JPH08325296A - Antibody, hybridoma and their use - Google Patents

Abstract

PURPOSE: To obtain a therapeutic agent for diseases in which a human betacellulin protein participates and a means for diagnosing the diseases. CONSTITUTION: This antibody is capable of specifically binding to a human betacellulin protein or its mutein, especially a monoclonal antibody, having 140000-160000 molecular weight, divided into an immunoglobulin class belonging to IgG without carrying out the cross reaction with a human epidermal growth factor(EGF) and a human transforming growth factor a(TGF α) and capable of specifically binding to the human betacellulin protein and neutralizing biological activities of the human betacellulin protein. Furthermore, this means is capable of detecting and determining the betacellulin protein and further diagnosing diabetes or its complications, etc., in which the betacellulin protein participates.

Description

Detailed Description of the Invention

[0001]

BACKGROUND OF THE INVENTION 1. Field of the Invention The present invention relates to an antibody against a human betacellulin (BTC) protein, a hybridoma, a method for producing them, and uses thereof.

[0002]

2. Description of the Related Art The epidermal growth factor group consists of epidermal growth factors.
r, EGF) by Cohen, S .; [Journal of
Biological Chemistry (J. Biol. Che
m. ) 237 , 1555 (1962); Development of Biology (Dev. Biol.) 12 ,
394 (1965)], a number of factors have been found. It is considered that these factors have various functions such as differentiation, maturation, survival, function maintenance and proliferation of not only epithelial cells but also various cells.
Specifically, these factors are, in addition to the previously mentioned EGF,
Transforming growth factor alpha [transf
orming grow factor α: TG
F-α, Todaro GJ and DeLarco
JE, Nature 264 , 26 (1)
976); Marquardt H .; et al.
Proc Nats of the National Academy of Sciences USA
l Acad Sci USA) 80, 4684 (1
983)], amphiregulin [amphiregu
lin: Shoyab M. et al. Science 243 , 1074 (198)
9)], heparin-binding EGF [heparin-bi
nending EGF: HB-EGF, Higashiy
ama S. et al. Science 25
1 , 936 (1991)]. Human BTC protein is described in JP-A-6-87894 (EP-A 0555).
785), and also Biochemical and Biophysical Research Communications (B
iochem. Biophys. Res. Commu
n. ) 190 , 1173-1179 (1993). The BTC protein has been found as a novel cell growth factor produced by pancreatic beta tumor cells derived from transgenic mice [Shing. Y et al.
Science 259 , 1604 (1993)]
Furthermore, the human BTC gene was cloned based on the nucleotide sequence of the gene, and the properties of the BTC protein were examined. As a result, (1) mature BTC protein is produced by processing a precursor molecule having a transmembrane domain at the C-terminus. (2) BTC gene is a normal mouse kidney,
It is expressed in lung, liver, and pancreatic beta cells.
(3) BTC protein exhibits a growth promoting activity on vascular smooth muscle cells and retinal pigment epithelial cells. (4) BTC protein acts as a ligand to EGF receptor [Watana]
be T.B. et al. Journal of Biological Chemistry (J. Biol. Chem.) 2
69 , 9966 (1994)]. From these things, B
TC protein plays an important role in various organs, and it is considered that abnormal expression thereof may cause a disease. In addition, it may contribute to the proliferation of smooth muscle cells involved in the development of arteriosclerosis, especially in the development of diabetic arteriosclerosis, diabetic vascular complications such as diabetic retinopathy, or cell canceration. It may be involved. An antibody that inhibits the activity of the human BTC protein is considered as one of the therapeutic agents for the diseases in which the BTC protein is involved, but there is currently no report on the antibody against the human BTC protein. Further, as one of means for diagnosing the above-mentioned diseases, it is considered to measure the human BTC protein concentration in body fluid, but it has not been achieved yet.

[0003]

[Problems to be Solved by the Invention] The human BTC protein is
Due to its abnormal expression (overexpression), it may be involved in the development of arteriosclerosis, especially in the development of diabetic vascular complications, or the increase in malignancy of cancer cells.
Inhibiting the excessive activity of C protein may be a therapeutic agent for these. In such a disease, it is possible to diagnose the disease by tracing the amount of human BTC protein in the blood. However, in order to measure the human BTC protein which is present only in a trace amount in the body fluid, the sensitivity is High measurement method is required.

[0004]

In view of the above situation, the present inventors have prepared an antibody that enables highly sensitive measurement of human BTC protein and neutralizes the action of human BTC protein. As a result of further research, the present invention has been completed. That is, the present invention provides (1) an antibody that specifically binds to human betacellulin protein or a mutein thereof, and (2) human betacellulin protein is SEQ ID NO: 1.
It is a protein having an amino acid sequence represented by (1)
The antibody described in (1) or (2), wherein (3) the antibody is a monoclonal antibody, (4) human epidermal growth factor (EGF), human transforming growth factor α (TGFα) and mouse betacellulin. Does not cross-react with at least one of the proteins (1), (2)
Alternatively, the antibody described in (3), (5) human epidermal growth factor (EGF) and human transforming growth factor α.
A monoclonal antibody that does not cross-react with (TGFα), belongs to IgG, and specifically binds to human betacellulin protein or its mutein, and neutralizes its biological activity. (6) Recognizing the amino acid sequence of the 31st (Arg) to 80th (Tyr) of the amino acid sequence represented by SEQ ID NO: 1, which does not cross-react with betacellulin protein (1), ( 2), (3), (4) or (5) antibody, (7) a clone consisting of mammalian spleen cells immunized with human betacellulin or a mutein thereof, and allogeneic or xenogeneic lymphoid cells (8) The hybridoma described in (7) above is grown in a liquid medium or in the abdominal cavity of a mammal to give a monoclonal antibody. Generating body, accumulation allowed, and collecting it, the (5) preparation of monoclonal antibody according, (9) above (1), (2),
(3), (4), (5) or (6) The method of detecting and quantifying a human betacellulin protein or a mutein thereof, which comprises contacting an antibody with a subject.
The antibody according to (1), (2), (3), (4), (5) or (6) is brought into contact with a subject to determine the amount of human betacellulin protein or its mutein in the subject. A method for diagnosing diabetes or its complications characterized by quantifying (11) above (1), (2), (3), (4),
(5) or a diagnostic agent for diabetes or its complications comprising the antibody according to (6), (12) above (1),
(2), (3), (4), (5) or (6) The diagnostic kit for diabetes or its complications comprising the antibody according to (6), and (13) above (1), (2), (3),
Purification of human betacellulin protein or its mutein, which comprises contacting the antibody according to (4), (5) or (6) with a crudely purified sample to isolate human betacellulin protein or its mutein It is about law.

Human BTC to which the antibody of the present invention is bound
As a protein, BTC-like activity, namely fibroblasts,
Any human-derived protein having a cell growth promoting action such as vascular smooth muscle cells and retinal pigment epithelial cells may be used. Natural (eg, liver, kidney, etc.)
It may be derived or may be a recombinant protein produced by a genetic engineering method. Specifically, as a human-derived BTC protein, for example, a mature protein having the amino acid sequence represented by SEQ ID NO: 1 (Japanese Patent Laid-Open No.
No. 87894) or a precursor protein having the amino acid sequence represented by SEQ ID NO: 2. These BTC proteins may be simple proteins composed only of amino acids, or may be complex proteins such as glycoproteins, lipoproteins, heme proteins, metalloproteins, flavoproteins and phosphoproteins. When it is a glycoprotein, examples of the sugar chain include neutral sugars such as D-mannose, D-galactose and L-fructose, amino sugars such as D-glucosamine and D-galactosamine, and sialic acid. Examples of the mutein of human BTC protein include a deletion type mutein in which at least one constituent amino acid of the above BTC protein is deleted, and at least one constituent amino acid of BTC protein is replaced with another amino acid. Substitution type muteins, addition type muteins in which at least one amino acid is added to BTC protein, and the like are used. The number of amino acid deletions, substitutions or additions is
Any number may be used as long as it does not lose the original function of the BTC protein. Specifically, SEQ ID NO: 1 or SEQ ID NO: 2
The amino acid sequence of about 1 to 40 amino acids of the amino acid sequence represented by SEQ ID NO: 1 or about 1 to 10 of the amino acid sequence of SEQ ID NO: 2 is replaced with another amino acid sequence. Amino acid sequence,
Alternatively, a protein having an amino acid sequence obtained by adding about 1 to 40 amino acids to the amino acid sequence represented by SEQ ID NO: 1 or SEQ ID NO: 2 is used. Among these muteins, deletion type muteins and the like are preferable,
For example, a protein having an amino acid sequence in which about 1 to 40 amino acids are deleted from the N-terminal of the amino acid sequence represented by SEQ ID NO: 1 is preferable. More specifically, for example, a deletion type mutein of human BTC protein having an amino acid sequence in which 12 or 30 amino acids are deleted from the N-terminal of the amino acid sequence represented by SEQ ID NO: 1 is used [Watanabe Et al., Journal of Biochemistry, 269: 9966 (199
Four)〕. Other muteins of BTC proteins include BT
Any one may be used, such as one in which the N-terminus of C protein is acylated, one that is glycosylated, one that is chemically modified such as a polyethylene glycol derivative, as long as the action of BTC protein is not lost. In particular, in the present invention, as the human BTC protein, it is preferable to use human BTC having the amino acid sequence of SEQ ID NO: 1 (hereinafter sometimes abbreviated as human BTC-I), in which case methionine is further added to the amino terminus. It may be a mixture of those having a residue (Met) and those not having one, and the aspartic acid (A
sp). The mutein of BTC protein is 30 from the N-terminal of the amino acid sequence of BTC-I having the amino acid sequence represented by SEQ ID NO: 1.
A deletion-type human BTC mutein (hereinafter sometimes abbreviated as human BTC-II) in which one amino acid is deleted is preferable. Among the BTC proteins or their muteins used in the present invention, the human BTC protein having the amino acid sequence represented by SEQ ID NO: 1 lacks 12 or 30 amino acids from the N-terminal of the amino acid sequence represented by SEQ ID NO: 1. A deletion type human BTC mutein having a lost amino acid sequence is known, but other BTC proteins and muteins thereof can be produced by a method known per se or a method analogous thereto.

