JP2561149B2 - Functional polypeptide - Google Patents

Description

TECHNICAL FIELD The present invention relates to a novel polypeptide, more specifically, a novel functional polypeptide containing a cell adhesion domain peptide of human fibronectin and a heparin-binding domain peptide, and The present invention relates to genes encoding them and a genetic engineering manufacturing method using the genes.

[Conventional technology]

Fibronectin (hereinafter referred to as FN) is a glycoprotein present in plasma and extracellular matrix and is known to have various functions [Annual Review
Annual Revie of Biochemi
stry), 57, 375-413 (1988)]. Attempts have been made to use natural FN for wound healing, eye drops, and other pharmaceuticals and cosmetics, but because it is collected from blood, its supply is limited, its cost is high, and pathogenic bacteria are used. It has not been put to practical use due to the possibility of contamination by viruses or the like. Also, taking out and using the functional domain of FN has not been put to practical use for the same reason.

[Problems to be Solved by the Invention]

It is known that there are two heparin-binding regions (heparin-binding domain) in FN, and one region is near the N-terminal, and Ca ion is required for binding. The other region is near the C-terminal, and the binding activity for heparin in this region is stronger than that in the above-mentioned region and is not affected by Ca ions.

Recent studies have revealed that the heparin-binding domain of FN, like the cell adhesion domain, plays an important role in adhesion, spreading, and migration of fibroblasts, endothelial cells, and certain cancer cells. It was The heparin-binding domain of FN is considered to contribute to cell adhesion, spreading, migration, etc. by binding to proteoglycans on the surface layer of cells and causing interactions between cells and extracellular matrix. Therefore, a polypeptide having both a cell adhesion activity and a pepperin-binding activity binds to both cells and extracellular matrix and contributes to the repair of wound tissue and the maintenance of homeostasis, and its use as a drug. Can be expected.

An object of the present invention is to provide a novel functional polypeptide having both functions of FN cell adhesion activity and heparin binding activity, and an advantageous method for producing the same.

[Means for solving the problem]

Briefly describing the present invention, the first invention of the present invention is represented by the following general formula I: C ₂₇₇ Met _n H _271- X ... [I] [wherein C ₂₇₇ is Pro of the cell adhesion domain of human fibronectin]. ^It shows a 277 amino acid peptide residue corresponding to ^1239- Ser ^{1515 and} has the following formula II: H ₂₇₁ corresponds to Ala ^1690- Thr ¹⁹⁶⁰ of the heparin-binding domain of human fibronectin.
A single amino acid peptide residue is shown and has the following formula III: X has the following formula IV: A peptide residue represented by or a group in which a part or all thereof is deleted, Met represents a methionine residue, and n represents a number of 1 or zero] The second invention relating to the sex polypeptide relates to a gene encoding the novel functional polypeptide of the first invention. A third invention of the present invention relates to a recombinant plasmid containing a gene encoding the above-mentioned polypeptide, and a fourth invention relates to a transformant into which the above-mentioned recombinant plasmid has been introduced. The present invention relates to a method for producing a novel functional polypeptide, which comprises culturing the transformant and collecting the polypeptide from the culture.

The present inventors have studied the construction of a novel polypeptide having both cell spreading activity and heparin binding activity and a method for producing the same, and a novel method in which a cell adhesion domain of human FN and a heparin-binding domain are bound directly or via a linker peptide. Various functional polypeptides were prepared by genetic engineering.
As a result of examining the biological constitution of this novel functional polypeptide, it has both cell spreading activity and heparin-binding activity, and further, the cell spreading activity of BHK and NRK cells is the cell adhesion domain alone. It was found to be enhanced compared to.

 Hereinafter, the present invention will be specifically described.

Regarding the gene structure of human FN, The ENBO Journal, Vol. 4, pp. 1755-1759 (198
It is described in 5). In addition, a cDNA clone encoding the cell adhesion domain and the heparin-binding domain (pL
F2, pLF3, pLF4 and pLF5), Biochemistry, Vol. 25, pp. 4936-4941 (1986).
It is described in. The present inventors developed a cell adhesion active polypeptide and a method for producing the same by extracting a cDNA fragment for the cell adhesion domain from pLF5, connecting it to an expression vector and introducing it into E. coli (patent application 63-31820). As the cDNA of the cell adhesion domain required in the present invention, the recombinant pair plasmid pTF7021 described in Japanese Patent Application No. 63-31820 can be used. pTF7021 is a plasmid that expresses FN Pro ^1239- Met ¹⁵¹⁷ (279 amino acid residues). Cloning site immediately before the C-terminal stop codon of the translation region of pTF7021
For example, by introducing an Nco I site, the cDNA of the cell adhesion domain and the cDNA of another domain can be linked.

