JP2023023613A - TRα gene-modified eel - Google Patents

Abstract

To provide an eel that has a shortened period as a larval fish.SOLUTION: An eel shows a reduction or loss in functions of thyroid hormone receptor αA(TRαA) gene and thyroid hormone receptor αB(TRαB) gene.SELECTED DRAWING: None

Description

TECHNICAL FIELD The present invention relates to an eel having a modified thyroid hormone receptor α gene and a method for producing the same.

Larvae (Leptocephalus) of Eelidae fishes are characterized by having a longer larvae period than other fishes, and metamorphosing into juveniles after growing up to large larvae. The current standard larval breeding method for Japanese eels requires a longer larval period (160-450 days after hatching) than under the natural environment (110-170 days after hatching). In addition, the mortality rate is higher in the larval stage than in the juvenile stage and later, and even when a small number of larval larvae are carefully reared, the survival rate of Japanese eels to fry (glass eels) is often less than 10%. For this reason, the breeding of eel larvae requires a great deal of labor and time, and the low yield (survival rate) of larval eels is an obstacle to efficient mass production. It is desirable to shorten the larvae period or improve the survival rate by improving the

On the other hand, it has been reported that the length of the larvae period of Japanese eels in captivity is a genetic trait controlled by a large number of genes (Non-Patent Document 1).
In amphibians, larval growth is promoted in individuals whose thyroid hormone receptor α (TRα) gene is partially functionally inhibited by genome editing technology, and early metamorphosis to adults can be initiated. reported (Non-Patent Document 2).
Furthermore, in Japanese eels, high expression of the TRα gene is observed throughout the larval stage, suggesting that it is involved in the growth and metamorphosis of the larval stage (Non-Patent Document 3), but the details have not been clarified. .

Nomura, K. et al. Genetic parameters and quantitative trait loci analysis associated with body size and timing at metamorphosis into glass eels in captive-bred Japanese eels (Anguilla japonica). PLoS One 13, e0201784, 2018. Wen, L. et al. Regulation of growth rate and developmental timing by Xenopus thyroid hormone receptor α. Dev. Growth Differ. 58, 106-115, 2016. Kawakami, Y. et al. Characterization of thyroid hormone receptors during early development of the Japanese eel (Anguilla japonica). Gen. Comp. Endocrinol. 194, 300-310, 2013.

Until now, there was no technology to shorten the larvae period of eels by adding genetic improvements. The present invention relates to providing eels with a shortened larvae period.

As a result of intensive studies to solve the above problems, the present inventors have found that the larval stage of eels is reduced by introducing mutations into the eel thyroid hormone receptor αA gene and the thyroid hormone receptor αB gene to inhibit their function. The inventors have found that the larval period survival rate is improved unexpectedly, and completed the present invention.

That is, the present invention provides the following [1] to [9].
[1] An eel in which the functions of the thyroid hormone receptor αA (TRαA) gene and the thyroid hormone receptor αB (TRαB) gene are reduced or lost.
[2] The eels of [1], which have loss-of-function mutations in the TRαA gene and the TRαB gene.
[3] The TRαA gene is any one of (a) to (c) below, and the TRαB gene is any one of (d) to (f) below, [1] or [2] Eels mentioned:
(a) a polynucleotide consisting of the nucleotide sequence represented by SEQ ID NO: 1;
(b) a polynucleotide consisting of a nucleotide sequence having 90% or more identity with the nucleotide sequence shown in SEQ ID NO: 1 and encoding a protein that functions as TRα;
(c) a polynucleotide consisting of a base sequence in which one or several bases are deleted, inserted, substituted or added to the base sequence shown in SEQ ID NO: 1 and encoding a protein that functions as TRα;
(d) a polynucleotide consisting of the nucleotide sequence represented by SEQ ID NO: 3;
(e) a polynucleotide consisting of a nucleotide sequence having 90% or more identity with the nucleotide sequence shown in SEQ ID NO: 3 and encoding a protein that functions as TRα;
(f) A polynucleotide consisting of a nucleotide sequence in which one or several nucleotides have been deleted, inserted, substituted or added to the nucleotide sequence shown in SEQ ID NO:3 and encoding a protein that functions as TRα.
[4] The eels of any one of [1] to [3], which lack part or all of the TRαA gene and part or all of the TRαB gene.
[5] A method for producing eels, comprising the step of introducing loss-of-function mutations into the TRαA gene and the TRαB gene.
[6] A method for improving the survival rate of larvae of eels, comprising the step of introducing loss-of-function mutations into the TRαA gene and the TRαB gene.
[7] the TRαA gene is any one of (a) to (c) below, and the TRαB gene is any one of (d) to (f) below, [5] or [6] Description method:
(a) a polynucleotide consisting of the nucleotide sequence represented by SEQ ID NO: 1;
(b) a polynucleotide consisting of a nucleotide sequence having 90% or more identity with the nucleotide sequence shown in SEQ ID NO: 1 and encoding a protein that functions as TRα;
(c) a polynucleotide consisting of a base sequence in which one or several bases are deleted, inserted, substituted or added to the base sequence shown in SEQ ID NO: 1 and encoding a protein that functions as TRα;
(d) a polynucleotide consisting of the nucleotide sequence represented by SEQ ID NO: 3;
(e) a polynucleotide consisting of a nucleotide sequence having 90% or more identity with the nucleotide sequence shown in SEQ ID NO: 3 and encoding a protein that functions as TRα;
(f) A polynucleotide consisting of a nucleotide sequence in which one or several nucleotides have been deleted, inserted, substituted or added to the nucleotide sequence shown in SEQ ID NO:3 and encoding a protein that functions as TRα.
[8] The method of any one of [5] to [7], wherein the introduction of loss-of-function mutations deletes part or all of the TRαA gene and part or all of the TRαB gene.
[9] The method of any one of [5] to [8], wherein the loss-of-function mutation is introduced by genome editing.