The method for producing the antibody of the present invention will be described below. The monoclonal antibody that specifically binds to the human BTC protein or its mutein and neutralizes its biological activity is produced by immunizing a mammal with the human BTC protein or its mutein. Human B mentioned above
When immunizing with the TC protein, laboratory animals such as sheep, goats, rabbits, guinea pigs, rats, and mice are used as the mammals to be immunized. In order to obtain monoclonal antibodies, rats and mice are preferable, and particularly, A mouse is preferred. Immunization may be performed according to a known method. For example, when immunizing a mouse, subcutaneously, intraperitoneally, intravenously, intramuscularly,
It is possible to use any route such as intracutaneous route, but it is preferable to inject mainly subcutaneously, intraperitoneally or intravenously (particularly subcutaneously). In addition, the immunity interval, immunity, etc. are highly variable, and various methods are possible.
A method of using spleen cells that have been immunized ˜6 times, and about 1 to 5 days, preferably about 2 to 4 days after the final immunization is often used. The immunization amount is about 0.1 μg or more per mouse, preferably about 10 μg to 300 μg per peptide amount.
It is desirable to use. In addition, it is desirable to perform partial blood collection before removing the spleen, confirm the increase in antibody titer in the blood, and then perform a fusion experiment using spleen cells. The cell fusion of the above-mentioned spleen cells and lymphoid cells is suitable, for example, by removing excised mouse spleen cells with markers such as hypoxanthine-guanine-phosphoribosyltransferase deficiency (HGPRT ~) and thymidine kinase deficiency (TK ~). Same or different (preferably the same) myeloma [eg, P3-X63-Ag.8U1 (Ichimori et al. Journal of Immunological Methods 80 55 (1
985))] and the like. For example, it is produced by fusing according to the method of Keller and Milstein [Nature 256 : 495 (1975)]. That is, for example, myeloma cells and splenocytes at a ratio of about 1: 5,
For example, a fusion agent such as Sendai virus or polyethylene glycol (PEG) is used by suspending it in a medium (hereinafter referred to as IH medium) in which Iscove's medium and Ham's F-12 medium are mixed in a ratio of 1: 1. Of course, it is also possible to add dimethyl sulfoxide (DMSO) and other fusion promoters. The molecular weight of PEG is usually about 1,000 to 6,0.
00, time is about 0.5 to 30 minutes, concentration is about 10% to 80
% Is used, but as an example of preferable conditions, PE
By treating G6,000 at about 35 to 55% for about 4 to 10 minutes, efficient fusion can be achieved. The fused cells were prepared by using hypoxanthine-aminopterin-thymidine medium [HAT medium; Nature, 256 , 495 (197).
5)] etc. can be used to selectively proliferate.

The culture supernatant of the grown cells can be screened for the production of the desired antibody. The antibody titer can be screened as follows. That is, in this case, as a first step, the presence or absence of antibody production against the immunized peptide can be examined by a known method such as a radioimmunoassay (RIA) method or an enzyme immunoassay (EIA) method. With respect to, various modified methods are possible. As one example of a preferable measurement method, one method using EIA will be described. For carriers such as cellulose beads,
For example, a rabbit anti-mouse immunoglobulin antibody is coupled according to a conventional method, and a culture supernatant to be measured and mouse serum are added thereto, and a constant temperature is maintained for a certain period of time (about 4 to 40 ° C. in the present specification). The same applies to the following). After this, after washing the reaction product well,
Peptide labeled with an enzyme (enzyme and peptide are coupled and purified according to a conventional method and then purified) is added, and the mixture is reacted at a constant temperature for a fixed time. After thoroughly washing the reaction product, an enzyme substrate is added and the reaction is carried out at a constant temperature for a certain period of time, and then the produced color product can be measured by absorbance or fluorescence. It is desirable to clone cells in wells that show growth in a selective medium and show antibody activity against the peptide used for immunization by the limiting dilution method or the like. By similarly screening the supernatant of the cloned cells and increasing the number of cells in wells with high antibody activity, a monoclonal antibody-producing hybridoma clone showing reactivity with the immunized peptide can be obtained. The hybridoma cloned in this manner is specifically expressed, for example, in a liquid medium such as P
RMI-1640 [Moore, G. E. FIG. , Et. a
l. Journal of American Medical Association (J. Am. Med. Assoc.) 19
9, 549 between about 2-10 days, such as medium supplemented with about 0.1 to 40 percent bovine serum (1967)], preferably about 3 to 5
By culturing for one day, the monoclonal antibody can be obtained from the culture solution. In addition, the desired antibody can be obtained by inoculating the abdominal cavity of a mammal with the above monoclonal antibody-producing hybridoma, allowing the hybridoma cells to proliferate, and collecting ascites. For this purpose, for example, in the case of a mouse, a mouse such as BALB / c previously inoculated with a mineral oil or the like is about 1 × 10 ⁴ to 1 ×.
10 ⁷ , preferably about 5 × 10 ⁵ to 2 × 10 ⁶ of the above-described monoclonal antibody-producing hybridomas are intraperitoneally inoculated, and ascites fluid is collected after about 7 to 20 days, preferably about 10 to 14 days. The antibody produced and accumulated in ascites can be easily isolated as a pure immunoglobulin from the target BTC monoclonal antibody by, for example, ammonium sulfate fractionation, DEAE-cellulose column chromatography and the like. The polyclonal antibody of the present invention can be produced by a method known per se or a method analogous thereto. For example, as the immunizing antigen, human BTC protein or a mutein thereof, for example, a polypeptide having a part of the 31st (Arg) to 80th (Thr) amino acid sequence of the amino acid sequence represented by SEQ ID NO: 1, etc. Used. The polypeptide used as the immunizing antigen preferably has 5 or more amino acid residues, and more preferably 10 or more amino acid residues. For example, a polypeptide having 15 amino acid residues from the 66th position to the 80th position of the amino acid sequence represented by SEQ ID NO: 1 can be used as an immunogen. The polypeptide can be produced by a peptide synthesis method known per se or a method analogous thereto, and may be a solid phase synthesis method or a liquid phase synthesis method. A complex of an immunizing antigen and a carrier protein is prepared, and a mammal is immunized in the same manner as in the above-mentioned method for producing a monoclonal antibody, and an antibody-containing substance against BTC or its mutein is collected from the immunized animal to separate and purify the antibody. It can be manufactured. Regarding a complex of an immunizing antigen and a carrier protein used for immunizing a mammal, the kind of the carrier protein and the mixing ratio of the carrier and the hapten are such that if the antibody can be efficiently against the hapten immunized by coupling with the carrier. , What kind may be coupled at any ratio, but, for example, bovine serum albumin, bovine thyroglobulin, hemocyanin, etc. in a weight ratio of about 0.1 to 20, preferably about 1 to 1 hapten. 5
A method of coupling at a ratio of is used. Various condensing agents can be used for coupling the hapten and the carrier, and glutaraldehyde, carbodiimide, maleimide active ester, active ester reagent containing thiol group and dithiopyridyl group, etc. are used. The condensation product is administered to a mammal at a site where the antibody can be produced by administration, itself or together with a carrier and a diluent. Complete Freund's adjuvant or incomplete Freund's adjuvant may be administered to enhance the antibody-producing ability upon administration. The administration is usually performed once every 2 to 6 weeks, about 3 to 10 times in total. Examples include monkeys, rabbits, dogs, guinea pigs, mice, rats, sheep, goats and the like. The antibody is collected from, for example, blood, ascites, etc., preferably blood, etc. of the mammal immunized by the above method. The anti-BTC antibody titer in the antiserum can be measured in the same manner as the antibody titer of the hybridoma culture supernatant. The antibody is separated and purified by the same immunoglobulin separation and purification method as the above-mentioned monoclonal antibody.

The antibody of the present invention specifically binds to the various types of human BTC proteins described above with high sensitivity, and may be either a monoclonal antibody or a polyclonal antibody. Monoclonal antibodies are particularly preferred. The antibody of the present invention preferably has at least one of the following properties. a) Does not neutralize the biological activity of mouse BTC protein and
It neutralizes the biological activity of TC protein. b) It shows no immune cross-reactivity with human TGF-α and human EGF. c) belong to the immunoglobulin class IgG ₁ subclass,
The molecular weight is 140,000 to 160,000. d) The 31st position of the amino acid sequence of SEQ ID NO: 1 (Ar
It specifically recognizes the 80th (Tyr) amino acid sequence (50 amino acid sequence) from g). Examples of the mouse BTC protein include mature mouse BTC protein having an amino acid sequence represented by SEQ ID NO: 3 [Shing et al., Science (Science), 259: 1604 (1993)]. Mature human BT having BTC protein and amino acid sequence represented by SEQ ID NO: 1
The amino acid sequence is approximately 80% homologous to C protein. However, the antibodies of the present invention (particularly monoclonal antibodies)
Has an extremely unique property that it does not bind to mouse BTC protein but specifically binds to human BTC protein. For example, the human BTC monoclonal antibody produced from the hybridoma obtained in Example 2 described later has the characteristics shown in a) to d) above. The antibody of the present invention may be any antibody as long as it specifically binds to human BTC protein and neutralizes its biological activity. The biological activity of the human BTC protein neutralized by the antibody of the present invention includes, for example, a cell growth promoting action on fibroblasts, vascular smooth muscle cells, retinal pigment epithelial cells and the like.
Specific examples of the monoclonal antibody of the present invention include 1A1 antibody, 2B2 antibody and 5E5 antibody which are monoclonal antibodies produced by the anti-human BTC monoclonal antibody-producing hybridomas 1A1, 2B2, 5E5 and the like obtained in Example 2 described later. And so on. As the polyclonal antibody of the present invention, the 66th amino acid sequence (Gl of the amino acid sequence represented by SEQ ID NO: 1 obtained in Example 10 described later (Gl
Examples include those that recognize the amino acid sequence from u) to the 80th (Tyr). For example, the monoclonal antibody obtained in the below-mentioned Example is 1 ng / ml of human BT.
Induction of DNA synthesis in quiescent mouse 3T3 cells in the presence of C is suppressed by addition of 1 μg / ml. Moreover, 10 pg / ml of human BTC protein can be detected by a sandwich ELISA method using a monoclonal antibody and a biotinylated antibody.

