JPH1052278A - Production of functional polypeptide - Google Patents

Abstract

PROBLEM TO BE SOLVED: To obtain a new transformant containing a recombinant plasmid coding for a functional polypeptide expressed by a specific amino acid sequence and having a cell adhesion activity and a heparin-bonding activity of fibronectin and useful e.g. for the production of a functional, polypeptide. SOLUTION: This new polypeptide is a transformant transformed by a recombinant plasmid containing a gene coding for a functional polypeptide expressed by an amino acid sequence of the formula and having a cell adhesion activity and a heparin-bonding activity of fibronectin. It is useful e.g. for the advantageous genetic engineering production of a functional polypeptide contributing to the restoration of the tissue of the wound part and the maintenance of homeostasis by bonding to both a cell and an extracellular matrix. The transformant can be produced by integrating a cDNA for a cell adhesion domain and a cDNA for a heparin-bonding domain of fibronectin into an expression vector and inserting the obtained recombinant expression vector into a host cell such as E.coli to effect the transformation of the cell.

Description

DETAILED DESCRIPTION OF THE INVENTION

[0001]

[0001] The present invention relates to a method for producing a novel functional polypeptide containing a heparin-binding domain peptide of human fibronectin by genetic engineering.

[0002]

2. Description of the Related Art Fibronectin (hereinafter referred to as FN) is a glycoprotein present in plasma and extracellular matrix, and is known to have various functions [Annual Review of Biochemistry (Annual Review of Biochemistry (Annual Review).
Review of Biochemistry), Vol. 57, pp. 375-413 (1
988)]. Attempts have been made to use natural FN for wound healing, eye drops and other pharmaceuticals and cosmetics. However, because it is collected from blood, the supply is limited, the cost is high, and pathogenic bacteria are used. It has not been put to practical use because of the possibility of contamination by viruses and viruses. Also, extracting and using a functional domain of FN has not been put to practical use for the same reason.

[0003]

The FN has two heparin-binding regions (heparin-binding domains).
One location is near the N-terminus and is known to require Ca ions for binding. The other region is near the C-terminus, and the binding activity of this region to heparin is stronger than that of the aforementioned region, and is not affected by Ca ions. Recent studies have gradually revealed that the heparin-binding domain of FN plays an important role in adhesion, extension and migration of fibroblasts, endothelial cells, and certain cancer cells, as well as the cell adhesion domain. Was. The heparin binding domain of FN binds to proteoglycans on the cell surface,
It is thought that by causing the interaction between the cell and the extracellular matrix, it contributes to cell adhesion, spreading, migration and the like. Therefore, polypeptides having both cell adhesion activity and peparin binding activity bind to both cells and the extracellular matrix and contribute to the repair of wound tissue and maintenance of homeostasis, making them useful as pharmaceuticals. Can be expected. An object of the present invention is to provide a method for genetically advantageous production of a novel functional polypeptide having both functions of FN cell adhesion activity and heparin binding activity.

[0004]

SUMMARY OF THE INVENTION To summarize the present invention, a first invention of the present invention comprises a gene encoding a functional polypeptide represented by an amino acid sequence represented by the following formula (Formula 1). The present invention relates to a transformant transformed with the recombinant plasmid described below.

[0005]

Embedded image Ala Ile Pro Ala Pro Thr Asp Leu Lys Phe Thr Gln Val Thr Pro Thr Ser Leu Ser Ala Gln Trp Thr Pro Pro Asn Val Gln Leu Thr Gly Tyr Arg Val Arg Val Thr Pro Lys Glu Lys Thr Gly Pro Met Lys Glu Ile Asn Leu Ala Pro Asp Ser Ser Ser Val Val Val Ser Gly Leu Met Val Ala Thr Lys Tyr Glu Val Ser Val Tyr Ala Leu Lys Asp Thr Leu Thr Ser Arg Pro Ala Gln Gly Val Val Thr Thr Leu Glu Asn Val Ser Pro Pro Arg Arg Ala Arg Val Thr Asp Ala Thr Glu Thr Thr Ile Thr Ile Ser Trp Arg Thr Lys Thr Glu Thr Ile Thr Gly Phe Gln Val Asp Ala Val Pro Ala Asn Gly Gln Thr Pro Ile Gln Arg Thr Ile Lys Pro Asp Val Arg Ser Tyr Thr Ile Thr Gly Leu Gln Pro Gly Thr Asp Tyr Lys Ile Tyr Leu Tyr Thr Leu Asn Asp Asn Ala Arg Ser Ser Pro Val Val Ile Asp Ala Ser Thr Ala Ile Asp Ala Pro Ser Asn Leu Arg Phe Leu Ala Thr Thr Pro Asn Ser Leu Leu Val Ser Trp Gln Pro Pro Arg Ala Arg Ile Thr Gly Tyr IIe Ile Lys Tyr Glu Lys Pro Gly Ser Pro Pro Arg Glu Val Val Pro Arg Pro Arg Pro Gly Val Thr Glu Ala Thr Ile Thr Gly Leu Glu Pro Gly Th r Glu Tyr Thr Ile Tyr Val Ile Ala Leu Lys Asn Asn Gln Lys Ser Glu Pro Leu Ile Gly Arg Lys Lys Thr Asp Glu Leu Pro Gln Leu Val Thr Leu Pro His Pro Asn Leu His Gly Pro Glu Ile Leu Asp Val Pro Ser Thr

[0006] A second invention is to cultivate the transformant,
The present invention relates to a novel method for producing a functional polypeptide, comprising collecting the polypeptide from the culture.

