JP3410038B2 - Method for producing L-aspartic acid - Google Patents

Description

Detailed Description of the Invention

[0001]

FIELD OF THE INVENTION The present invention relates to a method for producing crystalline L-aspartic acid from fumaric acid using aspartase. Further, it relates to a method of adding uncrystallized raw L-aspartic acid produced by the method to a raw material liquid and reusing it.

[0002]

2. Description of the Related Art JP-A-48-56618 discloses a method of adding fumaric acid to a DL-aspartic acid disodium salt solution to precipitate and recover DL-aspartic acid.
According to this method, DL-aspartic acid is chemically produced by reacting disodium fumarate with a large excess of ammonia to drive off excess ammonia, and then fumaric acid is added to precipitate DL-aspartic acid. Are separated. In this case, the solution before adding fumaric acid was DL-sodium aspartate, and the filtrate obtained by adding fumaric acid to this and separating DL-aspartic acid was disodium fumarate. It is disclosed that the following reaction is carried out by adding a large excess of ammonia to fumaric acid.

Usually, in the production of L-aspartic acid from ammonium fumarate using an enzyme, it is necessary to use at least one mole of ammonia with respect to the raw material, fumaric acid. In general, 2- to 2.3-fold molar amount of ammonia is used for the purpose. The optimum pH of aspartase, which is an enzyme that catalyzes this reaction, is around 8.3. In a pH range that is much higher than this pH, the enzyme activity may be lowered or the enzyme activity may be deteriorated. In the method of JP-A-48-56618, a large excess of ammonia is added to the disodium fumarate solution and used in the next reaction. However, when it is used in the enzymatic reaction by aspartase, a large excess of ammonia is not used. Can not.

The pH of the disodium fumarate solution is 8.4.
However, since a solution obtained by adding 1 mol of ammonia to the solution has a pH of 12.1 at 30 ° C. and aspartase is denatured, it cannot be used for an enzymatic reaction by aspartase. Further, Japanese Patent Publication No. 2524306 discloses a method in which fumaric acid is added to a monoammonium L-aspartate solution to precipitate and recover L-aspartate. In this method, a diammonium fumaric acid salt solution is made into an L-aspartic acid monoammonium salt solution by the action of aspartase, and then fumaric acid is added to precipitate L-aspartic acid as crystals, and the crystals are separated. A method is disclosed in which ammonia is added to the filtrate after separation and reused in the next reaction. In this method, fumaric acid is added to a monoammonium L-aspartate solution so that the salt of L-aspartic acid and fumaric acid undergoes an exchange reaction with fumaric acid or L-aspartic acid.
It is carried out under heterogeneous conditions in which crystals of either or both aspartic acids are always present.

In this method, the amount of fumaric acid added is 0.5 times the molar amount of L-aspartic acid present in the solution, but the liquid after separating the crystals of L-aspartic acid is the raw material liquid. In order to re-use the fumaric acid, the fumaric acid must be added again in order to restore the lowered substrate concentration to the initial concentration, and therefore the fumaric acid which is a solid is added twice. Increasing the number of complicated steps for handling solids is not good workability in industrial implementation.
Further, the purity of L-aspartic acid obtained is low.

[0006]

SUMMARY OF THE INVENTION An object of the present invention is to provide a method for producing crystalline L-aspartic acid with higher purity using aspartase, which solves the above problems.

[0007]

[Means for Solving the Problems] An intensive study was conducted to solve these problems. The amount of fumaric acid added for crystal precipitation is L- in the L-ammonium aspartate solution.
The fumaric acid salt formed after addition of fumaric acid is monoammonium fumarate in the vicinity of equimolar to aspartic acid salt, and this salt generally has low solubility. Due to the formation of this low-solubility salt, a part of it precipitates as crystals, and L-
It was found that the purity of L-aspartic acid obtained was low because it was mixed in the aspartic acid crystals.

In order to prevent this, ammonia is first added to an L-aspartate ammonium solution obtained by an enzymatic reaction with aspartase, and then an excess of ammonia is added to the fumaric acid present in the reaction solution. Based on the total number of moles of salt and L-aspartate, 0.
It was found that, when 6 to 1.2 times mol of fumaric acid was added, the added fumaric acid was dissolved and crystals of L-aspartic acid were precipitated.

By adding ammonia, not only monoammonium fumarate is produced after the addition of fumaric acid, but a mixture of monoammonium fumarate and diammonium fumarate is produced. Since ammonium has a high solubility, it does not enter the L-aspartic acid as crystals. In addition, the concentration of monoammonium fumarate that is partially formed can be reduced by the formation of diammonium fumarate and can be brought into a state of being dissolved in a solution. Therefore, crystals of monoammonium fumarate are L-aspartic acid. It can be prevented from being mixed in. As a result, highly pure L-aspartic acid crystals can be obtained.

Further, by using ammonia and an alkali metal hydroxide such as sodium hydroxide together for neutralizing the fumaric acid solution which is a substrate solution of aspartase, the recovery rate of L-aspartic acid crystals is increased, It was found that the amount of alkali metal hydroxide used at this time was in a range suitable for the enzymatic reaction by aspartase.

The present invention has been completed based on the above findings. That is, in the present invention, aspartase is allowed to act on a mixed solution containing fumaric acid, ammonia, and an alkali metal hydroxide to obtain an L-aspartate-containing reaction solution,
L- formed by crystallizing L-aspartic acid from the reaction solution
In the method for producing aspartic acid, ammonia is added to the L-aspartate-containing reaction solution, and then fumaric acid is added to crystallize L-aspartic acid to produce crystalline L-aspartic acid. It is a characteristic method for producing L-aspartic acid.

Further, according to the present invention, uncrystallized L-aspartic acid which is not crystallized in the above crystallization step is separated to obtain the uncrystallized L-aspartic acid.
Ammonia is added to the aspartic acid-containing liquid, and this can be reused as a raw material liquid for crystalline L-aspartic acid. Further, the present invention provides fumaric acid,
Aspartase is allowed to act on a mixed solution containing reused ammonium L-aspartate, ammonia and alkali metal hydroxide to obtain a reaction liquid containing L-aspartate.
L- formed by crystallizing L-aspartic acid from the reaction solution
In the method for producing aspartic acid, ammonia is added to the L-aspartate-containing reaction solution, and then fumaric acid is added to crystallize L-aspartic acid to produce crystalline L-aspartic acid. It is a characteristic method for producing L-aspartic acid.

As the aspartase, a transformant containing the aspartase gene or a product obtained by immobilizing a treated product thereof can be used. Further, in a reactor containing immobilized aspartase having an activity of 250 U or more as aspartase, fumaric acid containing 8 to 20% fumaric acid and L-aspartic acid in terms of fumaric acid, L-aspartic acid, ammonia and In the above method of passing a mixed solution of an alkali metal hydroxide, the flow rate is LHSV = 2 to 20
It is preferable that

1 U = 1 μmole L-aspartic acid production / min / ml immobilized enzyme was added to LHSV (Liquid Hour Spa).
ce Velocity; superficial velocity) = liquid flow capacity (ml) / catalyst filling capacity (ml) per hour. As the immobilized aspartase, an ion exchange resin may be used as a carrier for immobilization and cells or treated cells may be immobilized on the carrier by adsorption or coating with a polymer. Further, as the immobilized aspartase, a spherical styrenedivinylbenzene copolymer ion exchange resin is used as a carrier for immobilization, and the following general formula (I) is used.

[0015]

[Chemical 4]

(Wherein Y is a direct bond, or

[0017]

[Chemical 5]

Is a divalent group represented by R ₁ and R
₂ are each independently a hydrogen atom or an organic residue,

[0019]

[Chemical 6]

Is an anion, and n is 100 to 5
It is possible to use a mixture of a polymer represented by the formula (1) and a bacterial cell or a treated product of the bacterial cell, which is coated on the surface of a spherical styrenedivinylbenzene copolymer ion exchange resin and immobilized on the carrier. .