Since the antibody of the present invention can specifically bind with high sensitivity to human BTC protein or its mutein, it can be used for the detection / quantification method of human BTC protein or its mutein. Examples of the method for detecting and quantifying the human BTC protein of the present invention or its mutein include, for example, the antibody of the present invention retained on a carrier (hereinafter, human BT
(C antibody may be abbreviated) and the antibody retained on the carrier is used to measure human BTC protein using a conjugate obtained by directly binding a labeling agent to an anti-human BTC antibody having an antigenic determinant site different from that of the antibody. It can be performed by an immunochemical assay. Of these, enzyme immunoassay is preferred. As the anti-human BTC antibody retained on the carrier used in the above-mentioned assay and the antibody having an antigenic determinant site different from that of the anti-human BTC antibody, the above-mentioned antibody of the present invention is used, but a monoclonal antibody is used. preferable. As the monoclonal antibody, 1A1 antibody, 2B2 antibody, 5E5 antibody and the like produced in Example 2 described later are preferable, and they may be appropriately selected.

Examples of the carrier in the anti-human BTC antibody retained on the carrier used in the above measuring method include gel particles (eg, agarose gel [eg, Sepharose 4B, Sepharose 6B (Pharmacia Fine Chemical Co., Sweden)). )], Dextran gel [eg, Sephadex G-75, Sephadex G-1
00, Sephadex G-200 (manufactured by Pharmacia Fine Chemicals (Sweden)), polyacrylamide gel [eg, Biogel P-30, Biogel P-6]
0, Biogel P-100 (manufactured by Bio-Rad Laboratories (USA)), cellulose particles [eg, Avicel (manufactured by Asahi Kasei), ion exchange cellulose (eg, diethylaminoethyl cellulose, carboxymethyl cellulose)], physical adsorbent [eg, Glass (eg, glass spheres, glass rods, aminoalkyl glass spheres, aminoalkyl glass rods), silicon pieces, styrene resins (eg polystyrene spheres, polystyrene particles), immunoassay plates (eg Nunc (Denmark)) ], Ion exchange resin (eg, weakly acidic cation exchange resin [eg, Amberlite IRC-50 (manufactured by Rohm and Haas Company (USA)), Zeocarp 226 (manufactured by Palmchid Company (West Germany))], weakly basic Anion exchange resin [eg Amberlite IR-4B, Dowe Box 3 (Dow Chemical Company (USA))]}, and the like. In order to hold the antibody on the carrier, but may apply the known conventional means, for example,
"Metabolism", Vol. 8 (1971), pp. 696, bromcyan method, glutaraldehyde method and the like can be mentioned. Further, as a simpler method, it may be physically adsorbed on the surface of the carrier.

Examples of the labeling agent in the anti-human BTC antibody to which the labeling agent is bound include radioisotopes, enzymes, fluorescent substances, luminescent substances and the like, but it is preferable to use enzymes. As the enzyme, those having stable and large specific activity are preferable, and peroxidase, alkaline phosphatase,
β-D-galactosidase, glucose oxidase and the like can be used, but peroxidase is preferable. As the peroxidase, those of various origins can be used, and examples thereof include peroxidase obtained from, for example, horseradish, pineapple, fig, sweet potato, broad bean, corn, etc.
Horseradish peroxidase extracted from horseradish, especially horseradish perox
Idase) (HRP) is preferred. Fab ′ as an antibody molecule for binding an antibody to peroxidase
In order to utilize the thiol group of, it is convenient to use a peroxidase into which a maleimide group has been introduced in advance. As a method for introducing a maleimide group into peroxidase, a maleimide group can be introduced via an amino group of peroxidase. For that, N-
A succinimidyl-maleimide-carboxylate derivative can be used, and N- (γ-maleimidobutyloxy) succinimide (sometimes abbreviated as GMBS) is preferable. Therefore, a certain group may be inserted between the maleimide group and peroxidase. GM
To react BS with peroxidase, both pH
It is carried out by reacting in a buffer solution of 6 to 8 at a temperature of about 10 to 50 ° C. for about 10 minutes to 24 hours. The buffer solution may be, for example, 0.1 at pH 7.0.
M phosphate buffer etc. are mentioned. The maleimidated peroxidase thus obtained can be purified by, for example, gel chromatography. Examples of the carrier used for performing the gel chromatography include Sephadex G-25 [Pharmacia Fine Chemicals (Sweden)], Biogel P-2 [Bio-Rad Laboratories (USA)].
Manufactured] and the like. The reaction between the maleimidated peroxidase and the antibody molecule can be carried out by reacting both in a buffer solution at a temperature of about 0 ° C. to 40 ° C. for about 1 to 48 hours. As the buffer solution, for example,
An example is a 0.1 M phosphate buffer solution containing 5 mM ethylenediaminetetraacetic acid sodium salt having a pH of 6.0. The peroxidase-labeled antibody thus obtained can be purified by, for example, gel chromatography. Examples of the carrier used when performing the gel chromatography include Sephadex G-25 (Pharmacia Fine Chemical Co. (Sweden)),
Biogel P-2 [manufactured by Bio-Rad Laboratories (USA)] and the like can be mentioned. Furthermore, a thiol group may be introduced into peroxidase and reacted with a maleimidated antibody molecule. Direct binding of an enzyme other than peroxidase to the antibody can be performed according to the case of peroxidase, and the glutaraldehyde method, periodate method, water-soluble carbodiimide method and the like known per se can be used.

Examples of test samples in the detection / quantification method of the present invention include body fluids such as urine, serum, plasma, and cerebrospinal fluid, or extracts of animal cells or fungi or culture supernatants thereof. As an example of the detection / quantification method of the present invention, the case where the labeling agent is peroxidase will be specifically described below.
It is not limited to peroxidase. First,
: An antigen-antibody reaction is carried out by adding an analyte containing a human BTC protein to be measured to an anti-human BTC antibody retained on a carrier, and then the peroxidase and the anti-human BTC protein antibody obtained above are added thereto. The reaction product is added. A substrate of peroxidase is added to the reaction product obtained in step (1), and the enzyme activity of the reaction product is determined by measuring the absorbance or fluorescence intensity of the resulting substance. : The above steps (1) to (5) are performed in advance on a standard solution of a known amount of human BTC protein, and the relationship between the human BTC protein and the absorbance or fluorescence intensity is prepared as a standard curve. : The absorbance or fluorescence intensity obtained for an analyte (test sample) containing an unknown amount of human BTC protein is applied to a standard curve to measure the amount of human BTC protein in the analyte. This method of detecting and measuring the human BTC protein or its mutein can be directly applied to the diagnosis of diabetes or its complications using the antibody of the present invention described below.

Furthermore, the antibody of the present invention can be used for the purification of human BTC protein or its mutein contained in a crudely purified sample. For purification of human BTC protein,
The purified antibody of the present invention is coupled to a suitable carrier such as activated agarose gel beads according to a conventional method and then packed in a column, and a sample containing crude human BTC protein such as culture supernatant or ruptured cells is obtained. Is applied to an antibody affinity column, adsorbed, washed, and then, for example, K
It can be efficiently purified by a chaotropic reagent such as SCN (potassium thiocyanate) or a method of elution under acidic conditions such that human BTC is not inactivated. The antibody column using the antibody of the present invention can be produced by the following method, for example, by coupling the monoclonal antibody of the present invention, which is purely purified from ascites fluid inoculated with a hybridoma, with an appropriate carrier. The carrier to be used may be any carrier as long as the human BTC protein is specifically and efficiently adsorbed after the coupling and can be appropriately eluted thereafter. Examples of the carrier include agarose, cellulose or acrylamide polymers. And polyacrylamide gel beads activated so that the primary amine of the protein can be easily bound,
For example, Affi-Gel-10 (manufactured by Bio-Rad) or the like is conveniently used in the method described below. Affi-Gel
The reaction between 10 and the antibody is carried out in a buffer solution of about 0.001 to 1M, preferably about 0.1M bicarbonate. The reaction conditions are about 0 ° C to 20 ° C, about 10 minutes to 24 hours, and various pHs are possible, but preferably about 4 ° C,
Conditions of about 4 hours, pH about 3-10 are used. The amount ratio of Affigel-10 and antibody to be mixed is larger as the amount of antibody is higher up to about 50 mg per 1 ml of Affigel, so more antibody will be attached, so any amount may be used within this range, but the binding efficiency and affinity column chromatography Considering purification efficiency, about 10 to 30 mg of antibody is conveniently used. The antibody-carrier conjugate thus obtained is washed well with the buffer used in the reaction and then left for several days, or the final concentration is about 0.05 to 0.10 M ethanolamine / hydrochloric acid, glycine, etc. By adding a compound having a primary amine to the reaction mixture at about 4 ° C for about 1 to 4 hours, or reacting a protein such as 1-5% bovine serum albumin (BSA) at 4 ° C overnight, remaining unreacted After blocking the active group, it can be used as an antibody column by packing in an appropriate column. In the case of purification with the above-mentioned antibody column, for example, a human BTC protein-containing sample is dissolved in a buffer solution near neutrality, for example, a phosphate buffer solution or a Tris / hydrochloric acid buffer solution and adsorbed on the antibody column.
Next, the column is washed with the same buffer, and then the human BTC protein is eluted. As the eluent, a weakly acidic solution such as an acetic acid solution, a solution containing polyethylene glycol, a solution containing a peptide that is more easily bound to an antibody than a sample, a high-concentration salt solution, or a combination thereof is used. Those that do not accelerate the decomposition of the above are preferable. The column eluate is neutralized with a buffer solution by a conventional method. If necessary, the above-mentioned purification operation using the antibody column can be performed again. In this way, a substantially pure human BTC protein that is substantially free of pyrogens and endotoxins is obtained. The substantially pure human BTC protein of the present invention has a protein content of 90% (w / w) or more of human BTC protein, and more preferably 95% (w / w) or more of BTC protein. Is mentioned.

