JP2777678B2 - Recombinant human hepatocyte growth factor and method for producing the same - Google Patents

Description

DETAILED DESCRIPTION OF THE INVENTION

[0001]

BACKGROUND OF THE INVENTION 1. Field of the Invention The present invention relates to a polypeptide having hepatic parenchymal cell growth activity,
The present invention relates to a recombinant expression vector capable of expressing a nucleotide sequence encoding a polypeptide having a physiological activity enabling maintenance and proliferation of hepatocytes in o), a transformant, and a method for producing the polypeptide. The polypeptide produced according to the present invention is used as a hepatocyte culture reagent, a liver regeneration promoter, a basic study of liver function, a study of the action of various hormones and drugs on liver parenchymal cells, a study of carcinogenesis of liver cancer, and the polypeptide. Can be expected to be used in clinical diagnostic reagents using antibodies against, and therapeutic agents for liver diseases.

[0002]

2. Description of the Related Art Conventionally, polypeptides having cell growth activity include epidermal growth factor (EGF), fibroblast growth factor (FGF), nerve cell growth factor (NGF), platelet-derived growth factor (PDGF), and vascular endothelium. Cell growth factor (E
CGF) is known. In addition to these growth factors, a polypeptide having hepatic parenchymal cell growth activity in vitro was partially purified from regenerated liver rat serum by Nakamura et al. In 1984 and named Hepatocyte Growth Factor (hereinafter abbreviated as HGF). Was.

Until the discovery of HGF, liver parenchymal cells did not show any proliferation even in the presence of mammalian serum in which various cell lines were actively growing, and usually fell off the culture vessel wall in about one week. As a result, long-term in vitro culture was not possible. However, hepatocytes proliferated extremely well in the presence of HGF, and the cells could be cultured (Bioc
hem, Biophys. Res. Commun., 122, 1450, 1984). Other researchers also confirmed that this HGF activity was present in the blood after partial hepatectomy and in the blood of fulminant hepatitis patients.

[0004] Under such circumstances, the present inventors have previously conducted research by separating and purifying HGF from rat platelets.
This rat platelet-derived HGF was found to be composed of two types of subunits, and 27 amino acid sequences contained in HGF were successfully identified (Japanese Patent Application No. 63-3).
11866).

[0005]

Since in vivo HGF is a polypeptide secreted in a very small amount from liver tissue or platelets, it is almost impossible to supply HGF stably due to the difficulty in obtaining raw material tissue. . In particular, human HG
In F, the only activity confirmed to date is only in the serum of patients with fulminant hepatitis. In order to use this human HGF for culturing liver parenchymal cells and for researching hepatocytes, and furthermore, as a therapeutic drug for liver disease, a large amount of polypeptides having the same activity as human HGF is supplied by applying gene recombination technology. It is desired to do.

[0006]

Means for Solving the Problems The present inventors have conducted intensive studies to solve the above-mentioned problems, and as a result, have found that rat platelet-derived H
C prepared from rat liver mRNA using an oligonucleotide synthesized based on the amino acid sequence of GF as a probe
It has been found that a cDNA containing a nucleotide sequence encoding a rat HGF polypeptide can be obtained from a DNA library. Furthermore, it has been found that a cDNA containing a nucleotide sequence encoding human HGF polypeptide can be obtained from a cDNA library prepared from human liver mRNA using the rat-derived cDNA as a probe. (Natur
e, 342 , 440, 1989).

[0007] Further, Northern hybridization with mRNAs derived from various human tissues excluding the liver was performed using a part or all of the cDNA derived from human liver as a probe, and the placenta and leukocyte mRNAs were also HGF-like. It was found that the presence of a transcript was observed. The present inventors have found that cDN prepared from leukocyte-derived mRNA
From the A library, a cDNA containing the nucleotide sequence encoding human HGF was isolated, the nucleotide sequence was clarified, a recombinant expression vector containing the cDNA was prepared, and the cDNA was transformed with the recombinant expression vector. A transformant is obtained, and the transformant is cultured to obtain human leukocyte-derived H
The present inventors have found that the GF gene is expressed and completed the present invention.

That is, the present invention relates to a recombinant expression vector capable of expressing a DNA containing a nucleotide sequence encoding human hepatocyte-derived hepatocyte growth factor, a transformant transformed with the recombinant expression vector, and a transformant. The present invention relates to a method for culturing a transformant, collecting and producing recombinant human leukocyte-derived hepatocyte growth factor from the culture, and a recombinant human leukocyte-derived hepatocyte growth factor.

The recombinant DNA expression vector encoding the human hepatocyte growth factor of the present invention and the transformant are prepared, for example, as follows. That is, (1) mRNA is isolated from human leukocytes, a cDNA library is prepared according to a conventional method, and (2) the human leukocyte-derived cDNA described above is probed with all or a part of the human liver-derived HGF cDNA already isolated. The library is screened, and the cDNA of interest is isolated from the isolated clone.
Is extracted. (3) cDN of this human leukocyte-derived HGF
A cDNA fragment encoding human HGF was excised from A using restriction enzymes, incorporated into an expression vector, and (4) a host cell was transformed with the obtained recombinant expression vector to obtain a transformant. By culturing the transformant, human leukocyte HGF can be collected from the culture supernatant and produced.

Hereinafter, each step of the present invention will be described in detail. 1) Isolation of mRNA and Northern Hybridization mRNA of human leukocytes can be obtained according to a conventional method. For example, according to the method of JM Chirgvin et al. Described in Biochemistry, 18 , 5294 (1979), RNA obtained from a solution of human leukocytes in guanidine thiocyanate is further subjected to liquid chromatography using an oligo dT cellulose column or to oligo dT The mRNA can be prepared by applying it to latex. Also,
Human leukocyte mRNA can also be purchased and used as a commercial product from Clontech. The mRNA thus obtained and c encoding human liver-derived HGF
Northern hybridization with DNA, for example,
Molecular cloning: ALaboratory Manual, Cold Sprin
g Harbor Laboratory, New York, 202 (1982).
As a probe, all or part of human liver-derived HGF cDNA can be labeled with ³² P and used.

2) Preparation of cDNA Using human erythrocyte mRNA, for which the presence of the HGF transcript has been confirmed as described above, as a template and reverse transcriptase,
H. Okayama et al. (Mol. Cell. Biol., 2, 161, 1982).
And Mol. Cell. Biol., 3, 280, 1983) or U. Gub.
cDNA according to the method of ler et al. (Gene, 25 , 263, 1983).
And a cDNA library can be prepared by incorporating this cDNA into a plasmid or phage. Plasmid vectors incorporating cDNA include pBR322 derived from Escherichia coli (Toyobo), pUC1
8 and pUC19 (Toyobo), pUB1 derived from Bacillus subtilis
10 (Sigma). These vectors are not limited to those exemplified here as long as they are conserved in the host cell and can be replicated and amplified. m
As a method for preparing a cDNA library by incorporating cDNA synthesized using RNA as a template into a plasmid or phage, the method of T. Maniatis et al.
ning, A Laboratory Manual, Cold Spring Harbor Labo
ratory, NewYork, 239, 1982) or the method of TV Hyunh et al. (DNA Cloning: A Practical Approach, 1, 49, 1985)
Can be exemplified. Similarly to mRNA, a human leukocyte cDNA library can be purchased and used as a commercial product from Clontech.

3) cDNA library screening The recombinant expression vector such as a plasmid or phage obtained as a cDNA library is maintained in a suitable host cell such as Escherichia coli. Examples of Escherichia coli that can be a host include Escherichia coli NM514, C600 (Stratagene), NM522, JM101 (Pharmacia) and the like. When the cDNA vector is a plasmid, it should be retained in host cells that have been grown in advance using the calcium chloride method, calcium chloride / rubidium chloride method, etc., and when the cDNA vector is a phage, using the in vitro packaging method, etc. (Molecular Cloning, Cold Spring Harbor Laborator
y, New York, 249, 1982). From the thus obtained transformants, a colony hybridization method (Gene, 10 , 63, 1980) and a plaque hybridization method (Science, 196, 180) were performed using a probe in which human liver-derived HGF cDNA was labeled with ³² P. , 1977)
A clone can be caught. In addition, using an antibody against the target polypeptide, the labeled antibody method (DNA
Cloning: A Practical Approach, 1, 49, 1985) can also be used to clone cDNA.

Next, the transformant is subjected to a conventional method (Molecular Cloning).
ning, A Laboratory Manual, ColdSpring Harbor Labor
atory, New York, 1982), a recombinant DNA such as a plasmid or phage is isolated, and the cDNA base sequence is determined as it is or after digestion with a restriction enzyme. The nucleotide sequence was determined by the Maxam and Gilbert chemical method (Proc. Natl. Aca
d. Sci. USA., 74 , 560, 1977) and the dideoxy method of Sanger (Proc. Natl. Acad. Sci. USA., 74 , 5463, 1977). Of the described mRNA and a part of the cDNA whose base sequence has been determined or a part of the cDNA
Using the NA as a primer, a new cDNA was synthesized by the primer extension method (Proc. Natl. Acad. Sci. USA., 76 , 731, 1979).
Recombinant D such as a plasmid or phage containing the second cDNA linked to the first cDNA from the NA library
It is possible to clone NA. This step of primer extension and cloning is repeated multiple times as necessary.

