JP3057292B2 - Monoclonal antibodies, hybridomas, their production methods and uses - Google Patents

Description

The present invention relates to a monoclonal antibody against a heparin binding secretory transforming factor (hereinafter sometimes abbreviated as hst-1) protein,
Hybridomas, their production and use.

2. Description of the Related Art The hst-1 gene is a transforming gene isolated from human gastric cancer tissue [H. Sakamoto et al., Procesings of the National Academy of Sciences (Proc. Natl. Acad. Sci. USA) 83 : 39
97 (1986)] and its gene product was found to be similar in structure and biological activity to fibroblast growth factor (FGF), one of the cell growth factors [T. Yoshida et al., Processings of the National Academy of Sciences (Proc. Natl. Acad. Sci. USA) 84 : 7305
(1987), K. Miyagawa et al., Oncogene 3 ,
383 (1988)]. The hst-1 gene has been isolated not only from gastric cancer but also from colon cancer, liver cancer and Kaposi's sarcoma of AIDS patients [T. Koda et al., Japanese Journal of
Cancer Research (Jpn.J.Cancer Res.) (Gann) 7
8 : 325 (1987), H. Nakagawa et al., Japanese Journal of Cancer Research (Jpn. J. Cancer Re
s.) (Gann) 78 : 651 (1987), Y. Yuasa et al., Japanese Journal of Cancer Research (Jpn.J.Ca)
ncer Res.) (Gann) 78 : 103 (1987), P. Delli Bovi et al.
Cell (Cell) 50 : 729 (1987)], this gene is a basic FG
It is thought that together with F, acidic FGF, Int-2 gene product and the like, an FGF family having binding properties to heparin is formed. The gene isolated from Kaposi's sarcoma was K-
Also called FGF. As described above, the hst-1 gene is isolated from various cancer tissues, and is considered to be involved in canceration. In addition, since the hst-1 gene is a transforming gene having the function of a cell growth factor, its gene product is expressed as FGF. It also has the potential to be a prophylactic treatment, such as a treatment for damage.

Note that hst-1 may be described as HSTF1 (M.
Yoshida et al., Processings of the National Academy of Sciences (Proc. Natl. Aca
d. Sci. USA), vol. 85, pp. 4861-4864) 1988)].

The nucleotide sequence of the hst-1 gene has already been reported [MT
aira et al., The Prossings of the National Academy of Sciences (Proc.Natl.Acad.Sc
iUSA) 84 : 2980 (1987), T. Yoshidar et al., Proceedings of the National Academy of Sciences (Proc. Natl. Acad. Sci. USA) 84 : 7305 (198)
7)], The report also shows the constituent amino acids of hst-1 deduced from this.

However, naturally occurring hst-1 is considered to be extremely small, and there has been no report of obtaining hst-1 from a biomaterial.

Problems to be Solved by the Invention As described above, naturally occurring hst-1 is extremely small, and a method that can be easily used as a method for quantifying hst-1 has not been established. Hst which is indispensable for developing as a medicine or reagent
There are very many unclear points about basic findings such as properties concerning -1.

Therefore, many basic findings on hst-1 such as hst
It is thought that if the distribution of in-vivo-1 in vivo and its production mode can be known, the relationship between hst-1 and cancer will be investigated, and the development of hst-1 as a drug / reagent will be easy. Can be

It is also important to accurately know the amount of the hst-1 protein when purifying this protein from a recombinant. Furthermore, the blood hst- of the animal to which the hst-1 protein was administered was
1 It is very important to track the protein concentration, but it cannot be measured by the conventional method using 3T3 cells because serum is mixed in the sample. Usually, hst-1 is measured by lowering the serum concentration and culturing the cells.
However, this method has the drawback that the operation is delicate, the measurement error is large, and it takes a long time to obtain a result, since cells are used, and the DNA synthesis ability is recovered back. Have. Therefore, development of a simple and accurate means for measuring hst-1 protein for the above purpose is desired.

Means for Solving the Problems In view of the above-mentioned circumstances, the present inventors have conducted various studies to find a practical means for measuring the hst-1 protein, and as a result, have prepared a monoclonal antibody against the hst-1 protein which enables the measurement. As a result of further research based on this, the present invention was completed.

The present invention relates to (1) heparin binding secretory transforming factor (hst-1)
Monoclonal antibodies to the protein having the following properties: (a) molecular weight: about 140-160 kilodaltons, (b) cross-linked to both acidic fibroblast growth factor (aFGF) and basic fibroblast growth factor (bFGF) (C) an immunoglobulin class belonging to IgG; (2) a cloned hybridoma consisting of mammalian spleen cells immunized with the hst-1 protein and mammalian lymphoid cells; (3) (4) The method for producing a hybridoma according to the above (2), wherein the spleen cells of the mammal immunized with the hst-1 protein and the lymphoid cells of the mammal are fused and cloned. 2) The hybridoma according to the above (2), wherein the hybridoma is grown in a liquid medium or intraperitoneally of a mammal to produce and accumulate a monoclonal antibody, which is collected. ) Monoclonal antibody according production methods; and (5) relates to the above (1) detection and determination of hst-1 protein, which comprises using the monoclonal antibodies.

hst-1 is based on Taira et al., Proceedings of the
National Academy of Sciences (Pro
c. Natl. Acad. Sci. USA), 84 , 2980-2984 (1987), it is shown as consisting of a 206 amino acid sequence.

However, Delli-Bovi et al., Molecular and Cellulous Biology.
ar Biology), 8 , 2933-2941 (1988).
This shows that expression in OS-1 cells (the target substance is referred to as K-FGF) results in the removal of 30 or 31 amino acids from the N-terminus. Therefore,
The mature protein of hst-1 is considered most appropriate to have an amino acid sequence in which 31 amino acids have been eliminated from the N-terminal of the 206 amino acid sequence (shown in FIG. 1). Can be

The hst-1 protein in the present invention includes the above-mentioned mature protein and hst-1 mutein.

The hst-1 mutein includes a deletion type mutein of hst-1.

As the defective mutein, at least one amino acid among the constituent amino acids of hst-1 is deleted.
-1 activity.

The defective mutein is preferably one in which 1 to 43 consecutive amino acids of hst-1 are deleted.

More preferred examples of the defective mutein of the present invention include those in which 1 to 43 consecutive constituent amino acids have been deleted from the N-terminus. More preferably, a mutein (hst-1) lacking amino acid number 27 from the N-terminus
It may also be referred to as mutein N27. The amino acid sequence is the first
See Figure 2. ).

Hst-1 proteins that immunize mammals include hst-1
Or the mutein described above.

In order to obtain the mature protein of hst-1, for example, an expression type vector containing a DNA having a nucleotide sequence encoding the above-described hst-1 polypeptide is prepared and introduced into an appropriate host cell. May be produced. Examples of the expression type vector include (a) isolating RNA encoding hst-1, (b) synthesizing a single-stranded complementary DNA (cDNA) from the RNA, and then synthesizing a double-stranded DNA; The complementary DNA was incorporated into a plasmid, (d) a host was transformed with the obtained recombinant plasmid, and (e) the obtained transformant was cultured, and then an appropriate method was used from the transformant, for example, using a DNA probe. A plasmid containing the target DNA is isolated by the colony hybridization method, (h) the cloned DNA of interest is excised from the plasmid, (g) an oligonucleotide containing an ATG codon is optionally bound, and ) Ligation of the DNA downstream of the promoter in the vehicle.