Since the antibody of the present invention binds to human BTC or its mutein with high sensitivity, it is extremely useful as a reagent for detecting / quantifying human BTC or its mutein, a reagent for purifying human BTC protein or its mutein. . On the other hand, the abnormal expression of BTC protein or its mutein may contribute to the development of diabetes or its complications, and in these cases, these diseases can be predicted by measuring the amount of human BTC protein. . Further, as a disease caused by overproduction of human BTC protein, diseases such as arteriosclerosis and acute tumor are considered. In such a case, since the amount of human BTC produced in the living body is extremely small, a highly sensitive quantification method is necessary. For example, in the assay method using the monoclonal antibody of the present invention, human BTC protein can be assayed up to 10 pg / ml as shown in Example 8 described later. This is
This is a remarkable breakthrough in measuring human BTC in vivo, which is present in a very small amount. As described above, it is possible to diagnose diabetes or its complications by using the antibody of the present invention. In this diagnosis, the method for detecting and quantifying human BTC protein or its mutein was described above. , For example, an anti-human BTC antibody retained on a carrier,
And an immunochemical assay method for measuring human BTC protein using a conjugate in which a labeling agent is directly bound to an anti-human BTC antibody having an antigenic determinant site different from that of the antibody retained on a carrier. In particular, it is preferable to use the enzyme immunoassay method. The anti-human BTC antibody retained on the carrier used in the above diagnostic method and the anti-human BTC antibody having an antigenic determinant site different from that of the antibody include
Although the antibody of the present invention is used in each case, a monoclonal antibody is preferable. As the monoclonal antibody, 1A1 antibody, 2B2 antibody, 5E5 antibody and the like produced in Example 2 described later are preferable, and they may be appropriately selected. As for the carrier and the labeling agent, those described in the above-mentioned detection and measurement methods can be similarly used. Examples of diagnostic agents and diagnostic kits containing the antibody of the present invention include peroxidase-conjugated 5E5 antibody, diagnostic agent comprising a combination of 1A1 antibody immobilized on a carrier such as beads, and peroxidase-conjugated 5E5.
A diagnostic kit containing a 1A1 antibody immobilized on a carrier such as an antibody or a bead and a peroxidase substrate can be mentioned. When enzyme immunoassay is carried out using these, human BT in a sample can be obtained.
The C protein or its mutein can be detected specifically and with high sensitivity, and by extension, diabetic complications such as diabetes or diabetic arteriosclerosis can be diagnosed.

Further, as described above, regarding the diseases which may be caused by the excessive activity of the human BTC protein, the antibody of the present invention has a strong neutralizing activity, so that the extra human BTC protein in vivo is The antibody of the present invention can be administered to humans as a therapeutic agent by removing the antibody to neutralize the activity of human BTC protein. The toxicity of the antibody of the present invention is low. The daily dose when the antibody of the present invention is administered to a human is
Usually about 100, depending on age, symptoms, sex, etc.
It is μg / kg to 10 mg / kg. In administering the antibody of the present invention, itself, or an appropriate pharmacologically acceptable carrier, excipient, diluent (these examples, water,
It can be parenterally administered in a dosage form such as an injection, by mixing with physiological saline). When a parenteral preparation such as an injection is produced, a tonicity agent (eg, glucose, D-
Sorbitol, D-mannitol, sodium chloride, etc., preservatives (eg, benzyl alcohol, chlorobutanol, methyl paraoxybenzoate, propyl paraoxybenzoate, etc.), buffers (eg, phosphate buffer, sodium acetate buffer, etc.) ) And the like can be appropriately mixed.

In the present specification and drawings, when abbreviations are used for bases, amino acids, etc., IUPAC-IUB Biochemical Nomenclature Committee (Commission on Bio).
Chemical Nomenclature) or an abbreviation commonly used in this field, examples of which are given below. When amino acids may have optical isomers, the L form is shown unless otherwise specified. DNA Deoxyribonucleic acid A Adenine C Shitonin G Guanine T Thymine Ala: Alanine Arg: Arginine Asn: Asparagine acid Asp: Aspartic acid Cys: Cysteine Gln: Glutamine Glu: Glutamic acid Gly: Glycine His: Histidine Ile: Isoleucine Leu: Leucine Lys: Lysine Met: Methionine Phe: Phenylalanine Pro: Proline Ser: Serine Thr: Threonine Trp: Tryptophan Tyr: Tyrosine Val: Valine The present invention will be described in more detail below with reference to Reference Examples and Examples. It is not limited. The transformed cell Escherichia coli MM294 (DE3) / pTB1516 obtained in Reference Example 3 described below has been designated as the accession number FERM BP-3836 from April 21, 1992 under the Ministry of International Trade and Industry Institute of Industrial Science and Technology (NIB).
H), and has been deposited with the Fermentation Research Institute (IFO) under the accession number IFO 15282 from April 16, 1992. The transformant A9 / 1515-14 obtained in Reference Example 4 described below has been deposited with the IFO under accession number IFO50389 from December 28, 1992, and the transformant is 1991
Deposit number FERM BP-415 at NIBH from 1st of March
Deposited as 9. The mouse 1A1 cells, 2B2 cells, and 5E5 cells obtained in Example 2 described later were 1
Deposit number IFO 50 to IFO from February 15, 994
Deposited as 437, 50438 and 50439,
In addition, since March 23, 1995, it has been deposited in NIBH with deposit numbers FERM P-14847, FERM P-14848 and FERM P-14849 in Japan.
Contract number FERM BP-53 from February 13, 996
93, FERM BP-5394 and FERM BP-
It was transferred to the international deposit as 5395 and deposited.

Reference Example 1 (human BTC c for mammalian cells)
Construction of DNA Expression Plasmid) A 0.7 Kb SmaI-DraI fragment containing a cDNA encoding a human BTC protein (hereinafter, abbreviated as human BTC cDNA) was prepared as a plasmid pTB1499.
(See Example 4 of JP-A-6-87894) (Bi
ochem, Biophys, Res, Commun, 190 , 1173 (199
3)) isolated from. The BglII linker was ligated to the blunt end of this fragment using T4 DNA ligase. Bg1
0.7K containing human BTC cDNA after digestion with II
The b fragment was excised from the IL-2 cDNA region to give pT
B399 (Cell Structure Function (Cel
l Structure Function), 12 , p. 205 (198
B) of the expression plasmid pTB1308 prepared from 7))
It was inserted into the gII site by ligation with T4 DNA ligase (Fig. 1). Generated plasmid pTB151
5 was cut with Sa1I and HindIII. MuLV
A 2.4 Kb fragment containing the LTR and human BTC cDNA was isolated and pTB348 (cell structure function, 12 , 205 (198) containing the SV40 early region promoter and hamster DHFR cDNA.
7)) was introduced between the Sa1I-HindIII sites.
The resulting plasmid was named pTB1507 (Figure 2).

Reference Example 2 (human BTC cDNA of E. coli)
Construction of Expression Plasmid) A 0.6 Kb EcoRI-BamHI fragment encoding the human BTC precursor protein (1-147 amino acid residues) was isolated from the plasmid pTB1515 (Reference Example 1). ATG translation initiation codon (a: 5'TATGGATG
GG 3'b;5'AATTCCCATCCCA 3 ') was added to the EcoR of the above 0.6 Kb fragment.
After ligation to the I site, the generated 0.6 Kb NdeI-
The BamHI fragment was cloned into the T7 promoter (Gene, 56, 12
5 (1987)) in the plasmid pET-3c to construct plasmid pTB1505. 80 amino acid residues of human BTC protein (1 (As
p) to 80 (Tyr)) to obtain a DNA fragment encoding plasmid pTB1505 as a template and two oligonucleotides (1: 5'AT) as a primer.
ACATATGGATGGGAATTCCA 3 ',
2: 5'CCGGATCCTAGTAAAACAAGT
PCR was performed using CAACTCT 3 '). The product was digested with NdeI and BamHI and fractionated by 2.0% agarose gel electrophoresis to obtain the desired 0.25 Kb.
The DNA fragment was isolated. This 0.25 Kb NdeI-
The BamHI fragment was ligated and inserted downstream of the T7 promoter of pET-3c with T4 DNA ligase to obtain plasmid pTB.
1516 (FIG. 4) was obtained.

Reference Example 3 (Expression of Human BTC in Escherichia coli) Escherichia coli MM294 was lysogenized with lambda phage (Studie, Supra) which had been recombined with RNA polymerase gene of T7 phage. Then, this plasmid pLysS was introduced into E. coli MM294 (DE3),
E. coli MM294 (DE3) / pLysS was obtained. The plasmid pTB1516 was introduced into this strain, which gave E. coli MM294 (DE3) / pLysS, pTB.
1516 was obtained. The transformed cells were treated with 100 μg / m
It was incubated at 37 ° C. in 20 ml of L-broth containing 1 ampicillin and 10 μg / ml chloramphenicol. When the Klett value was about 180, isopropyl β-D-thiogalactoside (IPTG) was added to the medium to a final concentration of 0.4 mM, and the culture was continued for 4 hours. The cells were collected by centrifugation, and 20 mM Tris-HC
1 (pH 7.4), 10 mM EDTA, 0.5M N
Suspended in 0.5 ml of a buffer containing aCl, 10% sucrose and 0.25 mM PMSF, to this suspension egg white lysozyme was added to a concentration of 0.5 mg / ml. After placing this in ice-melt for 1 hour, the mixture was incubated at 37 ° C for 5 minutes and centrifuged (serval, 15,000 rp).
m) for 30 minutes at 4 ° C.) to obtain a supernatant. This bacterial extract was used as a molecular and cellular biology (Mol. Cell. Biol.) 8 , 588 (198).
Balb / c at rest according to the method described in 8).
3T3 A31-714-4 cells (Int. J. Cancer 1
DNA synthesis was measured induced activity by ^{2, 463 (1973)) 3} H- thymidine incorporation into. The results are shown in Table 1.
Shown in In measuring the biological activity of the human BTC protein, the measurement based on the above DNA synthesis inducing activity is generally used [Watanabe T. et al. et al. Journal of Biological Chemistry (J.
Biol. Chem. ) 269 , 9966 (199)
4); EP-A 0555785].