INDUSTRIAL APPLICABILITY According to the present invention, it is possible to provide an eel with a shortened larval period and an improved survival rate during the larval period, a method for producing the same, and a method for improving the survival rate of eels. Such eels have genetic characteristics suitable for efficient seedling production. In addition, the eel of the present invention can obtain the effects of shortening the larvae period and improving the survival rate of the larval period from the F0 generation individual into which the mutation is introduced, and its genetic characteristics are obtained through breeding and mating using the F0 individual. It becomes possible to infiltrate large-scale aquaculture populations.

FIG. 4 is a diagram showing the relationship between the age at the start of metamorphosis and the rate of metamorphosis initiation in the control group and the TRαA gene and TRαB gene mutation-introduced groups. FIG. 4 shows changes in survival rate of the control group and the TRαA gene and TRαB gene mutation-introduced groups. FIG. 3 shows the relationship between the TRαA gene editing rate (%) per individual and the number of days until the start of metamorphosis (A), and the relationship between the TRαB gene editing rate (%) per individual and the number of days until the start of metamorphosis (B).

Abbreviations such as base sequences (nucleotide sequences) and nucleic acids in this specification are defined by IUPAC-IUB regulations (IUPAC-IUB communication on Biological Nomenclature, Eur. J. Biochem., 138: 9-37, 1984), "base It is described using symbols commonly used in the field, such as "Guidelines for Preparation of Specifications Containing Sequences or Amino Acid Sequences" (edited by the Patent Office). As used herein, the term "deoxyribonucleic acid (DNA)" includes not only double-stranded DNA, but also single-stranded DNAs such as the sense strand and antisense strand that constitute it.

As used herein, "nucleotide", "oligonucleotide" and "polynucleotide" are synonymous with nucleic acid and shall include both DNA and RNA. The DNA includes all of cDNA, genomic DNA and synthetic DNA. Further, the RNA includes all of total RNA, mRNA, rRNA and synthetic RNA. Also, "nucleotides", "oligonucleotides" and "polynucleotides" may be double-stranded or single-stranded, and "nucleotides" (or "oligonucleotides", "polynucleotides") having a sequence ), unless otherwise specified, is also meant to include "nucleotides" (or "oligonucleotides", "polynucleotides") having a sequence complementary thereto.

As used herein, the term “gene” refers to double-stranded DNA containing genomic DNA, single-stranded DNA (positive strand) containing cDNA, and single-stranded DNA (complementary strand) having a sequence complementary to the positive strand. strands), and fragments thereof, which contain some biological information in the sequence information of the bases that make up the DNA. Unless otherwise specified, the term "gene" refers indiscriminately to regulatory regions, coding regions, exons, and introns.

As used herein, the identity of base sequences or amino acid sequences is calculated by the Lipman-Pearson method (Science, 1985, 227: 1435-1441). Specifically, it is calculated by performing analysis using a homology analysis program of genetic information processing software GENETYX with Unit size to compare (ktup) set to 2.

As used herein, "nucleotide sequence in which one or several bases are deleted, inserted, substituted, or added" is preferably 1 or more and 30 or less, more preferably 1 or more and 15 or less, and still more preferably refers to a nucleotide sequence in which 1 to 9 bases have been deleted, inserted, substituted or added. In addition, the term "amino acid sequence in which one or several amino acids are deleted, inserted, substituted or added" as used herein preferably means 1 or more and 10 or less, more preferably 1 or more and 5 or less, More preferably, it refers to an amino acid sequence in which 1 to 3 amino acids have been deleted, inserted, substituted or added. As used herein, "addition" of bases or amino acids includes addition of bases or amino acids to one and both termini of a sequence.

