JPH1014580A - Heat-resistant phosphorylase and its production - Google Patents

Abstract

PROBLEM TO BE SOLVED: To obtain the subject new enzyme, a heat-resistant phosphorylase derived from Bacillus stearothermophilus, useful for antimicrobial agents for medical use, antitumor agents, therapeutic agents for cardiopathy, and for producing α-glucan and the substrates for synthesizing α-glucan. SOLUTION: This enzyme is a new heat-resistant phosphorylase having the following characteristics: having variation(s) due to the deletion, substitution or addition of at least one amino acid in the amino acid sequence ranging from the 1st Met to the 798th Met in the sequence table shown by the formula; forming glucose-1-phosphate and α-1,4-glucan through acting on starch; optimum temperature is 50 deg.C; resistant to heat even at 60 deg.C; and stable at pH6.5-11. This enzyme is useful, for antimicrobial agents for medical use, antitumor agents (platinum complex), therapeutic agents for cardiopathy (amine salt), and for producing glucose-1-phosphate as a substrate for synthesizing α-glucan. This new enzyme is obtained by subjecting the chromosome DNA of Bacillus stearothermophilus TRBE14 strain to PCR using a primer followed by expressing the resultant gene.

Description

DETAILED DESCRIPTION OF THE INVENTION

[0001]

[0001] The present invention relates to a novel thermostable phosphorylase, a gene encoding the phosphorylase, an expression vector for expressing the phosphorylase, a method for producing the phosphorylase, and glucose-1-using the thermostable phosphorylase. The present invention relates to a method for producing phosphoric acid and α-glucan.

[0002]

2. Description of the Related Art It is known that phosphorylase (EC. 2.4.1.1) is widely distributed in plants such as potato tubers, animals such as rabbit muscle, microorganisms such as yeast, and the like. Phosphorylase is a medical antibacterial agent, an antitumor agent (platinum complex), a therapeutic agent for heart disease (amine salt), and glucose-1-phosphate (G-1), which is useful as a substrate for α-glucan synthesis.
P ").

[0003] Further, phosphorylase is also useful for synthesizing α-glucan such as amylose. For example, as shown in FIG.
By acting on a mixture of 1-phosphate and a saccharide such as maltopentaose, α-glucan is synthesized by a reverse synthesis reaction. The obtained α-glucan is used as a substrate for synthesizing useful carbohydrates such as cycloamylose.

[0004] Production of glucose-1-phosphate or α-
For the production of glucan, potato-derived phosphorylase is mainly used. This is because a relatively large amount of enzyme is easily obtained. Phosphorylase derived from Escherichia coli is also produced in large quantities because its gene has been isolated.

When an enzyme is used industrially in the processing of α-glucan, it is desirable to carry out the reaction at 60 ° C. or higher in order to suppress the aging of α-glucan as a substrate and to prevent contamination by various bacteria. Have been. However, these enzymes are all enzymes having a high activity in a medium temperature range of about 30 ° C. to 45 ° C., and are not used at a high temperature of 60 ° C. or more. For example, the optimal reaction temperature of the phosphorylase enzyme derived from Escherichia coli is 30 ° C. (Weinhusel summary AEnzyme and Microbial Tesla).
chnology 17 , 140-146 (1994)), the optimal reaction temperature of the phosphorylase enzyme from potato is 40 ° C. (Kita et al., Japanese Patent Application Laid-Open No. 2-231092), and the optimal temperature of the phosphorylase enzyme from rabbit muscle is 30 ° C. (Nakatani et al., J. Ap.
p. Biochem. 5 , 371-374 (1983)). Even the phosphorylase with the highest optimal temperature is at most about 45 ° C (Weinhusel summary AApp. Microbiol, Biotechnol (1
994) 41, 510-516).

[0006] Therefore, the problem that contamination of various bacteria and aging of α-glucan occur and glucose-1-phosphate cannot be efficiently produced remains unsolved.

[0007] Further, when α-glucan such as amylose is produced by utilizing the reverse reaction of phosphorylase, it is necessary to prevent contamination of various bacteria and aging of the product α-glucan.
It is desirable to carry out the reaction at a temperature of 0 ° C. or higher.

Therefore, it has been required to isolate a thermostable enzyme having an activity even at a reaction temperature of 60 ° C.

By the way, Escherichia coli (hereinafter sometimes referred to as E. coli) has two types of phosphorylases.
It is called maltodextrin phosphorylase (MalP) and glycogen phosphorylase (GlgP). Bacterial Gl
It is characteristic that the specific activity of gP is extremely low compared to other phosphorylases. This is thought to be due to the need for GlgP with low specific activity in bacteria to slowly degrade the glycogen that has accumulated under conditions unsuitable for growth (Yu et al., J. Biol. Chem. 263, 13706-13711,
1988).

In Bacillus bacteria, a gene having homology to the GlgP gene has been isolated from Bacillus subtilis (Kiel et al., Mol. Microbio
l. 11.203-218, 1994). This gene is known to be present at the end of glycogen biosynthesis genes
(See FIG. 2 (a)), but it is not clear whether a gene corresponding to MalP in E. coli exists.

On the other hand, thermophilic bacteria are present in Bacillus microorganisms. However, it is unknown whether thermophilic bacteria have a glycogen biosynthetic gene group similar to that of Bacillus subtilis as shown in FIG. 2 (a). Whether such a glycogen biosynthesis gene group exists was completely unknown.

For example, in the case of Bacillus stearothermophilus strain CU21,
The glycogen biosynthesis genes are interrupted by the inserted sequence and are not functioning (Kiel et al., DNA Seq.-
J. DNA Seq. Map. 4.1-9, 1993). In the Bacillus stearothermophilus 1503-4R var.4 strain, a branching enzyme gene, a gene belonging to the glycogen biosynthesis system, has been isolated, but a meaningful nucleotide sequence downstream of it has been found at present. Not (Kie1
Mol. Gen. Genet., 230, 136-144, 1991). Furthermore, it was discovered that in Bacillus caldolyticus, a part of the gene similar to the glycogen biosynthesis gene group similar to Bacillus subtilis shown in FIG. 2 (a) exists downstream of the branching enzyme gene. It is unknown whether the phosphorylase gene is present (Kiel
Seq. -J. DNA Seq. Map. 3, 1-9, 1992).

[0013] Even if the phosphorylase gene is located further downstream, Bacillus stearothermophilus C
As can be seen from the example of the U21 strain, the phosphorylase gene may be disrupted. In addition, the branching enzyme itself has no heat resistance (Kiel et al., Seq.-J DNA Se
q. Map. 3, 1-9, 1992), it was unclear whether the phosphorylase had thermostability, even if the phosphorylase gene was present in perfect form.

Furthermore, in Escherichia coli, since GlgP is not required for glycogen synthesis itself, glycogen biosynthetic genes having a phosphorylase such as Bacillus subtilis also exist in thermophiles that synthesize glycogen. It was unknown whether it was. Even if phosphorylase was obtained, it was considered that the specific activity might be extremely low as in the case of Escherichia coli.

[0015] Thus, despite the industrial need for thermostable phosphorylases, their existence is unknown and the isolation of this thermostable enzyme has been a task for those skilled in the art.

[0016]

SUMMARY OF THE INVENTION The present invention is directed to overcoming the above-mentioned problems and aims at: (1) isolating a gene encoding a thermostable phosphorylase; (2) A recombinant that produces the above phosphorylase is obtained by introducing a product inserted into an expression vector capable of high expression into an appropriate host such as a microorganism; By expressing the resulting bacterial cell extract containing the thermostable phosphorylase at 60 ° C.,
Establishment of a method for producing a phosphorylase enzyme that can easily remove contaminating enzymes and is also advantageous in terms of purification; or (4) conventional problems caused by reacting at a high temperature using thermostable phosphorylase Overcoming glucose-1-
To establish a method for producing phosphoric acid or α-glucan.