[0020]

[Table 1]

Reference Example 4 (Establishment of A9 Cell Line Producing Human BTC) An expression plasmid containing pTB1515 (Reference Example 1) containing human BTC cDNA and human HPRT gene in mouse A9 cells (ATCC CCL 1.4). p4a
A8 (Jolly, DJ and others, Proceedings of the National Academy of Sciences US
A, 80 , 477 (1983)) and simultaneously transduced by the calcium phosphate method. This cell is 10%
The cells were grown in DMEM supplemented with fetal bovine serum for 2 days, and subsequently cultured in HAT medium (Littlefield, JW, Science, 145 , 709 (1964)) for selection. HPRT ⁺ cells were grown in HAT medium and clones were isolated by the limiting dilution method. Cells of each clone (10 ⁵ cells per well in a 24-well plate) are plated and cultured for 2 days in growth medium followed by 0.5 days of 0.5% DMEM with 0.5% fetal calf serum.
Cultured in Human BT secreted into the medium by 10 ⁶ cells
The C level was examined by the DNA synthesis inducing action on mouse 3T3 cells described in Reference Example 3. The results for several clones are shown in Table 2 below.

[0022]

[Table 2]

Reference Example 5 Purification of ATC- produced BTC 3.5 M of the culture supernatant of A9 / 1515-14 cells was supplemented with 1 M potassium phosphate (pH 6.0) and 0.5 M ED.
1 each for TA, 5% CHAPS, 0.25M PMSF
80 ml, 7 ml, 36 ml, 7 ml each were added, and S-
Sepharose column (diameter 2.6 x 40 cm, p
Harmacia). The column was charged with 300 ml of buffer solution (0.1 M potassium phosphate (pH 6.0), 1
mM EDTA, 0.05% CHAPS, 0.5 mM
After washing with PMSF), the above buffer containing 0.7 M NaCl was flown at a flow rate of 1 ml / min to elute the protein. 5m
The DNA synthesis inducing activity (biological activity) of BALB / c3T3 cells was examined for each of the fractions collected every 1
-32 and 40-49 are respectively BTC-I and BTC
-II was pooled (Figure 5). S-Sepharos
e) The BTC-I pool fraction from the e-column was fractionated at 25% and 80% flow rate and then subjected to ultrafiltration (Centrip).
rep-10; Amicon) and concentrated to 20 mM T
ris (pH 7.4), 1 mM EDTA, 0.05%
Gel filtration column equilibrated with CHAPS (diameter 1.6 x 6
0cm; Superdex 75pg, Pharmacia)
Flow rate of 1.2 ml / min, and 15 minutes after the start, fractions were collected every 1.2 ml. Fractions that showed high biological activity (fraction number 35-41) were pooled (Figure 6A). S
-BTC-II obtained from Sepharose column
The pooled fraction was concentrated by ultrafiltration (YM2, Amicon),
20 mM Tris (pH 7.4), 1 mM EDTA,
A gel filtration column (diameter: 1.6 × 60 cm; Superdex 75 pg, Pharmacia) equilibrated with 0.05% CHAPS was applied at a flow rate of 1.2 ml / min.
It fractionated every 1.2 ml from 15 minutes. Fraction Nos. 66-74, which showed high bioactivity, were pooled (Figure 6B). The BTC-I pool fraction collected from the gel filtration column was applied to a heparin HPLC column (diameter 0.8 × 5 cm; AFpak HR).
-894, Showa Denko). Column is 20 mM T
ris-HCl (pH 7.4), 1 mM EDTA-
After washing with 0.05% CHAPS, 0-0.9M NaC
a concentration gradient of 1 at a flow rate of 1 ml / min for 30 minutes,
The eluate was fractionated every 1 ml. Fractions Nos. 9 to 13 showing biological activity were pooled (FIG. 7A). The BTC-II pool fraction collected from the gel filtration column was applied to a heparin HPLC column (diameter 0.8 × 5 cm; AFpak HR).
-894, Showa Denko). Column is 20 mM T
ris-HCl (pH 7.4), 1 mM EDTA-
After washing with 0.05% CHAPS, 0-0.9M NaC
a concentration gradient of 1 at a flow rate of 1 ml / min for 30 minutes,
The eluate was fractionated every 1 ml. Fractions Nos. 16-19 in which bioactivity was observed were pooled (FIG. 7B). To the BTC-I pool fraction collected from the heparin column, TFA was added to a final concentration of 0.1%, and C18 reverse phase HPL was added.
C column (diameter 0.46 x 15 cm; Asahipak
ODP-50, Asahi chemical). Acetonitrile concentration gradient (0-63%) was applied for 70 minutes in the presence of 0.1% TFA, and 0.5 ml (1 mi
The eluate was collected for each n) (Fig. 8A). Biological activity was observed in agreement with the protein elution peak. When the protein in this portion was examined by SDS-PAGE / silver staining, the molecular weight was 26-3.
A band was detected only at the 0K position (Fig. 9A). By the above operation, 150 μg of BTC-I was obtained. To the BTC-II pool fraction collected from the heparin column, TFA was added to a final concentration of 0.1%, and C18 reverse phase HPL was added.
C column (diameter 0.46 x 15 cm; Asahipak
ODP-50, Asahi chemical). Acetonitrile concentration gradient (0-63%) was applied for 70 minutes in the presence of 0.1% TFA, and 0.5 ml (1 mi
The eluate was collected for each n) (Fig. 8B). Biological activity was observed in agreement with the protein elution peak. S of this part of the protein
When examined by DS-PAGE / silver staining, a band was detected only at the position of molecular weight 14K (Fig. 9B). By the above operation, 75 μg of BTC-II was obtained.

[0024] The purified E. of BTC produced from Reference Example 6 recombinant E. coli coli MM294 (DE3) / plysS, p
After culturing TB1516 overnight, the culture broth was inoculated into the LB medium at a 20-fold dilution. After culturing at 37 ° C for 2 hours, IPTG was added to a final concentration of 0.1 mM, and the cells were further cultured for 3 hours. The cells were collected by centrifugation and stored at -20 ° C until use. A cell stock equivalent to 5 liters of culture was thawed and ice-cooled to 50 mM Tris-HC.
1 (pH 7.4), 10 mM EDTA-0.2M Na
It was suspended in 300 ml of a buffer containing Cl, 10% sucrose and 1 mM APMSF. 40 mg of egg white lysozyme was dissolved in this, incubated at 4 ° C. for 2 hours, then sonicated, and centrifuged at 20,000 × g for 1 hour to obtain a supernatant. After passing this supernatant through a 200 ml Q-Sepharose bed, TCA was added to a final concentration of 4
%, And the mixture was allowed to stand at 40 ° C. for 10 minutes. Two
The precipitate collected by centrifugation at 20,000 xg for 20 minutes was
20 mM Tris (pH 7.4), 1 mM ED
While suspending in a buffer containing TA-0.15M NaCl and 1 mM APMSF and homogenizing in a mortar,
The pH was adjusted to 6 by adding 5M NaOH. The supernatant obtained by centrifuging this homogenate at 100,000 × g for 1 hour was used as an S-Sepharose column (diameter: 1.6 × 10 6).
cm, pharmacia). 0.1 column
M potassium phosphate (pH
6.0), washed with a buffer containing 1 mM EDTA, 0.5 mM PMSF, a 0 M to 1 M NaCl concentration gradient was applied over 400 ml for 200 minutes, and the eluate was collected every 5 ml. Fraction Nos. 20 to 27, which were found to have high biological activity, were designated E. E. coli BTC I, Fraction Nos. 40 to 45 E. coli BTC II fractions were pooled (Fig. 10). E. FIG. TFA was added to the pool fraction of E. coli BTC I to a final concentration of 0.1%, and a C18 reverse phase HPLC column (diameter 1.0 × 25 cm;
Asahipak ODP-50, Asahi chem
ical). After washing the column with 0.1% TFA, a 0% to 63% acetonitrile concentration gradient was applied to the column.
The eluate was collected every 4 ml over 0 ml for 170 minutes. Biological activity was observed in agreement with the peak of the arrow (Fig. 11). When this peak was examined by SDS-PAGE and silver staining, one band was recognized around 18K (Fig. 12, lane I). The BTCI was purified. By this method 630 μg of E. E. coli BTC I was obtained. E. FIG. coli BTC II S-Sepharos
e column pool fraction was subjected to C18 reverse phase HPLC column (diameter 4.6 × 15 cm; Asahip) in the presence of 0.1% TFA.
ak ODP-50, Asahi chemical)
I went to After washing the column, a gradient of 0% to 63% acetonitrile was applied over 35 ml for 70 minutes, and the eluate was collected every 0.5 ml. Biological activity was observed in agreement with the peak of the arrow (Fig. 13). When this peak was examined by SDS-PAGE and silver staining, it was 14.3K.
A single band was observed at a position where the molecular weight was smaller than that of (lysozyme) (Fig. 12, lane II), and BTCII was purified. By this method 990 μg of E. coli BTCII
was gotten. E. FIG. The N-terminal amino acid sequences of E. coli BTC I and II were determined up to 20 amino acid residues. BTC
I was found to have a predicted N-terminus starting from the translation initiation methionine, and BTC II was a molecule lacking the N-terminal 31 residues (FIG. 14).

Example 1 (Immunity) A suspension prepared by dissolving the human BTC-I obtained in Reference Example 6 above in physiological saline and sufficiently suspending it with an equal volume of Freund's complete adjuvant was prepared. / C mouse (♀, 10 weeks old) was intradermally administered to perform the first immunization (antigen human BTC-I 50 μg / mouse). Three weeks later, a human BTC-I suspension dissolved in Freund's incomplete adjuvant was prepared in the same manner as in the primary immunization, and booster immunization was performed.
After further boosting twice every two weeks, 3 weeks later, 50 μg of human BTC-I dissolved in physiological saline was added.
Was administered intraperitoneally for the final immunization.

