JP3082171B2 - Recombinant human hepatocyte growth factor and method for producing the same - Google Patents

Description

DETAILED DESCRIPTION OF THE INVENTION

[0001]

BACKGROUND OF THE INVENTION The present invention relates to polypeptides having hepatocyte proliferation activity, and more particularly, to in vitro (in vivo) polypeptides.
The present invention relates to a recombinant expression vector, a transformant capable of expressing a base sequence encoding a polypeptide having a physiological activity enabling maintenance and proliferation of hepatocytes in vitro, and a method for producing the polypeptide. The polypeptide produced according to the present invention is used as a hepatocyte culture reagent, a liver regeneration promoter, a basic study of liver function, a study of the action of various hormones and drugs on liver parenchymal cells, a study of carcinogenesis of liver cancer, and the polypeptide. Can be expected to be used in clinical diagnostic reagents using antibodies against, and therapeutic agents for liver diseases.

[0002]

2. Description of the Related Art Conventionally, polypeptides having cell growth activity include epidermal growth factor (EGF), fibroblast growth factor (FGF), nerve cell growth factor (NGF), platelet-derived growth factor (PDGF), and vascular endothelium. Cell growth factor (E
CGF) is known. In addition to these growth factors, a polypeptide having hepatic parenchymal cell growth activity in vitro was partially purified from regenerated liver rat serum by Nakamura et al. In 1984 and named Hepatocyte Growth Factor (hereinafter abbreviated as HGF). Was.

Until the discovery of HGF, liver parenchymal cells did not show any proliferation even in the presence of mammalian serum in which various cell lines were actively growing, and usually fell off the culture vessel wall in about one week. As a result, long-term in vitro culture was not possible. However, hepatocytes proliferated extremely well in the presence of HGF, and the cells could be cultured (Bi
ochem, Biophys. Res. Commu
n. , 122, 1450 , 1984). Other researchers also confirmed that this HGF activity was present in the blood after partial hepatectomy and in the blood of fulminant hepatitis patients.

[0004] Under such circumstances, the present inventors have previously conducted research by separating and purifying HGF from rat platelets.
This rat platelet-derived HGF was found to be composed of two types of subunits, and 27 amino acid sequences contained in HGF were successfully identified (Japanese Patent Application No. 63-3).
11866).

[0005]

Since in vivo HGF is a polypeptide secreted in a very small amount from liver tissue or platelets, it is almost impossible to supply HGF stably due to the difficulty in obtaining raw material tissue. . In particular, human HG
In F, the only activity confirmed to date is only in the serum of patients with fulminant hepatitis. In order to use this human HGF for culturing liver parenchymal cells and for researching hepatocytes, and furthermore, as a therapeutic drug for liver disease, a large amount of polypeptides having the same activity as human HGF is supplied by applying gene recombination technology. It is desired to do.

[0006]

Means for Solving the Problems The present inventors have conducted intensive studies to solve the above-mentioned problems, and as a result, have found that rat platelet-derived H
C prepared from rat liver mRNA using an oligonucleotide synthesized based on the amino acid sequence of GF as a probe
It has been found that a cDNA containing a nucleotide sequence encoding a rat HGF polypeptide can be obtained from a DNA library. Furthermore, it has been found that a cDNA containing a nucleotide sequence encoding human HGF polypeptide can be obtained from a cDNA library prepared from human liver mRNA using the rat-derived cDNA as a probe. (Na
cure, 342 , 440, 1989).

[0007] Further, Northern hybridization with mRNAs derived from various human tissues excluding the liver was performed using a part or all of the cDNA derived from human liver as a probe, and the placenta and leukocyte mRNAs were also HGF-like. It was found that the presence of a transcript was observed. The present inventors have found that cDN prepared from leukocyte-derived mRNA
From the A library, a cDNA containing the nucleotide sequence encoding human HGF was isolated, the nucleotide sequence was clarified, a recombinant expression vector containing the cDNA was prepared, and the cDNA was transformed with the recombinant expression vector. A transformant is obtained, and the transformant is cultured to obtain human leukocyte-derived H
The present inventors have found that the GF gene is expressed and completed the present invention.

That is, the present invention relates to a recombinant expression vector capable of expressing a DNA containing a nucleotide sequence encoding human hepatocyte-derived hepatocyte growth factor, a transformant transformed with the recombinant expression vector, and a transformant. The present invention relates to a method for culturing a transformant, collecting and producing recombinant human leukocyte-derived hepatocyte growth factor from the culture, and a recombinant human leukocyte-derived hepatocyte growth factor.

The recombinant DNA expression vector encoding the human hepatocyte growth factor of the present invention and the transformant are prepared, for example, as follows. That is, (1) mRNA is isolated from human leukocytes, a cDNA library is prepared according to a conventional method, and (2) the human leukocyte-derived cDNA described above is probed with all or a part of the human liver-derived HGF cDNA already isolated. The library is screened, and the cDNA of interest is isolated from the isolated clone.
Is extracted. (3) cDN of this human leukocyte-derived HGF
A cDNA fragment encoding human HGF was excised from A using restriction enzymes, incorporated into an expression vector, and (4) a host cell was transformed with the obtained recombinant expression vector to obtain a transformant. By culturing the transformant, human leukocyte HGF can be collected from the culture supernatant and produced.

Hereinafter, each step of the present invention will be described in detail. 1) Isolation of mRNA and Northern Hybridization mRNA of human leukocytes can be obtained according to a conventional method. For example, Biochemistry, 18 , 529
4 (1979). M. Chirgv
According to the method of In et al., the mRNA can be prepared by further subjecting RNA obtained from a solution of human leukocytes to guanidine thiocyanate to liquid chromatography using an oligo dT cellulose column or to oligo dT latex. Also, human leukocyte mRNA
Can be purchased from Clontech and used as a commercial product. Northern hybridization of the mRNA thus obtained with cDNA encoding human liver-derived HGF can be performed, for example, by using Molecular
cloning: A Laboratory Man
ual, Cold Spring Harbor La
boratery, New York, 202 (198
It can be carried out by the method of Maniatis et al. Described in 2). As a probe, human liver-derived H
All or part of the GF cDNA can be labeled with ³² P before use.