[0021]

BEST MODE FOR CARRYING OUT THE INVENTION The present invention is described in detail below.
The enzyme-containing material having an aspartase activity used in the present invention is, for example, bacterial cells such as Escherichia coli or Brevibacterium genus, a Pseudomonas microorganism known to have a high aspartase activity, or these bacterial cells. Sonicated, milled, freeze-thawed, enzyme-treated, detergent-treated, etc. to crush the microbial cells, ammonium sulfate salting out, acetone precipitation, etc. Etc. and purified products obtained by a conventional method, and any of them can be used.

When a part of alkali metal hydroxide is used for neutralizing fumaric acid, the amount of ammonia becomes relatively small,
This reduces the reaction rate of fumaric acid to L-aspartic acid. Therefore, as the bacterium having aspartase activity, it is particularly preferable to use Escherichia coli transformed with a plasmid having an aspartase gene incorporated therein and capable of producing a large amount of aspartase.

The aspartase gene that can be used in the present invention is Escherichia coli, Pseudomonas fluorescens, Enterobacter, Citrobactor.
er) microorganisms such as Escherichia coli (Escherilia coli), which are naturally recognized as having a gene hybrid with each other, and are derived from a microorganism having aspartase activity can be preferably used. And this gene is, for example, Escherichia coli K-12 (IFO3301) chromosomal DNA, Pseudo
It can be obtained by amplification from monas fluorescens (IFO3081) chromosomal DNA by PCR using primers prepared based on a known aspartase gene sequence.

The aspartase gene-incorporating plasmid is not particularly limited as long as it is a plasmid that is replicated in the microbial cells belonging to Escherichia coli.
8, pKK223-3, etc. can be used. Escherichia coli K-12 strain Escherichia coli is preferably used as a host microorganism into which a plasmid incorporating the aspartase gene is introduced.

These aspartase activity-containing microbial cells, treated products thereof, or enzymes may be immobilized on a carrier before use. As a carrier for immobilization, natural polymers such as cellulose, alginic acid, carrageenan, and mannan gel, or suitable synthetic polymers such as ion exchange resins, polyvinyl alcohol, and polyacrylamide can be used by a conventional method. Among these,
In particular, it is preferable that a spherical styrene-divinylbenzene copolymer ion-exchange resin carrier is immobilized by coating a mixture of the polymer represented by the general formula (I) with bacterial cells or a treated product thereof. , For example, PAS-880 or the like on a water-insoluble carrier is dried by mixing a water-soluble polymer having a property of cross-linking between polymer chains or between the polymer and the cell surface with the cell Therefore, the method of coating is preferable. Immobilized aspartase immobilized by this method has a low pressure loss and a thin diffusion layer, so the diffusion resistance is small and the LHSV is high.
Can be used for the reaction in.

The substrate used in the present invention is a fumaric acid neutralized salt aqueous solution. As the alkali used for neutralization, ammonia and alkali metal hydroxide are used in combination. The amount of the alkali metal hydroxide used is 0.1 to 1.2 times, preferably 0.3 to 1.0 times the total number of moles of L-aspartate and fumarate in the substrate solution. The molar ratio is more preferably 0.4 to 0.8 times. Here, "the total number of moles of L-aspartate and fumarate in the substrate solution" means "the number of moles of fumarate in the substrate solution" in the initial state where L-alpartate is not present. It will be readily understood by those skilled in the art that the term "fumaric acid" itself is actually added to the substrate solution. Due to the nature of the present invention considering reuse of the substrate liquid, the expressions are unified as described above for convenience. This also applies to the description of the amount of ammonia used below. If the amount of the alkali metal hydroxide used is less than this range, the recovery rate of the obtained L-aspartic acid is lowered, which is not preferable. If it is more than this range, the pH of the fumaric acid neutralized salt aqueous solution will be too high, and the amount of ammonia that can be added will be small, and the conversion rate of fumaric acid to L-aspartic acid will be low and that of aspartase It is not preferable because it may cause deactivation.

As ammonia, aqueous ammonia is usually industrially easy to use, but liquid ammonia or ammonia gas can also be used. The amount of ammonia used is 1 to 2 times, preferably 1.1 to 1.8 times, and more preferably 1.2 to the total moles of L-aspartate and fumarate in the substrate solution. The molar ratio is 1.5 times, and after adding the alkali metal hydroxide, ammonia is added in the above range to adjust the pH of the substrate solution to 6 to 9.5, preferably 7 to 9.3, and more preferably. It is preferable to adjust it in the range of 8 to 9. The fumaric acid concentration during the reaction is usually 5 to
20% by weight is preferable, but considering the productivity and the purity of L-aspartic acid to be obtained, it is particularly effective to react in the range of 8 to 15% by weight.

Further, the substrate medium further contains manganese chloride,
Manganese salt such as manganese sulfate, or magnesium salt such as magnesium chloride or magnesium sulfate, divalent metal salt such as cobalt salt is 0.1 to 50 mM, preferably 1
It is desirable to add it at a concentration of 10 mM. The mode of the reaction tank in the present invention is not particularly limited, but it can be carried out in a conventionally known reaction tank such as a batch type reaction apparatus or a column type reaction apparatus. The number of reaction tanks may be one or plural.

For industrial mass production, a column type reactor is particularly preferable, and the spherical styrenedivinylbenzene copolymer ion-exchange resin carrier mentioned above is charged with the polymer represented by the general formula (I) and the aspartase gene. When immobilized aspartase prepared by coating a mixture of E. coli cells transformed with the incorporated plasmid and capable of producing a large amount of aspartase was used, the liquid flow rate was within the range of LHSV = 2 to 20. The reaction can be carried out at.

Since the activity is not so high when ordinary Escherichia coli is immobilized and used, it is necessary to prolong the reaction time or slow the liquid passing rate. However, the activity of the aspartase-recombinant immobilized aspartase is low. Since it is extremely high, the conversion rate can be sufficiently increased even at the above-mentioned liquid passing rate.
The reaction temperature is low at a low temperature, so that the lower limit is usually 10 ° C., and at a high temperature, about 50 ° C. is preferable because it causes inactivation of aspartase, and more preferably 15 to 40. It is better to carry out in the range of ° C. Under the conditions as described above, first, fumaric acid is reacted with ammonia. The higher the conversion rate, the better the reaction. However, if the conversion rate is about 90%, the L-
There is no problem in the crystal precipitation of aspartic acid.

Next, the pH of the reaction liquid is adjusted to 9 or more by adding ammonia to the reaction liquid thus obtained. The pH is preferably 9.1 or higher, more preferably 9.3 or higher. The upper limit of the amount of ammonia added at this time is equimolar to the total number of moles of the fumarate and L-aspartate present in the reaction solution, and particularly the fumarate and L-asparagine present in the reaction solution. It is 0.1 to 0.9 times mol, and more preferably 0.3 to 0.7 times mol, with respect to the total number of moles of the acid salt. When it is less than this range, monoammonium fumarate is mixed in the obtained L-aspartic acid, which is not preferable. On the other hand, if the amount exceeds this range, the amount of L-aspartic acid obtained decreases, which is not preferable.

Then, fumaric acid is added to the reaction solution containing ammonia. The amount of fumaric acid added is 0.6 to 1.2 times, preferably 0.7 to 1.2 times the total number of moles of the fumarate and L-aspartate present in the reaction solution.
It is 1.1 times mol, more preferably 0.8 to 1.0 times mol. If it is less than this range, the amount of L-aspartic acid that can be separated as crystals becomes small, which is not preferable. On the other hand, if the amount exceeds this range, the fumarate will be mixed into the obtained L-aspartic acid, which is not preferable.