As for the heparin-binding domain, a fragment obtained by decomposing it with trypsin, thermolysin, cathepsin D, etc. has been reported, and its size ranges from 29 kD to 38 kD. Although the domain has not been specified in detail, it is generally known from a fragment containing three type III similar sequences consisting of about 90 amino acids and a part of the following type III cs type sequence. X described in the above formula I of the present invention is
It corresponds to a part of III cs type array. For heparin binding activity
Although not requiring III cs, there is also the idea that the III cs sequence is required for adhesion of certain lymphoid cells. The present inventors have found a fragment containing three type III similar sequences of the heparin-binding domain (corresponding to H ₂₇₁ described in the above formula I of the present invention) and a fragment containing a part of III cs (formula I of the formula I). H ₂₇₁ −
X) was expressed in Escherichia coli and the heparin-binding activity and the cell adhesion activity were measured. As a result, both have heparin-binding activity and BHK cell-adhesion activity,
Furthermore, it was found that H _271- X has enhanced adhesion and spreading activity.

The cDNA encoding the heparin-binding domain is pLF2435.
Can be taken from. pLF2435 is the above-mentioned pLF2, pLF
3, a plasmid reconstructed from pLF4 and pLF5, containing the cDNA encoding the heparin-binding domain of LN.
However, since the cDNA corresponding to the III cs part is not included,
The DNA sequence corresponding to X needs to be constructed by chemical synthesis. A necessary cDNA fragment was cut out from pLF2435 with a restriction enzyme, and synthetic DNA containing a start codon at the 5'side was prepared.
On the side, synthetic DNA containing a stop codon was ligated with DNA ligase, and then ligated to an appropriate expression vector to prepare II
A plasmid expressing a peptide having a sequence of three type I similar sequences can be obtained (see FIG. 1). That is, FIG. 1 shows the plasmid pH expressing H ₂₇₁ .
It is a process drawing for constructing D101.

By combining this plasmid with chemically synthesized DNA corresponding to part (X) of III cs, a plasmid expressing a peptide containing III cs can be obtained (see FIG. 2). That is, FIG. 2 shows the plasmid pH expressing _H296 .
It is a process drawing for constructing D102.

As the expression vector, all existing ones can be used, for example, pUC118N / pUC119N [Fabs
FEBS Letters, Volume 223, Pages 174-180 (1
Good results can be obtained by using 987), and derivatives thereof. By introducing these into a plasmid into Escherichia coli, the heparin-binding domain polypeptide can be expressed and its properties can be investigated. Then, cDNA fragments were extracted from these plasmids and 3'of the translation region of the plasmid (pTF7520) derived from pTF7021 was extracted.
By connecting to the terminal Nco I site, a recombinant plasmid expressing a polypeptide in which the cell adhesion domain of FN and the heparin-binding domain are linked can be obtained (see FIGS. 3 and 4). That is, FIG. 3 shows C ₂₇₇ -Met-H.
₂₇₁ is a process diagram for constructing plasmid pCH101 expressing, FIG. 4 is a process diagram for constructing plasmid pCH102 which expresses C ₂₇₇ -Met-H _296.

A methionine residue derived from the Nco I site is contained as a linker in the junction of the plasmid. The presence or absence of a linker does not influence the effect of the present invention, but can be easily removed by a site-specific mutation technique if necessary.

The target peptide is accumulated in Escherichia coli by introducing the obtained plasmid into Escherichia coli and culturing it under appropriate conditions. Immunoplotting is used to confirm expression. After separating all bacterial cell proteins of recombinant E. coli by SDS-polyatalylamide electrophoresis, the electrophoretic pattern is transferred to a nitrocellulose membrane. A monoclonal antibody that recognizes the cell adhesion domain of FN (FN-10, Takara Shuzo), and
The band detected by both of the monoclonal antibodies recognizing the heparin domain of FN [IST-1 or IST-2, sold by Sera-Lab] is the polypeptide of interest.