4) Construction of Recombinant Expression Vector for Human HGF Restriction enzymes from several types of recombinant vectors such as plasmids and phages containing cDNAs encoding all or a part of the amino acid sequence of cloned human leukocyte HGF. CDNA is cut out by human leukocyte-derived HG.
The recombinant expression vector can be prepared by religating downstream of the promoter of a vector suitable for expression of F using a restriction enzyme and DNA ligase. More specifically, in order to efficiently express human leukocyte-derived HGF, a recombinant expression vector is required in turn in the downstream direction of transcription as necessary (1) promoter, (2) ribosome binding site, (3) initiation codon, (4)
It is constructed to contain a DNA containing a base sequence encoding human leukocyte-derived HGF, (5) a stop codon, and (6) a terminator. Escherichia coli-derived plasmid pBR322 as a DNA vector that can be used in the present invention,
pUC18 (Toyobo), plasmid pU derived from Bacillus subtilis
B110 (Sigma), plasmid pRB1 derived from yeast
5 (ATCC 37062), bacteriophage λgt10, λ
gt11 (Stratagene), virus SV40 (B
RL), BPV (ATCC VR-703), vectors derived from retrovirus genes, and the like, but are not particularly limited as long as they can be replicated and amplified in a host. In particular, to easily express human leukocyte-derived HGF, S
It is preferable to use a vector derived from a virus gene such as V40. For example, a recombinant expression vector in which DNA encoding the above-mentioned cloned human leukocyte-derived HGF is ligated to the late region of the SV40 vector is introduced into a monkey cell line called COS cells (Cell, 23 , 175, 1981). It can be expressed by Regarding the promoter and terminator, the target human leukocyte-derived H
There is no particular limitation as long as it corresponds to the host used to express the base sequence encoding GF. For example, when the host is Escherichia coli, the promoter is trp promoter, lac promoter, or the like; when the host is Bacillus subtilis, the promoter is SPO1 promoter or SPO2 promoter;
When the host is an animal cell such as mouse fibroblast or Chinese hamster ovary cell,
Examples include the virus-derived SV40 promoter and HSV1TK promoter. When the host is Escherichia coli, the terminator is a trp terminator, lpp terminator, or the like; when the host is Bacillus subtilis, the amyF terminator is used; when the host is yeast, the CYC1 terminator is used; when the host is an animal cell, SV40 is used. A terminator, an HSV1TK terminator and the like can be exemplified. These promoters and terminators are appropriately combined depending on the host used. In the present invention, the DNA containing the nucleotide sequence encoding human leukocyte-derived HGF is not particularly limited as long as the polypeptide in which the DNA is expressed has hepatocyte proliferation activity. For example, the DNA may be a DNA having a base sequence in which a part of the base sequence is substituted, deleted, inserted, or a combination thereof. The DN containing a base sequence encoding human leukocyte-derived HGF
A may have ATG as a translation start codon and TAA, TGA, or TAG as a translation stop codon. If necessary, add a start codon or stop codon to one.
They may be arranged in combination of one or more or in combination with other codons, and are not particularly limited. Further, it is preferable that one or more of ampicillin resistance gene, neomycin resistance gene, DHFR gene, and the like, which can serve as a selection marker for a host transformed with the recombinant expression vector, be contained in an appropriate position of the vector.

5) Transformation of host cells and culture thereof The recombinant expression vector of human HGF leukocyte thus constructed is prepared by the competent cell method (J. Mol. Biol., 53, 1).
54, 1970), the protoplast method (Proc. Natl. Acad. Sc)
i. USA, 75 , 1929, 1978) Calcium phosphate method (Scienc
e, 221 , 551, 1983) DEAE dextran method (Science,
215 , 166, 1983), the electric pulse method (Proc. Natl. Acad.
USA, 81, 7161 , 1984), in vitro packaging method (Proc. Natl. Acad. Sci. USA, 72, 581, 1975), viral vector method (Cell, 37 , 1053, 1984), or microinjection method (Exp Cell. Res., 153 , 34
7, 1984) to produce a transformant. At this time, Bacillus subtilis, yeast, animal cells and the like are used as hosts in addition to the above-mentioned Escherichia coli. In particular, mouse fibroblast C127 (J. Virol., 26, 291, 1978) and Chinese hamster ovary cell CHO (Proc. Natl. Aca
d. Sci. USA, 77 , 1929, 1978). The resulting transformant is cultured in an appropriate medium according to the host in order to produce the desired recombinant human leukocyte HGF. The medium contains a carbon source, a nitrogen source, an inorganic substance, a vitamin, a serum, a drug and the like necessary for growth of the transformant. As an example of the culture medium, when the host of the transformant is E. coli,
B medium (Nissui Pharmaceutical) M9 medium (J. Exp. Mol. Genet., Co.)
ld Spring Harbor Laboratory, New York, 1972, p. 43
1) When the host is yeast, YEPD medium (Genetic
Engineering, vol. 1, Plenum Press, New York, 1979,
p.117), when the host is an animal cell, a MEM medium containing 20% or less of fetal bovine serum, a DMEM medium,
PMI1640 medium (Nissui Pharmaceutical) and the like can be mentioned. Culture of the transformant is usually performed at 20 ° C. to 45 ° C. and at a pH of 5 to 8, and aeration and stirring are performed as necessary. When the host is an adhesive animal cell, a carrier such as glass beads, collagen beads, or acetyl cellulose follow fiber is used. The method can be carried out as long as the transformant grows under a medium composition or culture conditions other than those described above, and is not limited thereto.

6) Purification of human HGF Recombinant human leukocyte HGF produced in the culture supernatant of the transformant or in the transformant as described above can be purified by a known salting-out method, solvent precipitation method, dialysis method, or the like. Separation and purification can be performed by external filtration, gel electrophoresis, or a combination of gel filtration chromatography, ion exchange chromatography, reverse phase chromatography, affinity chromatography, and the like. In particular, salting out method using ammonium sulfate, S-
Sepharose ion chromatography, a combination of heparin sepharose affinity chromatography and phenyl sepharose reverse phase chromatography, or a combination of ammonium sulfate salting out method, S-sepharose ion chromatography, and anti-HGF antibody Sepharose affinity chromatography are preferred and effective purification methods. . The recombinant human leukocyte-derived HGF obtained by the above-described method showed an activity of remarkably promoting the proliferation of rat liver parenchymal cells, similar to rat liver, rat platelets, and recombinant human liver-derived HGF.

7) Measurement of HGF activity HGF activity was determined by the method described in Proc. Natl. Acad. Sci. USA, 80 , 7229.
(1983) according to the method described in the following. Hepatocytes were separated and purified from Wistar rats by collagenase reflux. The obtained rat liver parenchymal cells were subjected to 5% bovine serum, 2 × 10 ⁻⁹ M insulin and 2 × 10 ^9
The cells were suspended in a Williams E medium (Flow Laboratories) supplemented with ^-9 M dexamethasone, and seeded on a 24-well multiplate at a concentration of 1.25 × 10 ⁵ cells / well. 5%
In the presence of CO ₂ and 30% O ₂ and 65% N ₂ , 3
After culturing at 7 ° C. for 20 hours, the medium was replaced with a Williams E medium supplemented with 0.1 μg / ml of aprotinin, and at the same time, a predetermined amount of a test sample was added. After 15 hours, 15 μCi / ml
Of ¹²⁵ I deoxyuridine was added at 10 μl / well. The control group received 5 μg / ml aphidicolin 15 minutes before the addition of ¹²⁵ I-deoxyuridine. After further incubation for 4 hours, the ^cells were labeled with ¹²⁵ I. Cells
After washing twice with PBS of pH 7.4, the cells were fixed with a cold 10% aqueous solution of trichloroacetic acid (TCA). The cells were solubilized with 0.5 ml of 1N aqueous sodium hydroxide solution per well, and the radioactivity was measured by a gamma counter. Also, a part of the sample after radioactivity measurement was taken and subjected to the Lowry method (J. Biol. C
193, 265, 1951). The amount of ¹²⁵ I incorporated into the hepatic parenchyma cells when the test sample was added was determined as the difference in count from the control, and this was converted to 1 mg of rat hepatic parenchymal protein to obtain DNA.
Synthetic activity (dpm / mg protein). H of test sample
GF activity was measured in the same test as epidermal growth factor (EG
F) The activity corresponding to 50% of the DNA synthesizing activity of the hepatic parenchymal cells when 10 ng / ml was used was defined as one unit and displayed.

[0018]

Industrial Applicability According to the present invention, it becomes possible to supply a large amount of a novel physiologically active peptide which enables the proliferation of hepatocytes in vitro. The recombinant human leukocyte-derived HGF supplied by the present invention is useful as a clinical diagnostic reagent or a therapeutic agent for liver disease. In addition, the hepatic parenchymal cells produced and maintained by the action of the recombinant human leukocyte-derived HGF produced by the present invention can be used, for example, for the study of the action of various hormones and drugs on hepatic parenchymal cells for basic research on hepatic function, for carcinogenesis of liver cancer It is extremely useful as a host cell for research or for in vitro culture of hepatitis virus.