RNA encoding hst-1 can be obtained from various human cancer cells, for example, gastric cancer, colorectal cancer, liver cancer, Kaposi's sarcoma, human germ cell tumor, NIH3T3 transformant by human hst-1 gene, and the like.

The expression vector thus obtained is integrated into a suitable host (eg, Escherichia coli, Bacillus subtilis, yeast, animal cells),
By culturing the obtained transformant in a medium, the hst
-1 can be produced.

In order to produce the mutein, a site-directed mutagenesis technique is employed.
The technology is well known and is available from Lathe
r, RF) and JP Lecoq (Lecoq, JP),
Genetic Engineer
ing), Academic Press (1983) pp. 31-50,
Is shown in Oligonucleotide directed mutagenesis was performed by M. Smith (M.) and S. Gillam (Gi.
llam, S.), Genetic Engineering: Principles and Methods, Plenum Press (1981), Vol. 3, pp. 1-32.

In order to produce a structural gene encoding the mutein, for example, (a) a single-stranded DNA consisting of a single strand of the structural gene of hst-1
With the mutant oligonucleotide primer (the primer is complementary to the region containing the codon for cysteine to replace this single strand or, optionally, the antisense triplet that pairs with this codon). However, other codons for amino acid encoding of the codon, or antisense
Inconsistencies with triplets do not apply. And (b) extending the primer with a DNA polymerase,
Forming a mutated heteroduplex, and (c) replicating the mutated heterodimer.

Next, the phage DN carrying the mutated gene
A is isolated and integrated into a plasmid.

By transforming a suitable host with the thus obtained plasmid and culturing the obtained transformant in a medium, mutein can be produced.

When immunizing the hst-1 protein, the hst-1 protein may be used as a complex with a carrier protein and then used for immunization.

Examples of the carrier protein include bovine serum albumin, bovine thyroglobulin, hemocyanin and the like.

When a complex with a carrier protein is used, the coupling ratio between the carrier protein and the hst-1 protein is about 0.1
Used up to 30 times (carrier / hst-1 protein: weight ratio). Preferably, about 0.5 to 5 times is used.

Further, various condensing agents can be used for coupling the hapten and the carrier protein, and glutaraldehyde, carbodiimide, and the like are conveniently used.

When immunizing with the hst-1 protein or a complex thereof with a carrier protein, the mammal to be immunized is a sheep,
Experimental animals such as goats, rabbits, guinea pigs, rats and mice are used, but rats and mice are preferred for obtaining monoclonal antibodies. For example, when immunizing a mouse, subcutaneous, intraperitoneal, intravenous, intramuscular, intradermal, or any other route can be used as the immunization method.
It is preferably injected intraperitoneally or intravenously (especially subcutaneously). The immunity interval, immunity amount, etc. are also highly variable, and various methods can be used. A method using spleen cells excised 4 days later is often used. The amount of immunization was about 0.1 μg per mouse as the amount of peptide
As described above, it is desirable to use about 10 μg to 300 μg. Before removing the spleen, it is preferable to perform a fusion experiment using spleen cells after performing partial blood sampling to confirm an increase in the antibody titer in the blood.

Spleen cells of a mouse cell fusion was excised for example between the spleen cells and lymphoid cells, hypoxanthine - guanine - phosphoribosyl transferase deficiency (HGPRT ^-)
And, thymidine kinase deficient (TK ^-) myeloma [Examples of mammalian suitable homologous or heterologous (preferably the same kind) having such markers, P3-X63-Ag · 8U1 ( Ichimori et al., Journal of Immunological Method 80 55 (198
5))), etc., and fusion with a lymphoid cell line.
For example, it is produced by fusing according to the method of Keller and Milstein et al. [Nature 256 : 495 (1975)]. For example, myeloma cells and spleen cells at a ratio of about 1: 5, such as Iskov medium and Ham F-12
The medium is suspended in a 1: 1 mixed medium (hereinafter referred to as IH medium), and a fusion agent such as Sendai virus or polyethylene glycol (PEG) is used. Of course, it is also possible to add dimethyl sulfoxide (DMSO) or other fusion promoters. The degree of polymerization of PEG is usually about 1000 to 6000, the time is about 0.5 to 30 minutes, and the concentration is about 10% to 80%.
Approximately 4 to 10 minutes for efficient fusion. The fused cells were cultured in hypoxanthine-aminopterin-thymidine medium [HAT medium; Nature, 256 , 495].
(1975)] and the like.

The culture supernatant of the proliferating cells can be screened for the production of the desired antibody, and the antibody titer can be screened as follows. That is, in this case, first, as a first step, the presence or absence of production of an antibody against the immunized peptide is determined by a radioimmunoassay (RIA) method or an enzyme immunoassay (EI
A) The method can be examined by a method such as the method, but various modifications of these methods are also possible. As an example of a preferable measurement method, one method using EIA will be described.
For example, a rabbit anti-mouse immunoglobulin antibody is coupled to a carrier such as cellulose beads according to a conventional method, and a culture supernatant or mouse serum to be measured is added thereto, and a constant temperature (about 4 to 40 ° C. The same applies to the following.) Thereafter, the reaction product is thoroughly washed, and a peptide labeled with an enzyme (purified after coupling the enzyme and the peptide according to a conventional method) is added, and the reaction is carried out at a constant temperature for a certain period of time. After thoroughly washing the reaction product, an enzyme substrate is added, and the reaction is allowed to proceed at a constant temperature for a certain period of time. Thereafter, the formed color product can be measured by absorbance or fluorescence.

It is desirable that the cells of the wells that show growth in the selective medium and exhibit only antibody activity against the peptide used for immunization be cloned by a limiting dilution method or the like. By screening the supernatant of the cloned cells in the same manner and increasing the number of well cells with a high antibody titer, a monoclonal antibody-producing hybridoma clone that is reactive with the immunized peptide can be obtained.

The hybridoma cloned in this way is
Grow in liquid medium. Specifically, for example, a liquid medium such as RPMI-1640 [Moore, GE, et.al.
Of American Medical Association (J.
Am.Med.Assoc.) 199, 549 (1967 )] of about between 0.1 to 40% bovine serum medium and the like at about 2-10 days plus, preferably about 3
By culturing for 5 days, the monoclonal antibody can be obtained from the culture solution. In addition, an antibody can be obtained by inoculating intraperitoneally into a mammal, growing cells, and collecting ascites. For this, for example, in the case of mice, BALB / c inoculated in advance with mineral oil, etc.
About 1 × 10 ⁴ to 1 × 10 ⁷ mice, preferably about 5 ×
10 ^{5 to} 2 × 10 ⁶ hybridomas are inoculated intraperitoneally, and the ascites fluid is collected after about 7 to 20 days, preferably about 10 to 14 days. Antibodies generated and accumulated in ascites fluid include, for example, ammonium sulfate fraction, DEAE
-Monoclonal antibodies can be easily isolated as pure immunoglobulins by cellulose column chromatography or the like.

Thus, a monoclonal antibody against the hst-1 protein is obtained.