The desired polypeptide is purified, for example, as follows.
After culturing the recombinant Escherichia coli in a medium such as L-broth and collecting the cells, ultrasonication is performed to obtain a disrupted cell suspension, which is centrifuged to obtain a supernatant. After dialysis of the supernatant, it is passed through a column of DEAE ion exchanger, and then affinity chromatography of CM ion exchanger and / or heparin-agarose is performed.
By the above operation, the desired polypeptide can be purified.

The obtained polypeptide is used for measuring cell spreading activity on BHK and NRK cells and for measuring heparin binding activity. The cell spreading activity can be measured, for example, by Ruosrati.
Lahti et al. [Methods in Enzymology, Vol. 82, pp. 803-831 (1
981)]. That is, after coating the sample, a suspension of BHK or NRK cells was added to a microtiter plate blocked with BSA, incubated at 37 ° C for about 1 hour, and then unadsorbed cells were washed and then fixed with formalin. Then, the intensity of cell extension can be measured by measuring the proportion of the extended cells under a microscope. On the other hand, the heparin-binding activity is determined by adsorbing a sample on a carrier that binds heparin, for example, a column of AF-Heparint Yopal (Tosoh) and elution by increasing the salt concentration of NaCl. The binding capacity of can be demonstrated.

As a result of the above measurement, the obtained polypeptide is
It is proved that it has a strong cell spreading activity on RK cells and a strong affinity for heparin.

〔Example〕

Hereinafter, the present invention will be described more specifically by way of examples, but the present invention is not limited to these examples.

Example 1 cDN encoding FN heparin-binding domain Ala ¹⁶⁹⁰ -Thr ¹⁹⁶⁰ (271 amine acid residue, hereinafter abbreviated as H-271)
Cloning of A fragment (see Fig. 1) (1-1) Preparation of synthetic DNA adapter 5'side (chain length 63 and 55, see Fig. 1) and 3 for connecting the cDNA fragment of heparin-conjugated dometoin to a vector Adapters on the ′ side (chain lengths 25 and 33, see FIG. 1) were synthesized using an Applied Biosystems DNA synthesizer. After phosphorylating 2 μg of each 5 ′ end, an annealing operation was performed to form a double chain.

(1-2) Preparation of Nco I-Sac I fragment 5.9 kb plasmid pLF2435 containing cDNA fragment encoding HN-271 of FN [Biochemistry Vol. 25, 4936-4]
941 (1986)] 100 μg was digested with BamHI and SacI,
It was subjected to allose gel electrophoresis and a 1.2 kb fragment was recovered. This fragment was further digested with Hae II and subjected to agarose gel electrophoresis to recover a 0.4 kb Hae II-Sac I fragment.
This fragment 700ng and the 5'-side adapter 120 obtained in (1-1)
ng to T4 DNA ligase buffer, 0.5 mM ATP, 10 mM DTT
And 20 µl of a reaction solution containing 2.8 units of T4 DNA ligase and incubated at 16 ° C overnight. Reaction temperature at 65 ℃, 10
After digestion, it was digested with Nco I and Sac I and subjected to agarose gel electrophoresis to give a 0.52 kb Nco I-Sac I fragment of about 120 ng.
Was recovered.

(1-3) Preparation of Sac I-BamH I fragment 100 μg of the above plasmid pLF2435 was added to EcoO 109I and Sa.
cI digestion, electrophoresis on agarose gel, 0.52k
The fragment of b was recovered. This fragment was further digested with Ban II and subjected to agarose gel electrophoresis to give a 0.27 kb Sac I-B
The an II fragment was recovered. 400 ng of this fragment and 80 ng of the 3′-side adapter obtained in (1-1) were incubated overnight at 16 ° C. in a 20 μl reaction solution containing a T4DAN ligase buffer, 0.5 mM ATP, 10 mM DTT and 2.8 units of T4 DNA ligase. After treating the reaction solution at 65 ° C for 10 minutes, BamHI and Sa
cI digestion, agarose gel electrophoresis, 0.30kb
About 65 ng of Sac I-BamH I fragment was recovered.