[0017]

The phosphorylase of the present invention has a substrate specificity of decomposing α-1,4-glucan to produce glucose-1-phosphate, and has an optimal temperature of 5: 1.
0 ° C., heat resistant even at 60 ° C., and stable properties in the range of pH 6.5 to 11.

In a preferred embodiment, it has an amino acid sequence from Met at position 1 to Met at position 798 of SEQ ID NO: 1 in the sequence listing.

In a preferred embodiment, the phosphorylase has a mutation caused by deletion, substitution or addition of one or more amino acids in the amino acid sequence from Met at position 1 to Met at position 798 of SEQ ID NO: 1 in the sequence listing. And
The phosphorylase containing the mutation has a specific activity and heat resistance equal to or higher than that of the phosphorylase not containing the mutation.

In a preferred embodiment, the phosphorylase is Bacillus stearothermophilus TRBE14
It is derived from the strain.

In a preferred embodiment, it has a higher specific activity than E. coli phosphorylase.

In a preferred embodiment, the specific activity is at least 9 times that of E. coli glycogen phosphorylase.

The present invention also relates to a phosphorylase gene encoding an amino acid sequence from Met at position 1 to Met at position 798 of SEQ ID NO: 1 in the sequence listing.

In a preferred embodiment, the phosphorylase gene is a DNA sequence represented by SEQ ID NO: 4 in the Sequence Listing.

In a preferred embodiment, a phosphorylase having a mutation caused by deletion, substitution or addition of one or more amino acids in the amino acid sequence from Met at position 1 to Met at position 798 of SEQ ID NO: 1 in the sequence listing And
The phosphorylase containing the mutation is a phosphorylase gene having a specific activity and heat resistance equal to or higher than that of the phosphorylase not containing the mutation.

In a preferred embodiment, the nucleotide sequence of the present invention can be amplified by PCR using the primer sets of SEQ ID NOs: 2 and 3 in the Sequence Listing.

Further, the present invention relates to an expression vector containing a thermostable phosphorylase gene.

[0028] The present invention also relates to a microorganism transformed with the expression vector.

[0029] In a preferred embodiment, the microorganism is a mesophilic bacterium.

[0030] In a preferred embodiment, the microorganism is a prokaryote.

[0031] In a preferred embodiment, the prokaryote is Escherichia coli.

Further, the present invention relates to a method for producing a thermostable phosphorylase, which comprises a step of culturing a transformed microorganism, a step of heating to 60 ° C. or higher, and a step of collecting and purifying phosphorylase produced by the culturing. .

[0033] In a preferred embodiment, the transformed microorganism is a mesophile.

[0034] In a preferred embodiment, the transformed microorganism is Escherichia coli.

The present invention relates to a recovered and purified phosphorylase.

In a preferred embodiment, the recovered and purified thermostable phosphorylase has an optimum temperature of 50 ° C., is thermostable even at 60 ° C., and is stable in a pH range of 6.5 to 11. Including.

The present invention also relates to a phosphorylase which is stabilized with inorganic phosphate or glucose-1-phosphate.

In a preferred embodiment, the phosphorylase of the present invention retains about 50% activity after heating at 70 ° C. for 30 minutes in the presence of 60 mM glucose-1-phosphate.

In a preferred embodiment, when the α-glucan decomposition reaction is carried out at 60 ° C. in the presence of 1M phosphoric acid, no decrease in the reaction rate is observed even after 1 hour.

[0040] In a preferred embodiment, the phosphorylase has a higher specific activity than E. coli phosphorylase.

In a preferred embodiment, the specific activity of the phosphorylase of the present invention is at least 9 times that of glycogen phosphorylase of Escherichia coli.

The present invention also relates to a method for producing glucose-1-phosphate by subjecting α-glucan to phosphorolysis using a thermostable phosphorylase.

Further, the present invention relates to saccharides and glucose
The present invention relates to a method for synthesizing α-glucan, comprising the step of allowing the phosphorylase according to claims 1 to 3 to act using 1-phosphate as a substrate.

In a preferred embodiment, the phosphorylase is reacted at a temperature higher than 60 ° C. to prevent precipitation of α-glucan and contamination of various bacteria to prevent aging of the product α-glucan. .

[0045] In a preferred embodiment, the α-glucan is amylose.

[0046]

DESCRIPTION OF THE PREFERRED EMBODIMENTS The present invention will be described below in detail.

In the present invention, the term "thermophilic bacterium" means a microorganism having an optimum growth temperature of 50 ° C. to 105 ° C. and hardly growing below 30 ° C. Among them, a microorganism having an optimum temperature of 90 ° C. or more Is defined as a hyperthermophilic bacterium.

[0048] In the present invention, the term "mesophilic bacterium" refers to a microorganism whose growth temperature is in a normal temperature environment, and particularly a microorganism whose optimum growth temperature is 20 ° C to 40 ° C.

In the present invention, “having heat resistance even at 60 ° C.” means that 0.1M 3-morpholinopropanesulfonic acid is used.
(MOPS) means that 80% or more of the activity remains when treated at 60 ° C. for 30 minutes in the presence of 60 mM glucose-1-phosphate in a buffer (pH 7.0).

In the present invention, “stable in the range of pH 6.5 to 11” means that the cells are treated at the respective pHs in the respective buffer solutions (50 mM) shown in FIG. 5 at 40 ° C. for 40 minutes. At 95
% Means that the activity remains.

In the present invention, “phosphorylase activity”
Are 100 mM MOPS (pH 7.0), 45 mM glucose-1-phosphate, 1
It is measured by quantifying the amount of inorganic phosphoric acid generated when phosphorylase is allowed to act at 40 ° C. for 30 minutes in an α-glucan composition solution consisting of% (w / v) soluble. The activity of producing 1 μmol of inorganic phosphoric acid per minute is defined as one unit.

In the present invention, “α-glucan” refers to α-glucan.
1,4-glucan, including starch, amylose, glycogen, etc.

The present invention relates to a method for producing a mutation by deleting, substituting or adding one or more amino acids in the amino acid sequence represented by SEQ ID NO: 1 in the sequence listing or the amino acid sequence represented by SEQ ID NO: 1 in the sequence listing. A phosphorylase containing the mutation, wherein the phosphorylase having the same or higher activity and thermostability as the phosphorylase containing no mutation. Such mutations may occur naturally or may be generated by the action of mutagens or artificially using site-directed mutagenesis. In addition, as a result of the introduction of the mutation, it may have the same or higher activity and heat resistance as phosphorylase containing no mutation.

Improvement of the production capacity by recombination can be achieved by cloning the gene of interest and expressing the cloned gene.

The thermostable phosphorylase gene is a sequence of the branching enzyme gene of Bacillus stearothermophilus TRBE14 (Takata et al., Appl. Environ. Mi.
crobiol. 60, 3096-3104, 1994), the chromosomal DNA was used for the IPCR method ("Cell Engineering
PCR experiment protocol, Shulansha ")) to obtain DNA fragments present sequentially on the downstream side. Furthermore, using a primer synthesized based on the nucleotide sequence of this DNA fragment, the phosphorylase gene can be directly amplified using the polymerase chain reaction (PCR) using the chromosomal DNA of Bacillus stearothermophilus TRBE14 strain as a template. .

In addition, Bacillus stearothermophilus T
The RBE14 strain has been deposited with the Industrial Technology Institute under the accession number FERM P-13916.