2) Preparation of cDNA Using human leukocyte mRNA, for which the presence of the HGF transcript has been confirmed as described above, as a template, a reverse transcriptase is used. Okayama et al. (Mol. Cell. Bi.
ol. , 2. 161, 1982 and Mol. Cel
l. Biol. , 3, 280 , 1983) or U.S.A.
Gubler et al. (Gene, 25 , 263, 19).
83), a cDNA library can be prepared by incorporating the cDNA into a plasmid or phage. As a plasmid vector for incorporating cDNA, pBR322 derived from E. coli is used.
(Toyobo), pUC18 and pUC19 (Toyobo), pUB110 derived from Bacillus subtilis (Sigma) and the like. These vectors are not limited to those exemplified here as long as they are conserved in the host cell and can be replicated and amplified. As a method for preparing a cDNA library by incorporating cDNA synthesized using mRNA as a template into a plasmid or phage, T.I. Ma
niatis et al. (Molecular Clon)
ing, A Laboratory Manual, C
old Spring Harbor Laborat
ory, New York, 239, 1982) or T.W. V. Hyunh et al. (DNA Clonin
g: A Practical Approach, 1,
49, 1985). Also,
Similarly to mRNA, a human leukocyte cDNA library can be purchased from Clontech and used as a commercial product.

3) cDNA library screening The recombinant expression vector such as a plasmid or phage obtained as a cDNA library is maintained in a suitable host cell such as Escherichia coli. As Escherichia coli which can be a host, for example, Escherichia coli NM5
14, C600 (Stratagene), NM522, J
M101 (Pharmacia) can be exemplified. When the cDNA vector is a plasmid, it should be retained in host cells that have been grown in advance using the calcium chloride method, calcium chloride / rubidium chloride method, etc., and when the cDNA vector is a phage, using the in vitro packaging method, etc. Is possible (Molecu
lar Cloning, Cold Spring H
arbor Laboratory, New York
k, 249, 1982). From the transformants thus obtained, colony hybridization (Gene, 10 , 63, 1980) and plaque hybridization (Science, 196, 1) were performed using a probe in which HGF cDNA derived from human liver was labeled with ³² P.
80, 1977). In addition, using an antibody against the target polypeptide, a labeled antibody method (DNA Cloni) is used.
ng: A Practical Approach,
1, 49 , 1985), it is also possible to clone cDNA.

Next, a conventional method (Molecu) was used from the transformant.
lar Cloning, A Laboratory
Manual, Cold Spring Harbor
 Laboratory, New York, 198
According to 2), recombinant DNA such as plasmids and phages
Isolated and digested as is or digested with restriction enzymes
The NA base sequence is determined. The base sequence is Maxam and Gil
Bart's chemical method (Proc. Natl. Acad. Sc.
i. USA. ,74, 560, 1977) and Sanger
Dideoxy method (Proc. Natl. Acad. Sc)
i. USA. ,74, 5463, 1977).
Is determined. The described mRNA and nucleotide sequence were determined
Part of cDNA or synthetic DNA of part of cDNA
The primer extension method (P
rc. Natl. Acad. Sci. USA. ,7
6, 731, 1979) newly synthesized cDNA
In the same manner as above, the first
Plasmid containing a second cDNA linked to the cDNA
Cloning of recombinant DNA such as phage and phage
Is possible. This primer extension and
The cleaning process is repeated a plurality of times as necessary.

4) Construction of Recombinant Expression Vector for Human HGF Restriction enzymes from several types of recombinant vectors such as plasmids and phages containing cDNAs encoding all or a part of the amino acid sequence of cloned human leukocyte HGF. CDNA is cut out by human leukocyte-derived HG.
The recombinant expression vector can be prepared by religating downstream of the promoter of a vector suitable for expression of F using a restriction enzyme and DNA ligase. More specifically, in order to efficiently express human leukocyte-derived HGF, a recombinant expression vector is required in order in the downstream direction of transcription as necessary (1) promoter, (2) ribosome binding site, (3) initiation codon, (4) It is constructed to contain a DNA containing a nucleotide sequence encoding human leukocyte-derived HGF, (5) a stop codon, and (6) a terminator. Escherichia coli-derived plasmids pBR322, pUC18 (Toyobo), Bacillus subtilis-derived plasmid pUB110 (Sigma), yeast-derived plasmid pRB15 (ATCC 37062), bacteriophage λgt10, λgt11 ( Stratagene), virus SV40 (BRL), BPV (ATC)
CVR-703), a vector derived from a retrovirus gene, and the like, but are not particularly limited as long as they can be replicated and amplified in a host. In particular, in order to easily express human leukocyte-derived HGF, it is preferable to use a vector derived from a virus gene such as SV40.
For example, the above-mentioned cloned human leukocyte-derived HGF
The recombinant expression vector in which the DNA encoding the SV40 is ligated to the late region of the SV40 vector is a COS cell (Cell, 2).
3 , 175, 1981) can be introduced and expressed. Regarding the promoter and terminator, the target human leukocyte-derived HG
There is no particular limitation as long as it corresponds to the host used for the expression of the nucleotide sequence encoding F. For example, when the host is Escherichia coli, the promoter is trp promoter, lac promoter, or the like; when the host is Bacillus subtilis, the promoter is SPO1 promoter or SPO2 promoter;
When the host is an animal cell such as mouse fibroblast or Chinese hamster ovary cell,
Examples include the virus-derived SV40 promoter and HSV1TK promoter. When the host is Escherichia coli, the terminator is a trp terminator, a 1pp terminator, or the like. When the host is Bacillus subtilis, the amyF terminator is used. When the host is yeast, the CYC1 terminator is used. When the host is an animal cell, the SV40 terminator is used. , HSV1TK terminator and the like. These promoters and terminators are appropriately combined depending on the host used. In the present invention, the DNA containing the nucleotide sequence encoding human leukocyte-derived HGF is not particularly limited as long as the polypeptide in which the DNA is expressed has hepatocyte proliferation activity. The base sequence shown in 1 is exemplified, and a DNA having a base sequence in which a part of the above base sequence is substituted, deleted, inserted, or a combination thereof may be used. The DN containing a base sequence encoding human leukocyte-derived HGF
A may have ATG as a translation start codon and TAA, TGA, or TAG as a translation stop codon. If necessary, add a start codon or stop codon to one.
They may be arranged in combination of one or more or in combination with other codons, and are not particularly limited. Further, it is preferable that one or more kinds of genes, such as an ampicillin resistance gene, a neomycin resistance gene, and a DHFR gene, which can serve as a selection marker for a host transformed with the recombinant expression vector, are contained at appropriate positions in the vector.