[0019]

EXAMPLES The present invention will be described in more detail with reference to the following examples, but the present invention is not limited to these examples.

Example 1 1) Northern hybridization of human tissue mRNA and human liver-derived HGF cDNA mRNA of human brain, placenta, leukocyte, lung, and liver (Clontech) (2 μg each) was obtained according to the method of Maniatis et al.
cular Cloning: A Laboratory Manual, ColdSpring Ha
rbor Laboratory, New York, 202, 1982).
After subjecting it to agarose electrophoresis containing 66 M formaldehyde, it was fixed on a nylon filter Genescreen Plus (DuPont). HGFcD derived from human liver
A 2.2 kb BamHI-KpnI fragment of NA was separated and purified by agarose gel electrophoresis,
[Α ³² P] d using A-labeling system (Amersham)
Probe prepared by labeling with CTP, 5 × S
SPE buffer (1 × SSPE: 180 mM NaCl
10 mM sodium phosphate, 1 mM EDTA, pH
6.8) 5x Denhardt's solution, 10% dextran sulfate, 40% formaldehyde, 0.1% SDS, 0.1
The nylon filter was immersed in a hybridization solution comprising mg / ml E. coli DNA, and subjected to a hybridization reaction at 42 ° C. for 16 hours. After the reaction, the nylon filter was washed three times with 1 × SSC buffer containing 0.1% SDS at 60 ° C. and then air-dried. This nylon filter is intensified with Screen Lightning Plus (DuPont) and X-ray film, RX (Fuji Photo Film)
And exposed at -80 ° C for 16 hours. As a result of development, the presence of HGF-like transcripts was observed in placenta and leukocyte mRNA as well as liver mRNA.

2) Preparation of cDNA library derived from human leukocytes
^{5 '} ACATT contained in the 3' untranslated region of GF cDNA
Using an oligonucleotide having the nucleotide sequence of CTCTGAAATCTTCAT ^{3 '} as a primer, cDNA was synthesized according to the method of Gubler et al. (Gene, 25 , 263, 1983) using cDNA synthesis system plus (Amersham). cDNA is phenol / chloroform (1: 1, V
/ V) after purification by extraction and ethanol precipitation;
Dissolve in 10 mM Tris-HCl buffer (abbreviated as STE buffer) containing 5 M NaCl and 1 mM EDTA;
7 μg / 20 μl. This cDNA was obtained using the cDNA cloning system λgt10 (Amersham).
Huynh et al. (DNA Cloning I, APractical Appro
ach, 1 , 49, 1982) and cloned into the EcoRI site of λgt10 as follows. EcoRI adapters were added to both ends of the cDNA using T4 DNA ligase. The reaction solution was applied to a gel filtration column for cDNA purification equilibrated with an STE buffer, and eluted with the same buffer to collect 500 μl of a cDNA fraction. After ethanol precipitation was repeated twice by a conventional method, the residue was dried under reduced pressure to obtain a linker-added cDNA. Again 50 ng / μ in STE buffer
After dissolving at a concentration of l, the previously prepared λgt
0.1 μg of adapter-added cDNA to 1 μg of 10 arms
Was inserted using T4 DNA ligase. This reaction solution was treated with cold ethanol and then dried lightly to obtain recombinant D.
The total amount of NA was changed to 10 mM containing 5 μl of 1 mM EDTA.
It was dissolved in Tris-HCl buffer pH 7.5 (abbreviated as TE buffer). This recombinant DNA was subjected to an in vitro packaging reaction to obtain a λgt10 recombinant phage. The number of recombinant phages obtained from 1 μg of cDNA measured by titration using Escherichia coli for phage plating was 5.0 × 10 ⁶ . C prepared in this way
The DNA library was prepared using an SE buffer (100 mM NaCl, 10 mM
It was stored at 4 ° C. in 20 mM Tris-HCl buffer (pH 7.5) containing MgSO ₄ and 0.01% gelatin.

3) cDNA of HGF gene derived from human leukocyte
Of Human Liver HG Labeled with [α ³² P] dCTP Using Multiprime DNA Labeling System (Amersham)
0.2 kb Ec of HAC69 which is part of FcDNA
Using the oRI fragment as a probe, the human leukocyte-derived HGF gene was cloned from the above cDNA library. Set the hybridization reaction temperature and washing temperature to 6
At 0 ° C., the washing solution was 2 × SSC buffer containing 0.1% SDS, and screening was performed to obtain positive clones HLC2 and HLC3. HLC2 and HLC3 cDNA isolated and purified from each phage by a conventional method were subjected to nucleotide sequence analysis and restriction enzyme cleavage analysis. Figure 1 shows HLC3
SEQ ID NO: 1 shows a part of the base sequence and the deduced amino acid sequence. Human leukocyte-derived H
The GF clone, HLC3, has the same characteristics as the previously determined human liver-derived HGF (Nature, 342, 440, 1989), but there are 38 differences in the nucleotide sequence within the coding region, resulting in deduction. There were 14 differences in the amino acid sequence obtained. HLC2 cDNA is HLC3cDN.
A has almost the same nucleotide sequence as A, but HLC3cD
The nucleotides from position 484 to position 498 of NA were deleted (SEQ ID NO: 2).

4) Human leukocyte-derived HG for monkey COS cells
Construction of F expression vector Human HGF expression vector CDM for monkey COS cells [dL
eHGF] and CDM [LeHGF] are shown in FIG.
Shown in The HLC2 and HLC3 phage DNAs obtained in 3) above are digested with restriction enzymes BamHI and KpnI,
A 2.2 kb DNA fragment was separated and purified. Oligonucleotide ^{5 '} CACAGTCATAGCTG consisting of KpnI cleavage site of HLC2 and HLC3, sequence contained on the 3' side thereof and HpaI, SmaI and SalI cleavage sites
TTAACCCGGG ³ ', ^5' TCGACCCGGGTT
AACAGCTATGACTGTGGTAC ^{3 ′} was synthesized and used as a KpnI-SalI adapter. HLC above
BamHI-KpnI DNA fragments of HLC2 and HLC3,
Bluescript KS previously digested with KpnI-SalI adapter and restriction enzymes BamHI and SalI
M13 + (Stratagene) were mixed and ligated with T4 DNA ligase to give two types of plasmid pBS [dLeH
GF] and pBS [LeHGF] were obtained. Obtained pB
S [dLeHGF] and pBS [LeHGF] were digested with restriction enzymes BamHI and SalI and blunt-ended with T4 DNA polymerase.
Digested with T4 DNA polymerase and blunt-ended with T4 DNA polymerase
Expression vector CDM8 for S cells (Nature, 329, 840, 19
87) and ligated with T4 DNA ligase to obtain human leukocyte-derived HGF expression vectors CDM [dLeHGF] and CDM [LeHGF].

5) Transformation of monkey COS cells and expression of HGF gene derived from human leukocyte The obtained CDM [dLeHGF] and CDM [LeHG
F] After ethanol precipitation of the plasmid, 10 mM PB
It was dissolved in S buffer and adjusted to 2 μg / ml. Then 10%
COS-1 cells (ATCC CRL-1650) grown to a saturated cell density in a DMEM medium (Nissui Pharmaceutical) containing fetal bovine serum (Gibco) were washed twice with 10 mM PBS buffer and then treated with trypsin. After washing three times with the same buffer, the cells were resuspended in the same buffer to a cell density of 2 × 10 ⁷ cells / ml. 250 μl of the previously prepared plasmid solution and 250 μl of the cell suspension were mixed and allowed to stand under ice cooling for 10 minutes. Using this ice-cooled plasmid cell mixture high voltage pulse gene transfer apparatus ZA-1200 (PDS), a high voltage pulse was applied under the conditions of an applied voltage of 4 KV / 1 cm and a pulse time of 20 ms. The obtained cells were diluted with the above medium,
The cells were cultured at 7 ° C. in the presence of 5% CO _{2 for} 3 days. When the HGF activity in the culture supernatant on the third day of the culture was measured, they were 20 units / ml and 5 units / ml, respectively. On the other hand, HGFc
The expression vector CDM8 into which no DNA was inserted was introduced into COS-1 cells by the same method and cultured, but no HGF activity was observed in the culture supernatant.

Example 2 1) Construction of Human Leukocyte-Derived HGF Expression Vector for Mouse C127 Cells Human Leukocyte-Derived HGF Expression Vector pBPMT [LeHGF] for Mouse C127 Cells
No.) and pBPMT [dLeHGF]
No. 898) is shown in FIG. Plasmids pBS [LeHGF] and pBS [dLeHG obtained in Example 1
F] is digested with restriction enzymes XbaI and SalI, respectively.
After blunt-ending with T4 DNA polymerase, the mixture was mixed with the expression vector pBPMT for C127 cells previously digested with the restriction enzyme EcoRV, and ligated with T4 DNA ligase to bind to the human HGF expression vector pBPMT [LeHGF].
(Microtechnical Laboratory No. 2897) and pBPMT [dLeH
GF] (Microtechnical Laboratory No. 2898). The obtained human leukocyte-derived HGF expression vector has a human leukocyte-derived HGF gene between the MT-1 promoter and the poly (A) addition signal of the SV40 early gene. Transformation of mouse C127 cells with this expression vector is It is performed by papilloma virus (BPV). In addition, the selection of the transformed cells is performed by adding the herpes simplex virus type 1 thymidine kinase (HSV1T) to the neo gene of the transposon Tn5 (Gene, 19 , 329, 1982).
K) This can be achieved by a neo chimeric gene in which a promoter derived from a gene and a poly (A) additional signal are linked.