As used herein, the term "eels" means fish belonging to the genus Anguilla in the family Anguillidae. Examples of eels include Japanese eel (Anguilla japonica), giant eel (Anguilla marmorata), European eel (Anguilla anguilla), and American eel (Anguilla rostrata), among which Japanese eel is preferred. The eels may be farmed fish or wild fish, and their growth stage is not limited.

In the eels of the present invention, the functions of thyroid hormone receptor α (TRα) A gene and TRαB gene are reduced or lost.
“TRα gene” is a gene encoding thyroid hormone receptor α, which is a type of nuclear receptor and regulates the expression of target genes of thyroid hormone as a transcriptional regulator. Two isoforms of the TRα gene of eels, the TRαA gene and the TRαB gene, are known. For example, the TRαA gene of Japanese eel is registered as AB678206.1 in GenBank ([www.ncbi.nlm.nih.gov/genbank/]) and consists of the base sequence shown in SEQ ID NO: 1, and SEQ ID NO: 2 encodes a protein consisting of the amino acid sequence shown in The TRαB gene of Japanese eel is registered in GenBank as AB678207.1 and encodes a protein consisting of the base sequence shown in SEQ ID NO:3 and the amino acid sequence shown in SEQ ID NO:4.

Specific examples of the TRαA gene in the present invention include the following.
(a) a polynucleotide consisting of the nucleotide sequence represented by SEQ ID NO: 1;
(b) 90% or more, preferably 95% or more, more preferably 96% or more, still more preferably 97% or more, still more preferably 98% or more, still more preferably 99% or more of the base sequence represented by SEQ ID NO: 1 A polynucleotide consisting of an identical nucleotide sequence and encoding a protein that functions as TRα;
(c) A polynucleotide consisting of a base sequence in which one or several bases have been deleted, inserted, substituted or added to the base sequence shown in SEQ ID NO: 1 and encoding a protein that functions as TRα.
Among these, the TRαA gene is preferably a polynucleotide consisting of the nucleotide sequence shown in SEQ ID NO:1.
Specific examples of the TRαB gene in the present invention include the following.
(d) a polynucleotide consisting of the nucleotide sequence represented by SEQ ID NO: 3;
(e) 90% or more, preferably 95% or more, more preferably 96% or more, still more preferably 97% or more, still more preferably 98% or more, still more preferably 99% or more of the base sequence represented by SEQ ID NO: 3 A polynucleotide consisting of an identical nucleotide sequence and encoding a protein that functions as TRα;
(f) A polynucleotide consisting of a nucleotide sequence in which one or several nucleotides have been deleted, inserted, substituted or added to the nucleotide sequence shown in SEQ ID NO:3 and encoding a protein that functions as TRα.
Among these, the TRαB gene is preferably a polynucleotide consisting of the nucleotide sequence shown in SEQ ID NO:3.

Specific examples of proteins encoded by the TRαA gene of the present invention include the following.
(g) a protein consisting of the amino acid sequence shown in SEQ ID NO: 2;
(h) 90% or more, preferably 95% or more, more preferably 96% or more, still more preferably 97% or more, still more preferably 98% or more, still more preferably 99% or more of the amino acid sequence represented by SEQ ID NO: 2 a protein consisting of identical amino acid sequences and functioning as TRα;
(i) A protein consisting of an amino acid sequence in which one or several amino acids are deleted, inserted, substituted or added with respect to the amino acid sequence shown in SEQ ID NO:2 and functioning as TRα.
Among these, TRα consisting of the amino acid sequence shown in SEQ ID NO: 2 is preferable as the protein encoded by the TRαA gene.
Specific examples of proteins encoded by the TRαB gene of the present invention include the following.
(j) a protein consisting of the amino acid sequence shown in SEQ ID NO: 4;
(K) 90% or more, preferably 95% or more, more preferably 96% or more, still more preferably 97% or more, still more preferably 98% or more, still more preferably 99% or more of the amino acid sequence represented by SEQ ID NO: 4 a protein consisting of identical amino acid sequences and functioning as TRα;
(l) A protein consisting of an amino acid sequence in which one or more amino acids are deleted, inserted, substituted or added to the amino acid sequence shown in SEQ ID NO: 4 and functioning as TRα.
Among these, TRα consisting of the amino acid sequence shown in SEQ ID NO: 4 is preferable as the protein encoded by the TRαB gene.