5) Transformation of host cells and culture thereof The recombinant expression vector of human HGF leukocyte thus constructed is prepared by the competent cell method (J. Mol. Bio).
l. , 53, 154 , 1970), the protoplast method (Proc. Natl. Acad. Sci. USA, 7 ).
5 , 1929, 1978) Calcium phosphate method (Sci
ence, 221 , 551, 1983) DEAE dextran method (Science, 215 , 166, 198).
3), electric pulse method (Proc. Natl. Acad.
USA, 81, 7161 , 1984), an in vitro packaging method (Proc. Na. Tl. Acad . Sc).
i. USA, 72, 581 , 1975), the viral vector method (Cell, 37 , 1053, 1984), or the microinjection method (Exp. Cell. R).
es. , 153 , 347, 1984) to produce a transformant. At this time, Bacillus subtilis, yeast, animal cells and the like are used as hosts in addition to the above-mentioned Escherichia coli. In particular, mouse fibroblast C127 (JV
irol. , 26, 291 , 1978) and Chinese hamster ovary cells CHO (Proc. Natl. Ac).
ad. Sci. USA, 77 , 1929, 1978).
The obtained transformant is the recombinant human leukocyte HG of interest.
In order to produce F, the cells are cultured in a medium suitable for the host. The medium contains a carbon source, a nitrogen source, an inorganic substance, a vitamin, a serum, a drug and the like necessary for growth of the transformant. As an example of the medium, when the host of the transformant is Escherichia coli, the LB medium (Nissui Pharmaceutical) M9 medium (J.
Exp. Mol. Genet. , Cold Spring
g Harbor Laboratory, New Y
ork, 1972, p. 431) and the like, when the host is yeast, a YEPD medium (Genetic Engineer)
ring, vol. 1, Plenum Press, N
ew York, 1979, p. 117), and when the host is an animal cell, MEM medium, DMEM medium, RPMI1640 medium (Nissui Pharmaceutical) containing 20% or less of fetal bovine serum can be mentioned. Culture of the transformant is usually performed at 20 ° C. to 45 ° C. and at a pH of 5 to 8, and aeration and stirring are performed as necessary. When the host is an adhesive animal cell, a carrier such as glass beads, collagen beads, or acetyl cellulose follow fiber is used. The method can be carried out as long as the transformant grows under a medium composition or culture conditions other than those described above, and is not limited thereto.

6) Purification of human HGF Recombinant human leukocyte HGF produced in the culture supernatant of the transformant or in the transformant as described above can be purified by a known salting-out method, solvent precipitation method, dialysis method, or the like. Separation and purification can be performed by external filtration, gel electrophoresis, or a combination of gel filtration chromatography, ion exchange chromatography, reverse phase chromatography, affinity chromatography, and the like. In particular, salting out method using ammonium sulfate, S-
Sepharose ion chromatography, a combination of heparin sepharose affinity chromatography and phenyl sepharose reverse phase chromatography, or a combination of ammonium sulfate salting out method, S-sepharose ion chromatography, and anti-HGF antibody Sepharose affinity chromatography are preferred and effective purification methods. . The recombinant human leukocyte-derived HGF obtained by the above-described method showed an activity of remarkably promoting the proliferation of rat liver parenchymal cells, similar to rat liver, rat platelets, and recombinant human liver-derived HGF.

7) Measurement of HGF activity HGF activity is determined by the method described in Proc. Natl. Acad. Sc
i. USA, 80 , 7229 (1983). Hepatocytes were separated and purified from Wistar rats by collagenase reflux. The obtained rat liver parenchymal cells were subjected to 5% bovine serum, 2 × 1
0 ^-9 were suspended in M insulin and 2 × ^{10 -9} M dexamethasone Williams E medium supplemented with (Flow Laboratories, Inc.), 1.25 × 24-well multiplate
They were seeded at a concentration of 10 ⁵ cells / well. 5% CO ₂ and 3
After culturing at 37 ° C. for 20 hours in the presence of 0% O ₂ and 65% N ₂ , the medium was replaced with a Williams E medium supplemented with 0.1 μg / ml aprotinin, and a predetermined amount of a test sample was added at the same time. After 15 hours, 15 μCi / ml of ¹²⁵ I
10 μl / well of deoxyuridine was added. The control group received 5 μg / ml aphidicolin 15 minutes before the addition of ¹²⁵ I deoxyuridine. After further culturing for 4 hours, the ^cells were labeled with ^125I . PH cells
After washing twice with 7.4 PBS, the cells were fixed with a cold 10% aqueous solution of trichloroacetic acid (TCA). Solubilizing the cells with 0.5 ml of 1N aqueous sodium hydroxide solution per well;
The radioactivity was measured by a gamma counter. Also, a part of the sample after the radioactivity measurement was taken and subjected to the Lowry method (J. Bi).
ol. Chem. , 193, 265 , 1951). The amount of ¹²⁵ I incorporated into the hepatic parenchyma cells when the test sample was added was determined as the difference in count from the control.
The DNA synthesis activity (dpm / mg protein) was calculated in terms of g. The HGF activity of the test sample was expressed by defining one unit as an activity corresponding to 50% of the DNA synthesis activity of the hepatic parenchymal cells when 10 ng / ml of epidermal growth factor (EGF) was used in the same test.

[0018]

Industrial Applicability According to the present invention, it becomes possible to supply a large amount of a novel physiologically active peptide which enables the proliferation of hepatocytes in vitro. The recombinant human leukocyte-derived HGF supplied by the present invention is useful as a clinical diagnostic reagent or a therapeutic agent for liver disease. In addition, the hepatic parenchymal cells produced and maintained by the action of the recombinant human leukocyte-derived HGF produced by the present invention can be used, for example, for the study of the action of various hormones and drugs on hepatic parenchymal cells for basic research on hepatic function, for carcinogenesis of liver cancer It is extremely useful as a host cell for research or for in vitro culture of hepatitis virus.

[0019]

EXAMPLES The present invention will be described in more detail with reference to the following examples, but the present invention is not limited to these examples.