Example 2 (1) Cell fusion From the immunized mouse shown in Example 1, spleen was extracted 3 days after the final immunization to obtain splenocytes used for cell fusion, and PRM was obtained.
It was suspended in I 1640 medium (Nippon Pharmaceutical Co., Ltd.). Mouse myeloma cells P3 × 63Ag 8UI (P3U1) is 10%
The cells were subcultured in RPMI 1640 medium containing fetal bovine serum (FBS, Hycron Laboratories). Cell fusion is a method established by Köhler and Milstein [Kohler, G. et al. And Milstein, C.I. : Nature
256 , 495 (1975)]. The resulting spleen cells and mouse myeloma cells were mixed at a ratio of 5: 1, the medium was thoroughly removed, and then 1 ml of RPMI 164 was mixed.
50% polyethylene glycol 400 dissolved in 0 medium
Incubated for 2 minutes at 37 ° C in 0 (Sigma).
After washing the cells with serum-free RPMI medium,
AT (1 × 10 ⁻⁴ M hypoxanthine, 4 × 10 ⁻⁷ M aminopterin, 1.6 × 10 ⁻⁵ M thymidine) added, 1
RPMI 1640 medium containing 0% FBS (hereinafter HAT
It was suspended in a medium) and dispensed into each well of a 96-well culture plate at 3 × 10 ⁵ cells / 0.1 ml. Three
After culturing at 7 ° C and 7% CO ₂ for 3 days, HA was further added.
0.1 ml of T medium was added to each well. The cells grown under these conditions are hybrid cells. (2) Search for antibody-producing cells 0.1 ml of physiological saline containing 10 μg / ml of BTC-I obtained in Reference Example 5 was added to 96-well flat bottom ELISA.
Plate (Falcon 3912) was added to each well and left overnight at 4 ° C. 0.05% Tween 20
-After washing 3 times with PBS, 5 mg / ml BSA-
0.2 ml of 0.05% Tween 20-PBS was added to each well and allowed to stand at 37 ° C for 1 hour. 0.05 again
0.1 ml / well of culture supernatant diluted 2-fold serially with% Tween 20-PBS was added, and the mixture was allowed to stand at room temperature for 2 hours. After washing three times with 0.05% Tween 20-PBS, 0.1 ml of HRP-labeled anti-mouse IgG rabbit antibody solution (1 μg / ml) was added as a secondary antibody, and the mixture was allowed to stand at room temperature for 1 hour. After the washing was repeated 5 times, a coloring solution (ortho-phenylenediamine 10 ml, 50 mM phosphoric acid 2
Sodium · 24m M citrate buffer (pH 5.0) 1
HRP enzyme reaction was carried out by adding 0 ml and 0.1 ml of 1.7% hydrogen peroxide solution (120 μl mixed and prepared at the time of use). The enzyme reaction was stopped by adding 0.05 ml of 6N sulfuric acid, and the absorbance at a wavelength of 492 nm was measured (ELI
SA method). Primary screening was performed on the culture supernatant of the wells in which hybrid cells had grown by this method, and the cells in the wells with high absorbance were cloned by the limiting dilution method. Before cloning,
Cultured overnight under 7% CO ₂ . Mouse peritoneal exudate cells (1
0 ⁴ cells / well) was used as a feeder. further,
Screening and cloning were repeated, and anti-human BTC antibody-producing hybridomas 1A1, 2B2, 5E5
I got When the antibody titer in the hybridoma culture supernatant was measured by the above ELISA method, the wavelength of 4
The absorption at 92 nm was 1 or more. Cloned cells 1% in RPMI1640 medium containing 20% fetal calf serum
Dimethyl sulfoxide (DMSO) was added to 0% and stored in liquid nitrogen.

Example 3 (Immunoglobulin Class of Monoclonal Antibody) The culture supernatant of the hybridoma obtained in Example 2- (2) was reacted with various standard immunoglobulins using a mouse antibody subclass detection kit (Bio-Rad). Let Table 3 shows the results.

[0028]

[Table 3]

In the table, + means positive reaction, and negative means negative reaction. From Table 3, the three antibodies in the hybridoma culture supernatant belong to the immunoglobulin class IgG ₁ subclass.

Example 4 (Recognizing site of monoclonal antibody) 1 of BTC-I or BTC-II obtained in Reference Example 5 was used.
96-well flat-bottom ELISA plate (Falcon 3912) containing 0.1 ml of physiological saline containing μg / ml
In addition to each well, the plate was allowed to stand overnight at 4 ° C. 0.05% T
After washing three times with 20-PBS, 5 mg /
ml BSA-0.05% Tween20-PBS
0.2 ml was added to each well and left at 37 ° C. for 1 hour. After washing again with 0.05% Tween 20-PBS three times, 0.1% BSA-0.05% Tween
0.1 ml / well of culture supernatant diluted 2-fold serially with 20-PBS was added, and the mixture was left at room temperature for 2 hours. 0.0
After washing 3 times with 5% Tween 20-PBS, HRP-labeled anti-mouse IgG rabbit antibody solution (1
0.1 μg / ml) was added and the mixture was left at room temperature for 1 hour. After washing was repeated 5 times, a color developing solution (ortho-phenylenediamine 10 ml, 50 mM disodium phosphate / 24 mM citrate buffer (pH 5.0) 10 ml and a 1.7% hydrogen peroxide solution 120 μl were mixed and prepared at the time of use. 0.1 ml) was added to carry out the HRP enzyme reaction. The enzyme reaction was stopped by adding 0.05 ml of 6N sulfuric acid, and the absorbance at a wavelength of 492 nm was measured (ELISA
Law). The results are shown in Table 4.

[0031]

[Table 4]

In the table, + means positive reaction, and negative means negative reaction. From Table 4, it was found that the three kinds of antibodies in the hybridoma culture supernatant recognize the C-terminal side from Arg ^{62 of} human BTC (Fig. 3: +31).

Example 5 (Reaction Specificity of Monoclonal Antibody) BTC-I and human TGF-α (Gi obtained in Reference Example 5)
bco-BRL), human EGF (Boehringer Mannheim) or mouse EGF (Takara Shuzo)
0.1 ml of physiological saline containing g / ml was added to each well of a 96-well flat-bottom ELISA plate (Falcon 3912) and left at 4 ° C. overnight. 0.05% Tw
After washing 3 times with een 20-PBS, 5 mg / m
l BSA-0.05% Tween 20-PBS
0.2 ml was added to each well and left at 37 ° C. for 1 hour. After washing again with 0.05% Tween 20-PBS three times, 0.1% BSA-0.05% Tween
0.1 ml / well of culture supernatant diluted 2-fold serially with 20-PBS was added, and the mixture was left at room temperature for 2 hours. 0.0
After washing 3 times with 5% Tween 20-PBS, HRP-labeled anti-mouse IgG rabbit antibody solution (1
0.1 μg / ml) was added and the mixture was left at room temperature for 1 hour.
After washing 5 times, a coloring solution (ortho-phenylenediamine 10 ml, 50 mM disodium phosphate.
HRP enzyme reaction was carried out by adding 10 ml of 24 mM citrate buffer (pH 5.0) and 0.1 ml of a mixture of 120 μl of 1.7% hydrogen peroxide solution at the time of use). 6
The enzyme reaction was stopped by adding 0.05 ml of N-sulfuric acid, and the absorbance at a wavelength of 492 nm was measured (ELISA method). The results are shown in Table 5.

[0034]

[Table 5]

In the table, + indicates a positive reaction and − indicates a negative reaction. From Table 5, it was found that the three kinds of antibodies in the hybridoma culture supernatant specifically recognize the human BTC protein.

Example 6 (Purification of Monoclonal Antibody from Culture Supernatant) Obtained in Example 2 on a Protein A column equilibrated with a binding buffer (3M sodium chloride, 1.5M glycine (pH 8.7)). Mouse hybridoma 1A1 and 2B
Culture supernatant of 2, and 5E5 cells and binding buffer 1: 1
The mixture mixed in was attached. After washing with binding buffer, elution was performed with elution buffer (0.1 M citric acid (pH 5)).
The eluate was neutralized by adding 1 M Tris (pH 8.0), dialyzed against physiological phosphate buffer, and purified 1A1, 2B2
And 5E5 antibody were obtained.

Example 7 (Study on neutralizing activity of human BTC activity) 1A1, 2B2 and 5E5 purified by the method of Example 6
The antibody was used to examine the neutralizing activity against human BTC. Mouse Balb / c 3T3 A31-714 clone 4 cells were seeded on a 96-well plate in an amount of 2 × 10 ³ cells / well and cultured in 100 μl of DMEM containing 5% fetal bovine serum. The next day, the culture solution was exchanged with DMEM containing 1% FCS, and the culture was continued for another 3 days. 1 ng / m of purified human BTC-I together with 0.1, 1, and 10 μg / ml of monoclonal antibodies against the above-mentioned three kinds of human BTC.
1 h and cultured for 18 hours, then ³ H-thymidine (5C
i / mmol) 0.5 μCi / well was added and cultured for 6 hours. Remove the culture medium and wash the cells 3 times with PBS, then add 5%
The cells were lysed by adding 100 μl of SDS. Cell DN
The radioactivity incorporated into A was measured using a liquid scintillation counter to measure the neutralizing effect of each monoclonal antibody on the DNA synthesis inducing ability of human BTC. The results are shown in Fig. 15. In FIG. 15, the black squares represent the incorporation value of ³ H-thymidine when no antibody was added,
-□-is 1A1 antibody, ... ◇ is 2B2 antibody, △ is 5
The uptake value when the E5 antibody was added is shown. Each of the monoclonal antibodies suppressed the DNA synthesis of the cells when human BTC was added, depending on the concentration. In particular, the 5E5 antibody showed a strong neutralizing action. On the other hand, the same experiment was conducted using human EGF, human TGF-α, and human HB-EG belonging to the same EGF family.
Performed on F and mouse BTC. Each growth factor 1
DN of A31 cells induced by addition of ng / ml
A synthesis is 10 μg / ml of 1A1, 2B2 or 5E
Addition of 5 antibody did not suppress it at all. From the above results, the monoclonal antibodies 1A1, 2B2 and 5E5
Were found to specifically neutralize the biological activity of the human BTC protein.