The functions of the TRαA gene and the TRαB gene refer to functions originally possessed by the thyroid hormone receptor, such as ligand binding ability and expression regulation of thyroid hormone target genes.
"The functions of the TRαA gene and the TRαB gene are reduced" means that the eels of the present invention have a reduced function of the TRαA gene and a reduced function of the TRαB gene compared to wild-type eels. means declining. Here, "decreased function" means that the function of the eels of the present invention is, for example, 50% or less, preferably 20% or less, more preferably 10% or less, and further preferably 5% or less of the function in the wild type. indicates that it is declining. In one example, "the functions of the TRαA gene and the TRαB gene are reduced" means that the expression levels of the TRαA gene and the expression level of the TRαB gene in the eels of the present invention are lower than those of wild-type eels, respectively. For example, it refers to a decrease to 50% or less, preferably 20% or less, more preferably 10% or less, and even more preferably 5% or less. Here, "gene expression" may be expression of mRNA from the gene or expression of protein, but is preferably expression of protein. The functions and expression levels of the TRαA gene and TRαB gene can be measured by known methods. For example, gene expression levels can be measured by conventional techniques such as Northern blotting and quantitative PCR. The expression level of protein can be measured by conventional techniques such as Western blotting, colorimetry, and ELISA. Wild-type eels are eels having normal TRαA gene and normal TRαB gene, preferably eels having the same genetic constitution as the eels of the present invention except for the TRαA gene and TRαB gene. be.
Further, "having lost the function of the TRαA gene and the TRαB gene" means that in the eels of the present invention, the function of the TRαA gene is below the detection limit and the function of the TRαB gene is below the detection limit. In one example, "having lost the function of the TRαA gene and the TRαB gene" means that the expression level of the TRαA gene and the expression level of the TRαB gene in the eels of the present invention are each below the detection limit. The functions and expression levels of the TRαA gene and TRαB gene can be measured by known methods as described above.

Eels in which the functions of the TRαA gene and TRαB gene are reduced or lost, for example, are introduced with loss of function mutation (hereinafter sometimes simply referred to as mutation) in the TRαA gene and TRαB gene of eels. can be obtained by A "loss-of-function mutation" means a mutation that reduces or eliminates the function of a gene into which the mutation has been introduced. That is, the eels of the present invention preferably have loss-of-function mutations in each of the TRαA gene and the TRαB gene. The eels to be mutated may be wild-type eels or eels artificially bred from the wild-type eels, and the nucleotide sequence in the genome is deleted or inserted. , substituted or added mutant eels or mutants. Among them, wild-type eels are preferred. The type of mutation to be introduced is not particularly limited, and includes, for example, at least one mutation selected from deletion, insertion, substitution and addition to the base sequence of the gene. The number of bases to be deleted, inserted, substituted or added should be at least one base, preferably the number of bases that causes a frameshift. The position at which mutation is introduced is not particularly limited, and may be, for example, the coding region, non-coding region, promoter, enhancer, or other expression control region of the gene. Among these, it is preferable to introduce the mutation into the coding region of the gene, and it is more preferable to introduce the mutation further upstream (translation initiation side) in the coding region. In a preferred example, part or all of the TRαA gene is deleted and part or all of the TRαB gene is deleted in the eels of the present invention. In a more preferred example, the eels of the present invention have a partial deletion of the TRαA gene and a partial deletion of the TRαB gene. The eels of the present invention need only have mutations in at least one allele, and preferably have the mutations in both alleles. In addition, in the eels of the present invention, mutation may be introduced into at least a part of the cells constituting the individual as long as the effect of the present invention is exhibited, and mutations are introduced into all the cells constituting the individual. is preferred. On the other hand, the eels of the present invention preferably have no foreign gene integrated into their genome.

As means for introducing mutations, known methods can be used, and specific methods include, for example, chemical mutagens such as ethyl methanesulfonate, N-methyl-N-nitrosoguanidine, nitrous acid, ultraviolet rays, and X-rays. , mutagenesis by physical mutagens such as gamma rays and ion beams, and site-directed mutagenesis. Techniques for site-directed mutagenesis include the homologous recombination method, a method using Splicing overlap extension (SOE) PCR (Horton et al., Gene 77, 61-68, 1989), the ODA method (Hashimoto-Gotoh et al. , Gene, 152, 271-276, 1995), Kunkel method (Kunkel, TA, Proc. Natl. Acad. Sci. USA, 1985, 82, 488), artificial DNA nucleases or programmable genome editing using nuclease), and the like. Alternatively, a commercially available kit for site-directed mutagenesis can be used.

Genome editing specifically cuts the DNA double strand at the target locus on the genome, induces deletion, insertion, or substitution of nucleotides in the process of repairing the cut DNA, or inserts foreign polynucleotides. It is a technology that modifies the genome site-specifically.このような技術は、ＴＡＬＥＮ（ｔｒａｎｓｃｒｉｐｔｉｏｎ ａｃｔｉｖａｔｏｒ－ｌｉｋｅ ｅｆｆｅｃｔｏｒ ｎｕｃｌｅａｓｅ）、ＺＦＮ（ｚｉｎｃ－ｆｉｎｇｅｒ ｎｕｃｌｅａｓｅ）、ＣＲＩＳＰＲ（Ｃｌｕｓｔｅｒｅｄ Ｒｅｇｕｌａｒｌｙ Ｉｎｔｅｒｓｐａｃｅｄ Ｓｈｏｒｔ Ｐａｌｉｎｄｒｏｍｉｃ Ｒｅｐｅａｔ）／Ｃａｓ９、Ｈｏｍｉｎｇ ｅｎｄｏｎｕｃｌｅａｓｅ、ｃｏｍｐａｃｔ ｄｅｓｉｇｎｅｒ ＴＡＬＥＮなどとして知られている（Ｎａｔｕｒｅ Reviews Genetics, 2014, 15:321-334, Nucleic Acids Research, 2011, 39:e82, Nucleic Acids Research, 2006, 34:e149, Nature communications, 2013, 4:1762). Genome editing kits based on these technologies are commercially available and can be purchased from, for example, Life Technologies, Takara Bio Inc., and the like.