The sequence of the cloned gene is achieved by constructing an appropriate vector into which the cloned DNA has been inserted, introducing the expression vector into a microorganism, and culturing the recombinant microorganism and collecting the product. These methods are well known to those skilled in the art.

The host microorganism used in the present invention includes prokaryotes and eukaryotes, and mesophiles are preferred. Particularly preferred microorganisms include, for example, Escherichia coli, but are not limited thereto.

The expression vector is operably linked so that the gene of interest is transcribed and translated and, if necessary, contains a medium necessary for replication in a microorganism and selection of a recombinant. Say. When the secretory production of the expression product is intended, the nucleotide sequence encoding the secretory signal peptide is a DNA encoding the target protein.
Upstream with the correct reading frame. It is well known to those skilled in the art that the type of expression vector can be changed depending on the microbial host used.

As a preferred expression vector, pTrc99A (manufactured by Pharmacia), which can be expressed in Escherichia coli, is exemplified.

In some cases, the phosphorylase gene of interest must be engineered to be operably linked to the necessary transcriptional and translational elements in the expression vector. These include, for example, cases where the distance between the promoter and the coding region is too long and a decrease in transcription efficiency is expected, or where the distance between the ribosome binding site and the translation initiation codon is not appropriate. Processing methods include digestion with restriction enzymes,
Digestion with exonucleases such as Bal31, ExoIII,
Alternatively, site-directed mutagenesis using single-stranded DNA such as M13 or PCR may be mentioned.

The production of the target gene by the transformant which has acquired the phosphorylase-producing ability by introducing the expression vector depends on the host microorganism to be used, the type of the factor regulating the expression in the expression vector, and the substance to be expressed. Appropriate conditions are selected. For example, a usual shaking culture method can be used.

The medium to be used is not particularly limited as long as the host microorganism to be used grows.

In addition to a carbon source and a nitrogen source, the medium may contain an inorganic salt such as phosphoric acid, Mg ²⁺ , Ca ²⁺ , Mn ²⁺ , Fe ²⁺ , Fe ³⁺ , Zn ²⁺ ,
Salts such as Co ²⁺ , Ni ²⁺ , Na ⁺ , K ^{+ and the} like can be used as needed, mixed appropriately or used alone. Further, various inorganic substances and organic substances necessary for growth of the transformant and production of the enzyme may be added as necessary.

The temperature for culturing can be selected to be appropriate for the growth of the transformant to be used. Usually 15 ° C to 60 ° C. When using a mesophilic bacterium in a preferred embodiment of the present invention,
Culture at 25 ° C to 40 ° C is preferred. In addition, the culturing of the transformant is continued for a sufficient time for the production of phosphorylase, but in a preferred embodiment of the present invention, the culturing time is
It is about 24 hours.

When an expression vector having an inducible promoter is used, the expression can be controlled by adding an inducer, changing the culture temperature, adjusting the components of the medium, and the like. For example, when using an expression vector having a lactose-inducible promoter, expression can be induced by adding isopropyl-β-D-thiogalactopyranoside (IPTG).

After culturing in this way, the transformant is separated by, for example, centrifuging or filtering the culture to obtain a supernatant. Next, the supernatant containing the phosphorylase is subjected to ordinary means (for example, salting-out method, solvent precipitation, ultrafiltration)
To obtain a phosphorylase-containing fraction. This fraction is subjected to filtration, centrifugation, desalting and other treatments to obtain a crude enzyme solution. Further, the crude enzyme solution is freeze-dried, isoelectric focusing, ion exchange chromatography,
By appropriately combining ordinary enzyme purification means such as crystallization, a crude enzyme or a purified enzyme with improved specific activity can be obtained. If an enzyme that decomposes α-glucan such as α-amylase and an enzyme that decomposes glucose-1-phosphate such as phosphatase are not included, the crude enzyme can be used as it is in subsequent reactions.

When the thermostable phosphorylase gene of the present invention is expressed in a mesophilic bacterium such as Escherichia coli, the phosphorylase can be easily purified. Briefly, by heating the bacterial cell extract containing phosphorylase at 60 ° C,
Contaminating enzymes are insolubilized. This insoluble matter may be removed by centrifugation or the like, and dialysis may be performed.

The purified thermostable phosphorylase can be used to decompose α-glucan to produce glucose-1-phosphate. In this case, phosphorylase may be used as the immobilized enzyme.

The reaction temperature is 40 ° C. or higher, preferably 50 ° C. to 70 ° C.
° C, particularly preferably 60 ° C, which can prevent aging and bacterial contamination of the substrate α-glucan.

The production of glucose-1-phosphate can be carried out by reacting the phosphorylase of the present invention in an α-glucan solution containing an inorganic phosphate solution.

Phosphorylase phosphorylates glucan from the non-reducing end of α-glucan to produce glucose-1-phosphate, but when α-1,6-glucosyl bond is present in the substrate, the 4 The perphosphate degradation reaction stops just before the residue. Therefore, glucose-1-
When phosphoric acid is produced, the α-1,6-bond may be cleaved in advance, or an enzyme capable of cleaving the α-1,6-bond simultaneously with the phosphorylase reaction may be added. For example, a short-chain amylose in which the α-1,6-bond of corn starch has been cleaved can be used. When short chain amylose is used, phosphorolysis by phosphorylase is stopped leaving maltotetraose, so the theoretical limit yield of glucose-1-phosphate is 78%.

The phosphorylase of the present invention can be used not only for decomposing α-glucan but also for producing α-glucan. On this occasion,
Phosphorylase can also be used as an immobilized enzyme.

The reaction temperature is 40 ° C. or higher, preferably 50 ° C. to 70 ° C.
° C, particularly preferably from 60 to 70 ° C, whereby
Germ contamination can be prevented.

The saccharide that can be used as a substrate of the phosphorylase of the present invention is an α-glucan having a non-reducing end and a degree of polymerization of 4 or more.

When a reaction is carried out using a saccharide as a substrate, the molecular weight of the resulting α-glucan can be calculated, for example, using the following reaction formula and formula (1).

Reaction formula: nG-1-P + G (5) → nPi + G (5 + n) where G-1-P is glucose-1-phosphate and G (5) is maltopentaose ( 5 represents the degree of polymerization), and G (5 + n)
Is the resulting amylose (5 + n represents the degree of polymerization).

Formula (1): average degree of polymerization of the product = (moles of phosphoric acid generated / moles of initial maltopentaolose) +
5 Production of α-glucan is carried out, for example, by using a citrate buffer (p
H7.0), by acting phosphorylase on glucose-1-phosphate. When the phosphorylase of the present invention is used, the reaction proceeds sufficiently for a long time, and the product does not precipitate.

There is a slight variation depending on the pH in the reaction solution or the origin of the phosphorylase, but when the reaction reaches equilibrium, the concentration ratio between glucose-1-phosphate and phosphoric acid is 1: 1:
A concentration ratio of 3.6 to 4.5 (Fletterick, RJ, Ann. Rev. Bio
chem. 1980 49, 31-61: and Weinhausel et al., Enzyme an.
d Microbial Technology 1994 17,140-146). In the phosphorylase of the present invention, this ratio is almost as described above. Therefore, depending on the concentration ratio between glucose-1-phosphate and phosphoric acid, it is possible to control whether phosphorylase acts on either the synthesis reaction or the decomposition reaction.

[0080]

The present invention will be described in detail with reference to the following examples.
The present invention is not limited to these embodiments.