The present inventors have studied the construction of a novel polypeptide having both cell spreading activity and heparin binding activity and a method for producing the same, and have produced a novel functional polypeptide by genetic engineering. As a result of examining the biological activity of this novel functional polypeptide, it was found that it has both cell spreading activity and heparin binding activity,
It was found that the cell spreading activity on cells was enhanced as compared with the case where the cell adhesion domain was used alone.

[0008]

BEST MODE FOR CARRYING OUT THE INVENTION The present invention will be specifically described below. The gene structure of human FN is described in The EMBO Journal, Vol. 4, pp. 1755-1759.
Page (1985). For cDNA clones (pLF2, pLF3, pLF4 and pLF5) encoding the cell adhesion domain and the heparin binding domain, see Biochemistry, Vol. 25, pp. 4936-4494 (1).
986). The present inventors have developed a cell adhesion-active polypeptide and a method for producing the same by extracting a cDNA fragment for the cell adhesion domain from pLF5, connecting it to an expression vector, and introducing it into Escherichia coli. No. 63-31820 (JP-A-1-206998).
The cDNA of the cell adhesion domain required in the present invention is a recombinant plasmid described in JP-A-1-206998.
pTF7021 can be used. pTF7021 is FN Pro
^This is a plasmid that expresses ^1239- Met ¹⁵¹⁷ (279 amino acid residues). By introducing a cloning site, for example, an NcoI site immediately before the C-terminal stop codon of the translation region of pTF7021, cDNA of the cell adhesion domain and cDNA of another domain can be linked.

One specific example of the novel functional polypeptide according to the present invention is a compound represented by the general formula C _277- (Met) _n -H ₂₇₁ -X
[ _Wherein C ₂₇₇ is the cell adhesion domain of human FN Pro ^1239-
Indicates a 277 amino acid peptide residue corresponding to Ser ¹⁵¹⁵ ,
The following formula (Formula 2):

[0010]

Embedded image ₁₂₃₉ Pro Thr Asp Leu Arg Phe Thr Asn Ile Gly Pro Asp Thr Met Arg Val Thr Trp Ala Pro Pro Pro Ser Ile Asp Leu Thr Asn Phe Leu Val Arg Tyr Ser Pro Val Lys Asn Glu Glu Asp Val Ala Glu Leu Ser Ile Ser Pro Ser Asp Asn Ala Val Val Leu Thr Asn Leu Leu Pro Gly Thr Glu Tyr Val Val Ser Val Ser Ser Val Tyr Glu Gln His Glu Ser Thr Pro Leu Arg Gly Arg Gln Lys Thr Gly Leu Asp Ser Pro Thr Gly Ile Asp Phe Ser Asp Ile Thr Ala Asn Ser Phe Thr Val His Trp Ile Ala Pro Arg Ala Thr Ile Thr Gly Tyr Arg Ile Arg His His Pro Glu His Phe Ser Gly Arg Pro Arg Glu Asp Arg Val Pro His Ser Arg Asn Ser Ile Thr Leu Thr Asn Leu Thr Pro Gly Thr Glu Tyr Val Val Ser Ile Val Ala Leu Asn Gly Arg Glu Glu Ser Pro Leu Leu Ile Gly Gln Gln Ser Thr Val Ser Asp Val Pro Arg Asp Leu Glu Val Val Ala Ala Thr Pro Thr Ser Leu Leu Ile Ser Trp Asp Ala Pro Ala Val Thr Val Arg Tyr Tyr Arg Ile Thr Tyr Gly Glu Thr Gly Gly Asn Ser Pro Val Gln Glu Phe Thr Val Pro Gly Ser Lys Ser Thr Ala Thr Ile Ser Gly Leu Lys Pro Gly Val Asp Tyr Th r Ile Thr Val Tyr Ala Val Thr Gly Arg Gly Asp Ser Pro Ala Ser Ser Lys Pro Ile Ser Ile Asn Tyr Arg ₁₅₁₅ Thr Glu Ile Asp Lys Pro Ser

[0011] comprising a sequence represented by, H ₂₇₁ corresponds to Ala ¹⁶⁹⁰ -Thr ¹⁹⁶⁰ heparin binding domain of human FN 2
A 71 amino acid peptide residue represented by the following formula (Formula 3):

[0012]