The reaction solution containing fumaric acid is stirred at 45 ° C. or lower. At this time, if the temperature of the solution is too low, crystals of fumaric acid monoammonium salt, which has a low solubility, are mixed in the L-aspartic acid crystals, so the temperature is in the range of 10 to 40 ° C, preferably 25 to 35 ° C. After the addition of fumaric acid, stirring is continued for 1 second to 1 hour, preferably 1 minute to 15 minutes to complete the crystal precipitation of L-aspartic acid. The precipitated L-aspartic acid can be separated by a usual method such as suction filtration or centrifugal filtration, but a method such as centrifugal filtration that can reduce the liquid content is more preferable.

The separated L-aspartic acid crystals are washed with water if necessary. By washing, L
-The amount of fumaric acid salt mixed in a small amount into crystals of aspartic acid can be reduced and the crystal purity of the obtained L-aspartic acid can be increased, which is preferable, but reuse of the mother liquor from which the crystals are separated Considering the above, washing with a large amount of water is not preferable. The amount of washing water used is preferably in the range of 5 to 500% by weight, and more preferably 10 to 200% by weight, based on the amount of L-aspartic acid crystals. In this way it is possible in a simple manner to obtain small amounts of L-aspartic acid, for example containing 0.1 to 3% by weight, preferably 0.2 to 2% by weight of fumarate. The L-aspartic acid crystals containing the fumarate are easy to handle and are extremely useful as industrial L-aspartic acid because they do not easily scatter even when they become fine powder. Further, this L-aspartic acid can be used for food additives, pharmaceuticals, etc. by repeating purification.

The mother liquor from which L-aspartic acid crystals have been separated is mixed with the above washing solution, and ammonia is added to reuse the substrate solution as a substrate solution for producing L-aspartic acid. If necessary, the mother liquor and washing liquid are concentrated or adjusted appropriately. For example, since the capacity is increased by the amount of water coming from the washing liquid or the added ammonia, the mother liquor and the washing liquid can be concentrated so that the initial volume can be adjusted after the addition of ammonia. The amount of ammonia added may be the amount obtained by subtracting the number of moles of ammonia added before the addition of fumaric acid from the number of moles of L-aspartic acid separated as crystals. By doing so, the number of moles of ammonia can be 1 to 2 times the number of moles of fumaric acid and L-aspartic acid present in the solution. At this time, the pH of the solution is in the range of 6-11. Reaction of the substrate solution thus adjusted with an enzyme-containing substance having aspartase activity, addition of ammonia, precipitation of L-aspartic acid crystals by addition of fumaric acid, separation of L-aspartic acid crystals, and adjustment of mother liquor By repeating, the mother liquor is circulated and used as the substrate liquid. According to the invention, the circulation of the mother liquor is possible 10 times or more.

Next, a method for preparing E. coli-derived aspartase by a genetic engineering method will be described below. (I) Preparation of aspartase recombinant of Eschelichia coli Escherichia coli (Eschelichia coli) purchased from Fermentation Research Institute
coli) IFO3301 strain was inoculated into the LB medium shown in Table 1 and cultured at 37 ° C. for 8 hours. The cells were recovered from 1 ml of this culture solution and suspended in 1 ml of distilled water. 1 μl of this cell suspension was used as template D for amplifying the aspartase gene.
Used as NA.

[0037]

[Table 1]

(Ii) Amplification of Aspartase Gene by PCR and Preparation of Insertion Fragment Aspartase gene sequence (SEQ ID NO: 1) of known Escherichia coli K-12 strain (Biochem. J.237 (2),
547-557), the following two primers were prepared to amplify the aspartase gene of Escherichia coli. Primer F GGATAATCGTCGGTCGAA
AA Primer R CGTCATCTGACGTGCCTT
A reaction solution having the following composition was prepared using T KOD DNA polymerase (TOYOBO), and the aspartase gene was amplified by PCR.

[0039]

PCR conditions 98 ° C. 5 minutes 98 ° C. 30 seconds 53 ° C. 30 seconds 68 ° C. 1 minute cycle repeated 30 times After completion of the PCR reaction, the amplified DNA fragment was electrophoresed on 1% agarose gel and ethidium bromide. Upon staining, the expected fragment of about 1600 bp was amplified. Cut this fragment from the agarose gel and prepare
-The DNA was recovered by A-Gene (Bio Rad).

(Iii) Ligation of Insertion Fragment into Vector The pCR-Script Amp SK (+) cloning vector was ligated with the DNA fragment previously recovered in the presence of the restriction enzyme Srf and DNA ligase. This insert D
One of the transformants containing the NA fragment was designated as PUaspE1 strain. This PUaspE1 strain was added with ampicillin 100 ppm L
3 ml of B medium was inoculated and cultured with shaking at 37 ° C. overnight, and bacterial cells were recovered from 1.5 ml of the culture solution. The plasmid was recovered from the cells by the alkaline SDS method. This plasmid was named pUaspE1.

Analysis of the sequence of the insert fragment of this plasmid revealed that the aspartase gene was inserted in the opposite direction to the promoter of the vector. In order to reconnect to the promoter in the forward direction, it was decided to cut out the insert fragment from the plasmid pUaspE1 with the restriction enzymes SacI and BamHI and introduce it into pUC19. Plasmid pU
The aspE1 was digested with the restriction enzyme BamHI, DNA was recovered by ethanol precipitation, and then digested with the restriction enzyme SacI. The cleaved DNA fragments are separated by electrophoresis on a 1% agarose gel, cut out from the gel and prep-
DNA was recovered by A-Gene (bio rad).

(Iv) Preparation of vector 1 μg of plasmid pUC19 (manufactured by Nippon Gene) was digested with restriction enzyme BamHI, DNA was recovered by ethanol precipitation, and then digested with restriction enzyme SacI. Cut DNA
The fragments were separated by electrophoresis on a 1% agarose gel, cut out from the gel, and DNA was recovered by prep-A-Gene (bio rad) to obtain a vector. (V) Ligation of Insertion Fragment to Vector The vector cleaved with the restriction enzyme and the insertion fragment were ligated using Ligation High (TOYOBO) at 16 ° C. for 30 minutes.

(Vi) 2 μl of a reaction solution in which the transformation vector of Escherichia coli and the insert fragment were ligated to E. coli competent cell (XL2-Blue MRF 'Ultracompitent c
ells STRATAGENE) (200 μl) and transformed into E. coli. Transformed E. coli with ampicillin 100p
The cells were spread on LB agar medium containing pm and cultured overnight at 37 ° C. As a control, the plasmid pUC18 containing no inserted fragment was transformed, and ampicillin 1 was similarly prepared.
The cells were spread on LB agar medium containing 00 ppm and cultured overnight at 37 ° C.

20 colonies were picked up and inoculated into LB medium containing 100 ppm of ampicillin,
The culture was carried out at 37 ° C with shaking. After 8 hours, IPTG (isopropylthio-β-D-galactoside) was added to a concentration of 1 mM, and the mixture was further shake-cultured overnight at 30 ° C.
The bacterial cells were collected from ml. Similarly, a control transformant strain 1 having no insert fragment was cultured to recover the bacterial cells. 1 ml of the ammonium fumarate substrate solution shown in Table 2 was added to the recovered bacterial cells to suspend the bacterial cells and react at 30 ° C. for 1 hour.

[0046]

[Table 2]

Analysis of the reaction solution revealed that the E. coli transformant containing the insert fragment had a conversion rate to L-aspartic acid of 99.5%. On the other hand, the control transformant containing no insert had a conversion rate of 5%. One of the transformants containing this insert was named PUaspE2.