Mutations into the TRαA gene and TRαB gene of eels are preferably performed by genome editing, more preferably using CRISPR/Cas9, from the viewpoint of mutation introduction efficiency.
CRISPR / Cas9 mutagenesis of eels TRαA gene and TRαB gene can be performed, for example, as follows. That is, a single-stranded guide RNA (sgRNA) for target genes (TRαA gene and TRαB gene) and CRISPR-associated protein 9 (Cas9) are introduced into eel fertilized eggs. The introduced fertilized eggs are cultured, hatched, and then reared according to a normal breeding method for eels. Whether or not the desired mutation has been introduced can be determined by collecting samples from the obtained eels and analyzing them by conventional methods, confirming the nucleotide sequence of the target gene, or examining the target gene or the protein encoded by the target gene. can be determined by measuring the expression level of

sgRNA against the target gene used for CRISPR / Cas9 contains target gene sequence-specific CRISPR RNA (crRNA) and transactivating crRNA (tracrRNA), crRNA proto-spacer adjacent motif in the target gene (proto-spacer adjacent motif ; PAM) consists of about 20 bases upstream. The sgRNA can be designed using a known design tool such as CRISPRdirect, and the designed sgRNA can be obtained by synthesis. sgRNA and Cas9 are introduced into target cells such as fertilized eggs in the form of an RNP complex consisting of Cas9 protein and sgRNA, an expression plasmid containing the sgRNA sequence and the Cas9 gene, a viral vector containing the sgRNA sequence and the Cas9 gene, or sgRNA and Cas9mRNA. can do. Among these, from the viewpoint of reducing off-target effects, sgRNA and Cas9 are preferably introduced into target cells as RNP complexes. The introduction method may be appropriately selected according to the mode of introduction, and examples thereof include electroporation, transfection, microinjection, and the like. After introduction, the RNP complex binds to the target sequence on the genome and cleaves the DNA double strand 3 bases upstream of PAM (double-strand break; DSB). After DSB introduction, it is immediately repaired, but at that time, insertion or deletion of several bases to several tens of bases by the pathway of non-homologous end-joining (NHEJ) (insertion-deletion; Indel) (Indel mutation). Since this Indel can introduce a frameshift mutation into the target gene, the protein encoded by the target gene cannot be expressed normally and loses its function, so that the target gene can be efficiently knocked out.

The sgRNAs used for introducing mutations into the TRαA and TRαB genes of eels may be appropriately designed according to the nucleotide sequences of the genes. An sgRNA may be designed for each of the TRαA gene and the TRαB gene, or an sgRNA common to the TRαA gene and the TRαB gene may be designed using the common sequence of the TRαA gene and the TRαB gene as the target sequence. A specific example of the sgRNA includes, but is not limited to, an sgRNA whose target sequence is the base sequence of the antisense strand common to the TRαA gene and TRαB gene shown in SEQ ID NO:5.

In mutagenesis by genome editing into fertilized eggs, mutations are introduced in cells of fertilized eggs or early embryos (preferably one-cell stage embryos). When mutations are introduced into both alleles in a fertilized egg, genetically uniform individuals are obtained, but in many cases, mosaic individuals with different mutation patterns depending on the cells of the early embryo. An F1 heterozygous individual can be obtained by mating the F0 generation genetically uniform individual into which the mutation was introduced, or the mosaic individual in which the mutation was introduced into the germ cells, with the wild-type individual. F2 homozygous individuals can be obtained by crossing them. For mating and breeding of eels, methods commonly used in this field may be adopted. For breeding, feed known in this field can be used (for example, JP-A-11-253111, JP-A-2005-13116, JP-A-2017-55674, JP-A-2018-153147). . As shown in the examples below, the eels of the present invention exhibit the effects of the present invention from mosaic individuals of the F0 generation. Therefore, as long as the functions of the TRαA gene and TRαB gene are reduced or lost, the eels of the present invention include mosaic individuals, heterozygous individuals, and homozygous individuals for loss-of-function mutations contained in the TRαA gene and TRαB gene. is included. Mosaic individuals and heterozygous individuals have the TRαA and TRαB genes knocked down as individuals, and homozygous individuals have the genes knocked out as individuals.