(1-4) Preparation of Nco I-BamH I fragment 120 ng of Nco I-Sac I fragment obtained in (1-2) and (1-
65ng of the Sac I-BamH I fragment obtained in 3) was added to T4 DNA ligase buffer, 0.5 mM ATP, 10 mM DTT and 2.8 units of T4DN.
The mixture was incubated overnight at 16 ° C in a 20 µ reaction solution containing A ligase. After treating the reaction solution at 65 ° C for 10 minutes, use BamHI
And digested with Nco I and subjected to agarose gel electrophoresis,
About 28 ng of 0.82 kb Nco I-BamH I fragment was recovered.

(1-5) Construction of pUC118NT Secretory expression vector pIN III-ompA ₁ [Diembo Journal, Volume 3, 2437-2442 (1984)] 1 μg
It was digested with BamHI and Sa1I, subjected to agarose gel electrophoresis, and 0.95 kb BamHI-S containing a 1 pp terminator sequence.
The a1 I fragment was recovered. 30 ng of this fragment was previously BamHI
Plasmid pUC118N30 digested with S1 and Sa1 I and dephosphorylated
ng with T4 DNA ligase buffer, 0.5 mM ATP, 10 mM
Incubation was carried out overnight at 16 ° C. in a 20 μl reaction solution containing DTT and 2.8 units of T4 DNA ligase. Reaction solution 10μ
Escherichia coli HB101 was transformed with Escherichia coli to obtain a plasmid having a 1 pp terminator sequence, which was named pUC118NT.

In addition, pUC118N is obtained by introducing an Nco I site into the translation initiation codon site of a commercially available pUC118 vector (sold by Takara Shuzo Co., Ltd.), and further setting the distance between the site of ribosome binding and the initiation codon to 8 bases.

(1-6) Cloning of Nco I-BamH I Fragment into pUC118NT 0.1 μg of the plasmid pUC118NT obtained in (1-5) was added to NUC I
After decomposing with BamHI and dephosphorization. This plasmid 20
T4D together with 20 ng of Nco I-BamH I fragment obtained in (1-4)
NA ligase buffer, 0.5 mM ATP, 10 mM DTT and 2.8
16 μl in 20 μl reaction containing unit T4 DNA ligase
Incubated at 0 ° C overnight. 10 μl of this reaction solution was used for transformation of Escherichia coli HB101.

(1-7) Transformation of Escherichia coli and Confirmation of Plasmid E. coli HB10 was prepared using 10 μl of the reaction solution obtained in (1-6).
1 was transformed. Plasmid analysis was performed on 18 clones in the obtained transformants. That is, the plasmid prepared by the rapid method was digested with BamHI and NcoI,
Expected Nco I-Bam on agarose gel electrophoresis
The generation of bands for the HI fragment (0.82 kb) was examined. As a result, the band of interest was recognized in one clone. In addition, the nucleotide sequence was determined by the dideoxy method, and it was confirmed that the target sequence was included. This recombinant plasmid was named pHD101.

In addition, Escherichia coli HB101 carrying this plasmid was Escherichia coli.
It was labeled as richia coli HB101 / pHD101 and deposited at the Institute of Industrial Science and Technology, Institute of Microbial Science and Technology [Microtechnology Research Institute No. 2264 (FE
RM BP-2264)].