Example 1 Isolation of a Thermostable Phosphorylase Gene and Preparation of a Plasmid for Expression of a Thermostable Phosphorylase (1) Isolation of a Phosphorylase Gene For cloning a heat-resistant phosphorylase gene as a target gene. In addition, the present inventors, the sequence of the branching enzyme gene of Bacillus stearothermophilus TRBE14 strain (Takata et al., Appl.Environ.Microbiol.
60, 3096-3104, 1994)
(See “Cell Engineering Separate Volume, Plant Cell Engineering Series 2 PCR Experiment Protocol for Plants, Shulansha”) to sequentially obtain DNA fragments present on the downstream side. FIG. 2 (b) shows a schematic diagram of the DNA region. The nucleotide sequence analysis revealed that the phosphorylase gene was encoded at the position shown in FIG. 2 (b). As a result, the structure of the glycogen biosynthesis genes of Bacillus subtilis was very similar,
The homology of each gene was around 60%, and the degree of overlap was slightly different. Further, the structure further upstream of the glycogen biosynthesis gene group was completely different.
Therefore, from the fact that Bacillus subtilis has a glycogen biosynthesis gene group including a phosphorylase gene, it cannot be immediately imagined that Bacillus stearothermophilus has a similar glycogen biosynthesis gene group. Understandable by traders.

(2) Cloning of Thermostable Phosphorylase Gene Based on the nucleotide sequence shown in SEQ ID NO: 1 in the sequence listing, oligonucleotide, primer-N (SEQ ID NO: 2) and primer-C (SEQ ID NO: 3) were synthesized. did. 20 pmol of primer-N,
20 pmol of primer-C, 0.2 μg of Bacillus stearothermophilus TRBE14 strain chromosome (GENOME DNA ISOLATION KI
T (prepared using BIO101), a reaction solution containing 0.5 units of Ex-Taq DNA polymerase (Takara Shuzo), 10 ml of × 10 reaction buffer, and 20 nmol of deoxy NTP each.
The polymerase chain reaction (PCR) was performed using μl. PC
R was heated at 94 ° C for 1 minute, then at 98 ° C for 20 seconds, at 53 ° C for 1 minute,
Repeat the cycle of 8 ° C for 2 minutes 30 times, and finally,
This was performed under the condition of heating for a minute. As a result, a DNA fragment of about 2.5 kbp containing the thermostable phosphorylase gene was amplified. This DNA fragment was digested with the restriction enzymes EcoRI and PstI.
After purification with agarose gel electrophoresis, the plasmid pTGP99A (manufactured by Pharmacia) was incorporated into the same restriction enzyme cleavage point, and a plasmid pTGP91 for expression of a thermostable phosphorylase was prepared.
I got

Example 2 Measurement of Activity of Thermostable Phosphorylase The activity was determined by the method of Saheki et al.
l. Biochem. 148, 277-281 (1985)) and measured as follows. 100 mM MOPS (pH 7.0), 45 mM
A reaction solution (200 μl) composed of glucose-1-phosphate, 1% (w / v) soluble starch was incubated at 40 ° C. for 30 minutes,
A zinc molybdenum solution (100 mM zinc acetate, 15 mM ammonium molybdate (pH 5.0)) was added to stop the reaction. 200 μl of an ascorbic acid solution (10% ascorbic acid (pH 5) in the solution) was added thereto, and the mixture was incubated at 30 ° C. for 15 minutes.
The absorbance at nm was measured. The amount of the enzyme that releases 1 μmol of phosphoric acid per minute was defined as 1 unit, and the unit of activity was calculated.

Example 3 Purification of Thermostable Phosphorylase
Ten milliliters of a total culture of E. coli TG-1 strain containing plasmid pTGP91 was added to one liter of L medium (50 μg / m
(including 1 ampicillin) was added to a 2 liter Sakaguchi flask and shaken at 37 ° C. 2.5 hours later, 1 mM final concentration
Of isopropyl-β-D-thiogalactopyranoside and 1 mM of pyridoxine were added, and the culture was continued at 37 ° C. for an additional 21.5 hours. The cells were collected by centrifugation and 20 mM Tris-HC
After washing with 1 (pH 7.5) (hereinafter referred to as buffer A), the cells were suspended again in the same buffer and subjected to ultrasonic treatment. This was centrifuged to obtain a supernatant as a crude enzyme solution. The crude enzyme solution was treated at 60 ° C. for 1 hour to remove insolubles and dialyzed against buffer A. Q-Sepharose column in which dialysis solution is equilibrated with buffer A
(Pharmacia) and washed with buffer A containing 100 mM NaCl. Thermostable phosphorylase is 500 mM NaCl
The buffer was eluted with

Ammonium sulfate was added to the obtained enzyme solution to a final concentration of 300 mM, and then the solution was loaded on a phenyl toyopearl column (manufactured by TOSOH) equilibrated with buffer A containing 300 mM ammonium sulfate. After washing with buffer A containing 150 mM ammonium sulfate, the thermostable phosphorylase was eluted with buffer A. This was added to So
Load on urce15Q column (Pharmacia), buffer A
The enzyme was eluted by changing the NaCl concentration in the solution from 100 mM to 500 mM.

After adding ammonium sulfate to the obtained enzyme solution to a final concentration of 300 mM, a ResourcePhe column equilibrated with buffer A containing 300 mM ammonium sulfate.
(Manufactured by Pharmacia), washed with buffer A, and eluted with heat-resistant phosphorylase by flowing distilled water.
Tris-HCl (pH
7.0) A buffer solution was added to obtain a purified enzyme solution. Purified enzyme is SD
S polyacrylamide gel electrophoresis showed a single band (FIG. 3).

(Example 4: Specific activity of thermostable phosphorylase) Using the thermostable phosphorylase purified in Example 3, the specific activity of the present enzyme was measured. The specific activity was 1.82 units / mg. It was 3.45 units / mg when the soluble starch was replaced with glycogen (derived from rabbit liver, manufactured by Boehringer Mannheim) in the method described in Example 2. This specific activity is determined by the specific activity of E. coli glycogen phosphorylase (0.19 units / mg, Yu et al., J. Am.
Biol. Chem. 263, 13706-13711, 1988).
18 times.

Example 5 Properties of Thermostable Phosphorylase
The enzymatic properties of the present enzyme of the thermostable phosphorylase purified in Example 3 were analyzed using a method well known to those skilled in the art.
The optimum pH for the reaction of this enzyme is 6.5-7 (Fig. 4), and the pH is 6.5-11.
(FIG. 5). The optimal reaction temperature is 50
° C (Figure 6) and was stable up to 45 ° C (Figure 7). Furthermore, the enzyme was stabilized with inorganic phosphate and glucose-1-phosphate. For example, in the presence of 60 mM glucose-1-phosphate, about 50% of the activity remained after heating at 70 ° C. for 30 minutes.
When the reaction was carried out at 60 ° C. in the presence of 1 M phosphoric acid, no decrease in the reaction rate was observed even after 1 hour.

Example 6 Production of Glucose-1-phosphate 5
0 mg of waxy maize starch was suspended in 10 ml of 1M potassium phosphate buffer (pH 7.0) and dissolved by heating in a boiling water bath for 20 minutes. This was cooled to 60 ° C., and 0.13 unit of the thermostable phosphorylase purified in Example 3 was added. Sampling over time and glucose
1-phosphate was quantified. The quantification of glucose-1-phosphate is
Weinhuse1 judge summaryAEnzyme and Microbial Technology 17,
140-146 (1994), essentially following the enzymatic method described below.