By the above procedure, the eels of the present invention in which the functions of the TRαA gene and TRαB gene are reduced or lost can be produced. Accordingly, the present invention also provides a method for producing eels. The method includes introducing loss-of-function mutations into the TRαA gene and the TRαB gene. The eels obtained by the process may be mosaic individuals containing loss-of-function mutations in the TRαA and TRαB genes. Moreover, the method may further comprise the step of mating the eels obtained in the step of introducing loss-of-function mutations with wild-type eels. The eels obtained by the process may be heterozygous individuals containing loss-of-function mutations in the TRαA and TRαB genes. Furthermore, the method may further include a step of mating a plurality of eels obtained in the mating step. The eels obtained by the process may be homozygous individuals containing loss-of-function mutations in the TRαA and TRαB genes. Whether or not eels have loss-of-function mutations in the TRαA gene and TRαB gene is determined by collecting samples from individuals of the eels and analyzing them by conventional methods to confirm the nucleotide sequences of the TRαA gene and the TRαB gene or to confirm the genes. Alternatively, it can be determined by measuring the expression level of the protein encoded by the gene. For example, gene expression levels can be measured by conventional techniques such as Northern blotting and quantitative PCR. The expression level of protein can be measured by conventional techniques such as Western blotting, colorimetry, and ELISA. Therefore, in the method of the present invention, subsequent to each of the above steps, the TRαA gene and the TRαB gene lose function based on the nucleotide sequences of the TRαA gene and the TRαB gene or the expression level of the gene or the protein encoded by the gene. A step of selecting eels having the mutation may be included.

As shown in Examples below, the eels of the present invention have a significantly shorter larval stage and a significantly improved larval survival rate than wild-type eels. In addition, the mutation introduction rate (gene editing rate) to the TRαA gene and the mutation introduction rate (gene editing rate) to the TRαB gene in the eels of the present invention each show a negative correlation with the number of days until the start of metamorphosis, The effect of shortening the larvae period is achieved by introducing loss-of-function mutations into at least one of the TRαA gene and the TRαB gene, preferably both genes. Furthermore, the eels of the present invention exhibit such effects from the mutagenized F0 generation, that is, from the stage of mosaic individuals. Here, the term "larval stage" means the period of leptocephalus from hatching to metamorphosis. Further, the "survival rate during the larval period" means the probability that a group of eels survives after a certain period of time up to a certain point during the larval period. Thus, the eels of the present invention have genetic characteristics suitable for efficient seedling production, and the genetic characteristics acquired through breeding and mating of the eels can be applied to large-scale aquaculture groups in the future. Penetration is also possible.
Non-Patent Document 2 reports that a mutation was introduced into the amphibian TRα gene and a functional analysis was performed, but neither mentions nor suggests the effect of the mutation on the survival rate. Therefore, the effect of improving the survival rate in the larval period obtained by the present invention is a completely unexpected effect.

The present invention also provides a method for improving the survival rate of larvae of eels. The details of the method are the same as the production method described above.

EXAMPLES Next, the present invention will be described in more detail with reference to Examples, but the present invention is not limited to these.