Example 1 1) Northern hybridization of human tissue mRNA and human liver-derived HGF cDNA 2 μg of human brain, placenta, leukocyte, lung, and liver mRNA (Clontech) was used according to the method of Maniatis et al. (Molecular Cloning: Alabor).
attory Manual, Cold Spring
Harbor Laboratory, New York
k, 202, 1982) and subjected to agarose electrophoresis containing 0.66 M formaldehyde, and then immobilized on a nylon filter GeneScreen Plus (DuPont). BamHI- of human liver-derived HGF cDNA
A 2.2 kb fragment of KpnI was separated and purified by agarose electrophoresis, and a probe prepared by labeling with [α ³² P] dCTP using a multiprime DNA labeling system (Amersham), 5 × SSPE buffer (1
× SSPE: 180 mM NaCl 10 mM sodium phosphate, 1 mM EDTA, pH 6.8) 5 × Denhardt's solution, 10% dextran sulfate, 40% formaldehyde, 0.1% SDS, 0.1 mg / ml E. coli DN
The nylon filter was immersed in the hybridization solution consisting of A and subjected to a hybridization reaction at 42 ° C. for 16 hours. After the reaction, the nylon filter
Was washed three times with 1 × SSC buffer containing 0.1% SDS, and then air-dried. This nylon filter was brought into close contact with intensifying screen Lightning Plus (DuPont), X-ray film and RX (Fuji Photo Film), and -8
Exposure was performed at 0 ° C. for 16 hours. As a result of development, the presence of HGF-like transcripts was observed in placenta and leukocyte mRNA as well as liver mRNA.

2) Preparation of cDNA library derived from human leukocytes
^{5 '} ACAT contained in 3' untranslated region of GF cDNA
Using an oligonucleotide having a nucleotide sequence of TCTCTGAATCTTCAT ^{3 '} as a primer, cDNA
Gubl using Synthetic System Plus (Amersham)
cDNA was synthesized according to the method of Er et al. (Gene, 25 , 263, 1983). The cDNA was purified by phenol / chloroform (1: 1, V / V) extraction and ethanol precipitation, followed by 0.5 M NaCl and 1 mM E.
It was dissolved in a 10 mM Tris-HCl buffer containing DTA (abbreviated as STE buffer) to give 0.7 μg / 20 μl. This cDNA was cloned into a cDNA cloning system λgt10.
(Amersham) using the method of Huynh et al. (DNA
Cloning I, A Practical Ap
Proach, 1 , 49, 1982), and cloned into the EcoRI site of λgt10 as follows. T
4 DNA ligase was used to add EcoR to both ends of the cDNA.
An I adapter was added. C equilibrated with STE buffer
The reaction solution was applied to a gel filtration column for DNA purification, eluted with the same buffer, and 500 μl of a cDNA fraction was collected. After ethanol precipitation was repeated twice by a conventional method, the residue was dried under reduced pressure to obtain a linker-added cDNA. After redissolving in STE buffer at a concentration of 50 ng / μl, an adapter-added cD was added to 1 μg of the previously prepared λgt10 arm.
0.1 μg of NA was inserted using T4 DNA ligase. This reaction solution was treated with cold ethanol, and then gently dried, and the total amount of the obtained recombinant DNA was added to 5 μl of 1 mM EDT.
A was dissolved in 10 mM Tris-HCl buffer pH 7.5 (abbreviated as TE buffer) containing A. This recombinant DNA was subjected to an in vitro packaging reaction to obtain a λgt10 recombinant phage. The number of recombinant phages obtained from 1 μg of cDNA measured by titration using Escherichia coli for phage plating was 5.0 × 10 ⁶ . The cDNA library prepared in this manner was used in an SE buffer (100 mM N
It was stored at 4 ° C. in 20 mM Tris-HCl buffer (pH 7.5) containing aCl, 10 mM MgSO ₄ and 0.01% gelatin.

3) cDNA of HGF gene derived from human leukocyte
Of human liver derived from human liver labeled with [α ³² P] dCTP using a multiprime DNA labeling system (Amersham)
0.2 kb E of HAC69 which is a part of GF cDNA
Using the coRI fragment as a probe, the human leukocyte-derived HGF gene was cloned from the above cDNA library. The hybridization reaction temperature and the washing temperature were 60 ° C., the washing solution was 2 × SSC buffer containing 0.1% SDS, and screening was performed.
And HLC3. HLC2 and HLC3 cDNA isolated and purified from each phage by a conventional method were subjected to nucleotide sequence analysis and restriction enzyme cleavage analysis. Figure 1 shows HLC
SEQ ID NO: 1 shows a part of the base sequence and the deduced amino acid sequence. The human leukocyte-derived HGF clone, HLC3, is a previously determined human liver-derived HGF (Nature, 342, 440 , 198).
It has the same characteristics as 9), but there are 38 differences in the nucleotide sequence in the coding region, resulting in 14 differences in the deduced amino acid sequence. Also, HLC2cD
Although NA has almost the same nucleotide sequence as HLC3 cDNA, the nucleotides at positions 484 to 498 of HLC3 cDNA were deleted (SEQ ID NO: 2 in Sequence Listing).

4) Human leukocyte-derived HG for monkey COS cells
Construction of F expression vector Human HGF expression vector CDM for monkey COS cells [dL
eHGF] and CDM [LeHGF] are shown in FIG.
Shown in The HLC2 and HLC3 phage DNAs obtained in 3) above are digested with restriction enzymes BamHI and KpnI,
A 2.2 kb DNA fragment was separated and purified. Oligonucleotide ^{5 '} CACAGTCATAGCT consisting of KpnI cleavage site of HLC2 and HLC3, sequence contained on the 3' side thereof and HpaI, SmaI, and SalI cleavage sites
GTTAACCCGGG ^{3 ', 5'} TCGACCCGG
GTTAACAGCTATGACTGTGGTAC ^{3 '}
Was synthesized and used as a KpnI-SalI adapter. BamHI-KpnI DNA of HLC2 and HLC3
The fragment, KpnI-SalI adapter and Bluescript KSM13 + (Stratagene) previously digested with restriction enzymes BamHI and SalI were mixed, and T4D
The two plasmids pBS [d
LeHGF] and pBS [LeHGF] were obtained. The resulting pBS [dLeHGF] and pBS [LeHGF] were digested with restriction enzymes BamHI and SalI and blunt-ended with T4 DNA polymerase.
Expression vector CDM8 for COS cells (Nature,
329, 840 , 1987) and ligated with T4 DNA ligase to express human leukocyte-derived HGF expression vector CD.
M [dLeHGF] and CDM [LeHGF] were obtained.