PUaspE2 was inoculated into 3 ml of LB medium supplemented with 100 ppm of ampicillin and cultured at 37 ° C. for 8 hours. The plasmid was recovered from 1.5 ml of this culture by the alkaline SDS method. This plasmid was named pUaspE2. Use the plasmid pUaspE2 with the restriction enzyme SmaI and then the restriction enzyme HindI.
After cutting with II, DN by 1% agarose gel electrophoresis
The size of the A fragment was calculated to be about 2960 bp and 1
There were two fragments of 600 bp.

The PUaspE2 strain was inoculated into 3 ml of LB medium supplemented with 100 ppm of ampicillin, shake-cultured at 37 ° C., and after 8 hours, IPTG (isopropylthio-β-D-
(Galactoside) was added to a concentration of 1 mM, and the mixture was further cultured overnight at 30 ° C. with shaking. When cells were collected from 1 ml of this culture and the cell concentration OD660nm was measured.8.
It was 0. The cells were suspended in 10 ml of 20% ammonium fumarate substrate solution and reacted at 30 ° C. for 1 hour.
The reaction solution was analyzed by HPLC. When the aspartase activity was calculated from the produced L-aspartic acid and the cell concentration, it was found to be 2,000,000 μM-L-aspartic acid production /
The cell concentration was hr / OD 660 nm.

Similarly, a control transformant strain 1 having no insert fragment was cultured, the bacterial cells were collected, and the bacterial cell concentration OD660nm was measured to be 8.5. The cells were suspended in 10 ml of 20% ammonium fumarate substrate solution, reacted at 30 ° C. for 1 hour, and the reaction solution was analyzed by HPLC. From the produced L-aspartic acid and the cell concentration,
The aspartase activity was calculated to be 10,000μ
It was ML-aspartic acid production / hr / OD660nm bacterial cell concentration. The PUaspE2 strain thus obtained had an aspartase activity 200 times that of the strain without the inserted aspartase gene.

(Vii) Recombinant culture Escherichia coli (Eschelichia coli) aspartase recombinant Escherichia coli PUaspE2 strain was added to the medium shown in Table 1 and ampicillin 10
Inoculate 10 test tubes containing 3 ml of the medium containing 0 ppm and incubate at 37 ° C for 8 hours, then inoculate 1 each into 10 Sakaguchi flasks containing 100 ml of the medium containing 1 mM of IPTG. And cultured overnight at 30 ° C. with shaking. From this culture solution, bacterial cells were collected by centrifugation. When the aspartase activity of this cell was measured
1.05 moles L-aspartic acid was produced / hr / g.

Preparation of Immobilized Aspartase Using Aspartase Recombinant PAS-880 (manufactured by Nitto Boseki Co., Ltd.) at pH 7.0 with alkali.
70 g of the admixture and 230 g of deionized water were mixed well, and the bacterial cells previously collected were uniformly dispersed. Ion exchange resin (Amberlite IRA
-94 SCl type manufactured by Organo Co., average particle size 0.5 mm) 3
Put 00 ml and 200 0.5 inch Teflon balls,
One-sixth of the bacterial cell dispersion liquid obtained above was put therein and dried by an evaporator for 1 hour while rotating at 30 ° C. to coat the bacterial cells with an ion exchange resin. After performing this operation 6 times,
The Teflon spheres were removed to obtain beads of immobilized aspartase. The activity of this immobilized aspartase is 3500 U
Met. (1 U = 1 μmoles L-aspartic acid production / min / ml immobilized enzyme)

Culture of Escherichia coli IFO3301 Escherichia coli strain IFO without introduction of aspartase gene
3301 was cultured in the same manner as above except that ampicillin and IPTG were not added, and bacterial cells were collected. Preparation of non-recombinant immobilized aspartase Bead-shaped immobilized aspartase was obtained in the same manner as above except that Escherichia coli IFO3301 strain bacterial cells were used. The activity of this immobilized aspartase was 180 U.

[0054]

EXAMPLES The present invention will now be specifically described with reference to examples, but the present invention is not limited to these examples. Example 1 The aspartase recombinant immobilized aspartase prepared in the above was immersed in a 20% ammonium fumarate solution (pH 8.3) overnight, and 50 ml thereof was packed in a column, and the outside of the column was filled with expanded polystyrene. The reactor was insulated by keeping it warm with a heat insulating material. Through this Teflon tube wrapped with a heat insulating material, the substrate liquid at 20 ° C shown in Table 3 which was kept warm in a constant temperature water bath at 20 ° C was circulated at a rate of 500 ml per hour (LHSV = 10.0) to carry out a continuous reaction. It was

When the reaction solution was analyzed 3 hours after the start of the reaction, L-aspartic acid, which was almost equimolar to the fumaric acid consumed, was produced as a reaction product, and the reaction conversion rate was 99.2. %Met. 29.3 g of 25% aqueous ammonia was added to 1 L of this reaction liquid. PH of the solution at this time
Was 9.5. Add 70 g of fumaric acid and add 1
Stir for hours. At this time, the temperature of the suspension was 30 ° C. The crystal suspension was filtered, the cake was sufficiently pressed to remove water, and then washed with 100 ml of water. The obtained crystal was dried and weighed 61.3 g. The purity is 9
It was 8.4%.

[0056]

[Table 3]

Example 2 The aspartase gene-recombinant-immobilized aspartase prepared as described above was immersed in a 20% ammonium fumarate solution (pH 8.3) overnight, and 50 ml of the solution was packed into a column, and the outside of the column was packed. The reactor was thermally insulated by keeping it warm with a polystyrene foam insulation. Through this Teflon tube wrapped with a heat insulating material, the substrate liquid at 20 ° C shown in Table 3 which was kept warm in a constant temperature water bath at 20 ° C was circulated at a rate of 500 ml per hour (LHSV = 10.0) to carry out a continuous reaction. It was

When the reaction solution was analyzed 3 hours after the start of the reaction, L-aspartic acid, which was almost equimolar to the consumed fumaric acid, was produced as a reaction product, and the reaction conversion rate was 99.2. %Met. 29.3 g of 25% aqueous ammonia was added to 1 L of this reaction liquid. PH of the solution at this time
Was 9.5. Add 80 g of fumaric acid to this and add 1
Stir for hours. At this time, the temperature of the suspension was 30 ° C. The crystal suspension was filtered, the cake was sufficiently pressed to remove water, and then washed with 100 ml of water. The crystals obtained were dried and weighed 72.5 g. The purity is 9
It was 8.6%.

Example 3 After the aspartase-immobilized recombinant aspartase immobilized aspartase prepared above was immersed in a 20% ammonium fumarate solution (pH 8.3) overnight, 50 ml of the solution was packed into a column, and the outside of the column was packed. The reactor was thermally insulated by keeping it warm with a polystyrene foam insulation. Through this Teflon tube wrapped with a heat insulating material, the substrate liquid at 20 ° C shown in Table 3 which was kept warm in a constant temperature water bath at 20 ° C was circulated at a rate of 500 ml per hour (LHSV = 10.0) to carry out a continuous reaction. It was

When the reaction solution was analyzed 3 hours after the start of the reaction, L-aspartic acid, which was almost equimolar to the consumed fumaric acid, was produced as a reaction product, and its reaction conversion rate was 99.2. %Met. 29.3 g of 25% aqueous ammonia was added to 1 L of this reaction liquid. PH of the solution at this time
Was 9.5. Add 90 g of fumaric acid to this and add 1
Stir for hours. At this time, the temperature of the suspension was 30 ° C. The crystal suspension was filtered, the cake was sufficiently pressed to remove water, and then washed with 100 ml of water. The crystals obtained were dried and weighed 84.1 g. The purity is 9
It was 8.7%.