2) Transformation of mouse C127 cells and expression of human HGF gene Human leukocyte-derived HGF expression vector pBPMT [LeH
GF] (Microtechnical Laboratory No. 2897) and pBPMT [d
LeHGF] (Microtechnical Laboratories No. 2898) was introduced into mouse C127 cells by the method of Wigler et al. (Cell, 11 , 223, 1977). 29 μg of pBPMT obtained in the above (1)
[LeHGF] (Microtechnical Co., Ltd. No. 2897) Plasmid and pBPMT [dLeHGF] (Microtechnical Co., Ltd. No. 28)
No. 98) were dissolved in 240 μl each of 0.5 M calcium chloride, and 20 mM HEPES, 280 mM Na
2 × HE consisting of Cl and 1.5 mM sodium phosphate
240 μl of PES buffer (pH 7.1) was added with stirring. Stirring was continued at room temperature for 30 minutes to form a coprecipitate of plasmid and calcium phosphate. In advance, 5 × 10 ⁵ C127 cells were cultured at 37 ° C. for 24 hours in the presence of 5% CO ₂ using a DMEM medium (Nissui Pharmaceutical) supplemented with 10% fetal bovine serum (Gibco) and 10 mM glutamine. did. After replacing the medium, the plasmid and calcium phosphate coprecipitate were added, and the mixture was left at room temperature for 20 minutes. 3 more
After 4 hours incubation at 7 ° C., the medium was removed and
1 × HEPES buffer supplemented with 5% glycerin was added and left at room temperature for 5 minutes. After washing the cells with medium,
The medium was changed, and further incubated at 37 ° C. for 2 days.
The cells were diluted 10-fold and incubated in the same medium containing 1 mg / ml G418 (Sigma) in the presence of 5% CO _2.
The cells were cultured at 7 ° C. for 7 days to obtain transformed cells. From the obtained cell line, cells having high HGF activity in the culture supernatant were screened by the limiting dilution method, and a human leukocyte-derived HGF high producing strain B was screened.
PI-14 strain (pBPMT [LeHGF] (Microtechnical Research Institute No. 2897)) and BPD-27 strain (pBPMT [d
LeHGF] (Microtechnical Laboratory No. 2898)). The HGF producing ability of the culture supernatant of these cells was 12
10,000 units / l / day and 150,000 units / l / day.

Example 3 1) Construction of Human Leukocyte-Derived HGF Expression Vector for Chinese Hamster CHO Cells Human Leukocyte-Derived H for Chinese Hamster CHO Cells
GF expression vector pEVSSV [LeHGF] (Micro Engineering Laboratories No. 2899) and pEVSSV [dLeHGF]
FIG. 4 shows a construction diagram of (Microtechnical Laboratory No. 2900). The plasmids pBS [LeHGF] and pBS [dLeHGF] obtained in Example 1 were digested with restriction enzymes XbaI and SalI, respectively, blunt-ended with T4 DNA polymerase, and then digested with the restriction enzyme EcoRV.
Mix with HO cell expression vector pEVSSV, T4D
HGF expression vector derived from human leukocyte pEVSSV [LeHGF] by binding with NA ligase
No. 9) and pEVSSV [dLeHGF] (Microtechnical Laboratory No. 2900). The obtained human leukocyte-derived HGF
The expression vector contains the SV40 early promoter and poly (A)
It has the human leukocyte-derived HGF gene between the additional signals. In addition, the transformed cells were selected by using a mouse dihydrofolate reductase (DHFR) gene linked to an SV40 early promoter and a poly (A) additional signal by a DHFR gene.
This is made possible by the chimeric gene.

2) Transformation of Chinese hamster CHO cells and expression of human leukocyte-derived HGF gene Human leukocyte-derived HGF expression vector pEVSSV [Le
HGF] (Microtechnical Research Institute No. 2899) and pEVSSV
[DLeHGF] (Microtechnical Laboratories No. 2900) was prepared in the same manner as in Example 2 except that D
HFR-deficient CHODUX cells were introduced. The resulting cell line was free of ribonucleosides and deoxyribonucleosides, and was dialyzed against 10% dialyzed fetal bovine serum (Gibco).
Α-M containing 50% glutamine and 50 nM methotrexate
Using an EM medium (Flow Laboratory), cells with high HGF activity in the culture supernatant were screened by the limiting dilution method. The resulting colonies were stable human leukocyte-derived H
In order to obtain a high GF-producing strain, the cells were grown up to 9 generations in the same medium. This cell line is 100 nM, 250 nM, 5
Growth was performed in the same medium while increasing the concentration of methotrexate to 00 nM, 750 nM, and 1000 nM, and a stable human leukocyte-derived HGF-high producing strain EVI-65 was obtained.
Strain (pEVSSV [LeHGF]
No. 9)) and EVD-104 strain (pEVSSV [dLe
HGF] (Microtechnical Laboratory No. 2900)). The human leukocyte-derived HGF-producing ability of these cells was 90,000 units / l / day and 130,000 units / l / day, respectively.

Example 4 Purification of Recombinant Human Leukocyte-Derived HGF from Cultured Supernatant C127 Cell Supernatant HGF-producing mouse C obtained in Example 2
127 recombinant cell line BPD-27 (15 base deleted HGF
HGF derived from recombinant human leukocytes from the culture supernatant of
Was purified. 1) Cation exchange chromatography Tween 80 was added to a final concentration of 0.01% to 500 ml of a culture solution of BPD-27 strain, and Sterivex HV was added.
The mixture was filtered with a filter (Nippon Millipore Limited). 1/20 volume of 1 M Tris · HCl (pH 8.
5) Add buffer and add buffer A (50 mM Tris.HCl, 1
0 mM Hepes, 2 mM CaCl ₂ , 150 mM NaCl,
It was added to S-Sepharose FF (manufactured by Pharmacia, column size inner diameter 1.6 cm, height 5 cm) equilibrated with 0.01% Tween 80, pH 8.5). After washing the unadsorbed substance with the buffer A, the adsorbed substance was eluted with a linear concentration gradient (100 ml in total) of 0.15 M to 1.0 M NaCl.
FIG. 5 shows the chromatographic pattern. Fractions having HGF activity were collected and used as S-Sepharose eluate.

2) Affinity chromatography The S-Sepharose eluate was adjusted to pH 7.5 with 1N acetic acid, and then diluted with 2 volumes of distilled water containing 0.01% Tween 80 to obtain a buffer B (10 mM Tris.HCl, 0.3M NaC
l, 0.01% Tween 80, pH 7.5). Heparin Sepharose CL-6B (manufactured by Pharmacia, column diameter 1 cm, height 3 cm). After washing the column with buffer B, 0.3M to 2.0M
Was eluted with a linear concentration gradient of NaCl (30 ml in total). FIG. 6 shows the chromatographic pattern. Fractions having HGF activity were collected and used as a heparin eluate.

3) Reversed phase HPLC A phenyl 5PW RP column (manufactured by Toso, 0.75 cm inside diameter, 7.5 cm height) equilibrated with distilled water containing 0.1% TFA (trifluoroacetic acid, v / v%) ), Add heparin eluate and add 0% to 90% with 0.1% TFA
Elution was performed with a gradient of acetonitrile. Recombinant human leukocyte-derived HGF was eluted at an acetonitrile concentration of about 40%. The chromatogram is shown in FIG.
The yield of purified recombinant human HGF is about 20 μg,
The activity recovery rate from the culture supernatant was 18%.

4) SDS-Polyacrylamide Electrophoresis SGF-polyacrylamide electrophoresis of HGF derived from a 15-base deletion human recombinant leukocyte purified by the above three-stage chromatography under reduction and non-reduction of 2-mercaptoethanol To FIG. 8 shows the results. Purified recombinant HGF shows a single band with a molecular weight of 70,000 to 90,000 under non-reducing conditions (2-ME (-)), and a molecular weight of 60,000 to 7.5 under reducing conditions (2-ME (+)). It was divided into 10,000 α chains and β chains with a molecular weight of 30,000 to 40,000. That is, it was shown that the recombinant HGF was a heterodimer composed of an α chain and a β chain.

5) Hepatocyte Proliferation Activity of Recombinant Human Leukocyte-Derived HGF (15 Base Deletion Type) Rat primary cultured hepatocytes are known in vitro.
It has the liver function closest to in vivo among the ro systems. When purified HGF derived from a recombinant 15-base deletion human leukocyte was added to rat liver parenchymal cells obtained according to the method described in "Method for measuring HGF activity", 1-20 n
Strong cell growth was induced at a concentration of g / ml. Other factors that exhibit growth activity in this culture system include insulin and EGF
However, the recombinant HGF alone had a stronger activity than both, and showed an additive effect in the presence of these three.