5) Transformation of monkey COS cells and expression of HGF gene derived from human leukocyte The obtained CDM [dLeHGF] and CDM [LeHG
F] After ethanol precipitation of the plasmid, 10 mM PB
It was dissolved in S buffer and adjusted to 2 μg / ml. Then 10
COS-1 cells (ATCC CRL-1650) grown to a saturated cell density in a DMEM medium (Nissui Pharmaceutical) containing 10% fetal bovine serum (Gibco) were washed twice with 10 mM PBS buffer and then treated with trypsin. . After washing three times with the same buffer, the cells were resuspended in the same buffer to a cell density of 2 × 10 ⁷ cells / ml. 250 μl of the previously prepared plasmid solution and 250 μl of the cell suspension were mixed and allowed to stand under ice cooling for 10 minutes. This ice-cooled plasmid cell mixture high voltage pulse gene transfer apparatus ZA-1200 (PDS
4KV / 1cm pulse time 20
A high voltage pulse was applied under millisecond conditions. The obtained cells were diluted with the above-described medium, and then diluted at 37 ° C. in the presence of 5% CO _{2 for} 3 hours.
Cultured for days. When the HGF activity in the culture supernatant on the third day of the culture was measured, they were 20 units / ml and 5 units / ml, respectively.
ml. On the other hand, the expression vector CDM8 into which HGF cDNA was not inserted was introduced into COS-1 cells by the same method and cultured, but no HGF activity was observed in the culture supernatant.

Example 2 1) Construction of Human Leukocyte-Derived HGF Expression Vector for Mouse C127 Cells Human Leukocyte-Derived HGF Expression Vector pBPMT [LeHGF] for Mouse C127 Cells
No.) and pBPMT [dLeHGF]
No. 898) is shown in FIG. Plasmids pBS [LeHGF] and pBS [dLeHG obtained in Example 1
F] is digested with restriction enzymes XbaI and SalI, respectively.
After blunt-ending with T4 DNA polymerase, the mixture was mixed with the expression vector pBPMT for C127 cells previously digested with the restriction enzyme EcoRV, and ligated with T4 DNA ligase to bind to the human HGF expression vector pBPMT [LeHGF].
(Microtechnical Laboratory No. 2897) and pBPMT [dLeH
GF] (Microtechnical Laboratory No. 2898). The obtained human leukocyte-derived HGF expression vector has a human leukocyte-derived HGF gene between the MT-1 promoter and the poly (A) addition signal of the SV40 early gene. Transformation of mouse C127 cells with this expression vector is It is performed by papilloma virus (BPV). In addition, the selection of the transformed cells is performed by transposon Tn5 neo.
This is made possible by a neo chimeric gene in which a promoter derived from the herpes simplex virus type 1 thymidine kinase (HSV1 TK) gene and a poly (A) addition signal are linked to the gene (Gene, 19 , 329, 1982).

2) Transformation of mouse C127 cells and expression of human HGF gene Human leukocyte-derived HGF expression vector pBPMT [LeH
GF] (Microtechnical Laboratory No. 2897) and pBPMT [d
LeHGF] (Microtechnical Laboratories No. 2898) is Wigle
The cells were introduced into mouse C127 cells by the method of R. et al. (Cell, 11 , 223, 1977). 29 μg of the pBPMT [LeHGF] (Microtechnical Laboratories No. 2897) plasmid and pBPMT [dLeHG] obtained in the above (1)
F] (Microfabrication Kenjiro No. 2898) 240 μl each
Dissolved in 0.5 M calcium chloride and 20 mM HEP
ES, 2 × HEPES buffer (pH 7.1) consisting of 280 mM NaCl and 1.5 mM sodium phosphate,
240 μl were added with stirring. Stirring was continued at room temperature for 30 minutes to form a coprecipitate of plasmid and calcium phosphate. Using a DMEM medium (Nissui Pharmaceutical) supplemented with 10% fetal bovine serum (Gibco) and 10 mM glutamine in advance, 5 × 10 ⁵ C127 cells were added to 5% CO _2.
At 37 ° C for 24 hours. After replacing the medium, the plasmid and calcium phosphate coprecipitate were added, and the mixture was left at room temperature for 20 minutes. After further incubation at 37 ° C. for 4 hours, the medium was removed, 1 × HEPES buffer containing 15% glycerin was added, and the mixture was left at room temperature for 5 minutes. After washing the cells with the medium, the medium was changed and the cells
Incubated at 2 ° C for 2 days. The cells were diluted 10-fold and cultured in the same medium containing 1 mg / ml G418 (Sigma) at 37 ° C. for 7 days in the presence of 5% CO ₂ to obtain transformed cells. H in the culture supernatant was obtained from the obtained cell line.
Screening cells with high GF activity by limiting dilution,
Human leukocyte-derived HGF high-producing strain BPI-14 strain (pBP
MT [LeHGF] (Microtechnical Lab. No. 2897)) and BPD-27 strain (pBPMT [dLeHGF] (Microtechnical Lab. No. 2898)) were obtained. The HGF producing ability of the culture supernatant of these cells was 120,000 units / day, 15
It was 10,000 units / 1 / day.

Example 3 1) Construction of Human Leukocyte-Derived HGF Expression Vector for Chinese Hamster CHO Cells Human Leukocyte-Derived H for Chinese Hamster CHO Cells
GF expression vector pEVSSV [LeHGF] (Micro Engineering Laboratories No. 2899) and pEVSSV [dLeHGF]
FIG. 4 shows a construction diagram of (Microtechnical Laboratory No. 2900). The plasmids pBS [LeHGF] and pBS [dLeHGF] obtained in Example 1 were digested with restriction enzymes XbaI and SalI, respectively, blunt-ended with T4 DNA polymerase, and then digested with the restriction enzyme EcoRV.
Mix with HO cell expression vector pEVSSV, T4D
HGF expression vector derived from human leukocyte pEVSSV [LeHGF] by binding with NA ligase
No. 9) and pEVSSV [dLeHGF] (Microtechnical Laboratory No. 2900). The obtained human leukocyte-derived HGF
The expression vector contains the SV40 early promoter and poly (A)
It has the human leukocyte-derived HGF gene between the additional signals. In addition, the transformed cells were selected by using a mouse dihydrofolate reductase (DHFR) gene linked to an SV40 early promoter and a poly (A) additional signal by a DHFR gene.
This is made possible by the chimeric gene.