Example 8 (1) Monoclonal antibody 5E5 obtained in Example 6
1 mg was dialyzed against 0.1 M NaHCO ₃ (pH 8.0). NHS-Biotin 12 dissolved in DMSO
0 μg (Vector Co., USA) was added to the dialyzed antibody and reacted at room temperature for 2 hours with stirring. After the reaction, PB
It was dialyzed against S (-) to remove unreacted NHS-biotin. (2) The monoclonal antibody 1A1 obtained in Example 6 was diluted with 0.01 M Na ₂ HPO ₄ (pH 8.0) containing 0.01 M NaCl so as to have a concentration of 10 μg / ml, and immunoplate (Nunc, 50μ in Denmark)
l / well was injected and left at 4 ° C. overnight for adsorption. After removing the antibody that was not adsorbed, the plate was washed 3 times with PBS (-), and a blocking solution (Block Ace (Dainippon Pharmaceutical Co., Ltd.) diluted 4 times with PBS (-), 0.01
% Merthiolate (trademark) is added at 100 μl / well, and the mixture is left standing at 4 ° C. overnight, and then the blocking solution is removed.
After washing 5 times with PBS (-), 50 μl / well of human BTC protein diluted with a diluent (a solution obtained by adding 0.2% Tween 20 to PBS (-)) was added and reacted at 37 ° C. for 2 hours. After removing unreacted BTC, wash solution (PBS
(-) Solution containing 0.05% Tween 20) 6
Washed twice. Further, the biotinylated monoclonal antibody 5E5 prepared in (1) above was diluted 1/2000 with a diluent and added at 50 μl / well, and reacted at 37 ° C. for 2 hours. After removing the antibody-containing solution, wash 6 times with the washing solution, and dilute with 1 /
50 μl of 1000-fold diluted avidin D-conjugated horseradish peroxidase (Vector Co., USA) was added and reacted at room temperature for 30 minutes. After removing the reaction solution, it was washed 8 times with a washing solution and 50 μl of peroxidase substrate (Wako)
/ Well was added for color development, and 50 μl / well of 2N sulfuric acid was added to stop the reaction. After the reaction was completed, colorimetric determination was performed. FIG.
6 shows a detection curve of human BTC protein. The horizontal axis represents the added human BTC protein concentration, and the vertical axis represents the measured absorbance (A492 nm). Absorbance without addition of human BTC protein is 0.06 to 0.07, and if the concentration of human BTC protein showing an absorbance of 2 times or more thereof is significant, the above-mentioned assay system shows a concentration of 10 pg / ml to 200 pg / ml. It was found that human BTC can be detected and quantified. Also,
Human EGF, mouse EGF, human TGF-α, human HB
-EGF and mouse BTC showed only background level absorbance in this assay system, as shown in Table 6, demonstrating that this assay system is specific for human BTC protein.

[0039]

[Table 6]

[0040]

Example 9 Purification of human BTC using antibody column Monoclonal antibody 5E5 20m obtained in Example 6
Formyl cellophane (Seikagaku Corporation) 10 g we
After binding to t gel according to a standard method, it was packed in an econo column to obtain an affinity column. On the other hand, plasmid pTB168 was added to hamster CHO DHFR ~ cells.
5 (derivative of plasmid pTB1507 described in Reference Example 1: the MuLV-LTR region was replaced with the human EF-1 promoter [Nucleic Acids Res., 18 , 5322], and the human BTC cDNA region was replaced with the plasmid pT described in Reference Example 2).
From B1516 as a material, a plasmid in which the cDNA region encoding BTC-I having the amino acid sequence represented by SEQ ID NO: 1 was replaced) was introduced, and a human BTC high-producing cell was selected from among the cell lines that became DHFR ^+. CHO1685-
I got 39. The cells were treated with 5% fetal bovine serum and 35 μ
After culturing to confluence with DMEM supplemented with g / ml proline, the medium was exchanged with ASF medium (Ajinomoto) and culturing was continued for 3 days, and the culture supernatant was collected. After concentrating 5 liters of the culture supernatant under ice cooling with a concentrator (Amicon) about 4 times,
This concentrated liquid was passed through the affinity column at a flow rate of 20 ml / hour to adsorb BTC. After adsorption, it was washed with Dulbecco's phosphate buffer (PBS (-)) until the absorbance at 280 nm was 0.05 or less. Next, at the same flow rate, a 0.01 M phosphate buffer solution (pH: 0.5 M containing sodium chloride)
It was washed in 6.5). Further, it was eluted with 0.05 M glycine hydrochloric acid (pH 2.3) containing 0.15 M sodium chloride at the same flow rate. The eluted fraction was neutralized with 1M Tris-hydrochloric acid (pH 8.0) and dialyzed with PBS (-). 1 per fraction obtained
5% acrylamide electrophoresis [Laemmli, Nature, 27
7 , 680 (1970)]. The staining method was the Coomassie blue staining method. In FIG. 17, (1) is a molecular weight marker, (2) is a culture supernatant, (3) is a flow-through fraction, (4).
Is the elution fraction of high salt concentration (0.5M NaCl), (5)
Shows the result of the elution fraction by the elution buffer. Furthermore, trifluoroacetic acid (TFA) was added to the elution fraction (5) so that the final concentration was 0.05%, and TSK gel-
It was applied to an ODS80 column (Tosoh). 0.05% TF
In the presence of A, a gradient of acetonitrile concentration (0-60%) was applied for 60 minutes, and the eluate was collected at 1 ml / min [Fig.
8]. The protein elution peaks a, b and c were subjected to 15% acrylamide electrophoresis and stained by the silver staining method [Fig.
9]. (1) is a molecular weight marker, (5) is an elution fraction from an affinity column, (6) is an elution peak a, (7)
Indicates elution peak b, and (8) indicates elution peak c. The amount of human BTC protein in each fraction in the above purification process was measured by the method described in Example 8. The results are shown in Table 7.

[0041]

[Table 7]

The mouse Balb / described in Example 7 was also used.
As a result of measuring the biological activity of the above-mentioned eluate fractions by a ³ H-thymidine incorporation experiment using c3T3 cells, all fractions showed a DNA synthesis inducing activity corresponding to the amount of human BTC protein. From the above, it was revealed that the human BTC protein can be efficiently purified by using the antibody column using the antibody of the present invention.

[0043]

[Example 10] Anti-peptide antibody (polyclonal antibody)
Preparation of Polypeptides having the amino acid sequences of amino acids 66 to 80 of the amino acid sequence represented by SEQ ID NO: 1 were chemically synthesized and used as an antigen. (1) The above peptide (5 mg) and hemocyanin (10 m
g) and 4 ml of 0.2 M phosphate buffer (pH 7.3)
400 μl of 2.5% glutaraldehyde dissolved in ice-water and cooled in ice water was added dropwise with stirring. After stirring under ice cooling for 3 hours, the mixture was dialyzed against distilled water to obtain a complex of peptide and hemocyanin. (2) Bovine serum albumin (BSA) (132 mg) was dissolved in 3 ml of 0.1 M phosphate buffer (pH 7.5) (solution A). 11.2 mg of N- (γ-maleimidobutyloxy) succinimide (GMBS) was dissolved in 200 μl of dimethylformamide solution (solution B). While stirring with a stirrer, add solution B to solution A and add 30 parts of the mixture.
After reacting at 30 ° C. for 30 minutes, S using 0.1M phosphate buffer (pH 6.5) -0.1M NaCl as an eluent
Purification was performed using ephadex-G-25 (1.5 cm × 20 cm) to obtain a maleimide group-introduced bovine serum albumin. Peptide (5 mg) was added to 0.1 M phosphate buffer-5
Bovine serum albumin (20) dissolved in mM ethylenediaminetetraacetic acid (EDTA) and introduced with a maleimide group (20
mg) was added (total amount of 5 ml or less), and the reaction was carried out at 30 ° C. for 60 minutes. PBS was added to this to 12 ml to obtain a complex of the peptide and bovine serum albumin. (3) A complex of the peptide obtained in (1) above and hemocyanin is thoroughly mixed with complete Freund's adjuvant,
The mixture was injected subcutaneously in rabbits. Thereafter, every two weeks, the complex of the peptide obtained in (2) above and bovine serum albumin was mixed with incomplete Freund's adjuvant, and the mixture was injected into the same rabbit. Blood obtained by collecting rabbits immunized by the above method was centrifuged to obtain human BTC peptide antibody (polyclonal antibody).

[0044]

INDUSTRIAL APPLICABILITY The antibody of the present invention neutralizes the biological activity of human BTC protein or its mutein and specifically binds to human BTC protein or its mutein with high sensitivity.
It can be used as a therapeutic drug for diseases such as arteriosclerosis and cancer. Further, it can be used as a reagent for measuring (detecting, quantifying) human BTC protein or its mutein, and can be used for diagnosis of diabetes or its complications.