The monoclonal antibody of the present invention specifically binds to the hst-1 protein of the peptide of the immunogen.

In some cases, the monoclonal antibody of the present invention binds to an hst-1 protein different from the peptide of the immunogen used in the production.

The monoclonal antibodies of the present invention have the following properties: (a) molecular weight: 140-160 kilodaltons, (b) both acidic fibroblast growth factor (aFGF) and basic fibroblast growth factor (bFGF) Does not cross react; (c) the immunoglobulin class belongs to IgG.

Furthermore, some of the monoclonal antibodies of the present invention
Hst-1 which has a neutralizing activity on -1 protein and is active
The protein can be measured, and may be used as a therapeutic agent for diseases caused by the hst-1 protein.

Since the monoclonal antibody of the present invention binds to the hst-1 protein, it is extremely useful as a reagent for measuring the hst-1 protein. Further, facilitating measurement of hst-1 protein in living organs and tissues is extremely useful from the viewpoint of obtaining basic knowledge (for example, biodistribution) of hst-1 protein. For detection of hst-1 protein in living organs and tissues, quantification is usually performed by an enzyme immunoassay (EIA method) or the like, or a fluorescent antibody method or a radioimmunoassay method (RIA method) is used. Hst present in these organs and tissues
To determine the size of the -1 protein, western blotting of proteins is effective. In this method, a crude extract derived from an organ or tissue or a partially purified sample thereof is subjected to acrylamide electrophoresis, then transferred to a membrane filter, and detected with an HRP-conjugated anti-hst-1 protein antibody. Some of the cancer cells themselves produce hst-1 and the hst-
It is conceivable that the proliferation may be continued by 1 in some cases. When an anti-hst-1 protein antibody is allowed to act on such cancer, hst-1 which promotes proliferation is neutralized, and the inhibition of cancer cell proliferation, that is, an effect as an anticancer substance is expected. Hst-
In the case of cancer producing 1, hst-1 can be quantified using an antibody, and the invention can be applied to a diagnostic test for cancer. Furthermore, an antibody affinity column can be prepared using the binding ability between the antibody and the hst-1 protein, and used as a reagent for purifying the hst-1 protein.

The antibody molecule used for detecting and quantifying the hst-1 protein may be an IgG or a fraction thereof (eg, F (ab ') ₂ , Fab' or Fab). Above all, antibody molecules that directly bind a labeling agent are Fa
It is preferably b '.

The monoclonal antibody of the present invention can be used as a reagent in an immunochemical assay for hst-1 protein.

The amount of hst-1 protein in living tissues and body fluids can be measured by the immunochemical measurement method of hst-1 protein, and as described above, for example, angiogenic factors in various tissues and body fluids can be measured. It is thought that measurement of is useful for diagnosis of cancer.

An anti-hst-1 protein antibody is used as the antibody retained on the carrier.

The antibody bound to the labeling agent used in the measurement method of the present invention is one obtained by directly binding the labeling agent to an anti-hst-1 protein antibody having a different antigen-determining site from the antibody retained on the carrier. .

Anti-hst used in the immunochemical assay of the present invention
As the -1 protein antibody, any antibody having an ability to bind to the hst-1 protein may be used.

As the carrier in the antibody held on the carrier used in the method for measuring the hst-1 protein, for example, gel particles (eg, agarose gel [eg, Sepharose 4B, Sepharose 6B (Pharmashima Fine Chemical Co., Sweden))] Dextran gel [eg, Sephadex G-75, Sephadex G-100, Sephadex G
-200 (manufactured by Pharmacia Fine Chemicals (Sweden))], polyacrylamide gel [eg, Biogel P-30, Biogel P-60, Biogel P-100 (manufactured by Bio-Rad Laboratories (USA)]], cellulose particles [ Examples: Avicel (made by Asahi Kasei), ion exchange cellulose (eg, diethylaminoethylcellulose, carboxymethylcellulose)], physical adsorbent [eg, glass (eg, glass sphere, glass rod, aminoalkyl glass sphere, aminoalkyl glass rod), Silicon pieces, styrene resins (eg, polystyrene spheres, polystyrene particles), immunoassay plates (eg, Nunc (made in Denmark)), ion exchange resins イ オ ン examples, weakly acidic cation exchange resins [eg, Amberlite IRC-50 (Rohm and Haas (USA)), Zeoka Bed 226 (Pamuchitto Co. (Ltd., West Germany)), weakly basic anion exchange resin [e.g., Amberlite IR-4B, Dowex 3 (Dow Chemical Company (USA))]}, and the like.

For retaining the antibody on the carrier, known conventional means can be applied. For example, "Metabolism", Vol. 8, (1971), 69
The Bromcian method, glutaraldehyde method and the like described on page 6 can be mentioned. Further, as a simpler method, it may be physically adsorbed on the surface of the carrier.

Examples of the labeling agent in the antibody to which the labeling agent is bound include a radioisotope, an enzyme, a fluorescent substance, a luminescent substance, and the like, and it is preferable to use an enzyme. As the enzyme, a stable enzyme having a large specific activity is preferable, and peroxidase, alkaline phosphatase, β-D-galactosidase, glucose oxidase and the like can be used, but peroxidase is preferable. As the peyu oxidase, those of various origins can be used.Examples include peroxidase obtained from horseradish, pineapple, fig, sweet bean, broad bean, corn, etc., and particularly extracted from horseradish. Horseradish peroxidase (horser)
adish peroxidase) (HRP) is preferred.

In binding the antibody to peroxidase, it is convenient to use a peroxidase in which a maleimide group has been introduced in advance in order to utilize the thiol group of Fab 'as an antibody molecule.

As a method for introducing a maleimide group into peroxidase, a maleimide group can be introduced via an amino group of peroxidase. For that purpose, an N-succinimidyl-maleimide-carboxylate derivative can be used, and preferably, N- (γ-maleimidobutyloxy) succinimide (sometimes abbreviated as GMBS)
And so on. Therefore, a certain group may be inserted between the maleimide group and the peroxidase.

To make GMBS react with peroxidase,
at a temperature of about 10 to 50 ° C. in a buffer having a pH of about 6 to 8
The reaction is carried out for 10 minutes to 24 hours. Examples of the buffer include a 0.1 M phosphate buffer at pH 7.0. The maleimidated peroxidase thus obtained can be purified by, for example, gel chromatography. As the carrier used when performing the gel chromatography, for example,
Sephadex G-25 (manufactured by Pharmacia Fine Chemicals (Sweden)), Biogel P-2 (manufactured by Bio-Rad Laboratories (USA)), and the like.

The reaction between the maleimidated peroxidase and the antibody molecule is carried out in a buffer at a temperature of about 0 ° C. to 40 ° C. for about 1 hour.
For 48 hours.
Examples of the buffer include 0.1 M phosphate buffer containing 5 mM sodium salt of ethylenediaminetetraacetic acid at pH 6.0. The thus obtained peroxidase-labeled antibody can be purified by, for example, gel chromatography. Examples of the carrier used for performing the gel chromatography include Sephadex G-25 [manufactured by Pharmacia Fine Chemicals (Sweden)] and Biogel P-2 [manufactured by Bio-Rad Laboratories (USA)]. Can be

Furthermore, a thiol group may be introduced into peroxidase and reacted with a maleimidated antibody molecule.