Embedded image₁₆₉₀ Ala Ile Pro Ala Pro Thr Asp Leu Lys Phe Thr Gln Val Thr Pro Thr Ser Leu Ser Ala Gln Trp Thr Pro Pro Asn Val Gln Leu Thr Gly Tyr Arg Val Arg Val Thr Pro Lys Glu Lys Thr Gly Pro Met Lys Glu Ile Asn Leu Ala Pro Asp Ser Ser Ser Val Val Val Ser Gly Leu Met Val Ala Thr Lys Tyr Glu Val Ser Val Tyr Ala Leu Lys Asp Thr Leu Thr Ser Arg Pro Ala Gln Gly Val Val Thr Thr Leu Glu Asn Val Ser Pro Pro Arg Arg Ala Arg Val Thr Asp Ala Thr Glu Thr Thr Ile Thr Ile Ser Trp Arg Thr Lys Thr Glu Thr Ile Thr Gly Phe Gln Val Asp Ala Val Pro Ala Asn Gly Gln Thr Pro Ile Gln Arg Thr Ile Lys Pro Asp Val Arg Ser Tyr Thr Ile Thr Gly Leu Gln Pro Gly Thr Asp Tyr Lys Ile Tyr Leu Tyr Thr Leu Asn Asp Asn Ala Arg Ser Ser Pro Val Val Ile Asp Ala Ser Thr Ala Ile Asp Ala Pro Ser Asn Leu Arg Phe Leu Ala Thr Thr Pro Asn Ser Leu Leu Val Ser Trp Gln Pro Pro Arg Ala Arg Ile Thr Gly Tyr IIe Ile Lys Tyr Glu Lys Pro Gly Ser Pro Pro Arg Glu Val Val Pro Arg Pro Arg Pro Gly Val Thr Glu Ala Thr Ile Thr Gly Leu Glu Pro Gly Thr Glu Tyr ThrIle Tyr Val Ile Ala Leu Lys Asn Asn Gln Lys Ser Glu Pro Leu Ile Gly Arg Lys Lys ₁₉₆₀ Thr

Wherein X is the following formula (Formula 4):

[0014]

Embedded image Asp-Glu-Leu-Pro-Gln-Leu-Val-Thr-Leu-Pro-His-Pro-Asn-Leu-His-Gly-Pro-Glu-Ile-Leu-Asp-Val-Pro- Ser-Thr

And a group in which a part or all of the peptide residue is deleted, Met represents a methionine residue, and n represents a number of 1 or zero. Functional polypeptides.

As for the heparin-binding domain, a fragment obtained by digestion with trypsin, thermolysin, cathepsin D and the like has been reported, and its size is 29 kD.
To 38kD. Although the domain is not specified in detail, generally, three types III analogous sequences consisting of about 90 amino acids and a fragment containing a part of the type IIIcs sequence are known. X in the general formula of the present invention corresponds to a part of the IIIcs type sequence. Some believe that IIIcs is not required for heparin-binding activity, but that adhesion of certain lymphoid cells requires a IIIcs sequence. The present inventors have a fragment comprising three type III analogous sequences of heparin binding domain (corresponding to H ₂₇₁ as described in the general formula of the present invention), further fragment containing a portion of IIIcs (formula H ₂₇₁ -X) was expressed in E. coli, the results of the measurement of the heparin binding activity and cell adhesive activity, both of, which has a heparin-binding activity, have adhesive activity against BHK cells, the more H ₂₇₁ -X, It was found that the adhesion and spreading activities were enhanced.

CDNA encoding the heparin binding domain
Can be extracted from pLF2435. pLF2435 is a plasmid reconstituted from pLF2, pLF3, pLF4 and pLF5 and contains cDNA encoding the heparin binding domain of FN. However, since the cDNA corresponding to the IIIcs portion is not included, the DNA sequence corresponding to X must be constructed by chemical synthesis. A necessary cDNA fragment was excised from pLF2435 with a restriction enzyme, and a synthetic DN containing an initiation codon on the 5 'side was obtained.
A, and a synthetic DNA containing a stop codon on the 3 'side.
Is ligated with DNA ligase and then connected to an appropriate expression vector to obtain a plasmid expressing a peptide having a sequence of three type III analogs (see FIG. 1). That is, FIG. 1 is a process diagram for constructing plasmid pHD101 which expresses H _271.

By combining this plasmid with a chemically synthesized DNA corresponding to part (X) of IIIcs,
A plasmid expressing the peptide containing Ics is obtained (see FIG. 2). That is, FIG. 2 is a process diagram for constructing plasmid pHD102 which expresses H _296.

As the expression vector, any of the existing vectors can be used. For example, pUC118N / pUC119N
[FEBS Letters, Vol. 223,
Good results can be obtained by using 174-180 (1987), and derivatives thereof. By introducing these plasmids into Escherichia coli, heparin binding domain polypeptide can be expressed and its properties can be examined. Next, cDNA fragments were removed from these plasmids, and plasmids (pTF7520
By connecting to the 3'-terminal NcoI site of the translation region of (3), a recombinant plasmid expressing a polypeptide in which the cell adhesion domain of FN and the heparin binding domain are linked can be obtained (see FIGS. 3 and 4). That is, FIG.
₂₇₇ is a process diagram for constructing plasmid pCH101 expressing -Met-H _271, FIG. 4 is a process diagram for the construction of plasmid pCH 102 expressing C ₂₇₇ -Met-H _296.

At the junction in the plasmid, Nco
A methionine residue from the I site is included as a linker. The presence or absence of a linker does not affect the effect of the present invention, but can be easily removed by site-specific mutagenesis if necessary.

The target peptide is accumulated in E. coli by introducing the obtained plasmid into E. coli and culturing it under appropriate conditions. Immunoblotting is used to confirm expression. The whole cell protein of the recombinant E. coli
After separation by DS-polyacrylamide electrophoresis, the migration pattern is transferred to a nitrocellulose membrane. A monoclonal antibody that recognizes the cell adhesion domain of FN (FN-10, Takara Shuzo) and a monoclonal antibody that recognizes the heparin domain of FN [IST-1 or IST-2, Sera-L (Sera-L)
ab) The polypeptide detected in both cases is the target polypeptide. Purification of the target polypeptide is performed, for example, as follows. After culturing the recombinant Escherichia coli in a medium such as L-broth and collecting the cells, a lysate of the cells is obtained by sonication,
This is centrifuged to obtain a supernatant. After dialysis of the supernatant, it is passed through a column of a DEAE ion exchanger, followed by affinity chromatography such as a CM ion exchanger and / or heparin-agarose. By the above operation, the target polypeptide can be purified.