(1-8) Purification of peptide from recombinant Escherichia coli HB101 / pHD101 obtained in (1-7)
The cells were shake-cultured overnight at 37 ° C. in a test tube containing 5 ml of L-broth supplemented with 0 μg / ml of ampicillin. This was inoculated into 2 Erlenmeyer flasks containing 500 ml of the same medium and the culture was continued at 100 rpm. 2 mM IPTG at an absorbance of 0.3 at 660 nm
(Isopropyl-β-thiogalactoside) was added, and the cells were collected after 20 hours. Immunoblotting was performed using a part of the cells. That is, whole cell protein was converted to SDS-PAG.
After separation with E and transfer of the electrophoretic pattern to a nitrocellulose membrane, a monoclonal antibody (IST-1, sold by Ceralab) that specifically recognizes the heparin-binding domain of FN was allowed to act, and then peroxidase-labeled second The antibody was made to act. The peroxidase activity of the bound second antibody was developed in the presence of 4-chloro-1-naphthol and hydrogen peroxide, and it was confirmed that the desired peptide was produced at around 29 kD. Next, the whole cell pellet was mixed with 20 mM K ₂ H.
The suspension was sonicated by suspending it in a solution containing PO ₄ (pH 7.0), 1 mM EDTA, 5 mM meltcaptoethanol, 3 μM para-amidinophenylmethanesulfonyl fluoride (p-APMSF). After centrifugation at 12000 rpm for 20 minutes, 25 ml of supernatant was obtained. This was passed through a column of CM-Toyopearl 650M (15 ml) equilibrated with a 20 mM K ₂ HPO ₄ (pH 7.0) buffer. After removing the non-adsorbed fraction with the same buffer, it was eluted with 20 mM K ₂ HPO ₄ (pH 7.0) buffer containing 0.15 M NaCl and fractionated. The eluate was subjected to immunoblotting to collect the target fraction. This fraction was then added to 20 mM K ₂ HPO ₄ containing 0.15 M NcC1.
It was passed through a heparin-Toyopearl 650M column (80 ml) equilibrated with a (pH 7.0) buffer. Column 0.2M NaC1
After washing with 20 mM K ₂ HPO ₄ (pH 7.0) buffer containing
0.2M NaC1 to 0.45MN in K ₂ HPO ₄ (pH 7.0) buffer
Elution was performed with a linear concentration gradient of aCl, and fractionation was performed. The target fractions were collected by immunoblotting, desalted and freeze-dried to obtain about 20 mg of a substantially electrophoretic peptide. Using ABI's peptide sequencer 477A / 120A,
When the amino acid sequence from the N-terminal of this peptide was examined, the sequence of Ala-Ile-Pro-Ala-Pro-Thr-Asp-Leu was recognized, and the N-terminal sequence of the target peptide was in agreement. In addition, it was confirmed that the C-terminal was Thr by a carboxypeptidase P (Takara Shuzo) digestion method.

Example 2 A heparin-binding domain (Ala ¹⁶⁹⁰ -Thr) containing a part of the III cs region of FN (Asp ¹⁹⁶¹ -Thr ¹⁹⁸⁵ , 25 amino acid residues).
¹⁹⁸⁵ , Cloning of a cDNA fragment encoding 296 amino residues, hereinafter abbreviated as H-296) (see FIG. 2) (2-1) Preparation of Ban II-BamH I fragment CS1 region of III cs of FN [Journal Synthetic DNA (chain length 77) containing a DNA fragment encoding J. Cell Bio. 103, 2637-2647 (1986)].
And 78, see FIG. 2) were synthesized using a DNA synthesizer manufactured by Applied Biosystems. After phosphorylating 2 μg of each 5 ′ end, the complementary sequence portion was made into a double chain by an annealing operation. This DNA is 7mM Tris
-HCl (pH 7.5), 0.1 mM EDTA, 20 mM NCl, 7 mM MgCl ₂ ,
Incubation was carried out at 37 ° C for 30 minutes in a 100 µ reaction solution containing 0.1 mM dATP, dGTP, dCTP, dTTP and 2 units of Klenow enzyme. After stopping the reaction at 70 ° C for 5 minutes, it was digested with BamHI and BanII and subjected to agarose gel electrophoresis.
About 400 ng of the 11 kb BanII-BamHI fragment was recovered.

(2-2) Preparation of Sac I-BamH I fragment 200 ng of the Ban II-BamH I fragment obtained in (2-1)
490ng of the 0.27 kb Sac I-BamH II fragment obtained in -3) was added to T4 DNA.
Ligase buffer, 0.5mM ATP, 10mM DTT and 2.8 units of T4DA ligase in a 20μ reaction solution, 16 ℃,
Incubated overnight. The reaction solution was treated at 65 ° C. for 10 minutes, digested with BamHI and SacI, and subjected to agarose gel electrophoresis to recover about 100 ng of a 0.38 kb SacI-BamHI fragment.

(2-3) Preparation of Sac I-BamH I fragment (vector fragment) of pHD101 1 μg of plasmid pHD101 encoding H-271 was added to Sac
It was digested with I and BamHI, dephosphorylated, and then subjected to agarose gel electrophoresis to recover about 280 ng of a 4.6 kb Sac I BamHI vector fragment.

(2-4) Ligation of Sac I-BamH I fragment and vector 50 ng of 0.38 kb Sac I-BamH I fragment obtained in (2-2)
And 20 ng of the 4.6 kb Sac I-BamH I vector fragment obtained in (2-3) was added to T4 DNA ligase buffer, 0.5 mM ATP, 10 mM
Incubation was carried out overnight at 16 ° C. in a 20 μl reaction solution containing DTT and 2.8 units of T4 DNA ligase. This reaction 10
μ was used to transform E. coli HB101.