Direct binding of an enzyme other than peroxidase to the antibody can be carried out according to the method of peroxidase, and a per se known glutaraldehyde method, a periodic acid method, a water-soluble carbodiimide method and the like are used.

The test sample in the measurement system of the present invention includes a bodily fluid such as urine, serum, plasma, and cerebrospinal fluid, or an extract of animal cells or bacterial cells or a culture supernatant thereof. As an example of the measurement method of the present invention, the case where the labeling agent is peroxidase will be specifically described below, but is not limited to peroxidase.

First, the hst to be measured is added to the antibody held on the carrier.
After performing an antigen-antibody reaction by adding an analyte containing -1 protein, the peroxidase obtained above and
A conjugate with the hst-1 protein antibody is added and reacted.

Test samples in this measurement system include urine, serum,
Examples include body fluids such as plasma and cerebrospinal fluid, or extracts of animal cells or bacterial cells or culture supernatants thereof.

: A peroxidase substrate is added to the reaction product obtained in step (1), and the enzyme activity of the above reaction product is determined by measuring the absorbance or fluorescence intensity of the resulting substance.

The above-mentioned operations are performed in advance on a known amount of a standard solution of hst-1 protein, and the relationship between the hst-1 protein and absorbance or fluorescence intensity is prepared as a standard curve.

: The absorbance or the fluorescence intensity obtained for an analyte (test sample) containing an unknown amount of hst-1 protein is fitted to a standard curve, and the amount of hst-1 protein in the analyte is measured.

The hst-1 protein can be purified using an antibody obtained using a complex of a monoclonal antibody against the hst-1 protein and a carrier protein as an immunogen. This includes
It can be performed by performing affinity column chromatography using the antibody.

The affinity column chromatography can be performed, for example, by coupling the antibody to a suitable carrier, filling the column with the antibody, adsorbing a solution containing the hst-1 protein through the column, and then eluting the solution. .

Examples of the carrier include those similar to the carriers described above. In particular, gel particles and various synthetic resins are advantageously used. For example, CNBr-activated Se
pharose 4B (Pharmacia Fine Chemicals),
Affigel-10, Affigel-15 (manufactured by Bio-Rad Laboratories) and the like.

For coupling the antibody to the carrier, known conventional means can be applied. For example, "Metabolism", Vol.
Bromcian method and glutaraldehyde method described on page 696. In addition, a method using a water-soluble carbodiimide, an active ester method, and the like can also be used. However, as a simpler method, the compound may be physically adsorbed on the carrier surface.

In order to carry out purification using the antibody column thus obtained, the hst-1 protein in a buffer near neutrality is adsorbed to an antibody column packed with a carrier to which the antibody is bound. After washing the column with the same buffer, the specifically adsorbed hst-1 protein is eluted. To elute the specifically adsorbed hst-1 protein, for example, low pH
Alternatively, a high pH buffer or a buffer containing a high concentration of salt is used.

Examples of the low pH buffer include a 0.17 M glycine-hydrochloride buffer at pH 2.3, a 0.1 M sodium dicitrate-hydrochloride buffer at pH 1.8, and the like.

Examples of the high pH buffer include ammonia water at pH 11 and 0.2 M sodium borate buffer at pH 11.7.

As the buffer containing the high concentration of salt, for example, 6M
Guanidine hydrochloride solution, 7M urea solution and the like can be mentioned.

The above-mentioned elution may be a batch method or a method using a column.

The antigen eluate is purified, for example, by dialysis. For example, when eluting with a low pH buffer, for example, 0.1 M sodium carbonate buffer (pH 10.5), when eluting with a high pH buffer,
After neutralization with, for example, a 0.1 M glucine-hydrochloric acid buffer (pH 3.0), dialysis is performed against, for example, a 0.02 M phosphate buffer (pH 8.0) containing 0.1% NaN ₃ . The antigen solution eluted with a buffer containing a high concentration of salt can be directly dialyzed and stored in the above-mentioned phosphate buffer. Further, the eluate or dialysate can be stored as a freeze-dried preparation obtained by freeze-drying.

The hst-1 protein thus purified has a remarkable activity of promoting cell proliferation such as vascular endothelial cells and angiogenesis, and has low toxicity, and thus promotes healing of burns, wounds, postoperative tissues and the like. It can be used as a therapeutic agent such as an agent. Further, it can be used as a reagent for promoting cell culture.

In order to use the hst-1 protein as a medicament for the above treatment, a pharmaceutical composition (eg, injection, tablet, tablet, It can be safely administered parenterally or orally to a warm-blooded animal (eg, human, mouse, rat, hamster, rabbit, dog, cat) as a capsule, liquid, ointment.

Formulation as the above-mentioned pharmaceutical composition is carried out according to a conventional method.

When the hst-1 protein is used as the above-mentioned medicine, for example, an appropriate amount is selected from the daily dose of about 10 ng to 10 μg / kg and administered to the above-mentioned warm-blooded animal in consideration of the administration route, symptoms and the like. Is done.

The hst-1 protein thus purified is
It can be used as a reagent for promoting cell culture. In this case, hst-1 protein is preferably added to medium 1
It is preferable to add about 0.1 to 10 μg per medium to the medium.

In the specification and drawings of the present invention, when bases and amino acids are indicated by abbreviations, IUPAC-IUB Commision on B
This is based on the abbreviation by iochemical Nomenclature or the abbreviation commonly used in the art, and examples thereof are described below. Further, when an amino acid can be an optical isomer, the L-isomer is indicated unless otherwise specified.

DNA: deoxyribonucleic acid cDNA: complementary deoxyribonucleic acid A: adenine T: thymine G: guanine C: cytosine RNA: ribonucleic acid dATP: deoxyadenosine triphosphate dTTP: deoxythymidine triphosphate dGTP: deoxyguanosine triphosphate dCTP: deoxy Cytidine triphosphate ATP: Adenosine triphosphate Tdr: Thymidine EDTA: Ethylenediaminetetraacetic acid SDS: Sodium dodecyl sulfate Gly: Glycine Ala: Alanine Val: Valine Leu: Leucine Ile: Isoleucine Ser: Serine Thr: Threonine Cys: Cysteine Met: Methionine Glu: Glutamic acid Asp: Aspartic acid Lys: Lysine Arg: Arginine His Histidine Phe: Phenylalanine Tyr: Tyrosine Trp: Tryptophan Pro: Proline Asn: Asparagine Gln: Glutamine Clz: 2-Chlorobenzyloxycarbonyl BrZ: 2-Bromobenzyloxycarbonyl Bzl: benzyl Bo c: t-Butoxycarbonyl The transformant produced in Reference Example 2 described below and the hybridoma produced in Example 1 described below were obtained from the Research Institute of Fermentation (IFO) and the Research Institute of Microbial Industry and Technology of the Ministry of International Trade and Industry of the Ministry of International Trade and Industry. Depositary (FRI). The date and number of these deposits are shown in Table 1 below. In addition, FRI F
The ERM BP number indicates the deposit number of the deposit under the Budapest Treaty.

EXAMPLES Hereinafter, the present invention will be described in more detail with reference examples and examples, but the present invention is not limited thereto.