To 80 μl of the sample, add 80 μl of 1 M Tris-HCl (p
H7), 50 mM MgCl ₂ and 640 μl of distilled water were added. To this, 400 μl of a detection reagent solution (10 mM Tris-HCl (pH 7), 1.
8 μmol / ml NAD +, 30 nmol / ml glucose-1,6-diphosphate, 6 units / ml phosphoglucomutase (from rabbit muscle, Boehringer Mannheim), 6 units / ml
Glucose-6-phosphate dehydrogenase (Leuconos
toc mesenteroides, Boehringer Mannheim) was added, and the mixture was kept at 37 ° C. for 30 minutes, and the absorbance at 340 nm was measured.

As a result, up to 2 hours after the reaction, glucose-1-phosphate increased almost linearly, and finally reached 14 mM (FIG. 8). At this time, the starch decomposition rate was about 45.3%. Since phosphorylase acts from the non-reducing end of α-glucan and stops the reaction four residues before α-1,6-glucosidic bond, it was determined in this experiment that the decomposition reaction was almost completely completed.

(Example 7: Production of amylose) The thermostable phosphorylase prepared in Example 3 and a final concentration of 250 mM or 4
The reaction was carried out at 60 ° C. with 00 mM glucose-1-phosphate. The reaction was performed in a 10 mM citrate buffer (pH 7.0), the enzyme concentration was 0.85 units / ml, and a final concentration of 0.1 mM maltopentaose was used as a reaction primer. After sampling over time and heating at 100 ° C for 5 minutes,
Phosphoric acid generated by the method of i et al. was quantified. The molecular weight of the resulting amylose was calculated by using the following reaction equation with equation (1).

Reaction formula: nG-1-P + G (5) → nPi + G (5 + n) where G-1-P is glucose-1-phosphate and G (5) is maltopentaose ( 5 represents the degree of polymerization), and G (5 + n)
Is the resulting amylose (5 + n represents the degree of polymerization).

Formula (1): average degree of polymerization of product = (moles of phosphoric acid generated / moles of initial maltopentaolose) +
FIG. 9 shows the time course of the 5 reactions. Even at 60 ° C., the reaction proceeded sufficiently for a long time, and the product did not precipitate. The reaction solution after 24 hours is subjected to gel filtration chromatography (Superose6 + Supe
rdex30 (Pharmacia, 1 cm x 30 cm), eluate 150 mM NaCl,
The degree of polymerization was calculated using an enzyme-synthesized amylose (manufactured by Azinoki) as a reference. As a result, if the glucose concentration is 250 mM, amylose having a degree of polymerization of 261;
When the glucose concentration was 400 mM, amylose having a polymerization degree of 196 was produced, and it was revealed that amylose having the expected size was produced.

Example 8 Production of Glucose-1-phosphate Using Short-Chain Amylose as a Substrate The thermostable phosphorylase prepared in Example 3 was reacted in the following reaction mixture. The reaction solution composition was 0.2% or 2% short chain-length amylose (Nacalai Tesque, Inc., AmyloseA (average chain length 18), a product obtained by cutting α-1,6-bond of corn starch and drying), 0.9M Potassium phosphate and thermostable phosphorylase 0.04 unit / ml (pH 7.0) were contained. After incubating the reaction solution at 60 ° C., 65 ° C. or 70 ° C. for 18 hours, the reaction was stopped by adding sodium hydroxide to a final concentration of 0.8 N, and the resulting glucose-1-phosphate was dissolved in Example. The measurement was performed in the same manner as in Example 6.

As a control experiment, a rabbit muscle phosphorylase (type a, manufactured by Sigma) was used under the same conditions except that the reaction temperature was 30 ° C. At a substrate concentration of 2%, the substrate started to precipitate at the beginning of the reaction (within 30 minutes after the start of the reaction), and the reaction was stopped. Therefore, increase the enzyme to 0.4 units / ml,
The experiment was performed at a reaction temperature of 40 ° C. Table 1 shows the results. Phosphorolysis by phosphorylase stops at maltotetraose, so the theoretical limit yield is 78.
%.

Under the latter condition, no precipitation of the substrate was observed, but the yield of glucose-1-phosphate was higher when the thermostable phosphorylase was used, and the value was 60%.
61% to 68% at 65 ° C, 70 ° C and 70 ° C (Table 1).

[0098]

[Table 1]

[0099]

The enzyme of the present invention is the most thermostable phosphorylase discovered so far, and as shown in the above-mentioned Examples, the optimum reaction temperature is 50 ° C.
It can be used well even at ° C. The specific activity is at least 9 times that of E. coli glycogen phosphorylase. Therefore,
The problem of efficient production of glucose-1-phosphate, contamination of various bacteria caused by low reaction temperature and α-
Glucan aging, or the production of α-glucan such as amylose by utilizing the reverse reaction of phosphorylase, is also a problem. Has made it possible to work at higher reaction temperatures and has been possible to overcome.

Further, when the present enzyme gene is expressed using a mesophilic bacterium such as Escherichia coli as a host, the obtained bacterial cell extract containing heat-resistant phosphorylase is subjected to a heat treatment at 60 ° C. to easily remove contaminating enzymes. It can also be advantageous in terms of yield and purification.

[0101]

[Sequence list]

[0102]