Example 1 Production of TRαA gene- and TRαB gene-modified eels TRαA gene- and TRαB gene-modified eels were generated by genome editing. As the target sequence of the sgRNA, 18 bases CAGGGCTCCATCCTTTCTCC (SEQ ID NO: 5) on the 5' end side of the PAM sequence (AGG) among the antisense sequences common to the Japanese eel TRαA gene and TRαB gene was adopted. Phosphate-buffered saline containing sgRNA 100 ng / μL, Cas9 RNA 100 ng / μL, Cas9 protein (Fasmac) 500 ng / μL, phenol red at a concentration of 500 ng / μL Microinjection into Japanese eel one-cell stage embryos (mutation-introduced group). A control group was microinjected with phosphate-buffered saline containing the same concentration of substances other than sgRNA. Fertilized eggs microinjected into one-cell stage embryos were individually housed in each well of a 48-well culture plate filled with 1 mL of seawater containing antibiotics and kept in an incubator at 25°C and 100% humidity until 6 days after hatching. maintained.
In order to examine the ratio of mutagenized individuals, about 10 larvae two days after hatching were frozen at minus 30°C. Frozen larvae were lysed at 55° C. in 10 mM Tris buffer containing 0.1% Nonidet P-40 and protease at a concentration of 2 mg/mL. Among the genomic DNA, primers were designed with sequences specific to the TRαA gene and TRαB gene so that the region containing the sgRNA target sequence could be amplified by PCR (sense primer for TRαA: TTCCTCCTCCCTAGTGCTCA (SEQ ID NO: 6), antisense primer: CAACAGCTCACCTTGCAG (SEQ ID NO: 7), sense primer for TRαB: CCTAGTTCTGAGCCTTCTG (SEQ ID NO: 8), antisense primer: AAGCGTGTGGCTTGAGCTCT (SEQ ID NO: 9)). Larval lysates were subjected to PCR using primers specific for the TRαA or TRαB gene. Each amplified PCR product is subjected to heteroduplex mobility analysis using acrylamide gel, and the presence or absence of gene mutation is determined by the presence or absence of a smear-like band to examine the proportion of individuals in which the mutation has been introduced. rice field.
On the 6th day after hatching, the hatched larvae of the mutation-introduced group and the control group were housed in separate breeding tanks (acrylic Kreisel tanks, flooded with about 5.7 L), and diluted seawater with a salinity of 16 to 17 psu. After adjusting the temperature to ±0.5° C., the breeding water sterilized by ultraviolet light was poured in at a rate of 0.9 to 1.0 L/min, and the animals were reared while changing the water constantly. Feeding is 5 times a day from the 7th day after hatching at 9, 11, 13, 15, and 17:00, once in combination with the suspension feed for eel larvae described in Table 1 of JP-A-2018-153147. 10-15 mL was fed per mouse. At the time of feeding, the water injection is stopped, the feed is spread on the bottom of the tank using a pipette, and this state is maintained for 15 minutes to encourage feeding of the larvae, after which the water injection is resumed and the remaining food is discharged out of the tank. to keep the breeding water in the tank clean. The illuminance was set to about 1,000 lx only during feeding, and was set to 10 lx or less during times other than feeding. Each day, after the last feeding, the larvae were transferred to new tanks, and the used tanks were cleaned and thoroughly dried and used again the next day. Dead fish were removed from the aquarium and their age recorded. At 50 days and 100 days of age, 20 or more larvae were randomly selected from each tank, anesthetized in diluted seawater adjusted to 400 ppm of 2-phenoxyethanol, and then photographed using a digital camera. Then, phenotype data of total length and body height were recorded from the image data. In addition, the total number of surviving tails was counted, and the survival rate at each age was calculated using the number of tails at the time of housing (6 days old) as the denominator.
Individuals showing signs of metamorphosis (forward movement of the anus, decrease in body height, etc.) were taken out of the breeding tank, anesthetized in the same manner as above, and photographed. Age and body shape at the start of metamorphosis. Phenotypic data were recorded for After that, the animals were individually housed in polycarbonate containers having a volume of 250 mL, were filled with breeding water, and were maintained without feeding to observe progress of metamorphosis. The completion of metamorphosis was defined as the time when the body shape completely changed into a glass eel shape, and the age at the completion of metamorphosis was recorded.
The above operation was performed for 5 lots of Japanese eel.
In order to investigate the correlation between the gene editing rate per individual and the number of days until the start of metamorphosis, glass eels after the completion of metamorphosis were frozen at -80°C for lots 2 to 5. Genomic DNA was extracted from frozen glass eels using a commercially available kit for genomic DNA extraction (DNeasy Blood & Tissue Kit, Qiagen). Using the extracted DNA as a template, primers specific to the TRαA gene (SEQ ID NO: 6 and antisense primer: TGAATGCGTGCGTCTCCGT (SEQ ID NO: 10)) capable of amplifying the region containing the target sequence of the sgRNA shown above by PCR and to the TRαB gene PCR products amplified using specific primers (SEQ ID NOs: 8 and 9) were subjected to sequence analysis using a next-generation sequencer. The gene editing rate (%) was defined as the proportion of sequences introduced with mutations different from the original sequence among all the sequenced PCR products, and the correlation with the number of days until the start of metamorphosis was investigated.

Regarding the obtained eels of the TRαA gene and TRαB gene mutation-introduced groups and the control group of each lot, the number of individuals at the start of breeding, the rate of mutation introduction, the number of individuals at the start of metamorphosis, the number of individuals who completed metamorphosis, the survival rate at 100 days of age, and the rate of metamorphosis Table 1 below shows the age in days (age of the first individual, mean age in days) at the time of initiation (anal length/total length <70%).

In addition, the data for 5 lots (lots 1 to 5) were compiled, and the age until the start of metamorphosis was compared between the control group and the mutation-introduced group using survival time analysis by the Kaplan-Maier method. Individuals that died before the onset of metamorphosis after 100 days of age were included in the survival analysis as censored data for the age at which they died. Table 2 and FIG. 1 show the relationship between the age at the start of metamorphosis and the rate of metamorphosis initiation. A log-rank test and a Wilcoxon test were used to test between the mutation-introduced group and the control group, and a p value of <0.05 was considered significant.