The obtained polypeptide is BHK or NRK.
It is used to measure cell spreading activity on cells and to measure heparin binding activity. The cell spreading activity is measured, for example, by the method of Ruoslahti et al. [Methods in
Methods in Enzymology, 82
Vol., Pp. 803-831 (1981)]. That is, after coating a sample, a suspension of BHK or NRK cells was added to a microtiter plate blocked with BSA, and incubated at 37 ° C. for about 1 hour.
After washing the unadsorbed cells, the cells are fixed in formalin, and the ratio of the expanded cells is measured under a microscope, whereby the strength of the cell expansion can be measured. On the other hand, the heparin binding activity is determined by adsorbing a sample on a column to which heparin is bound, for example, a column of AF-heparintoyopearl (Tosoh).
The salt is eluted by increasing the salt concentration of NaCl, and the eluted salt concentration indicates the ability to bind to heparin. By the above measurement, the polypeptide obtained is BHK or N
It is proved that it shows strong cell spreading activity for RK cells and also has strong affinity for heparin.

[0023]

EXAMPLES Hereinafter, the present invention will be described more specifically with reference to examples, but the present invention is not limited to these examples.

Example 1 cDNA encoding the heparin-binding domain of FN, Ala ¹⁶⁹⁰ -Thr ¹⁹⁶⁰ (271 amino acid residues, hereinafter abbreviated as H-271)
Cloning of Fragment (See FIG. 1) (1-1) Preparation of Synthetic DNA Adapter The 5 ′ side (chain length 63 and 55, see FIG. 1) and the 3 ′ side (chain length 63 and 55; Adapters with chain lengths of 25 and 33, see FIG. 1) were synthesized using a DNA synthesizer from Applied Biosystems. After phosphorylation of 2 μg of each 5 ′ end, a double chain was formed by an annealing operation. (1-2) Preparation of NcoI-SacI Fragment A 5.9 kb plasmid pLF2435 containing a cDNA fragment encoding H-271 of FN [Biochemistry Vol. 25, No. 4936-
4941 (1986)] 100 μg was digested with BamHI and SacI,
A 1.2 kb fragment was recovered by agarose gel electrophoresis. This fragment was further digested with HaeII and subjected to agarose gel electrophoresis to recover a 0.46 kb HaeII-SacI fragment. 700 ng of this fragment and the 5 'adapter 1 obtained in (1-1)
20ng buffer for T4 DNA ligase, 0.5mM ATP, 10mMD
Incubated overnight at 16 ° C. in a 20 μl reaction containing TT and 2.8 units of T4 DNA ligase. 65
After treatment at 10 ° C. for 10 minutes, the mixture was digested with NcoI and SacI and subjected to agarose gel electrophoresis to recover about 120 ng of a 0.52 kb NcoI-SacI fragment. (1-3) Preparation of SacI-BamHI fragment 100 μg of the above plasmid pLF2435 was added to EcoO 109I and S
After digestion with acI, the mixture was subjected to agarose gel electrophoresis.
Was recovered. This fragment was further digested with Ban II and subjected to agarose gel electrophoresis to obtain a 0.27 kb SacI-B
The an II fragment was recovered. 400 ng of this fragment and 80 ng of the 3′-side adapter obtained in (1-1) were combined with a buffer for T4 DNA ligase,
Incubated overnight at 16 ° C. in a 20 μl reaction containing 0.5 mM ATP, 10 mM DTT and 2.8 units of T4 DNA ligase. After treating the reaction solution at 65 ° C for 10 minutes, BamHI and S
After digestion with acI, the gel was subjected to agarose gel electrophoresis.
About 65 ng of the SacI-BamHI fragment was recovered. (1-4) Preparation of NcoI-BamHI fragment 120 ng of the NcoI-SacI fragment obtained in (1-2) and the ScoI obtained in (1-3)
65 ng of the acI-BamHI fragment was incubated overnight at 16 ° C. in a 20 μl reaction containing T4 DNA ligase buffer, 0.5 mM ATP, 10 mM DTT and 2.8 units of T4 DNA ligase. After treating the reaction solution at 65 ° C. for 10 minutes, BamHI and
Digest with NcoI and run on agarose gel electrophoresis, 0.82
About 28 ng of the NcoI-BamHI fragment of kb was recovered.

(1-5) Construction of pUC118NT 1 μg of secretory expression vector pIN III-ompA ₁ [Diembo Journal, Vol. 3, pp. 2437-2442 (1984)] was used.
I and SalI, digested with agarose gel electrophoresis, 0.95 kb BamHI-Sal containing lpp terminator sequence
The I fragment was recovered. 30 ng of this fragment was digested with BamHI and SalI and dephosphorylated beforehand.
buffer for T4 DNA ligase, 0.5 mM ATP, 10 ng
20μ with mM DTT and 2.8 units of T4 DNA ligase
Incubate overnight at 16 ° C in 1 l of the reaction solution. Reaction liquid
Escherichia coli HB101 was transformed with 10 μl to obtain a plasmid having an lpp terminator sequence and named pUC118NT. The pUC118N was prepared by introducing an NcoI site into the translation initiation codon site of a commercially available pUC118 vector (Takara Shuzo Co., Ltd.), and further increasing the distance between the ribosome binding site and the initiation codon by 8
It is a base. (1-6) Cloning of NcoI-BamHI fragment into pUC118NT 0.1 μg of the plasmid pUC118NT obtained in (1-5) was
After digestion with BamHI, it was dephosphorylated. 20 ng of this plasmid
20 ng of the NcoI-BamHI fragment obtained in (1-4), a buffer for T4 DNA ligase, 0.5 mM ATP, 10 mM DTT and 2.8
In a 20 μl reaction containing units of T4 DNA ligase,
Incubated overnight at ℃. 10 μl of this reaction solution was used for transformation of E. coli HB101.