Example 5 Transformation of Chinese hamster CHO cells with human leukocyte-derived HGF gene and its expression Human human leukocyte-derived HGF expression vector pEVSSV (dL
eHGF) (Microtechnical Laboratories No. 2900) was introduced into DHFR-deficient Chinese hamster CHO cells by the method of Wigler et al. (Cell, 11, 233, 1977). About 30μ
g of pEVSSV (dLeHGF) plasmid was dissolved in 240 μl of 0.5 M calcium chloride, and
240 μl of 2 × HEPES buffer (pH 7.1) consisting of mM HEPES, 280 mM sodium chloride and 1.5 mM sodium phosphate was added with stirring. Stirring was continued at room temperature for 30 minutes to form a coprecipitate of the plasmid and calcium phosphate. Subsequently, 5 × 10 ⁵ C-cells were prepared using an α-MEM medium (Flow Laboratories) containing 10% fetal bovine serum (Gibco) and 1% glutamine.
HO cells were cultured at 37 ° C. for 24 hours in the presence of 5% CO ₂ . After the medium was replaced, the plasmid and calcium phosphate co-precipitated were added and left at room temperature for 20 minutes. After further incubation at 37 ° C. for 4 hours, the medium was removed, and 1 × HEPES buffer supplemented with 15% glycerin was added.
Let stand for minutes. After washing the cells with the medium, the medium was replaced and the cells were further cultured at 37 ° C. for 7 days to obtain transformed cells. The obtained cell line does not contain ribonucleoside and deoxyribonucleoside, and is a stable HGF high-producing strain using a dialyzed 10% fetal bovine serum (Gibco) and an α-MEM medium (Flow Laboratories) containing 2% glutamine. 100 nM, 250 nM, 500 nM, 750 n to obtain
Subculture was repeated in the same medium while sequentially increasing the concentrations of M, 1 μM, 2 μM and methotrexate. The obtained human leukocyte-derived HGF-producing recombinant cells were subjected to clone selection to obtain a stable human leukocyte-derived HGF-producing strain 515C. The HGF producing ability of these cells is about 800,000 units / l /
It was a day.

Example 6 Purification of Recombinant Human Leukocyte-Derived HGF from Cultured Supernatants of Transformed CHO Cells The human leukocyte-derived HGF-producing Chinese hamster CHO recombinant cell line 515C (15-base deleted HGF) obtained in Example 5 Producing strain) was cultured in an α-MEM medium (Flow Laboratories) containing 10% fetal bovine serum (Gibco), 1% glutamine and 2 μM methotrexate without ribonucleoside and deoxyribonucleoside, and from the culture supernatant. The recombinant human leukocyte-derived HGF was purified. 1) Cation exchange chromatography Tween 80 was added to a final concentration of 0.01% to 500 ml of a culture solution of the 515C strain, and the mixture was filtered with a Sterivex HV filter (Nippon Millipore Limited. 1/20 volume of the filtrate). 1M Tris.HCl (pH 8.
5) Add buffer and add buffer C containing 150 mM NaCl (50 mM Tris.HCl, 0.01% Tween 8
0, pH 8.5) S-Sepharose FF
(Manufactured by Pharmacia, column size inner diameter 1.6 cm, height 5 cm). Buffer C column with 150 mM Na
1 M Na after washing with buffer C containing Cl and buffer C containing 400 mM NaCl (marked by arrow A in FIG. 9).
Elution was carried out with buffer C containing Cl (marked by arrow B in FIG. 9). FIG. 9 shows the chromatographic pattern. The peaks eluted with buffer C containing 1 M NaCl (marked ← → in FIG. 9) were collected and used as S-Sepharose eluate.

2) Affinity chromatography The S-Sepharose eluate was adjusted to pH 7.5 with 1N hydrochloric acid, and then diluted with 2 volumes of distilled water containing 0.01% Tween 80 to obtain buffer B (10 mM Tris · HCl). , 0.3M
Heparin Sepharose CL-6B (Pharmacia, column size 1 cm inside diameter, height 5 cm) equilibrated with sodium chloride, 0.01% Tween 80, pH 7.5) was added. After washing the column with buffer B, 0.3M to 2.
Linear concentration gradient with 0M sodium chloride (total volume 40m
The adsorbate was eluted by l). FIG. 10 shows the chromatographic pattern. Fractions having HGF activity were collected and used as a heparin eluate.

3) Hydrophobic chromatography 20 mM phosphate buffer containing 4 M NaCl (pH 7.0)
0) equilibrated phenyl 5PW column (manufactured by Tosoh,
Heparin eluate was added to an inner diameter of 0.75 cm and a height of 7.5 cm). From solvent A: 20 mM phosphate buffer (pH 7.0) containing 4 M sodium chloride to solvent B: 20 mM phosphate containing 50% ethylene glycol Elution was performed with a concentration gradient in a buffer solution (pH 7.0). HGF activity is 2M N
eluted at aCl, 25% ethylene glycol concentration.
The chromatogram is shown in FIG. The yield of purified recombinant human leukocyte-derived HGF was about 500 μg, and the activity recovery rate from the culture supernatant was 25%.

4) Properties of Purified Recombinant Human Leukocyte-Derived HGF The biological, chemical and physicochemical properties of the recombinant human leukocyte-derived HGF obtained in the section 3) were measured. SDS-polyacrylamide electrophoresis SDS-polyacrylamide electrophoresis was performed on the recombinant HGF under 2-mercaptoethanol reduction and non-reduction. After the electrophoresis, the gel was stained by the silver staining method, and the result is shown in FIG. Recombinant HGF was separated into an α chain having a molecular weight of 60,000 to 75,000 and a β chain having a molecular weight of 30,000 to 40,000 under non-reducing conditions. Also, the β chain was divided into two bands, indicating the difference in the number of linked sugar chains in the β chain.

Sugar composition and analysis (neutral sugar and amino sugar) The purified recombinant HGF was evaporated to dryness and then hydrolyzed at 110 ° C. for 6 hours in the presence of 2.5N trifluoroacetic acid. After the hydrolyzate was evaporated to dryness, it was redissolved in water to obtain a sample. The sample was analyzed for sugar composition and analysis by HPLC using an anion exchange resin. As a result, fucose, galactose, mannose and N-acetylglucosamine were detected, and recombinant HGF was detected.
Was confirmed to be a glycoprotein.

Biological activity The hepatocyte proliferation activity of the purified recombinant HGF was measured according to the method described in the section "Measurement of HGF activity". As a result, the specific activity of the purified recombinant HGF was determined to be 200,000 to 500,000 unit / mg.

Example 7 Production of single-chain recombinant human leukocyte-derived HGF The human leukocyte-derived HGF (15-base deleted HGF) -producing CHO515C strain obtained in Example 5 was subjected to 10% fetal bovine serum (Gibco). And 1% glutamine and 2 μM methotrexate. The cells were cultured at 37 ° C. under 5% CO ₂ in an α-MEM medium (Flow Laboratories) containing neither ribonucleoside nor deoxynucleoside until the cells became confluent. After the culture, the culture solution was removed, and the cells were washed twice with PBS. Next, an α-MEM medium (containing no ribonucleoside and deoxynucleoside) supplemented with 1% glutamine, 500 μM methotrexate and 400 unit / ml aprotinin as a protease inhibitor was added, and the mixture was cultured at 37 ° C. under 5% CO ₂ . After culturing for about 1 day,
The culture supernatant was collected, and the recombinant HGF was purified by the same chromatography procedure as in Example 6. The activity recovery from the culture supernatant was about 15%.

The purified HGF derived from a 15-base deletion recombinant human leukocyte was subjected to SDS-acrylamide electrophoresis.
The result is shown in FIG. The purified recombinant HGF shows a band with a molecular weight of 70,000 to 90,000 daltons under non-reducing conditions,
In addition, a single band having a molecular weight of 80,000 to 95,000 daltons was shown under mercaptoethanol reduction conditions.

As a result, it was shown that the obtained recombinant HGF was of a single-chain type. The biological activity of the purified single-chain recombinant HGF was measured. That is, the proliferation activity on the primary cultured rat hepatocytes described in the section "Measurement of HGF activity" was measured. As a result, the single-chain recombinant HGF exhibited hepatocyte proliferation activity, and its specific activity was almost equal to the activity obtained in section 4) of Example 6, and was determined to be 20 to 500,000 unit / mg. Was.