Example 4 The aspartase-immobilized recombinant aspartase prepared as described above was immersed in a 20% ammonium fumarate solution (pH 8.3) overnight, and 50 ml of the solution was packed into a column, and the outside of the column was packed. The reactor was thermally insulated by keeping it warm with a polystyrene foam insulation. Through this Teflon tube wrapped with a heat insulating material, the substrate liquid at 20 ° C shown in Table 3 which was kept warm in a constant temperature water bath at 20 ° C was circulated at a rate of 500 ml per hour (LHSV = 10.0) to carry out a continuous reaction. It was

When the reaction solution was analyzed 3 hours after the start of the reaction, L-aspartic acid, which was almost equimolar to the fumaric acid consumed, was produced as a reaction product, and the reaction conversion rate was 99.2. %Met. To 1 L of this reaction liquid was added 34.6 g of 25% aqueous ammonia. PH of the solution at this time
Was 9.8. 100 g of fumaric acid was added thereto and stirred for 1 hour. At this time, the temperature of the suspension was 30 ° C. The crystal suspension was filtered, the cake was sufficiently pressed to remove water, and then washed with 100 ml of water. The crystals obtained were dried and weighed 94.1 g. The purity is 9
It was 8.5%. As shown in Examples 1 to 4 above, it is preferable that the amount of fumaric acid added is 70 g or more because the recovery rate of L-aspartic acid is 60% or more.

Example 5 The aspartase gene-recombinant-immobilized aspartase prepared as described above was immersed in a 20% ammonium fumarate solution (pH 8.3) overnight, and 50 ml of the solution was packed into a column, and the outside of the column was packed. The reactor was thermally insulated by keeping it warm with a polystyrene foam insulation. Through this Teflon tube wrapped with a heat insulating material, the substrate liquids shown in Table 4 at 20 ° C that were kept warm in a constant temperature water bath at 20 ° C were circulated at a rate of 500 ml per hour (LHSV = 10.0) to carry out a continuous reaction. It was

When the reaction solution was analyzed 3 hours after the start of the reaction, L-aspartic acid, which was almost equimolar to the consumed fumaric acid, was produced as a reaction product, and the reaction conversion rate was 99.2. %Met. 17.6 g of 25% aqueous ammonia was added to 1 L of this reaction liquid. PH of the solution at this time
Was 9.1. Add 70 g of fumaric acid and add 1
Stir for hours. At this time, the temperature of the suspension was 30 ° C. The crystal suspension was filtered, the cake was sufficiently pressed to remove water, and then washed with 100 ml of water. The obtained crystal was dried and weighed 88.3 g. The purity is 9
It was 8.6%.

[0065]

[Table 4]

Example 6 The aspartase gene-recombinant-immobilized aspartase prepared above was immersed in a 20% ammonium fumarate solution (pH 8.3) overnight, and 50 ml of the solution was packed into the column, and the outside of the column was packed. The reactor was thermally insulated by keeping it warm with a polystyrene foam insulation. Through this Teflon tube wrapped with a heat insulating material, the substrate liquids shown in Table 4 at 20 ° C that were kept warm in a constant temperature water bath at 20 ° C were circulated at a rate of 500 ml per hour (LHSV = 10.0) to carry out a continuous reaction. It was

When the reaction solution was analyzed 3 hours after the start of the reaction, L-aspartic acid, which was almost equimolar to the consumed fumaric acid, was produced as a reaction product, and the reaction conversion rate was 99.2. %Met. 17.6 g of 25% aqueous ammonia was added to 1 L of this reaction liquid. PH of the solution at this time
Was 9.1. Add 90 g of fumaric acid to this and add 1
Stir for hours. At this time, the temperature of the suspension was 30 ° C. The crystal suspension was filtered, the cake was sufficiently pressed to remove water, and then washed with 100 ml of water. The crystals obtained were dried and weighed 97.2 g. The purity is 9
It was 8.1%.

Example 7 The non-recombinant immobilized aspartase prepared as described above was added to a 20% ammonium fumarate solution (pH 8.3).
After soaking overnight in 50 ml, fill the column with 50 ml,
The reactor was insulated by keeping the outside of the column warm with a heat insulating material made of expanded polystyrene. The substrate solution shown in Table 3 at 20 ° C which was kept warm in a constant temperature water tank at 20 ° C was passed through the Teflon tube wrapped with a heat insulating material at a rate of 10 ml / h (LHSV = 0.2) to carry out a continuous reaction. It was

When the reaction solution was analyzed 10 hours after the start of the reaction, L-aspartic acid, which was almost equimolar to the consumed fumaric acid, was produced as a reaction product, and the reaction conversion rate was 99.0. %Met. 29.3 g of 25% aqueous ammonia was added to 1 L of this reaction liquid. P of the solution at this time
H was 9.5. 90 g of fumaric acid was added thereto and stirred for 1 hour. At this time, the temperature of the suspension was 30 ° C. The crystal suspension was filtered, the cake was sufficiently pressed to remove water, and then washed with 100 ml of water. The obtained crystals were dried and weighed 83.1 g. The purity is 9
It was 8.7%.

Example 8 The aspartase-immobilized recombinant aspartase prepared as described above was immersed in a 20% ammonium fumarate solution (pH 8.3) overnight, and 50 ml of the solution was packed into a column, and the outside of the column was packed. The reactor was thermally insulated by keeping it warm with a polystyrene foam insulation. Through this Teflon tube wrapped with a heat insulating material, the substrate liquid at 20 ° C shown in Table 3 which was kept warm in a constant temperature water bath at 20 ° C was circulated at a rate of 500 ml per hour (LHSV = 10.0) to carry out a continuous reaction. It was

When the reaction solution was analyzed 3 hours after the start of the reaction, L-aspartic acid, which was almost equimolar to the fumaric acid consumed, was produced as a reaction product, and the reaction conversion rate was 99.2. %Met. 87.9 g of 25% aqueous ammonia was added to 3 L of this reaction liquid. PH of the solution at this time
Was 9.5. 270 g of fumaric acid was added thereto and stirred for 1 hour. At this time, the temperature of the suspension was 30 ° C. The crystal suspension was filtered, the cake was sufficiently pressed to remove water, and then washed with 300 ml of water. The crystals obtained were dried and weighed 252.4 g. The purity was 98.7%. The filtrate from which the crystals were separated and the liquid from which the crystals were washed were mixed, concentrated under reduced pressure, and 70.0 g of 25% ammonia was added to make 3 L.

Using this solution again as a substrate solution, it was kept in a constant temperature water bath at 20 ° C. and passed through a Teflon tube wrapped with a heat insulating material at 20 ° C. at a rate of 500 ml / h (LHSV = 10.
It was circulated in 0) to carry out a continuous reaction. When the reaction solution was analyzed 30 minutes after the start of the reaction, L-aspartic acid, which was almost equimolar to the consumed fumaric acid, was produced as a reaction product, and its reaction conversion rate was 99.2%.

After 30 minutes from the start of the reaction, 2 L of the reaction solution was collected. To this reaction solution was added 58.6 g of 25% aqueous ammonia. The pH of the solution at this time was 9.5. To this, 180 g of fumaric acid was added and stirred for 1 hour. At this time, the temperature of the suspension was 30 ° C. This crystal suspension was filtered, and the cake was pressed sufficiently to drain water.
Washed with water. When the obtained crystals were dried, 18
It was 9.3 g. The purity was 98.7%. The filtrate from which the crystals were separated and the liquid from which the crystals were washed were mixed, concentrated under reduced pressure, and 46.7 g of 25% ammonia was added to add 2
It was set to L.