(2-5) Transformation of Escherichia coli and confirmation of plasmid Escherichia coli HB101 was obtained by using 10 μm after the reaction obtained in (2-4).
Was transformed. Plasmid analysis was performed on 12 clones in the obtained transformants. That is, the plasmid prepared by the rapid method was digested with BamHI and NcoI, subjected to agarose gel electrophoresis, and the expected NcoI-BamH
The generation of the band of the I fragment (0.9 kb) was examined. As a result, 1
The desired band was observed in the clone. In addition, the nucleotide sequence was determined by the dideoxy method, and it was confirmed that the target sequence was included. This recombinant plasmid was named pHD102.

In addition, Escherichia coli HB101 carrying this plasmid was Escherichia coli.
It was labeled as richia coli HB101 / pHD102 and deposited at the Institute of Microbial Science and Technology of the Agency of Industrial Science and Technology [Microtechnology Research Institute, No. 10721 (FER
MP-10721)].

(2-6) Purification of peptide from recombinant Escherichia coli HB101 / pHD102 obtained in (2-5)
Was cultured and purified in the same manner as in (1-8), and about 5 mg of a substantially electrophoretically single peptide was obtained from 500 ml of the culture solution. Using ABI's peptide sequencer 477A / 120A,
When the amino acid sequence from the N-terminal of this peptide was examined, it was in agreement with the N-terminal sequence of the target peptide. Further, it was confirmed by the carboxypeptidase P elimination method that the C terminus was Thr.

Example 3 cDN encoding a fusion protein of F-1 cell adhesion domain Pro ¹²³⁹ -Ser ¹⁵¹⁵ (277 amino acid residues) and H-271
Cloning of A fragment (see Fig. 3) (3-1) Cell adhesion domain Pro ¹²³⁹ -Ser ¹⁵¹⁵ (277
Construction of a plasmid encoding amino acid residue) The Nco I site was constructed immediately before the stop codon of the translation region of the recombinant plasmid pTF7021 described in Japanese Patent Application No. 63-31820 by a site-specific mutation technique. The introduced plasmid was constructed. The introduction of the Nco I site into pTF7021 was carried out using the oligonucleotide d [pCTATTACACCATGGATGGTTT
G] to synthesize the site-directed mutagenesis system Mutan-K (Site-directed m
utagenesis system Mutan-K) [sales by Takara Shuzo Co., Ltd.]
This was performed using With the introduction of this Nco I site, Gln ^1516- Met ^{1517 at} the C-terminal of the cell adhesion domain was converted to Met ^1516- Val.
^It is replaced by ¹⁵¹⁷ (see Figure 3). The resulting plasmid was named pTF7520.

(3-2) Preparation of Nco I-Hinc II fragment of pHD101 1 μg of recombinant plasmid pHD101 obtained in (1-7)
Was digested with Nco I and Hinc II and subjected to agarose gel electrophoresis to recover about 100 ng of a 1.77 kb Nco I-Hinc II fragment.

(3-3) Cloning of Nco I-Hinc II fragment of pHD101 into TF7520 The plasmid pTF7520 obtained in (3-1) was cloned into Hco I and Hinc.
After decomposing with II, it was dephosphorized. 50 ng of this plasmid together with 50 ng of Nco I-Hinc II fragment obtained in (1-2) was used for T4 DNA.
Ligase buffer, 0.5 mM ATP, 10 mM DTT and 2.8 units of T4 DNA ligase
Incubated at 0 ° C overnight. 10 μl of this reaction solution was used to transform Escherichia coli HB101, and FN cell adhesion domain Pro
A plasmid expressing a fusion protein (C ₂₇₇ -Met-H ₂₇₁ ) in which ¹²³⁹ -Ser ¹⁵¹⁵ (277 amino acid residues) and H-271 were bound to meet with Met was obtained and named pCH101.

In addition, Escherichia coli HB101 carrying this plasmid was Escherichia coli.
It was labeled as richia coli HB101 / pCH101 and deposited at the Institute of Microbial Science and Technology of the Agency of Industrial Science and Technology [Microtechnology Research Institute No. 2799 (FE
RM BP-2799)].