[0044]

[Sequence list] SEQ ID NO: 1 Sequence length: 2214 Sequence type: Nucleic acid Number of strands: Double strand Topology: Linear Sequence type: cDNA Origin Organism name: Human Sequence characteristics Characteristic sign: sig Peptide Location: 1-93 Characteristic determination method: E Symbol indicating feature: CDS Location: 1-2184 Method for characteristic determination: E Sequence GGATCCG CCAGCCCGTC CAGCAGCACC-1 ATG TGG GTG ACC AAA CTC CTG CCA GCC CTG CTG CTG CAG CAT GTC CTC 48 Met Trp Val Thr Lys Leu Leu Pro Ala Leu Leu Leu Gln His Val Leu 1 5 10 15 CTG CAT CTC CTC CTG CTC CCC ATC GCC ATC CCC TAT GCA GAG GGA CAA 96 Leu His Leu Leu Leu Leu Pro Ile Ala Ile Pro Tyr Ala Glu Gly Gln 20 25 30 AGG AAA AGA AGA AAT ACA ATT CAT GAA TTC AAA AAA TCA GCA AAG ACT 144 Arg Lys Arg Arg Asn Thr Ile His Glu Phe Lys Lys Ser Ala Lys Thr 35 40 45 ACC CTA ATC AAA ATA GAT CCA GCA CTG AAG ATA AAA ACC AAA AAA GTG 192 Thr Leu Ile Lys Ile Asp Pro Ala Leu Lys Ile Lys Thr Lys Lys Val 50 55 60 AAT ACT GCA GAC CAA TGT GCT AAT AGA TGT ACT AGG AAT AAA GGA CTT 240 Asn Thr Ala Asp Gln Cys Ala Asn Arg Cys Thr Arg Asn Lys Gly Leu 65 70 75 80 CCA TTC ACT TGC AAG GCT TTT GTT TTT GAT AAA GCA AGA AAA CAA TGC 288 Pro Phe Thr Cys Lys Ala Phe Val Phe Asp Lys Ala Arg Lys Gln Cys 85 90 95 CTC TGG TTC CCC TTC AAT AGC ATG TCA AGT GGA GTG AAA AAA GAA TTT 336 Leu Trp Phe Pro Phe Asn Ser Met Ser Ser Gly Val Lys Lys Glu Phe 100 105 110 GGC CAT GAA TTT GAC CTC TAT GAA AAC AAA GAC TAC ATT AGA AAC TGC 384 Gly His Glu Phe Asp Leu Tyr Glu Asn Lys Asp Tyr Ile Arg Asn Cys 115 120 125 ATC ATT GGT AAA GGA CGC AGC TAC AAG GGA ACA GTA TCT ATC ACT AAG 432 Ile Ile Gly Lys Gly Arg Ser Tyr Lys Gly Thr Val Ser Ile Thr Lys 130 135 140 AGT GGC ATC AAA TGT CAG CCC TGG AGT TCC ATG ATA CCA CAC GAA CAC 480 Ser Gly Ile Lys Cys Gln Pro Trp Ser Ser Met Ile Pro His Glu His 145 150 155 160 AGC TTT TTG CCT TCG AGC TAT CGG GGT AAA GAC CTA CAG GAA AAC TAC 528 Ser Phe Leu Pro Ser Ser Tyr Arg G ly Lys Asp Leu Gln Glu Asn Tyr 165 170 175 TGT CGA AAT CCT CGA GGG GAA GAA GGG GGA CCC TGG TGT TTC ACA AGC 576 Cys Arg Asn Pro Arg Gly Glu Glu Gly Gly Pro Trp Cys Phe Thr Ser 180 185 190 AAT CCA GAG GTA CGC TAC GAA GTC TGT GAC ATT CCT CAG TGT TCA GAA 624 Asn Pro Glu Val Arg Tyr Glu Val Cys Asp Ile Pro Gln Cys Ser Glu 195 200 205 GTT GAA TGC ATG ACC TGC AAT GGG GAG AGT TAT CGA GGT CTC ATG GAT 672 Val Glu Cys Met Thr Cys Asn Gly Glu Ser Tyr Arg Gly Leu Met Asp 210 215 220 CAT ACA GAA TCA GGC AAG ATT TGT CAG CGC TGG GAT CAT CAG ACA CCA 720 His Thr Glu Ser Gly Lys Ile Cys Gln Arg Trp Asp His Gln Thr Pro 225 230 235 240 CAC CGG CAC AAA TTC TTG CCT GAA AGA TAT CCC GAC AAG GGC TTT GAT 768 His Arg His Lys Phe Leu Pro Glu Arg Tyr Pro Asp Lys Gly Phe Asp 245 250 255 GAT AAT TAT TGC CGC AAT CCC GAT GGC CAG CCG AGG CCA TGG TGC TAT 816 Asp Asn Tyr Cys Arg Asn Pro Asp Gly Gln Pro Arg Pro Trp Cys Tyr 260 265 270 ACT CTT GAC CCT CAC ACC CGC TGG GAG TAC TGT GCA ATT AAA ACA TGC 864 Thr Leu Asp Pro HisThr Arg Trp Glu Tyr Cys Ala Ile Lys Thr Cys 275 280 285 GCT GAC AAT ACT ATG AAT GAC ACT GAT GTT CCT TTG GAA ACA ACT GAA 912 Ala Asp Asn Thr Met Asn Asp Thr Asp Val Pro Leu Glu Thr Thr Glu 290 295 300 TGC ATC CAA GGT CAA GGA GAA GGC TAC AGG GGC ACT GTC AAT ACC ATT 960 Cys Ile Gln Gly Gln Gly Glu Gly Tyr Arg Gly Thr Val Asn Thr Ile 305 310 315 320 TGG AAT GGA ATT CCA TGT CAG CGT TGG GAT TCT CAG TAT CCT CAC GAG 1008 Trp Asn Gly Ile Pro Cys Gln Arg Trp Asp Ser Gln Tyr Pro His Glu 325 330 335 CAT GAC ATG ACT CCT GAA AAT TTC AAG TGC AAG GAC CTA CGA GAA AAT 1056 His Asp Met Thr Pro Glu Asn Phe Lys Cys Lys Asp Leu Arg Glu Asn 340 345 350 TAC TGC CGA AAT CCA GAT GGG TCT GAA TCA CCC TGG TGT TTT ACC ACT 1104 Tyr Cys Arg Asn Pro Asp Gly Ser Glu Ser Pro Trp Cys Phe Thr Thr 355 360 365 GAT CCA AAC ATC CGA GTT GGC TAC TGC TCC CAA ATT CCA AAC TGT GAT 1152 Asp Pro Asn Ile Arg Val Gly Tyr Cys Ser Gln Ile Pro Asn Cys Asp 370 375 380 ATG TCA CAT GGA CAA GAT TGT TAT CGT GGG AAT GGC AAA AAT TAT ATG 1200 Met Ser His Gly Gln Asp Cys Tyr Arg Gly Asn Gly Lys Asn Tyr Met 385 390 395 400 400 GGC AAC TTA TCC CAA ACA AGA TCT GGA CTA ACA TGT TCA ATG TGG GAC 1248 Gly Asn Leu Ser Gln Thr Arg Ser Gly Leu Thr Cys Ser Met Trp Asp 405 410 415 AAG AAC ATG GAA GAC TTA CAT CGT CAT ATC TTC TGG GAA CCA GAT GCA 1296 Lys Asn Met Glu Asp Leu His Arg His Ile Phe Trp Glu Pro Asp Ala 420 425 430 AGT AAG CTG AAT GAG AAT TAC TGC CGA AAT CCA GAT GAT GAT GCT CAT 1344 Ser Lys Leu Asn Glu Asn Tyr Cys Arg Asn Pro Asp Asp Asp Ala His 435 440 445 GGA CCC TGG TGC TAC ACG GGA AAT CCA CTC ATT CCT TGG GAT TAT TGC 1392 Gly Pro Trp Cys Tyr Thr Gly Asn Pro Leu Ile Pro Trp Asp Tyr Cys 450 455 460 CCT ATT TCT CGT TGT GAA GGT GAT ACC ACA CCT ACA ATA GTC AAT TTA 1440 Pro Ile Ser Arg Cys Glu Gly Asp Thr Thr Pro Thr Ile Val Asn Leu 465 470 475 475 480 GAC CAT CCC GTA ATA TCT TGT GCC AAA ACG AAA CAA TTG CGA GTT GTA 1488 Asp His Pro Val Ile Ser Cys Ala Lys Thr Lys Gln Leu Arg Val Val 485 490 495 AAT GGG ATT CCA ACA CGA ACA AAC ATA GGA TGG ATG G TT AGT TTG AGA 1536 Asn Gly Ile Pro Thr Arg Thr Asn Ile Gly Trp Met Val Ser Leu Arg 500 505 510 TAC AGA AAT AAA CAT ATC TGC GGA GGA TCA TTG ATA AAG GAG AGT TGG 1584 Tyr Arg Asn Lys His Ile Cys Gly Gly Ser Leu Ile Lys Glu Ser Trp 515 520 525 GTT CTT ACT GCA CGA CAG TGT TTC CCT TCT CGA GAC TTG AAA GAT TAT 1632 Val Leu Thr Ala Arg Gln Cys Phe Pro Ser Arg Asp Leu Lys Asp Tyr 530 535 540 540 GAA GCT TGG CTT GGA ATT CAT GAT GTC CAC GGA AGA GGA GAT GAG AAA 1680 Glu Ala Trp Leu Gly Ile His Asp Val His Gly Arg Gly Asp Glu Lys 545 550 555 560 TGC AAA CAG GTT CTC AAT GTT TCC CAG CTG GTA TAT GGC CCT GAA GGA 1728 Cys Lys Gln Val Leu Asn Val Ser Gln Leu Val Tyr Gly Pro Glu Gly 565 570 575 TCA GAT CTG GTT TTA ATG AAG CTT GCC AGG CCT GCT GTC CTG GAT GAT 1776 Ser Asp Leu Val Leu Met Lys Leu Ala Arg Pro Ala Val Leu Asp Asp 580 585 590 TTT GTT AGT ACG ATT GAT TTA CCT AAT TAT GGA TGC ACA ATT CCT GAA 1824 Phe Val Ser Thr Ile Asp Leu Pro Asn Tyr Gly Cys Thr Ile Pro Glu 595 600 605 AAG ACC AGT TGC AGT GTT TAT G GC TGG GGC TAC ACT GGA TTG ATC AAC 1872 Lys Thr Ser Cys Ser Val Tyr Gly Trp Gly Tyr Thr Gly Leu Ile Asn 610 615 620 TAT GAT GGC CTA TTA CGA GTG GCA CAT CTC TAT ATA ATG GGA AAT GAG 1920 Tyr Asp Gly Leu Leu Arg Val Ala His Leu Tyr Ile Met Gly Asn Glu 625 630 635 640 AAA TGC AGC CAG CAT CAT CGA GGG AAG GTG ACT CTG AAT GAG TCT GAA 1968 Lys Cys Ser Gln His His Arg Gly Lys Val Thr Leu Asn Glu Ser Glu 645 650 655 ATA TGT GCT GGG GCT GAA AAG ATT GGA TCA GGA CCA TGT GAG GGG GAT 2016 Ile Cys Ala Gly Ala Glu Lys Ile Gly Ser Gly Pro Cys Glu Gly Asp 660 665 670 TAT GGT GGC CCA CTT GTT TGT GAG CAA CAT AAA ATG AGA ATG GTT CTT 2064 Tyr Gly Gly Pro Leu Val Cys Glu Gln His Lys Met Arg Met Val Leu 675 680 685 GGT GTC ATT GTT CCT GGT CGT GGA TGT GCC ATT CCA AAT CGT CCT GGT 2112 Gly Val Ile Val Pro Gly Arg Gly Cys Ala Ile Pro Asn Arg Pro Gly 690 695 700 ATT TTT GTC CGA GTA GCA TAT TAT GCA AAA TGG ATA CAC AAA ATT ATT 2160 Ile Phe Val Arg Val Ala Tyr Tyr Ala Lys Trp Ile His Lys Ile Ile 705 710 710 715 720 TTA AC A TAT AAG GTA CCA CAG TCA TAG 2187 Lys Thr Tyr Lys Val Pro Gln Ser 725