(1-7) Transformation of Escherichia coli and confirmation of plasmid Escherichia coli HB101 was transformed using 10 μl of the reaction solution obtained in (1-6). Plasmid analysis was performed on 18 clones in the obtained transformants. That is, the plasmid prepared by the rapid method was digested with BamHI and NcoI and subjected to agarose gel electrophoresis to examine the expected band formation of the NcoI-BamHI fragment (0.82 kb). As a result, a target band was observed in one clone. In addition, the nucleotide sequence was determined by the dideoxy method, and it was confirmed that the target sequence was contained. This recombinant plasmid was named pHD101. Escherichia coli HB101 carrying this plasmid was
It was designated as cherichia coli HB101 / pHD101 and deposited with the Institute of Microbial Industry and Technology, Ministry of International Trade and Industry [Microtechnical Research Institute No. 2264 (FERM BP-2264)].

(1-8) Purification of Peptide from Recombinant Escherichia coli HB101 / pHD101 obtained in (1-7)
The cells were shake-cultured overnight at 37 ° C. in a test tube containing 5 ml of L-broth supplemented with g / ml of ampicillin. This was inoculated into a 2 liter Erlenmeyer flask containing 500 ml of the same medium, and 100 rpm.
The culturing was continued. When the absorbance at 660 nm is 0.3, 2 mM
IPTG (isopropyl-β-thiogalactoside) was added,
After 20 hours, cells were collected. Immunoblotting was performed using a part of the cells. That is, whole cell proteins are converted to SDS-
After separation by PAGE and transfer of the electrophoresis pattern to a nitrocellulose membrane, a monoclonal antibody (IST-1, commercially available from Cellarlab) that specifically recognizes the heparin-binding domain of FN was allowed to act.
The antibody was allowed to act. The peroxidase activity of the bound second antibody was developed in the presence of 4-chloro-1-naphthol and hydrogen peroxide, and it was confirmed that the target peptide was produced at around 29 kD. Next, the whole cell pellet was added to 20 mM K
_The suspension was suspended in a solution containing ₂ HPO ₄ (pH 7.0), 1 mM EDTA, 5 mM meltcaptoethanol, and 3 μM para-amidinophenylmethanesulfonyl fluoride (p-APMSF) and subjected to sonication. After centrifugation at 12000 rpm for 20 minutes, 25 ml of the supernatant was obtained. This was passed through a _{20mM K 2 HPO 4 (pH 7.0} ) buffer equilibrated with CM- Toyopearl 650M column (15 ml). After removing the non-adsorbed fraction with the same buffer, 0.15M N
Elution with 20 mM K ₂ HPO ₄ (pH 7.0) buffer containing aCl
Fractionated. The eluate was subjected to immunoblotting to collect a target fraction. Next, this fraction was added to 20 mM containing 0.15 M NaCl.
Heparin-equilibrated with K ₂ HPO ₄ (pH 7.0) buffer
The solution was passed through a Toyopearl 650M column (80 ml). Column
After washing with _{20 mM K 2 HPO 4 (pH} 7.0) buffer containing _{0.2M NaCl, 20 mM K 2 HPO} 4 (pH 7.0) in buffer, 0.2
Elution was performed with a linear concentration gradient from M NaCl to 0.45 M NaCl, and fractionation was performed. The desired fraction was collected by immunoblotting, desalted, and lyophilized to obtain about 20 mg of an almost single peptide electrophoretically. When the amino acid sequence from the N-terminus of this peptide was examined using ABI peptide sequencer 477A / 120A, Ala-Ile-Pro-Ala-Pro-Thr-A
The sequence of sp-Leu was observed and was consistent with the N-terminal sequence of the peptide of interest. The C-terminal was confirmed to be Thr by the carboxypeptidase P (Takara Shuzo) digestion method.