Using this solution again as a substrate solution, the solution was kept in a constant temperature water bath at 20 ° C. and passed through a Teflon tube wrapped with a heat insulating material at 20 ° C. at a rate of 500 ml / h (LHSV = 10.
It was circulated in 0) to carry out a continuous reaction. When the reaction solution was analyzed 30 minutes after the start of the reaction, L-aspartic acid, which was almost equimolar to the consumed fumaric acid, was produced as a reaction product, and its reaction conversion rate was 99.2%.

Thirty minutes after the start of the reaction, 1 L of the reaction solution was sampled. To this reaction solution, 29.3 g of 25% aqueous ammonia was added. The pH of the solution at this time was 9.5. 90 g of fumaric acid was added thereto and stirred for 1 hour. At this time, the temperature of the suspension was 30 ° C. This crystal suspension was filtered, and the cake was pressed sufficiently to drain water.
Washed with water. When the obtained crystals were dried, 95.
It was 9 g. The purity was 98.7%.

Example 9 The aspartase gene-recombinant-immobilized aspartase prepared as described above was immersed in a 20% ammonium fumarate solution (pH 8.3) overnight, and 50 ml of the solution was packed into a column, and the outside of the column was packed. The reactor was insulated by keeping it warm with expanded polystyrene insulation. Through this Teflon tube wrapped with a heat insulating material, the substrate liquid at 20 ° C shown in Table 3 which was kept warm in a constant temperature water bath at 20 ° C was circulated at a rate of 500 ml per hour (LHSV = 10.0) to carry out a continuous reaction. It was When the reaction solution was analyzed 3 hours after the start of the reaction, L-aspartic acid, which was almost equimolar to the consumed fumaric acid, was produced as a reaction product, and its reaction conversion rate was 99.2%. It was 2 for 1 L of this reaction solution
29.3 g of 5% aqueous ammonia was added, and then 50 g (0.5 mol) of fumaric acid was added and stirred for 1 hour. At this time, the temperature of the suspension was 30 ° C. The crystal suspension is filtered, the cake is pressed well to drain the water, and then 100
Wash with ml of water. When the obtained crystals were dried, 5
It was 1.6 g. The purity was 98.8%.

Example 10 The aspartase-immobilized recombinant aspartase prepared as described above was immersed in a 20% ammonium fumarate solution (pH 8.3) overnight, and 50 ml of the solution was filled in the column, and the outside of the column was packed. The reactor was thermally insulated by keeping it warm with a polystyrene foam insulation. Through this Teflon tube wrapped with a heat insulating material, the substrate liquids shown in Table 5 at 20 ° C which were kept warm in a constant temperature water bath at 20 ° C were circulated at a rate of 100 ml / hr (LHSV = 2.0) to carry out a continuous reaction. It was When the reaction solution was analyzed 3 hours after the start of the reaction, L-aspartic acid, which was almost equimolar to the consumed fumaric acid, was produced as a reaction product, and the reaction conversion rate was 10.8%. It was

[0078]

[Table 5]

Example 11 The aspartase-immobilized recombinant aspartase prepared as described above was immersed in a 20% ammonium fumarate solution (pH 8.3) overnight, and 50 ml of the solution was filled in the column, and the column exterior was covered. The reactor was thermally insulated by keeping it warm with a polystyrene foam insulation. Through this Teflon tube wrapped with a heat insulating material, the substrate solution at 20 ° C shown in Table-6 kept in a constant temperature water tank at 20 ° C was circulated at a rate of 100 ml / hour (LHSV = 2.0) to carry out a continuous reaction. It was When the reaction solution was analyzed 3 hours after the start of the reaction, L-aspartic acid, which was almost equimolar to the consumed fumaric acid, was produced as a reaction product, and the reaction conversion rate was 80.2%. It was

[0080]

[Table 6]

Comparative Example 1 The aspartase gene-recombinant-immobilized aspartase prepared as described above was immersed in a 20% ammonium fumarate solution (pH 8.3) overnight, and 50 ml of the solution was filled in the column, and the outside of the column was packed. The reactor was thermally insulated by keeping it warm with a polystyrene foam insulation. Through this Teflon tube wrapped with a heat insulating material, the substrate liquid at 20 ° C, which was kept in a constant temperature water bath at 20 ° C, was passed through this column at a rate of 500 ml / h (LHSV = 10.0) to carry out a continuous reaction. It was

When the reaction solution was analyzed 3 hours after the start of the reaction, L-aspartic acid, which was almost equimolar to the consumed fumaric acid, was produced as a reaction product, and its reaction conversion rate was 99.7. %Met. To 1 L of this reaction solution, 58.6 g of 25% aqueous ammonia was added, and then 100 g of fumaric acid was added, followed by stirring for 1 hour. The crystal suspension was filtered, the cake was sufficiently pressed to remove water, and then washed with 100 ml of water. The obtained crystals were dried and weighed 56.1 g. The purity was 98.7%.

[0083]

[Table 7]

From these results, the yield of crystallized L-aspartic acid is low when NaOH is not added. Example 12 The aspartase gene-recombinant-immobilized aspartase prepared as described above was immersed in a 20% ammonium fumarate solution (pH 8.3) overnight, and 50 ml of the solution was packed into a column, and the outside of the column was filled with expanded polystyrene. The reactor was insulated by keeping it warm with a heat insulating material. Through this Teflon tube wrapped with a heat insulating material, the substrate liquid at 20 ° C shown in Table-8 kept in a constant temperature water bath at 20 ° C was circulated at a rate of 500 ml per hour (LHSV = 10.0) to carry out a continuous reaction. It was

When the reaction solution was analyzed 3 hours after the start of the reaction, L-aspartic acid, which was almost equimolar to the consumed fumaric acid, was produced as a reaction product, and the reaction conversion rate was 99.4. %Met. To 1 L of this reaction liquid was added 14.7 g of 25% aqueous ammonia. PH of the solution at this time
Was 9.1. Add 70 g of fumaric acid and add 1
Stir for hours. At this time, the temperature of the suspension was 30 ° C. The crystal suspension was filtered, the cake was sufficiently pressed to remove water, and then washed with 100 ml of water. The crystals obtained were dried and weighed 30.1 g. The purity is 9
It was 8.8%.

[0086]

[Table 8]

Example 13 The non-recombinant immobilized aspartase prepared as described above was added to a 20% ammonium fumarate solution (pH 8.3).
After soaking overnight in 50 ml, fill the column with 50 ml,
The reactor was insulated by keeping the outside of the column warm with a heat insulating material made of expanded polystyrene. Through this column, the substrate liquid shown in Table 3 at 20 ° C which was kept warm in a constant temperature water bath at 20 ° C was passed through a Teflon tube wrapped with a heat insulating material to obtain 100 ml / hr.
At a rate (LHSV = 2.0) for continuous reaction.
When the reaction solution was analyzed 3 hours after the start of the reaction, it was found that the reaction product had L of about equimolar to the consumed fumaric acid.
-Aspartic acid is produced and its reaction conversion rate is 80.2.
%Met.

[0088]

Industrial Applicability According to the present invention, crystalline L-aspartic acid having high purity can be produced with excellent workability without requiring complicated steps.