[0045]

[Sequence List] SEQ ID NO: 2 Sequence length: 2199 Sequence type: nucleic acid Number of strands: double-stranded Topology: linear Sequence type: cDNA Origin Organism name: Human Sequence characteristics Characteristic symbols: sig peptide Location: 1-93 Method for determining characteristics: E Symbol indicating feature: CDS Location: 1-2169 Method for determining characteristics: E Sequence GGATCCG CCAGCCCGTC CAGCAGCACC -1 ATG TGG GTG ACC AAA CTC CTG CCA GCC CTG CTG CTG CAG CAT GTC CTC 48 Met Trp Val Thr Lys Leu Leu Pro Ala Leu Leu Leu Gln His Val Leu 5 10 15 CTG CAT CTC CTC CTG CTC CCC ATC GCC ATC CCC TAT GCA GAG GGA CAA 96 Leu His Leu Leu Leu Leu Pro Ile Ala Ile Pro Tyr Ala Glu Gly Gln 20 25 30 AGG AAA AGA AGA AAT ACA ATT CAT GAA TTC AAA AAA TCA GCA AAG ACT 144 Arg Lys Arg Arg Asn Thr Ile His Glu Phe Lys Lys Ser Ala Lys Thr 35 40 45 ACC CTA ATC AAA ATA GAT CCA GCA CTG AAG ATA AAA ACC AAA AAA GTG 192 Thr Leu Ile Lys Ile Asp Pro Ala Leu Lys Il e Lys Thr Lys Lys Val 50 55 60 AAT ACT GCA GAC CAA TGT GCT AAT AGA TGT ACT AGG AAT AAA GGA CTT 240 Asn Thr Ala Asp Gln Cys Ala Asn Arg Cys Thr Arg Asn Lys Gly Leu 65 70 75 80 CCA TTC ACT TGC AAG GCT TTT GTT TTT GAT AAA GCA AGA AAA CAA TGC 288 Pro Phe Thr Cys Lys Ala Phe Val Phe Asp Lys Ala Arg Lys Gln Cys 85 90 95 CTC TGG TTC CCC TTC AAT AGC ATG TCA AGT GGA GTG AAA AAA GAA TTT 336 Leu Trp Phe Pro Phe Asn Ser Met Ser Ser Gly Val Lys Lys Glu Phe 100 105 110 GGC CAT GAA TTT GAC CTC TAT GAA AAC AAA GAC TAC ATT AGA AAC TGC 384 Gly His Glu Phe Asp Leu Tyr Glu Asn Lys Asp Tyr Ile Arg Asn Cys 115 120 125 ATC ATT GGT AAA GGA CGC AGC TAC AAG GGA ACA GTA TCT ATC ACT AAG 432 Ile Ile Gly Lys Gly Arg Ser Tyr Lys Gly Thr Val Ser Ile Thr Lys 130 135 140 AGT GGC ATC AAA TGT CAG CCC TGG AGT TCC ATG ATA CCA CAC GAA CAC 480 Ser Gly Ile Lys Cys Gln Pro Trp Ser Ser Met Ile Pro His Glu His 145 150 155 160 AGC TAT CGG GGT AAA GAC CTA CAG GAA AAC TAC TGT CGA AAT CCT CGA 528 Ser Tyr Arg Gly Lys Asp Leu Gln Glu Asn Tyr Cys Arg Asn Pro Arg 165 170 175 GGG GAA GAA GGG GGA CCC TGG TGT TTC ACA AGC AAT CCA GAG GTA CGC 576 Gly Glu Glu Glu Gly Gly Pro Trp Cys Phe Thr Ser Asn Pro Glu Val Arg 180 185 190 TAC GAA GTC TGT GAC ATT CCT CAG TGT TCA GAA GTT GAA TGC ATG ACC 624 Tyr Glu Val Cys Asp Ile Pro Gln Cys Ser Glu Val Glu Cys Met Thr 195 200 205 TGC AAT GGG GAG AGT TAT CGA GGT CTC ATG GAT CAT ACA GAA TCA GGC 672 Cys Asn Gly Glu Ser Tyr Arg Gly Leu Met Asp His Thr Glu Ser Gly 210 215 220 AAG ATT TGT CAG CGC TGG GAT CAT CAG ACA CCA CAC CGG CAC AAA TTC 720 Lys Ile Cys Gln Arg Trp Asp His Gln Thr Pro His Arg His Lys Phe 225 230 235 240 TTG CCT GAA AGA TAT CCC GAC AAG GGC TTT GAT GAT AAT TAT TGC CGC 768 Leu Pro Glu Arg Tyr Pro Asp Lys Gly Phe Asp Asp Asn Tyr Cys Arg 245 250 255 AAT CCC GAT GGC CAG CCG AGG CCA TGG TGC TAT ACT CTT GAC CCT CAC 816 Asn Pro Asp Gly Gln Pro Arg Pro Trp Cys Tyr Thr Leu Asp Pro His 260 265 270 ACC CGC TGG GAG TAC TGT GCA ATT AAA ACA TGC GCT GAC AAT ACT ATG 864 Thr Arg Trp Glu Tyr CysAla Ile Lys Thr Cys Ala Asp Asn Thr Met 275 280 285 AAT GAC ACT GAT GTT CCT TTG GAA ACA ACT GAA TGC ATC CAA GGT CAA 912 Asn Asp Thr Asp Val Pro Leu Glu Thr Thr Glu Cys Ile Gln Gly Gln 290 295 300 GGA GAA GGC TAC AGG GGC ACT GTC AAT ACC ATT TGG AAT GGA ATT CCA 960 Gly Glu Gly Tyr Arg Gly Thr Val Asn Thr Ile Trp Asn Gly Ile Pro 305 310 315 320 TGT CAG CGT TGG GAT TCT CAG TAT CCT CAC GAG CAT GAC ATG ACT CCT 1008 Cys Gln Arg Trp Asp Ser Gln Tyr Pro His Glu His Asp Met Thr Pro 325 330 335 GAA AAT TTC AAG TGC AAG GAC CTA CGA GAA AAT TAC TGC CGA AAT CCA 1056 Glu Asn Phe Lys Cys Lys Asp Leu Arg Glu Asn Tyr Cys Arg Asn Pro 340 345 350 GAT GGG TCT GAA TCA CCC TGG TGT TTT ACC ACT GAT CCA AAC ATC CGA 1104 Asp Gly Ser Glu Ser Pro Trp Cys Phe Thr Thr Asp Pro Asn Ile Arg 355 360 365 GTT GGC TAC TGC TCC CAA ATT CCA AAC TGT GAT ATG TCA CAT GGA CAA 1152 Val Gly Tyr Cys Ser Gln Ile Pro Asn Cys Asp Met Ser His Gly Gln 370 375 380 GAT TGT TAT CGT GGG AAT GGC AAA AAT TAT ATG GGC AAC TTA TCC CAA 1200 Asp Cy s Tyr Arg Gly Asn Gly Lys Asn Tyr Met Gly Asn Leu Ser Gln 385 390 395 400 ACA AGA TCT GGA CTA ACA TGT TCA ATG TGG GAC AAG AAC ATG GAA GAC 1248 Thr Arg Ser Gly Leu Thr Cys Ser Met Trp Asp Lys Asn Met Glu Asp 405 410 415 TTA CAT CGT CAT ATC TTC TGG GAA CCA GAT GCA AGT AAG CTG AAT GAG 1296 Leu His Arg His Ile Phe Trp Glu Pro Asp Ala Ser Lys Leu Asn Glu 420 425 430 AAT TAC TGC CGA AAT CCA GAT GAT GAT GCT CAT GGA CCC TGG TGC TAC 1344 Asn Tyr Cys Arg Asn Pro Asp Asp Asp Ala His Gly Pro Trp Cys Tyr 435 440 445 ACG GGA AAT CCA CTC ATT CCT TGG GAT TAT TGC CCT ATT TCT CGT TGT 1392 Thr Gly Asn Pro Leu Ile Pro Trp Asp Tyr Cys Pro Ile Ser Arg Cys 450 455 460 GAA GGT GAT ACC ACA CCT ACA ATA GTC AAT TTA GAC CAT CCC GTA ATA 1440 Glu Gly Asp Thr Thr Pro Thr Ile Val Asn Leu Asp His Pro Val Ile 465 470 475 475 480 TCT TGT GCC AAA ACG AAA CAA TTG CGA GTT GTA AAT GGG ATT CCA ACA 1488 Ser Cys Ala Lys Thr Lys Gln Leu Arg Val Val Asn Gly Ile Pro Thr 485 490 495 CGA ACA AAC ATA GGA TGG ATG GTT AGT TTG AGA TAC AGA AAT AAA CAT 1536 Arg Thr Asn Ile Gly Trp Met Val Ser Leu Arg Tyr Arg Asn Lys His 500 505 510 ATC TGC GGA GGA TCA TTG ATA AAG GAG AGT TGG GTT CTT ACT GCA CGA 1584 Ile Cys Gly Gly Ser Leu Ile Lys Glu Ser Trp Val Leu Thr Ala Arg 515 520 525 CAG TGT TTC CCT TCT CGA GAC TTG AAA GAT TAT GAA GCT TGG CTT GGA 1632 Gln Cys Phe Pro Ser Arg Asp Leu Lys Asp Tyr Glu Ala Trp Leu Gly 530 535 535 540 ATT CAT GAT GTC CAC GGA AGA GGA GAT GAG AAA TGC AAA CAG GTT CTC 1680 Ile His Asp Val His Gly Arg Gly Asp Glu Lys Cys Lys Gln Val Leu 545 550 555 560 AAT GTT TCC CAG CTG GTA TAT GGC CCT GAA GGA TCA GAT CTG GTT TTA 1728 Asn Val Ser Gln Leu Val Tyr Gly Pro Glu Gly Ser Asp Leu Val Leu 565 570 575 ATG AAG CTT GCC AGG CCT GCT GTC CTG GAT GAT TTT GTT AGT ACG ATT 1776 Met Lys Leu Ala Arg Pro Ala Val Leu Asp Asp Phe Val Ser Thr Ile 580 585 590 GAT TTA CCT AAT TAT GGA TGC ACA ATT CCT GAA AAG ACC AGT TGC AGT 1824 Asp Leu Pro Asn Tyr Gly Cys Thr Ile Pro Glu Lys Thr Ser Cys Ser 595 600 605 GTT TAT GGC TGG GGC TAC ACT GGA TTG ATC AAC TAT GAT GGC CTA TTA 1872 Val Tyr Gly Trp Gly Tyr Thr Gly Leu Ile Asn Tyr Asp Gly Leu Leu 610 615 620 620 CGA GTG GCA CAT CTC TAT ATA ATG GGA AAT GAG AAA TGC AGC CAG CAT 1920 Arg Val Ala His Leu Tyr Ile Met Gly Asn Glu Lys Cys Ser Gln His 625 630 635 640 CAT CGA GGG AAG GTG ACT CTG AAT GAG TCT GAA ATA TGT GCT GGG GCT 1968 His Arg Gly Lys Val Thr Leu Asn Glu Ser Glu Ile Cys Ala Gly Ala 645 650 655 GAA AAG ATT GGA TCA GGA CCA TGT GAG GGG GAT TAT GGT GGC CCA CTT 2016 Glu Lys Ile Gly Ser Gly Pro Cys Glu Gly Asp Tyr Gly Gly Pro Leu 660 665 670 GTT TGT GAG CAA CAT AAA ATG AGA ATG GTT CTT GGT GTC ATT GTT CCT 2064 Val Cys Glu Gln His Lys Met Arg Met Val Leu Gly Val Ile Val Pro 675 680 685 GGT CGT GGA TGT GCC ATT CCA AAT CGT CCT GGT ATT TTT GTC CGA GTA 2112 Gly Arg Gly Cys Ala Ile Pro Asn Arg Pro Gly Ile Phe Val Arg Val 690 695 700 GCA TAT TAT GCA AAA TGG ATA CAC AAA ATT ATT TTA ACA TAT AAG GTA 2160 Ala Tyr Tyr Ala Lys Trp Ile His Lys Ile Ile Leu Thr Tyr Lys Val 705 710 715 715 720 CCA CAG T CA TAG 2172 Pro Gln Ser