[SEQ ID NO: 1] Sequence length: 798 Sequence type: amino acid Topology: linear Sequence type: protein Sequence Met Phe Thr Asp Lys Glu Thr Phe Lys Gln Ala Phe Leu Ile Arg Leu 1 5 10 15 Glu Thr Leu Cys Gly Lys Gln Phe Glu Glu Ser Thr Thr Arg Asp His 20 25 30 Tyr Tyr Val Leu Gly His Met Val Arg Glu His Ile Ser Arg His Trp 35 40 45 Ile Ala Thr Asn Glu Arg Asn Arg Ala Gln Lys Arg Lys Gln Val Tyr 50 55 60 Tyr Leu Ser Ile Glu Phe Leu Leu Gly Arg Leu Leu Gly Ser Asn Leu 65 70 75 80 Leu Asn Leu Gly Val Arg Gln Val Val Glu Glu Gly Leu Arg Asp Leu 85 90 95 Gly Ile Arg Leu Glu Asp Val Glu Glu Ser Glu Ala Asp Ala Gly Leu 100 105 110 Gly Asn Gly Gly Leu Gly Arg Leu Ala Ala Cys Phe Leu Asp Ser Leu 115 120 125 Ala Thr Leu Asn Leu Pro Gly His Gly His Gly Ile Arg Tyr Lys His 130 135 140 Gly Leu Phe Asp Gln Lys Ile Val Asp Gly Tyr Gln Val Glu Leu Pro 145 150 155 160 Gln Gln Trp Leu Arg His Gly Asn Val Trp Glu Ile Arg Lys Glu Glu 165 170 175 Leu Ala Val Glu Val Asn Phe Trp G ly Lys Val Glu Val Tyr Glu Gln 180 185 190 Asn Gly Cys Leu Val Phe Arg His Ile Asp Ser Lys Lys Val Met Ala 195 200 205 Val Pro Tyr Asp Met Pro Val Ile Gly Tyr Gly Thr Asn Thr Val Asn 210 215 220 Thr Leu Arg Leu Trp Asn Ala Glu Pro Ala Lys Thr Phe Pro Leu His 225 230 235 240 Lys Asp Val Met Gln Tyr Lys Arg Glu Thr Glu Ala Ile Ser Glu Phe 245 250 255 Leu Tyr Pro Asp Asp Ala His Asp Glu Gly Lys Ile Leu Arg Leu Lys 260 265 270 Gln Gln Tyr Phe Leu Val Ala Ala Ser Leu Gly Ser Ile Val Arg Ala 275 280 285 His Arg Leu Gln His Gly Asn Leu His Gln Leu His Glu Tyr Val Ala 290 295 300 Ile His Val Asn Asp Thr His Pro Val Leu Ala Ile Pro Glu Leu Met 305 310 315 320 Arg Ile Leu Leu Asp Glu Glu Gly Met Ser Trp Glu Glu Ala Trp His 325 330 335 Ile Thr Thr His Thr Ile Ala Tyr Thr Asn His Thr Thr Leu Ser Glu 340 345 350 Arg Leu Arg Met Ala Ile His Leu Phe Gln Pro Leu Leu Pro Arg Ile 355 360 365 Tyr Met Ile Val Glu Glu Ile Asn Glu Arg Phe Cys Arg Glu Leu Trp 370 375 380 Glu Arg Tyr Pro Gly Asp Trp Gly Arg I le Glu Gln Met Ala Ile Ile 385 390 395 400 400 Ala His Gly Val Val Lys Met Ala His Leu Ala Ile Ala Gly Ser His 405 410 415 Ser Val Asn Gly Val Ala Lys Leu His Thr Glu Ile Leu Lys Gln Arg 420 425 430 Glu Met Arg Leu Phe Tyr Glu Trp Ala Pro His Lys Phe Asn Asn Lys 435 440 445 Thr Asn Gly Val Thr His Arg Arg Trp Leu Leu Lys Ala Asn Pro Glu 450 455 460 Leu Ser Ala Leu Ile Thr Asp Thr Thr Gly Ser Arg Trp Ile His Glu 465 470 475 480 Pro Glu Thr Leu Ile Glu Leu Lys Pro His Ala Ser Asp Pro Ala Phe 485 490 495 Gln Gln Ala Leu Ser Ala Val Lys Gln Gln Arg Lys Gly Lys Leu Ala 500 505 510 Ala Arg Ile Tyr Glu Lys Thr Gly Ile Arg Val Asp Glu Ser Ser Ile 515 520 525 Phe Asp Val Gln Val Lys Arg Leu His Ala Tyr Lys Arg Gln Leu Leu 530 535 540 Asn Val Leu His Ile Met Tyr Leu Tyr Asn Arg Leu Lys Glu Asp Pro 545 550 555 560 His Phe Ser Ile Tyr Pro Arg Thr Phe Ile Phe Gly Ala Lys Ala Ser 565 570 575 Pro Gly Tyr Tyr Tyr Ala Lys Arg Ile Ile Lys Leu Ile His Ser Val 580 585 590 Ala Asp Lys Val Asn Asn Asp Lys Gln T hr Asn Glu Gln Leu Lys Val 595 600 605 Ile Phe Leu Glu Asn Tyr Arg Val Ser Leu Ala Glu Glu Ile Phe Pro 610 615 620 Ala Ala Ala Asp Val Ser Glu Gln Ile Ser Thr Ala Ser Ile Glu Ala Ser 625 630 630 635 640 Gly Thr Gly Asn Met Lys Phe Met Met Asn Gly Ala Leu Thr Leu Gly 645 650 655 655 Thr Leu Asp Gly Ala Asn Val Glu Ile Ala Glu Ala Val Gly Lys Glu 660 665 670 Asn Met Phe Leu Phe Gly Leu Thr Ala Glu Glu Val Leu Asn Tyr Tyr 675 680 685 Glu His Gly Gly Tyr Arg Ala His Glu Tyr Tyr His His Asp Lys Arg 690 695 700 Ile Lys Gln Val Val Asp Gln Leu Val Asn Gly Phe Phe Pro Asp Val 705 710 710 715 720 Ala Asp Tyr Phe Glu Pro Ile Tyr Asp Ser Leu Leu Thr Gln Asn Asp 725 730 735 Glu Tyr Phe Val Leu Arg Asp Phe Ala Ala Tyr Thr Glu Ala His Glu 740 745 750 Arg Val Glu Ala Ala Tyr Arg Asp Pro Ala Arg Trp Trp Tyr Met Ser 755 760 765 Ala Val Asn Ile Ala His Ser Gly Tyr Phe Ala Ser Asp Arg Thr Ile 770 775 780 Ala Glu Tyr Ala Val Asp Ile Trp Gly Ile Ser Pro Ser Met 785 790 795 798

[0103]

[SEQ ID NO: 2] Sequence length: 29 Sequence type: nucleic acid Number of strands: single-stranded Topology: linear Sequence type: other nucleic acid (synthetic DNA) Sequence CTTGAATTCA CAAGCCTATG AACAGCTGA 29

[0104]

[SEQ ID NO: 3] Sequence length: 29 Sequence type: nucleic acid Number of strands: single strand Topology: linear Sequence type: other nucleic acid (synthetic DNA) Sequence CTTCTGCAGA CTTCTTGACT GGTGCGCAA 29

[0105]