[0089]

[Sequence list]                            SEQUENCE LISTING    <110> Nippon Shokubai Co., Ltd.    <120> Method for Producing L-aspartic acid    <130> P98-0707    <150> JP 98/31858 <151> 1998-2-13    <160> 4    <210> 1 <211> 1573 <212> DNA <213> Escherichia coli    <400> 1 ggggataatc gtcggtcgaa aaacattcga aaccacatat attctgtgtgtttaaagcaa 60 atcattggca gcttgaaaaa gaaggttcac atg tca aac aac att cgt atc gaa 114                                  Met Ser Asn Asn Ile Arg Ile Glu                                    1 5 gaa gat ctg ttg ggt acc agg gaa gtt cca gct gat gcc tac tat ggt 162 Glu Asp Leu Leu Gly Thr Arg Glu Val Pro Ala Asp Ala Tyr Tyr Gly      10 15 20 gtt cac act ctg aga gcg att gta aac ttc tat atc agc aac aac aaa 210 Val His Thr Leu Arg Ala Ile Val Asn Phe Tyr Ile Ser Asn Asn Lys  25 30 35 40 atc agt gat att cct gaa ttt gtt cgc ggt atg gta atg gtt aaa aaa 258 Ile Ser Asp Ile Pro Glu Phe Val Arg Gly Met Val Met Val Lys Lys                  45 50 55 gcc gca gct atg gca aac aaa gag ctg caa acc att cct aaa agt gta 306 Ala Ala Ala Met Ala Asn Lys Glu Leu Gln Thr Ile Pro Lys Ser Val              60 65 70 gcg aat gcc atc att gcc gca tgt gat gaa gtc ctg aac aac gga aaa 354 Ala Asn Ala Ile Ile Ala Ala Cys Asp Glu Val Leu Asn Asn Gly Lys          75 80 85 tgc atg gat cag ttc ccg gta gac gtc tac cag ggc ggc gca ggt act 402 Cys Met Asp Gln Phe Pro Val Asp Val Tyr Gln Gly Gly Ala Gly Thr      90 95 100 tcc gta aac atg aac acc aac gaa gtg ctg gcc aat atc ggt ctg gaa 450 Ser Val Asn Met Asn Thr Asn Glu Val Leu Ala Asn Ile Gly Leu Glu 105 110 115 120 ctg atg ggt cac caa aaa ggt gaa tat cag tac ctg aac ccg aac gac 498 Leu Met Gly His Gln Lys Gly Glu Tyr Gln Tyr Leu Asn Pro Asn Asp                 125 130 135 cat gtt aac aaa tgt cag tcc act aac gac gcc tac ccg acc ggt ttc 546 His Val Asn Lys Cys Gln Ser Thr Asn Asp Ala Tyr Pro Thr Gly Phe             140 145 150 cgt atc gca gtt tac tct tcc ctg att aag ctg gta gat gcg att aac 594 Arg Ile Ala Val Tyr Ser Ser Leu Ile Lys Leu Val Asp Ala Ile Asn         155 160 165 caa ctg cgt gaa ggc ttt gaa cgt aaa gct gtc gaa ttc cag gac atc 642 Gln Leu Arg Glu Gly Phe Glu Arg Lys Ala Val Glu Phe Gln Asp Ile     170 175 180 ctg aaa atg ggt cgt acc cag ctg cag gac gca gta ccg atg acc ctc 690 Leu Lys Met Gly Arg Thr Gln Leu Gln Asp Ala Val Pro Met Thr Leu 185 190 195 200 ggt cag gaa ttc cgc gct ttc agc atc ctg ctg aaa gaa gaa gtg aaa 738 Gly Gln Glu Phe Arg Ala Phe Ser Ile Leu Leu Lys Glu Glu Val Lys                 205 210 215 aac atc caa cgt acc gct gaa ctg ctg ctg gaa gtt aac ctt ggt gca 786 Asn Ile Gln Arg Thr Ala Glu Leu Leu Leu Glu Val Asn Leu Gly Ala             220 225 230 aca gca atc ggt act ggt ctg aac acg ccg aaa gag tac tct ccg ctg 834 Thr Ala Ile Gly Thr Gly Leu Asn Thr Pro Lys Glu Tyr Ser Pro Leu         235 240 245 gca gtg aaa aaa ctg gct gaa gtt act ggc ttc cca tgc gta ccg gct 882 Ala Val Lys Lys Leu Ala Glu Val Thr Gly Phe Pro Cys Val Pro Ala     250 255 260 gaa gac ctg atc gaa gcg acc tct gac tgc ggc gct tat gtt atg gtt 930 Glu Asp Leu Ile Glu Ala Thr Ser Asp Cys Gly Ala Tyr Val Met Val 265 270 275 280 cac ggc gcg ctg aaa cgc ctg gct gtg aag atg tcc aaa atc tgt aac 978 His Gly Ala Leu Lys Arg Leu Ala Val Lys Met Ser Lys Ile Cys Asn                 285 290 295 gac ctg cgc ttg ctc tct tca ggc cca cgt gcc ggc ctg aac gag atc 1026 Asp Leu Arg Leu Leu Ser Ser Gly Pro Arg Ala Gly Leu Asn Glu Ile             300 305 310 aac ctg ccg gaa ctg cag gcg ggc tct tcc atc atg cca gct aaa gta 1074 Asn Leu Pro Glu Leu Gln Ala Gly Ser Ser Ile Met Pro Ala Lys Val         315 320 325 aac ccg gtt gtt ccg gaa gtg gtt aac cag gta tgc ttc aaa gtc atc 1122 Asn Pro Val Val Pro Glu Val Val Asn Gln Val Cys Phe Lys Val Ile     330 335 340 ggt aac gac acc act gtt acc atg gca gca gaa gca ggt cag ctg cag 1170 Gly Asn Asp Thr Thr Val Thr Met Ala Ala Glu Ala Gly Gln Leu Gln 345 350 355 360 ttg aac gtt atg gag ccg gtc att ggc cag gcc atg ttc gaa tcc gtt 1218 Leu Asn Val Met Glu Pro Val Ile Gly Gln Ala Met Phe Glu Ser Val                 365 370 375 cac att ctg acc aac gct tgc tac aac ctg ctg gaa aaa tgc att aac 1266 His Ile Leu Thr Asn Ala Cys Tyr Asn Leu Leu Glu Lys Cys Ile Asn             380 385 390 ggc atc act gct aac aaa gaa gtg tgc gaa ggt tac gtt tac aac tct 1314 Gly Ile Thr Ala Asn Lys Glu Val Cys Glu Gly Tyr Val Tyr Asn Ser         395 400 405 atc ggt atc gtt act tac ctg aac ccg ttc atc ggt cac cac aac ggt 1362 Ile Gly Ile Val Thr Tyr Leu Asn Pro Phe Ile Gly His His Asn Gly     410 415 420 gac atc gtg ggt aaa atc tgt gcc gaa acc ggt aag agt gta cgt gaa 1410 Asp Ile Val Gly Lys Ile Cys Ala Glu Thr Gly Lys Ser Val Arg Glu 425 430 435 440 gtc gtt ctg gaa cgc ggt ctg ttg act gaa gcg gaa ctt gac gat att 1458 Val Val Leu Glu Arg Gly Leu Leu Thr Glu Ala Glu Leu Asp Asp Ile                 445 450 455 ttc tcc gta cag aat ctg atg cac ccg gct tac aaa gca aaa cgc tat 1506 Phe Ser Val Gln Asn Leu Met His Pro Ala Tyr Lys Ala Lys Arg Tyr             460 465 470 act gat gaa agc gaa cag taatcgtaca gggtagtaca aataaaaaag 1554 Thr Asp Glu Ser Glu Gln         475 gcacgtcaga tgacgtgcc 1573   <210> 2 <211> 478 <212> PRT <213> Escherichia coli    <400> 2 Met Ser Asn Asn Ile Arg Ile Glu Glu Asp Leu Leu Gly Thr Arg Glu   1 5 10 15 Val Pro Ala Asp Ala Tyr Tyr Gly Val His Thr Leu Arg Ala Ile Val              20 25 30 Asn Phe Tyr Ile Ser Asn Asn Lys Ile Ser Asp Ile Pro Glu Phe Val          35 40 45 Arg Gly Met Val Met Val Lys Lys Ala Ala Ala Met Ala Asn Lys Glu      50 55 60 Leu Gln Thr Ile Pro Lys Ser Val Ala Asn Ala Ile Ile Ala Ala Cys  65 70 75 80 Asp Glu Val Leu Asn Asn Gly Lys Cys Met Asp Gln Phe Pro Val Asp                  85 90 95 Val Tyr Gln Gly Gly Ala Gly Thr Ser Val Asn Met Asn Thr Asn Glu             100 105 110 Val Leu Ala Asn Ile Gly Leu Glu Leu Met Gly His Gln Lys Gly Glu         115 120 125 Tyr Gln Tyr Leu Asn Pro Asn Asp His Val Asn Lys Cys Gln Ser Thr     130 135 140 Asn Asp Ala Tyr Pro Thr Gly Phe Arg Ile Ala Val Tyr Ser Ser Leu 145 150 155 160 Ile Lys Leu Val Asp Ala Ile Asn Gln Leu Arg Glu Gly Phe Glu Arg                 165 170 175 Lys Ala Val Glu Phe Gln Asp Ile Leu Lys Met Gly Arg Thr Gln Leu             180 185 190 Gln Asp Ala Val Pro Met Thr Leu Gly Gln Glu Phe Arg Ala Phe Ser         195 200 205 Ile Leu Leu Lys Glu Glu Val Lys Asn Ile Gln Arg Thr Ala Glu Leu     210 215 220 Leu Leu Glu Val Asn Leu Gly Ala Thr Ala Ile Gly Thr Gly Leu Asn 225 230 235 240 Thr Pro Lys Glu Tyr Ser Pro Leu Ala Val Lys Lys Leu Ala Glu Val                 245 250 255 Thr Gly Phe Pro Cys Val Pro Ala Glu Asp Leu Ile Glu Ala Thr Ser             260 265 270 Asp Cys Gly Ala Tyr Val Met Val His Gly Ala Leu Lys Arg Leu Ala         275 280 285 Val Lys Met Ser Lys Ile Cys Asn Asp Leu Arg Leu Leu Ser Ser Gly     290 295 300 Pro Arg Ala Gly Leu Asn Glu Ile Asn Leu Pro Glu Leu Gln Ala Gly 305 310 315 320 Ser Ser Ile Met Pro Ala Lys Val Asn Pro Val Val Pro Glu Val Val                 325 330 335 Asn Gln Val Cys Phe Lys Val Ile Gly Asn Asp Thr Thr Val Thr Met             340 345 350 Ala Ala Glu Ala Gly Gln Leu Gln Leu Asn Val Met Glu Pro Val Ile         355 360 365 Gly Gln Ala Met Phe Glu Ser Val His Ile Leu Thr Asn Ala Cys Tyr     370 375 380 Asn Leu Leu Glu Lys Cys Ile Asn Gly Ile Thr Ala Asn Lys Glu Val 385 390 395 400 Cys Glu Gly Tyr Val Tyr Asn Ser Ile Gly Ile Val Thr Tyr Leu Asn                 405 410 415 Pro Phe Ile Gly His His Asn Gly Asp Ile Val Gly Lys Ile Cys Ala             420 425 430 Glu Thr Gly Lys Ser Val Arg Glu Val Val Leu Glu Arg Gly Leu Leu         435 440 445 Thr Glu Ala Glu Leu Asp Asp Ile Phe Ser Val Gln Asn Leu Met His     450 455 460 Pro Ala Tyr Lys Ala Lys Arg Tyr Thr Asp Glu Ser Glu Gln 465 470 475    <210> 3 <211> 20 <212> DNA <213> Artificial Sequence    <220> <223> Designed primer based on aspartase gene sequence of Escherichia coli K-12 strain (SEQ ID NO: 1).    <400> 3 ggataatcgt cggtcgaaaa 20    <210> 4 <211> 19 <212> DNA <213> Artificial Sequence    <220> <223> Designed primer based on aspartase gene sequence of Escherichia coli K-12 strain (SEQ ID NO: 1).    <400> 4 cgtcatctga cgtgccttt 19   