2) Transformation of Chinese hamster CHO cells and expression of human leukocyte-derived HGF gene Human leukocyte-derived HGF expression vector pEVSSV [Le
HGF] (Microtechnical Research Institute No. 2899) and pEVSSV
[DLeHGF] (Microtechnical Laboratories No. 2900) was prepared in the same manner as in Example 2 except that D
HFR-deficient CHO DUKX cells were introduced. The resulting cell line was free of ribonucleosides and deoxyribonucleosides and contained alpha-containing dialyzed 10% fetal calf serum (Gibco), 1% glutamine and 50 nM methotrexate.
Cells having high HGF activity in the culture supernatant were screened by a limiting dilution method using an MEM medium (Flow Laboratory). The resulting colonies were grown in the same medium up to 9 generations in order to obtain a stable human leukocyte-derived HGF-producing strain. This cell line has 100 nM, 250 nM,
Growing in the same medium while increasing the concentration of methotrexate sequentially to 500 nM, 750 nM, and 1000 nM, and further producing a stable human leukocyte-derived HGF high producing strain EVI
-65 strain (pEVSSV [LeHGF] (Microtechnical Laboratory No. 2899)) and EVD-104 strain (pEVSSV
[DLeHGF] (Microtechnical Laboratory No. 2900) was obtained. The human leukocyte-derived HGF-producing ability of these cells was 90,000 units / day and 130,000 units / day, respectively.

Example 4 Purification of Recombinant Human Leukocyte-Derived HGF from Cultured Supernatant C127 Cell Supernatant HGF-producing mouse C obtained in Example 2
127 recombinant cell line BPD-27 (15 base deleted HGF
HGF derived from recombinant human leukocytes from the culture supernatant of
Was purified. 1) Cation exchange chromatography A final concentration of 0.01% was added to 500 ml of the culture solution of the BPD-27 strain.
Tween 80 was added to obtain Sterivex H
The mixture was filtered with a V filter (Nippon Millipore Limited). Add 1/20 volume of 1 M Tris · HCl to the filtrate.
(PH 8.5) buffer was added, and buffer A (50 mM T
ris · HCl, 10 mM Hepes, 2 mM Ca
Cl ₂ , 150 mM NaCl, 0.01% Tween
80, pH 8.5) S-Sepharose FF
(Manufactured by Pharmacia, column size inner diameter 1.6 cm, height 5 cm). After washing the unadsorbed substance with buffer A, the adsorbed substance was eluted with a linear concentration gradient (100 ml in total) using 0.15 M to 1.0 M NaCl. FIG. 5 shows the chromatographic pattern. Collecting fractions having HGF activity,
S-Sepharose eluate was used.

2) Affinity chromatography The S-Sepharose eluate was adjusted to pH 7.5 with 1N acetic acid, and then diluted with 2 volumes of distilled water containing 0.01% Tween 80 to obtain a buffer B (10 mM Tris.HCl, 0.
3M NaCl, 0.01% Tween80, pH7.
Equilibrated in 5). Heparin Sepharose CL-6B
(Pharmacia, column size 1cm ID) Height 3
cm). After washing the column with buffer B, 0.3
M to 2.0 M NaCl linear gradient (total 3
0 ml). Fig. 6 shows the chromatographic pattern.
Shown in Fractions having HGF activity were collected and used as a heparin eluate.

3) Reversed phase HPLC A phenyl 5PW RP column (manufactured by Tosoh Corporation, 0.75 cm inside diameter, 7.5 cm height) equilibrated with distilled water containing 0.1% TFA (trifluoroacetic acid, v / v%) ) Was added with a heparin eluate, from 0% to 9% containing 0.1% TFA.
Elution was performed with a gradient of acetonitrile to 0%. Recombinant human leukocyte-derived HGF was eluted at an acetonitrile concentration of about 40%. The chromatogram is shown in FIG. The yield of purified recombinant human HGF was about 20 μg, and the activity recovery rate from the culture supernatant was 18%.

4) SDS-Polyacrylamide Electrophoresis SDS-Polyacrylamide Electrophoresis of HGF Derived from 15-base Deletion Type Human Recombinant Leukocytes Purified by the Three-Step Chromatography under Reduction and Non-Reduction of 2-Mercaptoethanol To FIG. 8 shows the results. Purified recombinant HGF
Shows a single band having a molecular weight of 70,000 to 90,000 under non-reducing conditions (2-ME (-)), and an α chain having a molecular weight of 60,000 to 75,000 under reducing conditions (2-ME (+)). And a β chain having a molecular weight of 30,000 to 40,000. That is, it was shown that the recombinant HGF was a heterodimer composed of an α chain and a β chain.

5) Hepatocyte Proliferation Activity of Recombinant Human Leukocyte-Derived HGF (15-Base Deletion Type) Rat primary cultured hepatocytes are known in the art.
It is a system having a liver function closest to in vivo among the in vitro systems. Purified rat hepatocytes obtained according to the method described in "Measurement method of HGF activity"
Addition of 5-base-deleted recombinant human leukocyte-derived HGF induced strong cell proliferation at a concentration of 1 to 20 ng / ml. Other factors that have a proliferative activity in this culture system include insulin and EGF, but the recombinant HGF alone has a stronger activity than both, and has an additive effect in the presence of these three. showed that.