[0045]

[Sequence list]

[0046]

[SEQ ID NO: 1] Sequence length: 80 Sequence type: Amino acid Topology: Linear Sequence type: Protein sequence Asp Gly Asn Ser Thr Arg Ser Pro Glu Thr Asn Gly Leu Leu Cys Gly 1 5 10 15 Asp Pro Glu Glu Asn Cys Ala Ala Thr Thr Thr Gln Ser Lys Arg Lys 20 25 30 Gly His Phe Ser Arg Cys Pro Lys Gln Tyr Lys His Tyr Cys Ile Lys 35 40 45 Gly Arg Cys Arg Phe Val Val Ala Glu Gln Thr Pro Ser Cys Val Cys 50 55 60 Asp Glu Gly Tyr Ile Gly Ala Arg Cys Glu Arg Val Asp Leu Phe Tyr 65 70 75 80

[0047]

[SEQ ID NO: 2] Sequence length: 1271 Sequence type: Nucleic acid Number of strands: Double strand Topology: Linear Sequence type: Genomic DNA Origin Biological name: Human Strain name: MCF7 Cell type: Breast Adenocarcino
Features of ma Cell Sequence Characteristic symbol: CDS Location: 295..828 Sequence characteristic feature symbol: mat peptide Location: 388..828 Sequence CAGCGTGGAG GCTCCAAGGA CCAAGTCCTG CGCCTCTTTG GCGGGGTGTG TGCAGGAGGA 60 GGGGGGGGATAA ATAGGAGGCC CCCTCCTCCC GCT GCCCTGGGTG TTTCCCTGCC TTGTAGCCAG GGTGCCAGCC TGGGAAGTAG TTTCGTTTCC 180 TTCTGCCTCC GGGATTAGTT TCCAGGCACC CTCTCAGGCG CCCGAGGCCC GGGAAGGGGG 240 CGAAGAAGGA GGGAGACTTG TCTAGGGGCT GCCCGGCCCG GCAGAGCGGG GTTG ATG 297 Met GAC CGG GCC GCC CGG TGC AGC GGC GCC AGC TCC CTG CCA CTG CTC CTG 345 Asp Arg Ala Ala Arg Cys Ser Gly Ala Ser Ser Leu Pro Leu Leu Leu -30 -25 -20 -15 GCC CTT GCC CTG GGT CTA GTG ATC CTT CAC TGT GTG GTG GCA GAT GGG 393 Ala Leu Ala Leu Gly Leu Val Ile Leu His Cys Val Val Ala Asp Gly -10- 5 +1 AAT TCC ACC AGA AGT CCT GAA ACT AAT GGC CTC CTC TGT GGA GAC CCT 441 Asn Ser Thr Arg Ser Pro Glu Thr Asn Gly Leu Leu Cys Gly Asp Pro 5 10 15 GAG GAA AAC TGT GCA GCT ACC ACC ACA CAA TCA AAG CGG AAA GGC CAC 489 Glu Glu Asn Cys Ala Ala Thr Thr Thr Gln Ser Lys Arg Lys Gly His 20 25 30 TTC TCT AGG TGC CCC AAG CAA TAC AAG CAT TAC TGC ATC AAA GGG AGA 537 Phe Ser Arg Cys Pro Lys Gln Tyr Lys His Tyr Cys Ile Lys Gly Arg 35 40 45 50 TGC CGC TTC GTG GTG GCC GAG CAG ACG CCC TCC TGT GTC TGT GAT GAA 585 Cys Arg Phe Val Val Ala Glu Gln Thr Pro Ser Cys Val Cys Asp Glu 55 60 65 GGC TAC ATT GGA GCA AGG TGT GAG AGA GTT GAC TTG TTT TAC CTA AGA 633 Gly Tyr Ile Gly Ala Arg Cys Glu Arg Val Asp Leu Phe Tyr Leu Arg 70 75 80 GGA GAC AGA GGA CAG ATT CTG GTG ATT TGT TTG ATA GCA GTT ATG GTA 681 Gly Asp Arg Gly Gln Ile Leu Val Ile Cys Leu Ile Ala Val Met Val 85 90 95 GTT TTT ATT ATT TTG GTC ATC GGT GTC TGC ACA TGC TGT CAC CCT CTT 729 Val Phe Ile Ile Leu Val Ile Gly Val Cys Thr Cys Cys His Pro Leu 100 105 110 CGG AAA CGT CGT AAA AGA AAG AAG AAA GAA GAA GAA ATG GAA ACT CTG 777 Arg Lys Arg Arg Lys Arg Lys Lys Lys Glu Glu Glu Met Glu Thr Leu 115 120 125 130 GGT AAA GAT ATA ACT CCT ATC AAT GAA GAT ATT GAA GAG ACA AAT ATT 825 Gly Lys Asp Ile Thr Pro Ile Asn Glu Asp Ile Glu Glu Thr Asn Ile 135 140 145 GCT TAAAAGGCTA TGAAGTTACC TCCAGGTTGG TGGCAAGCTG CAAAGTGCCT 878 Ala TGCTCATTTG AAAATGGACA GAATGTGTCT CAGGAAAAAC AGCTAGTAGA CATGAATTTT 938 AAATAATGTA TTTACTTTTT ATTTGCAACT TTAGTTTGTG TTATTATTTT TTAATAAGAA 998 CATTAATTAT ATGTATATTG TCTAGTAATT GGGAAAAAAG CAACTGGTTA GGTAGCAACA 1058 ACAGAAGGGA AATTTCAATA ACCTTTCACT TAAGTATTGT CACCAGGATT ACTAGTCAAA 1118 CAAAAAAGAA AAGTAGAAAG GAGGTTAGGT CTTAGGAATT GAATTAATAA TAAAGCTACCC1178 ATTTATCATCATTCATTATCATCATTCATTATCATTATTTCCATACATTCATTCATACATTC
71

[0048]

[SEQ ID NO: 3] Sequence length: 80 Sequence type: Amino acid Topology: Linear Sequence type: Protein Sequence: Asp Gly Asn Thr Thr Arg Thr Pro Glu Thr Asn Gly Ser Leu Cys Gly 1 5 10 15 Ala Pro Gly Glu Asn Cys Thr Gly Thr Thr Pro Arg Gln Lys Val Lys 20 25 30 Thr His Phe Ser Arg Cys Pro Lys Gln Tyr Lys His Tyr Cys Ile His 35 40 45 Gly Arg Cys Arg Phe Val Val Asp Glu Gln Thr Pro Ser Cys Ile Cys 50 55 60 Glu Lys Gly Tyr Phe Gly Ala Arg Cys Glu Arg Val Asp Leu Phe Tyr 65 70 75 80

[Brief description of drawings]

FIG. 1 is a construction diagram of plasmid pTB1515.

FIG. 2 is a construction diagram of plasmid pTB1507.

FIG. 3-1 shows the nucleotide sequence of the BTC-I cDNA obtained in Example 4 of JP-A-6-87894 and the amino acid sequence deduced therefrom.

FIG. 3-2 shows the nucleotide sequence of the BTC-I cDNA obtained in Example 4 of JP-A-6-87894 and the amino acid sequence deduced therefrom.

FIG. 4 is a construction diagram of plasmid pTB1516.

FIG. 5 shows the results of S-Sepharose column chromatography and DNA synthesis inducing activity obtained in Reference Example 5.

FIG. 6 shows the results of gel filtration obtained in Reference Example 5.

FIG. 7 shows the results of heparin high performance liquid chromatography column chromatography obtained in Reference Example 5.

FIG. 8 shows the results of reverse phase high performance liquid chromatography obtained in Reference Example 5.

FIG. 9 shows the results of SDS-PAGE silver staining obtained in Reference Example 5.

FIG. 10 shows the results of S-Sepharose column chromatography obtained in Reference Example 6.

FIG. 11 shows the results of reverse phase high performance liquid chromatography column chromatography obtained in Reference Example 6.

FIG. 12 SDS-PAGE obtained in Reference Example 6
The results of silver staining are shown.

FIG. 13 shows the results of reverse phase high performance liquid chromatography column chromatography obtained in Reference Example 6.

FIG. 14 shows the N-terminal amino acid sequences of BTC-I and BTC-II obtained in Reference Example 6.

FIG. 15 is a graph showing the neutralizing activity of the monoclonal antibody of the present invention on human BTC in Example 7.

FIG. 16 is a detection curve of human BTC.

FIG. 17 shows the results of Coomassie blue staining obtained in Example 9.

FIG. 18 shows the results of reverse phase high performance liquid chromatography column chromatography obtained in Example 9.

FIG. 19 shows the results of silver staining obtained in Example 9.

─────────────────────────────────────────────────── ─── Continuation of the front page (51) Int.Cl. ⁶ Identification code Internal reference number FI Technical display location C12N 15/02 ZNA C12P 21/08 C12P 21/02 G01N 33/53 D 21/08 33/577 B G01N 33/53 A61K 39/395 ABXN 33/577 AED // A61K 39/395 ABX 9281-4B C12N 5/00 B AED 9162-4B 15/00 ZNAC (C12P 21/08 C12R 1:91)

Claims (13)

[Claims] 1. An antibody that specifically binds to human betacellulin protein or a mutein thereof. 2. The human betacellulin protein has the SEQ ID NO:
The antibody according to claim 1, which is a protein having an amino acid sequence represented by 1. 3. The antibody is a monoclonal antibody.
Or the antibody according to 2. 4. The antibody according to claim 1, 2 or 3, which does not cross-react with at least one of human epidermal growth factor (EGF), human transforming growth factor α (TGFα) and mouse betacellulin protein. 5. An immunoglobulin class belonging to IgG, which does not cross-react with human epidermal growth factor (EGF) and human transforming growth factor α (TGFα), and specifically binds to human betacellulin protein or its mutein. And a monoclonal antibody that neutralizes its biological activity. 6. The antibody according to claim 1, 2, 3, 4 or 5, which recognizes the 31st (Arg) to 80th (Tyr) amino acid sequence of the amino acid sequence represented by SEQ ID NO: 1. 7. A cloned hybridoma consisting of spleen cells of a mammal immunized with human betacellulin or a mutein thereof and allogeneic or xenogeneic lymphoid cells. 8. The monoclonal antibody according to claim 5, wherein the hybridoma according to claim 7 is grown in a liquid medium or in the abdominal cavity of a mammal to produce and accumulate a monoclonal antibody, which is then collected. Manufacturing method. 9. A method for detecting and quantifying a human betacellulin protein or a mutein thereof, which comprises contacting an analyte with the antibody according to claim 1, 2, 3, 4, 5 or 6. 10. An antibody according to claim 1, 2, 3, 4, 5 or 6 is brought into contact with a subject to quantify the amount of human betacellulin protein or its mutein in the subject. Diagnosis of diabetes or its complications. 11. A diagnostic agent for diabetes or its complications, which comprises the antibody of claim 1, 2, 3, 4, 5 or 6. 12. A diagnostic kit for diabetes or its complications, which comprises the antibody of claim 1, 2, 3, 4, 5 or 6. 13. A human beta characterized in that the antibody of claim 1, 2, 3, 4, 5 or 6 is contacted with a crudely purified sample to isolate the human betacellulin protein or its mutein. A method for purifying a cellulin protein or a mutein thereof.