Example 2 Heparin-binding domain (Ala ¹⁶⁹⁰ -Th) containing a part of the IIIcs region of FN (Asp ¹⁹⁶¹ -Thr ¹⁹⁸⁵ , 25 amino acid residues)
r ¹⁹⁸⁵ , Cloning of cDNA fragment encoding 296 amino residues (hereinafter abbreviated as H-296) (see Fig. 2) (2-1) Preparation of Ban II-BamHI fragment CS1 region of IIIcs of FN [Journal of Cell Bio J. Cell Bio., Vol. 103, pp. 2637-2647 (1
986)] was synthesized using Applied Biosystems' DN (chain lengths 77 and 78, see Figure 2).
A Synthesized using a synthesizer. After phosphorylation of 2 μg of each 5 ′ end, a complementary sequence was converted into a double strand by an annealing operation. This DNA was purified with 7 mM Tris-HCl
(pH 7.5), 0.1mM EDTA, 20mM NaCl, 7mM MgCl
_2. Incubated for 30 minutes at 37 ° C. in a 100 μl reaction containing 0.1 mM dATP, dGTP, dCTP, dTTP and 2 units of Klenow enzyme. After stopping the reaction at 70 ° C for 5 minutes, BamH
The fragment was digested with I and Ban II and subjected to agarose gel electrophoresis to recover about 400 ng of a 0.11 kb Ban II-BamHI fragment. (2-2) Preparation of SacI-BamHI fragment 200 ng of the Ban II-BamHI fragment obtained in (2-1) and 490 ng of the 0.27 kb SacI-BanII fragment obtained in (1-3) were subjected to T4 DNA ligase. Buffer, 0.5 mM ATP, 10 mM DTT and 2.8 units of T4 DNA ligase in a 20 μl reaction mixture.
Incubated overnight at ℃. The reaction solution was treated at 65 ° C. for 10 minutes, digested with BamHI and SacI, and subjected to agarose gel electrophoresis to recover about 100 ng of a 0.38 kb SacI-BamHI fragment. (2-3) Preparation of SacI-BamHI fragment (vector fragment) of pHD101 1 μg of plasmid pHD101 encoding H-271 was added to SacI
After digestion with BamHI and dephosphorylation, agarose gel electrophoresis was performed to recover about 280 ng of a 4.6 kb SacI-BamHI vector fragment. (2-4) Binding of SacI-BamHI fragment to vector 50 ng of 0.38 kb SacI-BamHI fragment obtained in (2-2), (2-3)
20 ng of the 4.6 kb SacI-BamHI vector fragment obtained in
DNA ligase buffer, 0.5 mM ATP, 10 mM DTT and
Incubated overnight at 16 ° C. in a 20 μl reaction containing 2.8 units of T4 DNA ligase. 10 μl of this reaction solution
Was used for transformation of E. coli HB101.

(2-5) Transformation of E. coli and confirmation of plasmid Escherichia coli HB101 was transformed using 10 μl of the reaction solution obtained in (2-4). Plasmid analysis was performed on 12 clones in the obtained transformants. That is, the plasmid prepared by the rapid method was digested with BamHI and NcoI, subjected to agarose gel electrophoresis, and the expected NcoI-BamHI fragment was digested.
The generation of a (0.9 kb) band was examined. As a result, a target band was observed in one clone. In addition, the nucleotide sequence was determined by the dideoxy method, and it was confirmed that the target sequence was contained. This recombinant plasmid was designated as pHD102. In addition, Escherichia coli HB101 carrying this plasmid was
hia coli HB101 / pHD102, and deposited at the Institute of Microbial Industry and Technology, National Institute of Advanced Industrial Science and Technology
M P-10721)]. (2-6) Purification of Peptide from Recombinant Escherichia coli HB101 / pHD102 obtained in (2-5) was converted to (1-
Culture and purification were carried out in the same manner as in 8), and about 5 mg of a nearly single peptide was obtained electrophoretically from a 500 ml culture. ABI
The amino acid sequence from the N-terminus of the present peptide was examined using a peptide sequencer 477A / 120A of the same company, and was consistent with the N-terminal sequence of the target peptide. The carboxypeptidase P digestion method confirmed that the C-terminal was Thr.

Example 3 cDNA encoding a fusion protein between the cell adhesion domain of FN Pro ¹²³⁹ -Ser ¹⁵¹⁵ (277 amino acid residues) and H-271
Cloning of the fragment (see FIG. 3) (3-1) Construction of a plasmid encoding the cell adhesion domain Pro ¹²³⁹ -Ser ¹⁵¹⁵ (277 amino acid residues) The recombinant plasmid pTF7021 described in JP-A-1-206998 A plasmid into which an NcoI site was introduced was constructed by a site-directed mutagenesis method immediately before the termination codon of the translation region. Introduction of the NcoI site into pTF7021 was performed by synthesizing oligonucleotide d [pCTATTACACCATGGATGGTTTG] and performing site-directed mutagenesis.
System Mutant-K (Site-directed mutagenes
issystemMutan-K) [Takara Shuzo Co., Ltd. sales]. Gln ¹⁵¹⁶ -Met ¹⁵¹⁷ in the C-terminal cell binding domain with the introduction of this NcoI site is replaced by Met ¹⁵¹⁶ -Val ¹⁵¹⁷ (see FIG. 3). The resulting plasmid is called pTF7
Named 520. (3-2) Preparation of NcoI-Hinc II fragment of pHD101 1 μg of the recombinant plasmid pHD101 obtained in (1-7) was
The fragment was digested with I and Hinc II and subjected to agarose gel electrophoresis to recover about 100 ng of a 1.77 kb NcoI-Hinc II fragment. (3-3) Cloning of NcoI-HincII fragment of pHD101 into pTF7520 Plasmid pTF7520 obtained in (3-1) was replaced with NcoI and HincII
And dephosphorylated. 50 ng of this plasmid (1-2)
The mixture was incubated overnight at 16 ° C. in a 20 μl reaction solution containing a buffer for T4 DNA ligase, 0.5 mM ATP, 10 mM DTT and 2.8 units of T4 DNA ligase together with 50 ng of the NcoI-HincII fragment obtained in the above step. Use 10 μl of this reaction solution
Transform HB101 and use the cell adhesion domain of FN Pro ¹²³⁹ -S
A plasmid expressing a fusion protein (C ₂₇₇ -Met-H ₂₇₁ ) in which er ¹⁵¹⁵ (277 amino acid residues) and H-271 were bound via Met was obtained and named pCH101. In addition, Escherichia coli HB101 / pCH
No. 101, and deposited at the Institute of Microbial Industry and Technology, Ministry of International Trade and Industry (Microtechnical Research Institute No. 2799 (FERM BP-279
9)].