Example 5 Transformation of Chinese hamster CHO cells with human leukocyte-derived HGF gene and its expression Human human leukocyte-derived HGF expression vector pEVSSV (dL
eHGF) (Microtechnical Laboratory No. 2900) is Wigler
The cells were introduced into DHFR-deficient cells of Chinese hamster CHO cells by the method described above (Cell, 11, 233, 1977). About 30 μg of pEVSSV (dLeHG
F) Dissolve each plasmid in 240 μl of 0.5 M calcium chloride and add 20 mM HEPES, 280 mM
240 μl of 2 × HEPES buffer (pH 7.1) consisting of sodium chloride and 1.5 mM sodium phosphate
Was added with stirring. Stirring was continued at room temperature for 30 minutes to form a coprecipitate of the plasmid and calcium phosphate. Subsequently, 5 × 10 ⁵ CHO cells were cultured in an α-MEM medium (Flow Laboratories) containing 10% fetal bovine serum (Gibco) and 1% glutamine in the presence of 5% CO _2.
The cells were cultured at 7 ° C for 24 hours. After the medium was replaced, the plasmid and calcium phosphate co-precipitated were added and left at room temperature for 20 minutes. After further incubation at 37 ° C. for 4 hours, the medium was removed and 1 × HEPE supplemented with 15% glycerin was added.
S buffer was added and left at room temperature for 5 minutes. After washing the cells with the medium, the medium was replaced and the cells were further cultured at 37 ° C. for 7 days to obtain transformed cells. The resulting cell line was free of ribonucleosides and deoxyribonucleosides and was dialyzed 10%.
Fetal bovine serum (Gibco), α-containing 2% glutamine
Stable H using MEM medium (Flow Laboratories)
100 nM, 250 nM, 5 to obtain a high GF producing strain
Subculture was repeated in the same medium while sequentially increasing the methotrexate concentration to 00 nM, 750 nM, 1 μM, and 2 μM. The obtained human leukocyte-derived HGF-producing recombinant cells were subjected to clone selection to obtain a stable human leukocyte-derived HGF-producing strain 515C. The HGF producing ability of these cells is about 8
It was 10,000 units / 1 / day.

Example 6 Purification of Recombinant Human Leukocyte-Derived HGF from Cultured Supernatants of Transformed CHO Cells The human leukocyte-derived HGF-producing Chinese hamster CHO recombinant cell line 515C (15-base deleted HGF) obtained in Example 5 Producing strain) was cultured in an α-MEM medium (Flow Laboratories) containing 10% fetal bovine serum (Gibco), 1% glutamine and 2 μM methotrexate without ribonucleoside and deoxyribonucleoside, and from the culture supernatant. The recombinant human leukocyte-derived HGF was purified. 1) Cation exchange chromatography Tween 80 was added to 500 ml of the culture solution of the 515C strain to a final concentration of 0.01%, and Sterivex H was added.
V filter (filtered by Nippon Millipore Limited. The filtrate was added to 1/20 volume of 1M Tris · HCl.
(PH 8.5) A buffer was added, and a buffer C containing 150 mM NaCl (50 mM Tris.HCl, 0.01
% Tween 80, pH 8.5) and added to S-Sepharose FF (Pharmacia, column size 1.6 cm, height 5 cm). Buffer C column with buffer C containing 150 mM NaCl and 400 m
Buffer C containing M NaCl (marked by arrow A in FIG. 9)
Buffer C containing 1 M NaCl (arrow B in FIG. 9).
(Marked with). FIG. 9 shows the chromatographic pattern. The peaks eluted with buffer C containing 1 M NaCl (marked ← → in FIG. 9) were collected and used as S-Sepharose eluate.

2) Affinity chromatography The S-Sepharose eluate was adjusted to pH 7.5 with 1N hydrochloric acid, and then diluted with 2 volumes of distilled water containing 0.01% Tween 80 to obtain a buffer B (10 mM Tris · HCl, 0.
3M sodium chloride, 0.01% Tween 80, pH
Heparin Sepharose CL- equilibrated in 7.5)
6B (Pharmacia, column size 1 cm inner diameter, 5 cm height). After washing the column with buffer B,
The adsorbate was eluted with a linear concentration gradient (total volume: 40 ml) using 0.3 M to 2.0 M sodium chloride. FIG. 10 shows the chromatographic pattern. Fractions having HGF activity were collected and used as a heparin eluate.

3) Hydrophobic chromatography 20 mM phosphate buffer containing 4 M NaCl (pH 7.0)
0) equilibrated phenyl 5PW column (manufactured by Tosoh,
Heparin eluate was added to the inner diameter (0.75 cm, height 7.5 cm), and the solvent A was 20 mM containing 4 M sodium chloride.
From phosphate buffer (pH 7.0) to solvent B: 20 mM phosphate buffer (pH 7.0) containing 50% ethylene glycol.
Elution was carried out with a concentration gradient to 0). HGF activity is 2
Eluted with M NaCl, 25% ethylene glycol. The chromatogram is shown in FIG. The yield of purified recombinant human leukocyte-derived HGF was about 500 μg, and the activity recovery rate from the culture supernatant was 25%.

4) Properties of Purified Recombinant Human Leukocyte-Derived HGF The biological, chemical and physicochemical properties of the recombinant human leukocyte-derived HGF obtained in the section 3) were measured. SDS-polyacrylamide electrophoresis SDS-polyacrylamide electrophoresis was performed on the recombinant HGF under 2-mercaptoethanol reduction and non-reduction. After the electrophoresis, the gel was stained by the silver staining method, and the result is shown in FIG. Recombinant HGF was separated into an α chain having a molecular weight of 60,000 to 75,000 and a β chain having a molecular weight of 30,000 to 40,000 under non-reducing conditions. Also, the β chain was divided into two bands, indicating the difference in the number of linked sugar chains in the β chain.

Sugar composition and analysis (neutral sugar and amino sugar) The purified recombinant HGF was evaporated to dryness and then hydrolyzed at 110 ° C. for 6 hours in the presence of 2.5N trifluoroacetic acid. After the hydrolyzate was evaporated to dryness, it was redissolved in water to obtain a sample. The sample was analyzed for sugar composition and analysis by HPLC using an anion exchange resin. As a result, fucose, galactose, mannose and N-acetylglucosamine were detected, and recombinant HGF was detected.
Was confirmed to be a glycoprotein.

Biological activity The hepatocyte proliferation activity of the purified recombinant HGF was measured according to the method described in the section "Measurement of HGF activity". As a result, the specific activity of the purified recombinant HGF was 200,000 to 500,000 unit /
mg.