[Brief description of the drawings]

FIG. 1 is a restriction map of HLC3.

FIG. 2 is a construction diagram of a human leukocyte-derived HGF expression vector for COS cells.

FIG. 3 is a construction diagram of a human leukocyte-derived HGF expression vector for mouse C127 cells.

FIG. 4 is a construction diagram of a human leukocyte-derived HGF expression vector for Chinese hamster CHO cells.

FIG. 5 is a diagram showing the relationship between the fraction of the S-Sepharose eluate, the absorbance of the eluted components, and their DNA synthesis activity.

FIG. 6 is a diagram showing the relationship between the fraction of a heparin eluate, the absorbance of the eluted components, and their DNA synthesis activity.

FIG. 7 is a diagram showing the relationship between the concentration of acetonitrile passed through and the absorbance of eluted components in reverse phase HPLC.

FIG. 8 shows SDS-polyacrylamide electrophoresis patterns under reduced and non-reduced conditions of purified recombinant human HGF.

FIG. 9 is a diagram showing a chromatographic pattern of an eluate of S-Sepharose.

FIG. 10 is a diagram showing the relationship between the fraction of a heparin eluate, the absorbance of eluted components, and their DNA synthesis activity.

FIG. 11 is a diagram showing the relationship between fractions of eluate, absorbance of eluted components, and their DNA synthesis activities in phenyl 5PW column chromatography.

FIG. 12 shows SDS-polyacrylamide electrophoresis patterns of purified recombinant human HGF under reducing and non-reducing conditions.

FIG. 13 shows SDS-polyacrylamide electrophoresis patterns of purified single-stranded recombinant human HGF under reducing and non-reducing conditions.

──────────────────────────────────────────────────続 き Continued on the front page (51) Int.Cl. ⁶ Identification symbol FI (C12P 21/02 C12R 1:91) (72) Inventor Manabu Shimonishi 2-1-1 Katada, Otsu-shi, Shiga Toyo Spinning Stock Company Pharmaceutical Research Laboratories (72) Inventor Shin Shimizu 2-1-1 Katata, Otsu City, Shiga Prefecture Toyo Spinning Co., Ltd.Pharmaceutical Research Laboratory (72) Inventor Izumi Inohara 2-1-1 Katata, Otsu City, Shiga Prefecture Toyo Spinning Stock Company Pharmaceutical Research Laboratories (72) Inventor Mariko Sakaguchi 2-1-1 Katata, Otsu City, Shiga Prefecture Toyo Spinning Co., Ltd.Pharmaceutical Research Laboratories (72) Inventor Osamu Asami 8-1, Higashino Tower, Konan City, Aichi Prefecture (56) References NATURE, 1989, Vol. 342, P. 440-443 (58) Fields investigated (Int. Cl. ⁶ , DB name) C12N 15/00-15/90 BIOSIS (DIALOG) WPI (D IALOG) EPAT (QUESTEL)

Claims (3)

(57) [Claims] 1. A method for producing hepatocyte growth factor (HGF) comprising the following steps. (1) Animal cells are transformed with a recombinant expression vector having a gene encoding the amino acid sequence of SEQ ID NO: 2 and a dihydrofolate reductase (DHFR) gene. (2) The above transformant while increasing the concentration of methotrexate Is cultured to select an HGF-producing strain. (3) The HGF-producing strain is cultured, and the produced HGF is recovered and purified. 2. The animal cell according to claim 1, wherein the animal cell is CH.
A method for producing HGF, comprising using O cells. 3. A method for producing a single-chain HGF, which comprises culturing the HGF-producing strain according to claim 1 in the presence of a protease inhibitor.