(3-4) Removal of intervening sequence (ATG) from pCH101 Cell adhesion domain Pro of fusion protein (C ₂₇₇ -Met-H ₂₇₁ ) expressed by plasmid pCH101 obtained in (3-3)
Me between ¹²³⁹ -Ser ¹⁵¹⁵ (277 amino acid residues) and H-271
t is added. The sequence (ATG) corresponding to this Met was removed by site-directed mutagenesis. Removal of the intervening sequence (ATG) from pCH101 was performed using oligonucleotide d (pAGGA
ATAGCGGATGGTTT] was synthesized using Site-Directed Mutagenesis System Mutan-K (Takara Shuzo Co., Ltd.). As a result, a plasmid expressing a fusion protein (C ₂₇₇ -H ₂₇₁ ) in which the cell adhesion domain Pro ¹²³⁹ -Ser ¹⁵¹⁵ (277 amino acid residues) and H-271 were directly bound was obtained and named pCH201. (3-5) Purification of peptide from recombinants Escherichia coli HB101 / pCH101 obtained in (3-3) was purified using (1-
The cells were cultured in the same manner as in 8), and an extract was obtained from 500 ml of the cultured cells. The monoclonal antibody (FN-10, Takara Shuzo) recognizing the cell adhesion domain of FN and the fraction reacting with both the monoclonal antibody IST-1 were purified by the same method as in (1-8) to obtain 15 mg of purified product. Obtained. The N-terminal sequence of this peptide matched the sequence of the target peptide. The carboxypeptidase P digestion method confirmed that the C-terminal was Thr.

[0032] Example 4 FN cell binding domain Pro ¹²³⁹ -Ser ¹⁵¹⁵ (see FIG. 4) Cloning of (277 amino acid residues) and cDNA fragment encoding the fusion protein of H-296 (4-1) pHD102 of NcoI -Preparation of Hinc II fragment 1 μg of the recombinant plasmid pHD102 obtained in (2-5) was used.
After digestion with NcoI and HincII, agarose gel electrophoresis was performed to recover about 100 ng of a 1.84 kb NcoI-HincII fragment. (4-2) Cloning of NcoI-HincII fragment of pHD102 into pTF7520 Plasmid pTF7520 obtained in (3-1) was replaced with NcoI and HincII
And dephosphorylated. 50 ng of this plasmid (4-1)
50 ng of the NcoI-HincII fragment obtained in the above, a buffer for T4 DNA ligase, 0.5 mM ATP, 10 mM DTT and 28 units of
Incubated overnight at 16 ° C. in a 20 μl reaction containing T4 DNA ligase. Using 10 μl of this reaction solution, E. coli H
B101 was transformed and the cell adhesion domain of FN Pro ¹²³⁹ -S
er ¹⁵¹⁵ (277 amino acid residues) and H-296 is obtained a plasmid expressing the bound fusion protein (C ₂₇₇ -Met-H ₂₉₆₎ through the Met, was named PCH102. In addition, Escherichia coli HB101 / pCH
No. 102 and deposited at the Institute of Microbial Industry and Technology, Ministry of International Trade and Industry (Microtechnical Research Institute No. 2800 (FERM BP-2800).
)].

[0033] (4-3) cell adhesion domain Pro of the fusion protein expressed by plasmid PCH102 obtained in removal (4-2) of the intervening sequence from _{pCH102 (ATG) (C 277 -Met} -H 296)
Me between ¹²³⁹ -Ser ¹⁵¹⁵ (277 amino acid residues) and H-296
t is added. The sequence (ATG) corresponding to Met was removed in the same manner as in (3-4). As a result, the cell adhesion domains Pro ¹²³⁹ -Ser ¹⁵¹⁵ (277 amino acid residues) and H-29
A plasmid expressing a fusion protein (C ₂₇₇ -H ₂₉₆ ) to which 6 was directly linked was obtained and named pCH202. (4-4) Purification of peptide from recombinant Escherichia coli HB101 / pCH102 obtained in (4-2) was purified using (3-5)
The cells were cultured and purified in the same manner as described above, and about 6 mg of an almost single peptide was obtained electrophoretically from a 500 ml culture. The results of N-terminal sequence analysis and C-terminal analysis were consistent with those of the target peptide.

Example 5 Measurement of Biological Activity Cell adhesion activity and heparin binding activity were measured using each of the polypeptides obtained in Examples 1 to 4. The cell adhesion activity was measured according to the method of Luos Lati et al. [Methods in Enzymology, Vol. 82, pp. 803-831 (1981)]. The sample was dissolved in distilled water, PBS (phosphate-buffered saline) or the like, and diluted stepwise on a 96-well microplate. After incubating at 4 ° C for 2 hours, the sample was adsorbed on the plate (50 µl / well). 3% BS
A (bovine serum albumin) in PBS solution containing 100 μl /
The plate was blocked by adding wells and incubating at 37 ° C. for 1 hour. After washing the plate with PBS, Dulbecco's Eagle's minimal nutrient medium (DME
M), 100 μl / well of baby hamster kidney cells (BHK-21) suspended at 5 × 10 ⁵ cells / ml were dispensed.
Incubated at 37 ° C for 1 hour. BHK-21 used
The cells used were subcultured from a cryopreserved strain and treated with trypsin (37 ° C, 5 minutes). After washing the plate with PBS, the cells were fixed on the plate with a 3% formalin solution. The extension of BHK-21 cells was observed under a microscope, and the concentration (ED ₅₀ ) of a sample in which the number of extended cells was 50% of the number of extended cells at a high concentration of n-FN was determined and used as an index of cell adhesion activity.