The human recombinant bFGF (rhbF
GF) is Iwane et al., Biophysical Biochemical
Research Communication (Biophys.Biochem.Res.
Commun.) 146, 470 (1987 ), European Patent Application Publication 23
What was manufactured by the method of the 7,966 gazette was used.

Regarding human recombinant aFGF, refer to Reference Example 1 described later.
Used in the method described in (1).

As the human recombinant hst-1 mutein N27 (mutein in which amino acid number 27 is deleted from the N-terminus of hst-1), the one produced by the method described in Reference Example 2 described later was used.

Reference Example 1 (Preparation of Recombinant Human aFGF)
5 , 960 (1987); Journal of Biological
Chemistry (Journal of Biological Chemistry) 26
3 , 16471 (1988), and the ICSU short report (Sho
rt Report) volume 8, Advances in Gene Technology: Protein Engineering and Production (Pr
otein Engineering and Production), Proceedings of
the 1988 Miami Bio / Technology Winter Symposium, IRL
It was manufactured by the following method with reference to the method described in Press, page 110.

(A) Construction of Expression Plasmid The chemically synthesized cDNA of human aFGF (FIG. 2) was converted to pUC18.
[Methods in Enzology
ymology), 101 , 20-78 (1983)], cut the plasmid pTB917 with BspMI, made this site blunt-ended by the reaction of a large fragment, and digested with BamHI to obtain a plasmid.
A 45 Kb DNA fragment was prepared. PET3c (Studier, FW et al., Journal of Molecular Biology (J. Mo.)
l. Biol.) 189 : 113-130 (1986)] to convert pET3c into Nde.
T4 DNA after digestion with I and blunt ends with large fragment
The Nco I linker 5'-CCATGG-3 'was ligated by ligase. After cutting this plasmid with NcoI and blunting the site with DNA polymerase large fragment,
Cut with BamHI to remove the S10 sequence and place there
The blunt BspM I-BamHI fragment was incorporated using T4 DNA ligase to obtain pTB975 (FIG. 3).

(B) Expression of human aFGF cDNA in E. coli Next, λ phage DE3 (Studier, FW et al., Journal of Molecular Biology (J. Mol.
Biol.) 189 : 113-130 (1986)).
Plasmid plysS with 7 phage lysozyme genes
(Studier, FW et al., Journal of Molecular Biology (J. Mol. Biol.) 189 : 113-130 (1986)), and E. coli MM294 (DE3) / plysS strain was prepared. After introducing pTB975 into this E. coli strain, E. coli MM294 (DE3) / pLysS, p
I made TB975. 35 μg / ml ampicillin, 10
After culturing at 37 ° C. in a medium containing μg / ml chloramphenicol, when the turbidity reaches Klett170, isopropyl β-D thiogalactoside (IPTG) was added to a final concentration of 0.5 mM, and the culture was further continued for 3 hours. Continued. The cells were collected by centrifugation, washed with ice-cold PBS, re-collected, and -20 until use.
Stored in ° C.

(C) Purification of human aFGF 100 ml of ice-cold 10 mM Tris-
HCl (pH 7.4), 10 mM EDTA, 0.6 M NaCl, 10% sucrose, 0.25 mM
The suspension was suspended in PMSF, and egg white lysozyme was added to a concentration of 0.5 mg / ml. After leaving in ice for 1 hour, the mixture was incubated at 37 ° C. for 5 minutes, subjected to sonication under ice cooling (twice for 20 seconds), and centrifuged (SORVALL, 18K rpm, 30 min, 4 ° C.) to obtain a supernatant. . This supernatant was added to 200 ml of ice-cold 20 mM Tris-HCl (pH 7.4),
Mix with 20 mM EDTA, 20 mM Tris-HCl (pH 7.4), 1 mM EDTA,
The sample was applied to a heparin sepharose column (2.5 × 4 cm in diameter) equilibrated with 0.2 M NaCl. The column was loaded with 150 ml of 20 mM Tris-
HCl (pH 7.4), 1mM EDTA, 0.5M NaCl, then 20mM Tr
The protein was eluted with is-HCl (pH 7.4), 1 mM EDTA, and 1.5 NaCl. The solution was fractionated every 6 ml, and the OD ₂₈₀ was monitored to collect the second peak fraction (No. 8-11, 24 ml in total) (No. 4).
Figure). An equivalent volume of 20 mM Tris-HCl (pH
7.4), 1 mM EDTA, 2M (NH ₄ ) ₂ SO ₄ were mixed and mixed with 20 mM Tris-H
It was applied to a phenyl sepharose column (2.5 × 8 cm in diameter) equilibrated with Cl (pH 7.4), 1 mM EDTA, 1 M (NH ₄ ) ₂ SO ₄ (flow rate).
0.5 ml / min.). After washing the column with 20 ml of the same buffer,
1M to 0M ammonium sulfate linear concentration gradient (flow rate 0.5m
l / min., gradient time 200 minutes) and eluted fraction 40-5
5 were collected (FIG. 5) and used as purified human aFGF.

(D) Reversed phase C4 HPLC A 0.2 mg / ml solution of purified human aFGF 1.2 mg / ml was mixed with 0.1% trifluoroacetic acid (TFA), applied to a reversed phase C4 column (VYDAC), and 0% to 90% in the presence of 0.1% TFA. The elution pattern was examined by applying a linear concentration gradient of% acetonitrile. Flow rate 1ml / mi
n., with a gradient time of 60 minutes (FIG. 6).

(E) Biological activity The activity of human aFGF was determined by the method of Sasada et al. (Sasada et al., Molecular Cell Biology 8 : 588).
According to -594 (1988), induction of DNA synthesis in mouse BALB / c3T3 cells was measured using [ ³ H] thymidine incorporation as an index. At the time of addition of the sample, a heparin (SIGMA Grade I) solution was mixed into the medium and the sample as needed.

Reference Example 2 (Preparation of Human Recombinant hst-1 Mutein N27) (a) Construction of Expression Plasmid Plasmid pKO6c5 containing human hst-1 cDNA [Processings of the National Academy of Sciences (Proc. Natl. Acad. Sci. (USA) 84 , 2980-298
4 (1987)] was digested with Hind III and blunt-ended by E. coli DNA polymerase I Klenow fragment reaction. Here BamH I
After ligation of the linker by T4 ligase reaction, BamHI
Cleavage with -Sty I gave a 0.49 kb DNA fragment. Synthetic oligonucleotides 5'TATGCCGGTGGCAGCGCAGCC3 'and 5'
A 0.51 kb NdeI-BamHI DNA fragment obtained by ligating CTTGGGCTGCGCTGCCACCGGCA3 ′ to the 5 ′ end of the 0.49 kb DNA (starting codon ATG, nucleotide No. 41 of human hst-1 cDNA)
The included) to 3-916, E. coli for expression having a φ10 promoter of the T7 phage vector pET3c [Gene (Gene) 56, 12
5-135 (1987)] and incorporated between NdeI and BamHI.
51 was obtained (FIG. 7).

