wherein the non-replicatable element is a 1,3-propanediol residue. Medicine kit. 36. The non-replicatable element is 1,4-anhydro-2-deoxy-D-ribitol 35. The reagent kit of claim 34, which is a residue. 37. DNA polymerase, primer pair for each sequence to be amplified (where each primer The primer comprises a non-replicable element) and the amplification production of the specific nucleic acid sequence described above. An increase in a specific nucleic acid sequence consisting of a nucleic acid probe capable of detecting the presence or absence of a substance. Reagent kit for width. 38. The nucleic acid, which can be replicated by the primer and a DNA polymerase; 38. The reagent kit of claim 37, further comprising a control nucleic acid sequence that can be detected by the probe. G. 39. 38. The method of claim 37, wherein the non-replicatable element is a 1,3-propanediol residue. Medicine kit. 40. The non-replicatable element is 1,4-anhydro-2-deoxy-D-ribitol 38. The reagent kit of claim 37, which is a residue. 41. The primers amplify a nucleic acid sequence indicative of a genetic disease or abnormality. 35. The reagent kit of claim 34, which is selected as follows. 42. The primers amplify a nucleic acid sequence indicative of a genetic disease or abnormality. 38. The reagent kit of claim 37, wherein the reagent kit is selected as follows.