[SEQ ID NO: 4] Sequence length: 2580 Sequence type: nucleic acid Number of strands: double-stranded Topology: linear Sequence type: Genomic DNA Origin Organism: Bacillus stearothermophilus Strain: TRBE14 Sequence GTTGGCGTCG GTCGGCAAAC CAATATAAAC AAGCCTATGA ACAGCTGATC AAAAAGGAGG 60 AGCACACGC TTG TTC ACG GAT AAA GAA ACG TTT AAA CAG GCG TTT TTG ATA 111 Met Phe Thr Asp Lys Glu Thr Phe Lys Gln Ala Phe Leu Ile 1 5 10 CGG TGC GTC AGC TGG GAG TCG ACG ACG CGC 159 Arg Leu Glu Thr Leu Cys Gly Lys Gln Phe Glu Glu Ser Thr Thr Arg 15 20 25 30 GAC CAT TAT TAT GTG CTT GGT CAT ATG GTA CGT GAA CAT ATT AGC CGC 207 Asp His Tyr Tyr Val Leu Gly His Met Val Arg Glu His Ile Ser Arg 35 40 45 CAT TGG ATC GCC ACG AAT GAG CGC AAT CGG GCG CAA AAG CGG AAG CAA 255 His Trp Ile Ala Thr Asn Glu Arg Asn Arg Ala Gln Lys Arg Lys Gln 50 55 60 GTG TAT TAT TTG TCG ATC GAG TTT TTA TTG GGC CGG TTG CTC GGC AGC 303 Val Tyr Tyr Leu Ser Ile Glu Phe Leu Leu Gly Arg Leu Leu Gly Ser 65 70 75 AAC TTA TTA AAC CTT GGT GTC CGT CAG GTC GTT GAA GAG GGG CTT CGC 351 Asn Leu Leu Asn Leu Gly Val Arg Gln Val Val Glu Glu Gly Leu Arg 80 85 90 GAT CTC GGC ATT CGT CTT GAA GAT GTC GAG GAG AGC GAG GCG GAT GCC 399 Asp Leu Gly Ile Arg Leu Glu Asp Val Glu Glu Ser Glu Ala Asp Ala 95 100 105 110 GGG CTT GGC AAC GGC GGA CTC GGG CGG CTC GCC GCC TGT TTT CTC GAT 447 Gly Leu Gly Asn Gly Gly Leu Gly Arg Leu Ala Ala Cys Phe Leu Asp 115 120 125 TCG CTG GCG ACG TTG AAT TTG CCG GGC CAT GGC CAT GGC ATC CGC TAT 495 Ser Leu Ala Thr Leu Asn Leu Pro Gly His Gly His Gly Ile Arg Tyr 130 135 140 AAA CAC GGG CTG TTT GAC CAA AAG ATC GTC GAT GGC TAT CAA GTC GAG 543 Lys His Gly Leu Phe Asp Gln Lys Ile Val Asp Gly Tyr Gln Val Glu 145 150 155 CTG CCT CAG CAA TGG CTG CGC CAC GGA AAC GTT TGG GAA ATA CGA AAA 591 Leu Pro Gln Gln Trp Leu Arg His Gly Asn Val Trp Glu Ile Arg Lys 160 165 170 GAG GAG CTG GCT GTC GAG GTC AAT TTT TGG GGG AAG GTT GAG GTG TAC 639 Glu Glu Leu Ala Val Glu Val Asn Phe Trp Gly Lys Val Glu Val Tyr 175 180 185 190 GAA CAA AAC GGG TGC CTC GTC TTC CGC CAT ATC GAC AGC AAA AAA GTG 687 Glu Gln Asn Gly Cys Leu Val Phe Arg His Ile Asp Ser Lys Lys Val 195 200 205 ATG GCG GTG CCA TAC GAC ATG CCC GTG ATC GGC TAC GGG ACG AAC ACG 735 Met Ala Val Pro Tyr Asp Met Pro Val Ile Gly Tyr Gly Thr Asn Thr 210 215 220 GTC AAT ACG CTG CGG CTT TGG AAC GCG GAG CCG GCG AAA ACG TTC CCG 783 Val Asn Thr Leu Arg Leu Trp Asn Ala Glu Pro Ala Lys Thr Phe Pro 225 230 235 CTT CAT AAG GAT GTC ATG CAA TAC AAG CGG GAG ACA GAA GCA ATT TCC 831 Leu His Lys Asp Val Met Gln Tyr Lys Arg Glu Thr Glu Ala Ile Ser 240 245 250 GAA TTT TTA TAC CCG GAT GAT GCG CAT GAC GAA GGG AAA ATT TTG CGC 879 Glu Phe Leu Tyr Pro Asp Asp Ala His Asp Glu Gly Lys Ile Leu Arg 255 260 265 270 TTG AAG CAG CAA TAT TTT CTC GTG GCC GCC AGC CTT GGC AGC ATC GTG 927 Leu Lys Gln Gln Tyr Phe Leu Val Ala Ala Ser Leu Gly Ser Ile Val 275 280 285 CGC GCC CAT CGC CTT CAG CAC GGG AAC CTA CAC CAG CTT CAT GAA TAT 975 Arg Ala His Arg Leu Gln His Gly Asn Leu His Gln Leu His Glu Tyr 290 295 300 GTC GCC ATT CAT GTA AAC GAC ACT CAT CCG GTG TTG GCG ATT CCG GAA 1023 Val Ala Ile His Val Asn Asp Thr His Pro Val Leu Ala Ile Pro Glu 305 310 315 CTA ATG CGC ATT TTG CTC GAT GAG GAA GGC ATG AGT TGG GAA GAA GCG 1071 Leu Met Arg Ile Leu Leu Asp Glu Glu Gly Met Ser Trp Glu Glu Ala 320 325 330 TGG CAC ATT ACG ACC CAT ACG ATC GCT TAC ACA AAC CAT ACG TCGTA 1119 Trp His Ile Thr Thr His Thr Ile Ala Tyr Thr Asn His Thr Thr Leu 335 340 345 345 350 TCC GAG CGC TTG AGA ATG GCG ATT CAT TTA TTT CAG CCG CTC TTG CCG 1167 Ser Glu Arg Leu Arg Met Ala Ile His Leu Phe Gln Pro Leu Leu Pro 355 360 365 CGC ATT TAT ATG ATC GTC GAG GAA ATT AAC GAA CGA TTT TGC CGT GAG 1215 Arg Ile Tyr Met Ile Val Glu Glu Ile Asn Glu Arg Phe Cys Arg Glu 370 375 380 CTA TGG GAA CGC TAC CCC GGC GAT TGG GGG CGG ATT GAA CAA ATG GCC 1263 Leu Trp Glu Arg Tyr Pro Gly Asp Trp Gly Arg Ile Glu Gln Met Ala 385 390 395 ATT ATC GCC CAT GGC GTG GTG AAA ATG GCG CAT TTG GCC ATC GCC GGC 1311 Ile Ile Ala His Gly Val Val Lys Met Ala His Leu Ala Ile Ala Gly 400 405 410 AGC CAT AGC GTC AAC GGA GTG GCG AAG CTG CAT ACA GAA ATT TTG AAA 1359 Ser His Ser Val Asn Gly Val Ala Lys Leu His Thr Glu Ile Leu Lys 415 420 425 430 CAG CGG GAA ATG CGC TTG TTT TAC GAA TGG GCG CCG CAC AAG TTT AAC 1407 Gln Arg Glu Met Arg Leu Phe Tyr Glu Trp Ala Pro His Lys Phe Asn 435 440 445 445 AAT AAA ACG AAC GGG GTG ACG CAT CGA CGT TGG CTG TTA AAA GCG AAC 1455 Asn Lys Thr Asn Gly Val Thr His Arg Arg Trp Leu Leu Lys Ala Asn 450 455 460 CCC GAG CTG TCG GCG TTG ATT ACC ACC GAC ACG ACC GGT TCG CGC TGG ATT 1503 Pro Glu Leu Ser Ala Leu Ile Thr Asp Thr Thr Gly Ser Arg Trp Ile 465 470 475 CAC GAG CCG GAA ACA CTG ATC GAG CTG AAA CCG CAT GCC TCC GAT CCG 1551 His Glu Pro Glu Thr Leu Ile Glu Leu Lys Pro His Ala Ser Asp Pro 480 485 490 GCG TTC CAG CAG GCG CTT TCG GCC GTT AAG CAG CAG CGC AAA GGC AAG 1699 Ala Phe Gln Gln Ala Leu Ser Ala Val Lys Gln Gln Arg Lys Gly Lys 495 500 505 510 CTC GCT GCC CGC ATT TAT GAA AAG ACC GGG ATC CGT GTT GA T GAG TCG 1647 Leu Ala Ala Arg Ile Tyr Glu Lys Thr Gly Ile Arg Val Asp Glu Ser 515 520 525 TCC ATC TTT GAT GTG CAA GTG AAG CGG CTG CAC GCC TAC AAA CGA CAG 1695 Ser Ile Phe Asp Val Gln Val Lys Arg Leu His Ala Tyr Lys Arg Gln 530 535 540 CTG TTG AAT GTA CTG CAC ATT ATG TAT CTA TAC AAT CGT CTA AAA GAA 1743 Leu Leu Asn Val Leu His Ile Met Tyr Leu Tyr Asn Arg Leu Lys Glu 545 550 555 GAC CCG CAC TTC TCG ATT TAC CCA CGC ACG TTC ATC TTC GGA GCG AAA 1791 Asp Pro His Phe Ser Ile Tyr Pro Arg Thr Phe Ile Phe Gly Ala Lys 560 565 570 GCG TCG CCT GGC TAC TAT TAC GCC AAG CGA ATC ATT AAG CTG ATT CAT 1839 Ala Ser Pro Gly Tyr Tyr Tyr Ala Lys Arg Ile Ile Lys Leu Ile His 575 580 585 590 TCG GTT GCC GAT AAG GTG AAC AAT GAC AAA CAG ACG AAC GAG CAG CTC 1887 Ser Val Ala Asp Lys Val Asn Asn Asp Lys Gln Thr Asn Glu Gln Leu 595 600 605 AAA GTC ATT TTT TTA GAA AAC TAT CGC GTG TCG CTT GCG GAG GAA ATT 1935 Lys Val Ile Phe Leu Glu Asn Tyr Arg Val Ser Leu Ala Glu Glu Ile 610 615 620 620 TTC CCG GCT GCT GAT GTG AGC GAA CAA ATT TCA ACC GCG AGC ATA GAG 1983 Phe Pro Ala Ala Asp Val Ser Glu Gln Ile Ser Thr Ala Ser Ile Glu 625 630 635 GCG TCC GGG ACG GGC AAC ATG AAA TTT ATG ATG AAC GGG GCG CTC ACG 2031 Ala Ser Gly Thr Gly Asn Met Lys Phe Met Met Asn Gly Ala Leu Thr 640 645 650 650 CTC GGA ACG CTC GAT GGA GCG AAC GTC GAA ATC GCT GAA GCG GTC GGA 2079 Leu Gly Thr Leu Asp Gly Ala Asn Val Glu Ile Ala Glu Ala Val Gly 655 660 665 670 AAA GAA AAT ATG TTT TTG TTC GGG CTG ACC GCC GAA GAA GTG CTG AAC 2127 Lys Glu Asn Met Phe Leu Phe Gly Leu Thr Ala Glu Glu Val Leu Asn 675 680 685 TAC TAC GAA CAC GGC GGT TAC CGG GCG CAT GAA TAT TAC CAC CAC GAC 2175 Tyr Tyr Glu His Gly Gly Tyr Arg Ala His Glu Tyr Tyr His His Asp 690 695 700 AAA CGG ATT AAA CAA GTG GTC GAT CAA CTT GTG AAC GGC TTT TTC CCT 2223 Lys Arg Ile Lys Gln Val Val Asp Gln Leu Val Asn Gly Phe Phe Pro 705 710 715 GAT GTT GCT GAT TAC TTT GAG CCG ATT TAC GAC TCC TTG CTG ACG CAA 2271 Asp Val Ala Asp Tyr Phe Glu Pro Ile Tyr Asp Ser Leu Leu Thr Gln 720 725 730 AAC GAC GAA TAT TTC GTT CTG CGC GAC TTT GCC GCT TAT ACC GAA GCG 2319 Asn Asp Glu Tyr Phe Val Leu Arg Asp Phe Ala Ala Tyr Thr Glu Ala 735 740 745 750 750 CAT GAG CGG GTG GAG GCC GCT TAC CGC GAC CCG GCA CGC TGG TGG TAT 23 His Glu Arg Val Glu Ala Ala Tyr Arg Asp Pro Ala Arg Trp Trp Tyr 755 760 765 765 ATG AGC GCG GTC AAC ATC GCG CAC TCC GGC TAC TTT GCA AGC GAC CGG 2415 Met Ser Ala Val Asn Ile Ala His Ser Gly Tyr Phe Ala Ser Asp Arg 770 775 780 ACG ATC GCC GAG TAC GCC GTC GAT ATT TGG GGC ATT TCA CCA TCG ATG 2463 Thr Ile Ala Glu Tyr Ala Val Asp Ile Trp Gly Ile Ser Pro Ser Met 785 790 790 795 798 TGAGGCAAAA GCAAAATCAA GGGCGGAGTCGCGCGTGCAGGCTCGC TGATTGGGCG GCAACGGCAT GAACAGAAAA GAGACGTTCT GAACCAA 2580