(B) Expression of cDNA in E. coli λ phage DE3 (Studier, FW, et al., Journal of Molecular Biology (J. Mol. Bio)
l.) 189 : 113-130 (1986)), and the plasmid pLysS (Stu
Dier, FW et al., Journal of Molecular Biology (J. Mol. Biol.) 189 : 113-130 (1986)) was introduced to prepare E. coli MM294 (DE3) / pLysS strain.

The plasmid pTB1051 obtained in the above (a) was introduced into this E. coli MM294 (DE3) / pLysS strain, and the E. coli MM294 (DE
3) / pLysS, pTB1051 (IFO 14952, FERM BP-2621) was prepared. 10 μg / ml chloramphenicol, 35 μ
Cultured in L medium containing g / ml ampicillin, Klett value was about 1
At time 20, isopropyl β-D thiogalactopyranoside (IPTG) was added to a final concentration of 0.4 mM, and the culture was continued for another 4 hours. The cells were collected by centrifugation, washed with ice-cold phosphate buffered saline (PBS), re-collected, and stored at -20 ° C until use.

(C) Purification of recombinant hst-1 mutein Cells collected from a 10 liter culture were subjected to 250 ml of ice-cold 10 mM Tris
-HCl (pH 7.4), 10 mM EDTA, 0.5 M NaCl, 10% sucrose, 1
The suspension was suspended in mM PMSF, and egg white lysozyme was added to a concentration of 0.5 mg / ml. After leaving in ice for 1 hour, incubate at 37 ° C. for 5 minutes, sonicate under ice cooling (twice for 20 seconds), and centrifuge (SORVALL, 18K rpm, 30 min, 4 ° C.) to obtain a supernatant.
This was used as a cell extract.

250 ml of the cell extract was added to 20 mM Tris-HCl pH 7.6, 0.5 M NaCl
Nucleic acid components in the extract were removed by passing through Q Sepharose (Pharmacia (column (diameter: 5 × 5 cm)) equilibrated with the solution. The flow-through solution from the column and 20 mM Tris-HCl, pH7.
6. The combined column washes with 0.5M NaCl solution were collected (Q
Sepharose flow-through fraction 450 ml). This fraction was applied to a high performance liquid chromatography apparatus (Gilson) equipped with a heparin column Shodex AF-pak HR-2094, (2 cm ID × 25 cm, manufactured by Showa Denko). The column was washed with 20 mM Tris-HCl p
After washing with H7.6 solution, then 20 mM Tris-HCl pH7.6, 0.5 M NaCl solution, 20 mM TriS-HCl pH7.6, in buffer,
Linear gradient elution of 0.5M to 2M NaCl
ution, 180 min, flow rate 6.0 ml / min).

The elution pattern is shown in FIG. In FIG. 8, the vertical axis indicates the OD ₂₈₀ absorption value and the NaCl concentration in the gradient. The horizontal axis shows the fraction number, ti
Gradient elution was started at me0. Fractions were collected every 0.75 minutes. Table 1 shows the specific activities of these proteins and the recovered amount of hst-1 mutein. FIG. 9 shows the SDS-PAGE (12.5% polyacrylamide gel) of each fraction giving a peak.

(D) Reverse-phase C4HPLC About half the amount of eluted fraction # 56 from the heparin HPLC column (300 μg of protein) was applied to a reverse-phase C4 column (VYDAC) to obtain 0.1% T
The elution pattern was examined by applying a linear concentration gradient of 0% to 90% acetonitrile in the presence of FA. The flow was performed at a flow rate of 1 ml / min and a gradient time of 60 minutes (FIG. 10). SDS-PAGE (12.5% polyacrylamide gel) of the peak fraction detected at 36 to 37 minutes
Is shown in FIG. 11 together with the eluted fraction 56 from the heparin column.

In FIG. 11, 1 is a molecular weight marker (50 ng).
2 is the fraction 56 (50 ng) eluted from the heparin HPLC column, 3 is the fraction 56 (100 ng) eluted from the heparin HPLC column, 4 is the reverse phase HPLC eluted fraction (50 ng), and 5 is the reverse 12.5% of phase HPLC elution fraction (100ng)
The patterns of polyacrylamide gel electrophoresis are shown. The specific activity of these proteins is
(RhbFGF) (European Patent Publication No. 237,966)
When it was 1.00, it was measured as 0.43. Changes in the specific activity during these purification steps and the amount of recovered hst-1 mutein N27
It is shown in the table. In Table 2, the activity of FGF derived from bovine pituitary gland (Takara Shuzo) was defined as 1 for specific activity.

Thus, having the amino acid sequence shown in FIG.
hst-1 mutein N27 was obtained.

(E) Biological activity The activity of hst-1 mutein was determined by the method of Sasada et al.
Et al., Molecular Cell Biology
l), 8 : 588-594 (1988)), mouse BALB / c3T3
The induction of DNA synthesis in cells was measured using [ ³ H] thymidine incorporation as an index. The results are shown in Table 2 above.

Example 1 (1) Immunization: 50 μg of antigen hst-1 mutein N27 dissolved in 0.3 ml of physiological saline against BALB / c mice (♀8 weeks old) (Reference Example 2)
Was mixed with the same amount of Freund's complete adjuvant (Difco) and injected subcutaneously. Two weeks later, a mixture of the same amount of the antigen and 0.3 ml of Freund's incomplete adjuvant was subcutaneously administered again. Two and four weeks later, the same booster immunization was performed, and two weeks after the fourth immunization, 72 μg of hst-1 mutein N27 dissolved in physiological saline was inoculated intravenously.

(2) Cell fusion: Three days after the final administration of the antigen, the spleen was excised from the immunized mouse obtained in (1) above to obtain cells to be used for cell fusion.
These cells were suspended in a medium (hereinafter abbreviated as IH medium) in which Iskov medium and Ham F-12 medium were mixed at a ratio of 1: 1.

Mouse myeloma cells P3-X63-Ag · 8UI were subcultured in RPMI 1640 medium containing 10% fetal bovine serum under the conditions of 5% carbon dioxide and 95% air.

The cell fusion was carried out according to the method established by Kohler and Milstein et al. [Koehler, G. and Milstein, G .: Nature 256 , 495 (1975)]. Mix 2.4 × 10 ⁷ myeloma cells and 1.2 × 10 ⁸ immunized lymphocytes obtained by the method described above, spin down, 0.3 ml
45% polyethylene glycol 6000 dissolved in IH medium
(Hereinafter PEG6000) was added dropwise. PEG6000 solution should be 37 ° C in advance
And slowly added dropwise. 8 minutes later IH pre-warmed to 37 ° C
After adding 0.5 ml per 1 minute of the medium to 10 ml, the mixture was centrifuged at room temperature for 600 rpm for 15 minutes to remove the supernatant. The cell precipitate was suspended in 200 ml of IH medium containing 20% calf serum, and 768 wells were seeded at 100 μl each on a 96-well microplate (Nunc). One day later, an IH medium (containing 20% calf serum) containing HAT (hypoxanthine 1 × 10 ⁻⁴ M, aminopterin 4 × 10 ⁻⁷ M, thymidine 1.6 × 10 ⁻⁵ M) (hereinafter referred to as HAT medium). ) Was added to each well in an amount of 100 μl, and every third day, half of the medium was replaced with HAT medium. The cells grown in this way are hybrid cells.