(3-4) Removal of intervening sequence (ATG) from pCH101 Cell adhesion domain of fusion protein (C ₂₇₇ -Met-H ₂₇₁ ) expressed by plasmid pCH101 obtained in (3-3) Pro ¹²³⁹ -Ser ¹⁵¹⁵ ( (277 amino acid residues) and H-271 have Met added. The sequence (ATG) corresponding to this Met was removed by the site-directed mutagenesis technique. pCH10
The removal of the intervening sequence (ATG) from 1 was performed by synthesizing the oligonucleotide d [pAGGAATAGCGGATGGTTT], and the site-directed mutagenesis system mutant
It was carried out using K [Takara Shuzo Co., Ltd.]. As a result, cell adhesion domain Pro ¹²³⁹ -Ser ¹⁵¹⁵ (277 amino acid residues)
Fusion protein (C _277-
A plasmid expressing H ₂₇₁ ) was obtained and named pCH201.

(3-5) Purification of peptide from recombinant Escherichia coli HB101 / pCH101 obtained in (3-3)
Culture was performed in the same manner as in (1-8), and an extract was obtained from 500 ml of the cultured bacterial cells. Fractions that react with both the monoclonal antibody (FN-10, Takara Shuzo) that recognizes the cell adhesion domain of FN and the monoclonal antibody IST-1 were purified in the same manner as in (1-8) to obtain 15 mg of a purified product. Obtained. The N-terminal sequence of this peptide matched the sequence of the target peptide. Also,
Carboxypeptidase P digestion resulted in Thr-terminal
Was confirmed.

Example 4 cDN encoding a fusion protein of F1 cell adhesion domain Pro ¹²³⁹ -Ser ¹⁵¹⁵ (277 amino acid residues) and H-296
Cloning of A fragment (see Fig. 4) (4-1) Preparation of Nco I-Hinc II fragment of pHD102 1 of recombinant plasmid pHD102 obtained in (2-5)
μg was digested with Nco I and Hinc II and subjected to agarose gel electrophoresis to recover about 100 ng of a 1.84 kb Nco I-Hinc II fragment.

(4-2) Cloning of Nco I-Hinc II fragment of pHD102 into pTF7520 The plasmid pTF7520 obtained in (3-1) was cloned into Nco I and Hinc.
After decomposing with II, it was dephosphorized. 50ng of this plasmid together with 50ng of Nco I-Hinc II fragment obtained in (4-1) was used for T4 DNA.
Ligase buffer, 0.5 mM ATP, 10 mM DTT, and 28 units of T4 DNA ligase
Incubated at 0 ° C overnight. 10 μl of this reaction solution was used to transform Escherichia coli HB101, and FN cell adhesion domain Pro
A plasmid expressing a fusion protein (C ₂₇₇ -Met-H ₂₉₆ ) in which ¹²³⁹ -Ser ¹⁵¹⁵ (277 amino acid residues) and H-296 bound to Met and bound was obtained and named pCH102.

In addition, Escherichia coli HB101 carrying this plasmid was Escherichia coli.
It was displayed as richia coli HB101pCH102 and deposited at the Institute of Microbial Science and Technology of the Agency of Industrial Science and Technology [Microtechnology Research Institute No. 2800 (FERM
BP-2800)].

(4-3) Removal of intervening sequence (ATG) from pCH102 Cell adhesion domain Pro ¹²³⁹ -Ser ¹⁵¹⁵ (C ₂₇₇ -Met-H ₂₉₆ ) of fusion protein expressed by plasmid pCH102 obtained in (4-2) ( Met is added between H-296 and 277 amino acid residues). The sequence (ATG) corresponding to this Met was removed by the same method as in (3-4). As a result, a fusion protein (C-C1) that directly binds to the cell adhesion domain Pro ¹²³⁹ -Ser ¹⁵¹⁵ (277 amino acid residues) and H-296 (C
The resulting plasmids expressing ₂₇₇ -H _296), was named PCH202.

(4-4) Purification of peptide from recombinant Escherichia coli HB101 / pCH102 obtained in (4-2) was cultured and purified in the same manner as in (3-5), and electrophoresed from 500 ml of culture solution. About 6 mg of almost single peptide was obtained. The results of N-terminal sequence analysis and C-terminal analysis were in agreement with those of the target peptide.

Example 5 Measurement of biological activity Cell adhesion and heparin binding activity were measured using each of the polypeptides obtained in Examples 1 to 4 above.