The measurement of heparin binding activity was performed as follows. A equilibrated with 20 mM phosphate buffer (pH 7.0)
The sample was loaded on a column (1.5 ml) of F-heparin-Toyopearl 650 M, and the NaCl concentration in the buffer was gradually increased.
The binding strength to heparin was expressed by the concentration of the eluted salt.
Table 1 shows the results of measuring the biological activity of each sample by the above method.

[0036]

TABLE 1 TABLE 1 ─────────────────────────── specimen cell spreading activity heparin binding activity ED ₅₀ (nmol / ml) (elution (Salt concentration, mM) ─────────────────────────── H-271 None 300 H-296 41 300 C ₂₇₇ -Met-H ₂₇₁ 0.176 300 C ₂₇₇ -Met-H ₂₉₆ 0.084 300 ───────────────────────────

[0037]

As described above, according to the present invention,
A method for producing a novel polypeptide having both cell adhesion activity and heparin binding activity by genetic engineering is provided. This polypeptide is a useful protein that mediates the binding between cells and an extracellular matrix such as heparan sulfate and is useful for wound healing and the like.

[Brief description of the drawings]

FIG. 1 is a flow chart for constructing a plasmid pHD101 expressing H-271.

FIG. 2 is a flow chart for constructing a plasmid pHD102 expressing H-296.

3 is a process diagram for constructing plasmid pCH101 which expresses C ₂₇₇ -Met-H _271.

4 is a process diagram for constructing plasmid pCH102 which expresses C ₂₇₇ -Met-H _296.

──────────────────────────────────────────────────の Continuation of the front page (51) Int.Cl. ⁶ Identification code Agency reference number FI Technical indication (C12N 1/21 C12R 1:19) (C12P 21/02 C12R 1:19) (72) Inventor Shoichi Goto 3-4-1 Seta, Otsu-shi, Shiga Prefecture Takara Shuzo Co., Ltd., Central Research Laboratory Co., Ltd. (72) Inventor Fumio Kimizuka 3-4-1 Seta Seta, Otsu City, Shiga Prefecture Takara Shuzo Co., Ltd., Central Research Laboratory Co., Ltd. (72) Inventor Ikunoyuki Kato 3-4-1 Seta, Otsu-shi, Shiga Takara Shuzo Co., Ltd.

Claims (2)

[Claims] 1. A transformant transformed with a recombinant plasmid containing a gene encoding a functional polypeptide represented by an amino acid sequence represented by the following formula (Formula 1). Embedded image Ala Ile Pro Ala Pro Thr Asp Leu Lys Phe Thr Gln Val Thr Pro Thr Ser Leu Ser Ala Gln Trp Thr Pro Pro Asn Val Gln Leu Thr Gly Tyr Arg Val Arg Val Thr Pro Lys Glu Lys Thr Gly Pro Met Lys Glu Ile Asn Leu Ala Pro Asp Ser Ser Ser Val Val Val Ser Gly Leu Met Val Ala Thr Lys Tyr Glu Val Ser Val Tyr Ala Leu Lys Asp Thr Leu Thr Ser Arg Pro Ala Gln Gly Val Val Thr Thr Leu Glu Asn Val Ser Pro Pro Arg Arg Ala Arg Val Thr Asp Ala Thr Glu Thr Thr Ile Thr Ile Ser Trp Arg Thr Lys Thr Glu Thr Ile Thr Gly Phe Gln Val Asp Ala Val Pro Ala Asn Gly Gln Thr Pro Ile Gln Arg Thr Ile Lys Pro Asp Val Arg Ser Tyr Thr Ile Thr Gly Leu Gln Pro Gly Thr Asp Tyr Lys Ile Tyr Leu Tyr Thr Leu Asn Asp Asn Ala Arg Ser Ser Pro Val Val Ile Asp Ala Ser Thr Ala Ile Asp Ala Pro Ser Asn Leu Arg Phe Leu Ala Thr Thr Pro Asn Ser Leu Leu Val Ser Trp Gln Pro Pro Arg Ala Arg Ile Thr Gly Tyr IIe Ile Lys Tyr Glu Lys Pro Gly Ser Pro Pro Arg Glu Val Val Pro Arg Pro Arg Pro Gly Val Thr Glu Ala Thr Ile Thr Gly Leu Glu Pro Gly Thr Glu Tyr Thr Ile Tyr Val Ile Ala Leu Lys Asn Asn Gln Lys Ser Glu Pro Leu Ile Gly Arg Lys Lys Thr Asp Glu Leu Pro Gln Leu Val Thr Leu Pro His Pro Asn Leu His Gly Pro Glu Ile Leu Asp Val Pro Ser Thr 2. A functional polypeptide, which comprises culturing the transformant according to claim 1, and collecting a functional polypeptide represented by the amino acid sequence represented by the formula (Formula 1) from the culture. A method for producing a peptide.