(3) Search for antibody-producing cells: recombinant hst purified by the method described in Reference Example 2
-1 Mutein N27 was diluted to a concentration of 10 µg / ml with a 0.01 M carbonate buffer (pH 8.5), and 100 µl of the diluted solution was placed in each well of a 96-well immunoplate (manufactured by Nunc) and allowed to stand at 4 ° C overnight.
The hst-1 mutein N27 was bound to the solid layer. After washing with a 0.01 M phosphate buffer (pH 7.0) containing 0.15 M NaCl, 200 μl of a 0.01 M phosphate buffer containing 1% bovine serum albumin (BSA) is added to block excess binding sites. The wells were injected and stored in a cool place until use. 96 obtained by binding the human hst-1 mutein N27 obtained as described above.
100 μl of the hybrid cell culture supernatant was added to the well immunoplate.
And incubated at room temperature for 2 hours. After removing the culture supernatant and washing, a horseradish peroxidase (HRP) -labeled anti-mouse IgG goat antibody (Kappel) was added as a secondary antibody, and the mixture was incubated at room temperature for 2 hours. After removing the secondary antibody and washing the wells well, a peroxidase substrate solution (containing 0.02% H ₂ O ₂ and 0.15% o-phenylenediamine
pH 5.5 sodium citrate buffer) and add 25
After reacting at 10 ° C. for 10 minutes and stopping the enzyme reaction by adding 2N-sulfuric acid (100 μm), the absorbance at 492 nm was measured using an automatic colorimeter for microplate (MTP-32, manufactured by Corona) (ELISA method). ). By this method, the presence of bound antibody was observed in 7 wells.

(4) Cloning of hybrid cells: A 96-well microplate in which 5 × 10 ⁵ mouse thymocytes were seeded as vegetative cells in advance so that the number of cells in these wells was 0.5 per well. The cloning was carried out. As a result, 1 representative cloned cell was obtained from each well, and a total of 7 cloned cells, namely, HS-24, HS-101, HS-114, and HS-1 were obtained.
31 (IFO 50237, FERM BP-2906), HS-210, HS-233 (IFO
50238, FERM BP-2907) and HS-276.

(5) Production of antibody: 7 obtained by cloning in (4) above
Each of the hybridoma clones is
BALB / c in which 5 ml of mineral oil was administered intraperitoneally
Mice were inoculated into the abdominal cavity by inoculating 1 × 10 ⁶ mice per ascites. Hybridoma intraperitoneally
Ten days later, ascites was collected. About 10 each ascites obtained
The monoclonal antibody was purified from the ml according to the method of Stalin et al. [Journal of Biological Chemistry, 256 , 9750-9754 (1981)]. First, centrifugation was performed at 10,000 rpm for 15 minutes to remove the fibrin-like substance from the ascites, and then phosphate buffer-saline (PBS: 8.1 mM-Na ₂ HPO ₄ , 1.5
_{mM KH 2 PO 4, 27mM KCl} , 137mM NaCl, 280nm of ultraviolet absorption at pH7.2) (A ₂₈₀₎ was diluted to a concentration showing the value of 12-14. After dilution, a saturated ammonium sulfate solution was added to the sample to a concentration of 47%, salting out was performed for 60 minutes with stirring at 4 ° C, and then centrifugation (10,000 rotations, 15 minutes) was performed to obtain a precipitate. The precipitate was dissolved in a 20 mM Tris buffer solution (pH 7.9) containing 50 mM NaCl, and the solution 2 was dialyzed. Two hours later, the same dialysate was replaced with two new ones, and dialysis was performed for another 15 hours. After dialysis to remove precipitate
Centrifuge 10,000 rpm for 15 minutes, 20 supernatants value of the A ₂₈₀
It was prepared to have a concentration of 30. This sample was equilibrated with a sufficient amount of Tris buffer solution containing 50 mM NaCl in 20 ml of DE.
Apply to AE cellulose column (Whatman DE ₅₂ ), 50mM N
After washing well with aCl-containing Tris buffer solution, 50 mM-500 mM N
Using a concentration gradient solution of the same buffer containing aCl, fractionation was performed at an outflow rate of 1.5 ml / min, and the fractions were passed through and concentrated, and the purified monoclonal antibodies HS-24, HS-101, HS-114, H
S-131, HS-210, HS-233, and HS-276 were obtained.

The purity of the antibody was confirmed by SDS-polyacrylamide gel electrophoresis according to the method of Laemli et al. [Nature, 227 , 680-685 (1970)]. That is, ammonium sulfate salting out, the fraction passed through a DEAE cellulose column, reduced with 2-mercaptoethanol, acrylamide concentration 10%
Was run at 180 volts for 2.5 hours using the gel. As a result, in each of the monoclonal antibodies, two bands of a H chain were observed at a molecular weight of about 52K and an L chain was observed at a molecular weight of about 28K.

(6) Measurement of antibody subclass: The antibody subclass was measured by the following method. That is, 100 μl of each hybridoma culture supernatant cloned into a 96-well immunoplate coated with the recombinant hst-1 mutein N27 obtained in Reference Example 2,
Incubated for hours. After removing the culture supernatant and washing, 100 μl of an antibody against rabbit anti-mouse IgG1, IgG2a, IgG2b, IgG3, K chain and λ chain (Kappel) was added, and the mixture was incubated at room temperature for 2 hours. After removing each antibody and washing, HRP-labeled goat antibody rabbit IgG antibody (Kappel) was added and incubated at room temperature for 2 hours. After removing the labeled antibody and washing well, an enzymatic reaction was performed by the method described in (3) above, and the absorbance was measured. As a result, three types of monoclonal antibodies HS-24, HS-114 and HS-131 were of IgG1.K type, and the other four types of HS-101, HS-210, HS-233 and HS-276 were of IgG2b.K type. Turned out to be a subclass.

Example 2 (1) Enzyme labeling of antibody 1.5 ml of purified HS-131 antibody (5.8 mg / ml) was dialyzed against 0.1 M acetate buffer (pH 4.5) containing 0.1 M NaCl at 4 ° C for 20 hours, Add pepsin (Sigma, USA) (0.3 mg) and add 3
Digested at 7 ° C for 20 hours. The reaction was stopped by adjusting the pH to 8 with 1 M Tris, and separated using a column of Ultrogel AcA44 (manufactured by IBF, France) with 0.02 M borate buffer (pH 8.0) containing 0.15 M NaCl as eluent. ') ₂ was obtained.

This was concentrated to 1 ml and dialyzed against 0.1 M phosphate buffer (pH 6.0) at 4 ° C. for 20 hours to obtain 0.2 M mercaptoethylamine, 5 mM EDTA, 0.1 M phosphate buffer (pH 6.0) 0.1 The mixture was added and reduced at 37 ° C. for 90 minutes. The reaction solution was separated by Sephadex G-25
Separation was performed using fine (Pharmacia Fine Chemicals, Sweden) (φ1 × 60 cm) using 5 mM EDTA and 0.1 M phosphate buffer (pH 6.0) as an eluent to obtain a Fab ′ fraction. On the other hand, 10 mg of horseradish peroxidase (HRP) (Boehringer Mannheim, West Germany) was dissolved in 1.4 ml of 0.1 M phosphate buffer (pH 7.0), and N- (γ-maleimidobutyloxy) succinimide (GMBS) 2.1 mg was dissolved. Dissolved in N, N-dimethylformamide (DMF) 100μ and added at 30 ° C.
After stirring for 60 minutes, use Sephadex G-25 fine (φ1.2 × 60cm)
Separation was performed using 0.1 M phosphate buffer (pH 7.0) as an eluent to obtain HRP having a maleimide group introduced therein (maleimidated HR).
P). Fab ′ and maleimidated HRP were mixed at a molar ratio of 1: 1 and reacted at 4 ° C. for 20 hours. The reaction solution is Ultrogel A
Separation was performed using a 0.1 M phosphate buffer (pH 7.0) as an eluent on a column of cA44 to obtain an enzyme-labeled antibody (HS-131-HRP).