The cell adhesion activity can be determined by the method of Luoslati et al. [Methods
In Enzymology, Vol. 82, pp. 803-831 (198
1)]. The sample was dissolved in distilled water, PBS (phosphate buffered saline), etc., and serially diluted on a 96-well microplate. The sample was adsorbed on the plate by incubating at 4 ° C. for 2 hours (50 μ / well). 10% PBS solution containing 3% BSA (bovine serum albumin)
The plate was blocked by adding 0 μ / well and incubating at 37 ° C. for 1 hour. After washing the plate with PBS, 100 μ / well of baby hamster Ken cells (BHK-21) suspended in Dulbecoo's Eagle's minimal nutrient medium (DMEM) at 5 × 10 ⁵ cells / ml were dispensed. And incubated at 37 ° C. for 1 hour. Still used
BHK-21 cells were obtained by subculturing the cryopreserved strain and then subjecting it to trypsin treatment (37 ° C., 5 minutes). After washing the plate with PBS, the cells were fixed on the plate with a 3% formalin solution.

The extension of BHK-21 cells was observed under a microscope, and the concentration (ED ₅₀ ) of the sample in which the number of extended cells was 50% of the number of extended cells at high concentration of n-FN was determined and used as an index of cell adhesion activity.

 The heparin-binding activity was measured as follows.

The sample is placed on a column of AF Heparin-Toyopearl 650M (1.5 ml) equilibrated with 20 mM phosphate buffer (ph7.0), the NaCl concentration in the buffer is increased stepwise, and heparin is converted to heparin depending on the eluted salt concentration. Expressed the bond strength.

The first is the result of measuring the biological activity of each sample by the above method.
Shown in the table.

[Advantages of the Invention] As described above, according to the present invention, novel polypeptides having both cell adhesion activity and heparin binding activity, genes encoding them, and genetic engineering production using the genes are produced. A method is provided. This polypeptide mediates the binding between cells and extracellular matrix such as heparan sulfate, and is a useful protein useful for wound healing and the like.

[Brief description of drawings]

FIG. 1 is a process drawing for constructing a plasmid pHD101 expressing H-271, FIG. 2 is a process drawing for constructing a plasmid pHD102 expressing H-296, and FIG. 3 is a C ₂₇₇ -Met.
-H ₂₇₁ expressing plasmid pCH101, FIG. 4 shows a plasmid p expressing C ₂₇₇ -Met-H _296.
It is a process drawing for constructing CH102.

─────────────────────────────────────────────────── ─── Continuation of the front page (51) Int.Cl. ⁶ Identification number Office reference number FI technical display location // A61K 38/00 A61K 37/02 (C12P 21/02 C12R 1:19) (72) Inventor Goto, Seiichi 3-4-1, Seta, Otsu, Shiga Prefecture, Central Research Laboratory, Sake Brewing Co., Ltd. (72) Inventor, Fusao Kimizuka, 3-4-1, Seta, Otsu City, Shiga Pref. 72) Inventor Ikunoshin Kato 3-4-1 Seta, Otsu City, Shiga Prefecture, Central Research Laboratory, Mina Shuzo Co., Ltd. (56) Reference JP-A-62-89699 (JP, A) JP-A-62-272975 ( JP, A) JP 62-282593 (JP, A) JP 62-236485 (JP, A) JP 62-244393 (JP, A)

Claims (5)

(57) [Claims] 1. The following general formula I: C ₂₇₇ Met _n H _271- X ... [I] [wherein C ₂₇₇ is a 277 amino acid peptide residue corresponding to Pro ¹²³⁹ -Ser ¹⁵¹⁵ of the cell adhesion domain of human fibronectin. The following formula II: H ₂₇₁ corresponds to Ala ^1690- Thr ¹⁹⁶⁰ of the heparin-binding domain of human fibronectin.
A single amino acid peptide residue is shown and has the following formula III: X has the following formula IV: A peptide residue represented by or a group in which a part or all thereof is deleted, Met represents a methionine residue, and n represents a number of 1 or zero] Polypeptide. 2. A gene encoding the functional polypeptide according to claim 1. 3. A recombinant plasmid containing a gene encoding the functional polypeptide according to claim 2. 4. A transformant having the recombinant plasmid according to claim 3 introduced therein. 5. A method for producing a functional polypeptide, comprising culturing the transformant according to claim 4, and collecting the functional polypeptide according to claim 1 from the culture.