As shown in Tables 1 and 2 and FIG. 1, the age at the start of metamorphosis was shorter in the TRαA gene and TRαB gene mutation-introduced groups than in the control group. Comparing the median age at the time of initiation of metamorphosis between the two groups, considering censoring due to death, the mutation-introduced group was about 44 days shorter than the control group. The log-rank test and Wilcoxon test between the mutation-introduced group and the control group showed a p-value of <0.0001, indicating a significant difference between the two groups. That is, the larvae period was significantly shortened in the mutation-introduced group compared to the control group.

Furthermore, the data for 5 lots of lots 1 to 5 are summarized, and the mutagenized group and the control group are 50 days old, 100 days old, and the start of metamorphosis when the survival rate at 6 days old is 100 (%). The survival rate (mean (%) ± standard error) at the time was calculated. The Kruskal-Wallis rank sum test was used for the test between the mutation-introduced group and the control group, and p<0.05 was regarded as significant. The results are shown in FIG.
As shown in FIG. 2, in the mutagenized group, the survival rate at 50 days of age was improved, and the survival rate at 100 days of age and at the start of metamorphosis was significantly improved compared to the control group.
The above results demonstrate that introduction of loss-of-function mutations into the eel TRαA gene and TRαB gene can shorten the larval stage and improve the larval stage survival rate.

The correlation between the TRαA gene editing rate per individual and the number of days until the start of metamorphosis is shown in FIG. 3(A), and the correlation between the TRαB gene editing rate per individual and the number of days until the start of metamorphosis is shown in FIG. 3(B). As shown in FIG. 3, a negative correlation was observed between the gene editing rate and the number of days until the start of metamorphosis for both the TRαA gene and the TRαB gene. Therefore, it was clarified that the larvae period is shortened by mutation of either the TRαA gene or the TRαB gene, or both genes.

Claims (9)

An eel in which the functions of the thyroid hormone receptor αA (TRαA) gene and the thyroid hormone receptor αB (TRαB) gene are reduced or lost. 2. The eels according to claim 1, which have loss-of-function mutations in the TRαA gene and the TRαB gene. The eels according to claim 1 or 2, wherein the TRαA gene is any one selected from the following (a) to (c), and the TRαB gene is any one selected from the following (d) to (f):
(a) a polynucleotide consisting of the nucleotide sequence represented by SEQ ID NO: 1;
(b) a polynucleotide consisting of a nucleotide sequence having 90% or more identity with the nucleotide sequence shown in SEQ ID NO: 1 and encoding a protein that functions as TRα;
(c) a polynucleotide consisting of a base sequence in which one or several bases are deleted, inserted, substituted or added to the base sequence shown in SEQ ID NO: 1 and encoding a protein that functions as TRα;
(d) a polynucleotide consisting of the nucleotide sequence represented by SEQ ID NO: 3;
(e) a polynucleotide consisting of a nucleotide sequence having 90% or more identity with the nucleotide sequence shown in SEQ ID NO: 3 and encoding a protein that functions as TRα;
(f) A polynucleotide consisting of a nucleotide sequence in which one or several nucleotides have been deleted, inserted, substituted or added to the nucleotide sequence shown in SEQ ID NO:3 and encoding a protein that functions as TRα. The eels according to any one of claims 1 to 3, wherein part or all of the TRαA gene and part or all of the TRαB gene are deleted. A method for producing eels, comprising the step of introducing loss-of-function mutations into the TRαA gene and the TRαB gene. A method for improving the survival rate of larvae of eels, comprising the step of introducing loss-of-function mutations into the TRαA gene and the TRαB gene. The method according to claim 5 or 6, wherein the TRαA gene is any one selected from (a) to (c) below, and the TRαB gene is any one of (d) to (f) below:
(a) a polynucleotide consisting of the nucleotide sequence represented by SEQ ID NO: 1;
(b) a polynucleotide consisting of a nucleotide sequence having 90% or more identity with the nucleotide sequence shown in SEQ ID NO: 1 and encoding a protein that functions as TRα;
(c) a polynucleotide consisting of a base sequence in which one or several bases are deleted, inserted, substituted or added to the base sequence shown in SEQ ID NO: 1 and encoding a protein that functions as TRα;
(d) a polynucleotide consisting of the nucleotide sequence represented by SEQ ID NO: 3;
(e) a polynucleotide consisting of a nucleotide sequence having 90% or more identity with the nucleotide sequence shown in SEQ ID NO: 3 and encoding a protein that functions as TRα;
(f) A polynucleotide consisting of a nucleotide sequence in which one or several nucleotides have been deleted, inserted, substituted or added to the nucleotide sequence shown in SEQ ID NO:3 and encoding a protein that functions as TRα. The method according to any one of claims 5 to 7, wherein the introduction of the loss-of-function mutation deletes part or all of the TRαA gene and part or all of the TRαB gene, respectively. The method according to any one of claims 5 to 8, wherein the introduction of the loss-of-function mutation is performed by genome editing.

Images