(2) Preparation of antibody-bound solid phase The purified HS-233 antibody was diluted to a concentration of 10 µg / ml with a 0.01 M carbonate buffer (pH 8.5), and 100 µl thereof was added to each well of a 96-well immunoplate. After standing at night, the antibody was bound to the solid phase. After washing with 0.01 M phosphate buffer (pH 7.0) containing 0.15 M NaCl, inject 200 μl of 0.01 M phosphate buffer containing 1% BSA into each well and store in a cool place until use. did.

(3) Sandwich EIA method 100 μl of hst-1 mutein N27 solution prepared at various concentrations
Was placed in wells conjugated with the antibody and incubated at 4 ° C.-overnight. After removing the hst-1 mutein N27 solution, 100
100 μl per well of HRP-labeled HS-131 antibody diluted 1: 2
In addition, it was incubated at room temperature for 2 hours. After removing the labeled antibody, an HRP substrate solution was added, and the enzymatic reaction was performed in the same manner as described in Example 1, and the absorbance at 492 nm was measured. As a result, the detection limit of hst-1 mutein N27 in this measurement system was 1.2 Pg / well, enabling detection at a very low concentration (FIG. 13).

(4) Specificity of sandwich EIA In order to examine whether the set sandwich EIA is specific to hst-1, human recombinant aFGF prepared at various concentrations (obtained by the method described in Reference Example 1) And human recombinant bFGF, bovine aFGF and bFGF (R
& D System Co., Ltd.) as an antigen. That is, 100 μl of the above antigen preparation solution was added to the well to which the HS-233 antibody was bound, and the mixture was incubated at 4 ° C. for overnight. After removing the antigen, a 100-fold diluted HS-131-HRP solution was added at 100 μl per well, and the presence or absence of reactivity was examined in the same manner as described above. As a result, human aFGF and human
Even when bFGF, bovine aFGF and bovine bFGF were at a high concentration of 1 μg / ml, they were not detected in this sandwich EIA,
It was found that the system specifically recognized 1 protein (No.
Fig. 14: Results for human aFGF and human bFGF alone are shown).

(5) Influence of heparin It was examined whether the presence of heparin would affect the sandwich EIA. That is, heparin was added to the hst-1 mutein N27 solution prepared at various concentrations at 10 μg /
ml or 100 μg / ml, and add sandwich EIA
Was served. As a result, the ability of this EIA to recognize the hst-1 protein was hardly affected by the presence of heparin.
g / well detection sensitivity was maintained (Figure 15).

Effects of the Invention Since the monoclonal antibody of the present invention specifically binds to hst-1 protein and has high binding ability, it can be advantageously used as a reagent for measuring hst-1 protein.

Some of the monoclonal antibodies of the present invention have a neutralizing activity, can measure active hst-1 protein, and may be used as a therapeutic agent.

[Brief description of the drawings]

FIG. 1 shows the amino acid sequence of the mature protein of hst-1, FIG. 2 shows the cDNA sequence of chemically synthesized human aFGF, and FIG. 3 shows the construction of plasmid pTB975. FIGS. 4, 5 and 6 show human aF in Reference Example 1.
It is a figure regarding the column chromatogram in refinement | purification of GF. FIG. 7 is a construction diagram of the plasmid pTB1051 in Reference Example 2, and FIGS.
It is a figure regarding the column chromatogram in 1 mutein purification. 9 and 11 correspond to FIGS. 8 and
FIG. 11 is an electrophoretogram of peak components in the column chromatography in FIG. 10. FIG. 12 is an amino acid sequence diagram of hst-1 mutein of Reference Example 2. FIG. 13, FIG. 14 and FIG.
1 is a graph relating to the detection of -1 mutein and its specificity.

──────────────────────────────────────────────────続 き Continued on the front page (51) Int.Cl. ⁷ Identification symbol FI G01N 33/577 C12N 15/00 ZNAC // (C12P 21/08 C12R 1:91) (72) Inventor Teruhiko Yoshida Nerima-ku, Tokyo 7-7-5-603, Hikarigaoka (72) Inventor Yuzo Ichimori 5-725, Motomachi, Hamadera, Sakai-shi, Osaka (72) Inventor Koichi Igarashi 66-3, Shimogamo-Miyazaki-cho, Sakyo-ku, Kyoto-shi, Kyoto ) Inventor Kouichi Kondo 3-6-3, Kabudai, Kizu-cho, Soraku-gun, Kyoto (56) References JP-A-2-487 (JP, A) Proc. Natl. Acad. Sc i. USA, 84 (9), 2980-2984 (1987) (58) Fields investigated (Int. Cl. ⁷ , DB name) C07K 16/00-16/46 BIOSIS (DIALOG) WPI (DIALOG)

Claims (10)

(57) [Claims] 1. A heparin binding secretory.
Monoclonal antibodies against the transforming factor (hst-1) protein having the following properties: (a) molecular weight: about 140-160 kDa, (b) acidic fibroblast growth factor (aFGF) and basic fibroblasts Does not cross-react with any of the growth factors (bFGF). (C) The immunoglobulin class belongs to IgG. 2. The antibody according to claim 1, wherein the hst-1 protein is a hst-1 deficient mutein. 3. The antibody according to claim 2, wherein the hst-1 deficient mutein is a mutein in which 1 to 43 consecutive amino acids of hst-1 have been deleted. 4. A cloned hybridoma comprising a mammalian spleen cell immunized with the hst-1 protein and a mammalian lymphoid cell, producing the monoclonal antibody according to claim 1. 5. The hybridoma according to claim 4, wherein the hst-1 protein is a hst-1 deficient mutein. 6. The hybridoma according to claim 5, wherein the hst-1 deficient mutein is a mutein in which 1 to 43 consecutive constituent amino acids of hst-1 have been deleted. 7. The method for producing a hybridoma according to claim 4, wherein spleen cells of the mammal immunized with the hst-1 protein are fused with lymphoid cells of the mammal, followed by cleaning. 8. The method according to claim 1, wherein the hybridoma according to claim 4 is grown in a liquid medium or in a peritoneal cavity of a mammal to produce and accumulate the monoclonal antibody according to claim 1, and to collect the monoclonal antibody. The method for producing the monoclonal antibody described above. 9. A method for detecting and quantifying hst-1 protein, comprising using the monoclonal antibody according to claim 1. 10. The method according to claim 9, wherein the enzyme immunoassay is performed.
Detection and quantification of hst-1 protein.