[Brief description of the drawings]

FIG. 1 is a schematic diagram showing the concept of G-1-P production using phosphorylase and cycloamylose production.

FIG. 2 (a) shows a group of glycogen biosynthesis genes derived from Bacillus subtilis, and FIG. 2 (b) shows a group of glycogen biosynthesis genes derived from Bacillus stearothermophilus TRBE14 strain.

FIG. 3 shows the results of SDS polyacrylamide gel electrophoresis of purified thermostable phosphorylase.

FIG. 4 is a graph showing the optimum pH of a thermostable phosphorylase.

FIG. 5 is a graph showing the pH stability of thermostable phosphorylase.

FIG. 6 is a graph showing the optimal reaction temperature of thermostable phosphorylase.

FIG. 7 is a graph showing the thermostability of thermostable phosphorylase.

FIG. 8 is a graph quantifying the production of glucose-1-phosphate from waxy maize starch over time using thermostable phosphorylase.

FIG. 9: Glucose-1-using thermostable phosphorylase
It is the graph which quantified the production of amylose from phosphoric acid over time.

──────────────────────────────────────────────────続 き Continuation of the front page (51) Int.Cl. ⁶ Identification number Agency reference number FI Technical display location C12R 1:19)

Claims (21)

[Claims] 1. A phosphorylase having the following properties: 1) Substrate specificity: α-1,4-glucan or glucose-1-
Phosphoric acid; 2) optimal temperature: 50 ° C .; 3) heat resistance: heat resistant even at 60 ° C .; and 4) pH stability: pH 6.5-11. 2. 798 from Met at position 1 of SEQ ID NO: 1 in the sequence listing
The phosphorylase according to claim 1, which has an amino acid sequence up to the Met position. 3. 798 from Met at position 1 of SEQ ID NO: 1 in the sequence listing
A phosphorylase having a mutation due to deletion, substitution, or addition of one or more amino acids in the amino acid sequence up to the Met position, wherein the phosphorylase containing the mutation is equal to or more than a phosphorylase not containing the mutation The phosphorylase according to claim 1, which has a specific activity and thermostability. 4. The phosphorylase according to claim 1, wherein the phosphorylase is derived from Bacillus stearothermophilus TRBE14 strain. 5. The phosphorylase according to claim 2, which has a higher specific activity than Escherichia coli phosphorylase. 6. The phosphorylase according to claim 2, wherein the specific activity is at least 9 times that of E. coli glycogen phosphorylase. 7. 798 from Met at position 1 of SEQ ID NO: 1 in the sequence listing
Including a sequence encoding the amino acid sequence up to the Met position,
Phosphorylase gene. 8. The phosphorylase gene, wherein the phosphorylase gene is a DNA sequence represented by SEQ ID NO: 4 in the sequence listing. 9. 798 from Met at position 1 of SEQ ID NO: 1 in the sequence listing
A phosphorylase having a mutation due to deletion, substitution, or addition of one or more amino acids in the amino acid sequence up to the Met position, wherein the phosphorylase containing the mutation is equal to or more than a phosphorylase not containing the mutation A gene encoding a phosphorylase having specific activity and thermostability. 10. A DNA containing a phosphorylase gene, which is amplified by PCR using the primer sets of SEQ ID NOs: 2 and 3 in the sequence listing. An expression vector comprising the thermostable phosphorylase gene according to any one of claims 7 to 10. A microorganism transformed with the expression vector according to claim 11. 13. The transformed microorganism according to claim 12, wherein said microorganism is a prokaryote. 14. The method of claim 1, wherein said microorganism is a mesophilic bacterium.
3. The transformed microorganism according to 2. 15. The transformed microorganism according to claim 13, wherein the prokaryote is Escherichia coli. 16. A method for producing a thermostable phosphorylase, comprising: culturing the transformed microorganism according to claim 11, heating to 60 ° C. or higher, and collecting and purifying the phosphorylase produced by the culturing. Production method. 17. The method according to claim 16, wherein the transformed microorganism is a mesophilic bacterium. 18. The method according to claim 18, wherein the transformed microorganism is Escheric.
17. The method according to claim 16, which is hia coli. 19. A phosphorylase recovered and purified by the method according to claim 16. 20. A method for producing glucose-1-phosphate, comprising a step of phosphorylating α-glucan using the phosphorylase according to any one of claims 1 to 3. 21. A method for synthesizing α-glucan, comprising the step of reacting the phosphorylase according to claim 1 with a saccharide and glucose-1-phosphate as a substrate.