[0090]

[Sequence list free text]

[0091]

[SEQ ID NO: 3] Escherichia coli K-12
A primer prepared based on the nucleotide sequence of the aspartase gene of the strain (SEQ ID NO: 1).

[0092]

[SEQ ID NO: 4] Escherichia coli K-12
A primer prepared based on the nucleotide sequence of the aspartase gene of the strain (SEQ ID NO: 1).

Continuation of the front page (56) References JP-A-6-234713 (JP, A) JP-A-48-56618 (JP, A) JP-A-9-322790 (JP, A) JP-A-8-33493 (JP , A) JP-A-8-33492 (JP, A) JP-A-10-286087 (JP, A) (58) Fields investigated (Int.Cl. ⁷ , DB name) C12P 13 / 00-13 / 24 JISST File (JOIS) BIOSIS / WPI (DIALOG) PubMed

Claims (9)

(57) [Claims] 1. An aspartase is allowed to act on a mixed solution containing fumaric acid, ammonia and an alkali metal hydroxide to obtain L.
-A reaction solution containing aspartate is obtained, and L- is obtained from the reaction solution.
In the method for producing L-aspartic acid obtained by crystallizing aspartic acid, the reaction liquid containing L-aspartic acid salt is supplemented with ammonia, and then fumaric acid is added to crystallize L-aspartic acid. Sex L-
A method for producing L-aspartic acid, which comprises producing aspartic acid. 2. L-aspartic acid that does not crystallize in the crystallization step is separated, and ammonia is added to the L-aspartate-containing solution to obtain ammonium L-aspartate, which is crystalline L-aspartic acid. 2. The method for producing L-aspartic acid according to claim 1, which is a part of the production raw material liquid. 3. An L-aspartate-containing reaction liquid is obtained by allowing aspartase to act on a mixed solution containing fumaric acid, ammonium L-aspartate, ammonia and an alkali metal hydroxide, and L-asparagine is obtained from the reaction liquid. In the method for producing L-aspartic acid by crystallizing an acid, ammonia is added to the L-aspartate-containing reaction solution, and then fumaric acid is added to crystallize L-aspartic acid to form crystalline L-aspartic acid. -A method for producing L-aspartic acid, which comprises producing aspartic acid. 4. The molar ratio of the alkali metal hydroxide in the mixed solution is 0.1 to 1 times the mole of the fumarate and L-aspartate in the solution. The manufacturing method described. 5. The amount of fumaric acid added for crystallization is 0.6 with respect to the total number of moles of fumarate and L-aspartate present in the L-aspartate-containing reaction solution.
The production method according to any one of claims 1 to 4, wherein the amount is in the range of 1.2 to 1.2 times. 6. The production method according to claim 1, wherein the aspartase is a transformant containing an aspartase gene or a treated product thereof is immobilized. 7. A fumaric acid containing 8 to 20% fumaric acid and L-aspartic acid in terms of fumaric acid in a reactor containing immobilized aspartase having an activity of 250 U or more as aspartase, L-aspartic acid. 7. The production method according to claim 1, wherein the passage rate is set to LHSV = 2 to 20 when the mixed solution of ammonia and the alkali metal hydroxide is passed. 8. The immobilized aspartase uses an ion exchange resin as a carrier, and the cells or treated cells are immobilized on the carrier by adsorption or coating with a polymer. Manufacturing method. 9. An immobilized aspartase using a spherical styrenedivinylbenzene copolymer ion exchange resin as a carrier, wherein the following general formula (I): (In the formula, Y is a direct bond, or Is a divalent group represented by R ₁ and R ₂ are each independently a hydrogen atom or an organic residue, and Represents an anion, and n is a number of 100 to 5,000), and the styrene divinylbenzene copolymer ion-exchange resin surface coated with a mixture of a polymer represented by the formula (1) and a treated product of the bacterium. The production method according to claim 1, which is immobilized on a carrier.