Example 7 Production of single-chain recombinant human leukocyte-derived HGF The human leukocyte-derived HGF (15-base deleted HGF) -producing CHO515C strain obtained in Example 5 was subjected to 10% fetal bovine serum (Gibco). And 1% glutamine and 2 μM methotrexate. The cells were cultured in an α-MEM medium (Flow Laboratories) containing neither ribonucleosides nor deoxynucleosides at 37 ° C. under 5% CO ₂ until the cells became confluent. After the culture, the culture solution was removed, and the cells were washed twice with PBS. Next, α-M containing 1% glutamine, 500 μM methotrexate and 400 unit / ml aprotinin, which is a protease inhibitor, was added.
An EM medium (without ribonucleosides and deoxynucleosides) was added, and the cells were cultured at 37 ° C. under 5% CO ₂ . After culturing for about one day, the culture supernatant was collected, and the recombinant HGF was purified by a chromatographic operation substantially similar to the method described in Example 6. The activity recovery from the culture supernatant was about 15%.

The purified HGF derived from a 15-base deletion recombinant human leukocyte was subjected to SDS-acrylamide electrophoresis.
The result is shown in FIG. The purified recombinant HGF shows a band with a molecular weight of 70,000 to 90,000 daltons under non-reducing conditions,
In addition, a single band having a molecular weight of 80,000 to 95,000 daltons was shown under mercaptoethanol reduction conditions.

As a result, it was shown that the obtained recombinant HGF was of a single-chain type. The biological activity of the purified single-chain recombinant HGF was measured. That is, the proliferation activity on the primary cultured rat hepatocytes described in the section "Measurement of HGF activity" was measured. As a result, the single-chain recombinant HGF showed hepatocyte proliferation activity, and its specific activity was almost the same as the activity obtained in the section 4) of Example 6, and was from 200,000 to 500,000 unit /.
mg.

[0044]

[Sequence list]

SEQ ID NO: 1 Sequence length: 2214 Sequence type: Nucleic acid Number of strands: Double-stranded Topology: Linear Sequence type: cDNA Origin Organism name: Human Sequence characteristics Characteristic symbol: sig peptide Location: 1-93 Method for determining feature: E Symbol indicating feature: CDS Location: 1-2184 Method for determining feature: E sequence

[0045]

[Sequence list]

SEQ ID NO: 2 Sequence length: 2199 Sequence type: nucleic acid Number of strands: double-stranded Topology: linear Sequence type: cDNA origin Organism name: Human Sequence characteristics Characterizing symbol: sig peptide Location: 1-93 Method for determining feature: E Symbol indicating feature: CDS Location: 1-2169 Method for determining feature: E sequence

[Brief description of the drawings]

FIG. 1 is a restriction map of HLC3.

FIG. 2 is a construction diagram of a human leukocyte-derived HGF expression vector for COS cells.

FIG. 3 is a construction diagram of a human leukocyte-derived HGF expression vector for mouse C127 cells.

FIG. 4 is a construction diagram of a human leukocyte-derived HGF expression vector for Chinese hamster CHO cells.

FIG. 5 is a diagram showing the relationship between the fraction of the S-Sepharose eluate, the absorbance of the eluted components, and their DNA synthesis activity.

FIG. 6 is a diagram showing the relationship between the fraction of a heparin eluate, the absorbance of the eluted components, and their DNA synthesis activity.

FIG. 7 is a diagram showing the relationship between the concentration of acetonitrile passed through and the absorbance of eluted components in reverse phase HPLC.

FIG. 8 shows SDS-polyacrylamide electrophoresis patterns under reduced and non-reduced conditions of purified recombinant human HGF.

FIG. 9 is a diagram showing a chromatographic pattern of an eluate of S-Sepharose.

FIG. 10 is a diagram showing the relationship between the fraction of a heparin eluate, the absorbance of eluted components, and their DNA synthesis activity.

FIG. 11 is a diagram showing the relationship between fractions of eluate, absorbance of eluted components, and their DNA synthesis activities in phenyl 5PW column chromatography.

FIG. 12 shows SDS-polyacrylamide electrophoresis patterns of purified recombinant human HGF under reducing and non-reducing conditions.

FIG. 13 shows SDS-polyacrylamide electrophoresis patterns of purified single-stranded recombinant human HGF under reducing and non-reducing conditions.

──────────────────────────────────────────────────の Continued on the front page (51) Int.Cl. ⁷ Identification symbol FI C12R 1:91) (C12P 21/02 C12R 1:91) (72) Inventor Manabu Shimonishi 2-chome Katata 2-chome, Otsu City, Shiga Prefecture No. 1 Toyo Spinning Co., Ltd. Pharmaceutical Research Laboratories (72) Inventor Shin Shimizu 2-1-1 Katata, Otsu City, Shiga Prefecture Toyo Boshoku Co., Ltd. Pharmaceutical Research Laboratories (72) Inventor Izumi Inohara 2-1-1 Katata, Otsu City, Shiga Prefecture No. 1 Toyo Spinning Co., Ltd. Pharmaceutical Research Laboratories (72) Inventor Mariko Sakaguchi 2-1-1 Katata, Otsu City, Shiga Prefecture Toyo Spinning Co., Ltd. Pharmaceutical Research Laboratories (72) Inventor Osamu Asami No. 8 after Tono Tower, Konan City, Aichi Prefecture No. 1 (56) References Nature, 1989, Vol. 342, p. 440-443 (58) Fields investigated (Int. Cl. ⁷ , DB name) C12N 15/00-15/90 BIOSIS (DIALOG) ) WPI (DIALOG) EPAT (QUESTEL)

Claims (4)

(57) [Claims] 1. A method for producing hepatocyte growth factor (HGF) comprising the following steps. (1) transforming animal cells with a recombinant expression vector having a gene encoding the amino acid sequence of SEQ ID NO: 1 and a dihydrofolate reductase (DHFR) gene; and (2) transforming the above transformant while increasing the concentration of methotrexate. Is cultured to select an HGF-producing strain. (3) The HGF-producing strain is cultured, and the produced HGF is recovered and purified. 2. The animal cell according to claim 1, wherein the animal cell is CH.
A method for producing HGF, comprising using O cells. 3. A high HGF-producing cell line obtained by the following steps. (1) transforming animal cells with a recombinant expression vector having a gene encoding the amino acid sequence of SEQ ID NO: 1 or SEQ ID NO: 2 and a dihydrofolate reductase (DHFR) gene; (2) increasing the concentration of methotrexate The above transformant is cultured, and (3) a cell line producing high HGF is selected. 4. The animal cell according to claim 3, wherein the animal cell is CH.
A cell line that produces high HGF, characterized by using O cells.