JP2022513602A - Droplet diagnostic system and method based on CRISPR system - Google Patents

Abstract

RNA target proteins are utilized to provide robust, massively multiplexed CRISPR-based diagnostics by detecting in droplets with atomor sensitivity. Detecting both DNA and RNA at comparable levels of sensitivity in nanoliter volumes is simply along with applications in multiple scenarios of human health, including, for example, virus detection, bacterial strain typing, and sensitive genotyping. Targets and non-targets can be distinguished based on the difference in one base pair. [Selection diagram] Fig. 1

Description

Mutual reference to related applications This application is for US provisional application Nos. 62 / 767,070 filed November 14, 2018, US provisional application Nos. 62 / 841,812 filed May 1, 2019, and 2019. Claims interests in US Provisional Application No. 62 / 871,056 filed on July 5th. The entire contents of the above application are incorporated herein by reference in their entirety.

Reference to electronic sequence listing The size is 217KB, and the entire contents of the electronic sequence listing (BROD_3830WP_ST25.txt) prepared on October 7, 2019 are incorporated herein by reference in their entirety.
[Technical field]

The subjects disclosed herein are generally intended for droplet diagnostics related to the use of the CRISPR system.

The ability to rapidly detect nucleic acids with high sensitivity and single-base specificity for large numbers of samples in a rapid time frame has revolutionized the diagnosis and monitoring of many diseases, providing valuable epidemiological information and in general. It can be useful as a scientific tool that can be transformed. For platforms that can test large numbers of samples at once, using small samples offers clear advantages over current state-of-the-art technology. For example, the qPCR approach is sensitive, but expensive and relies on complex equipment, so it can only be used by highly trained operators in a laboratory environment. Other approaches, such as a new method combining isothermal nucleic acid amplification and a portable platform (Du et al., 2017; Pardee et al., 2016), provide high detection specificity in a point-of-care (POC) environment. The low sensitivity limits the application somewhat. As nucleic acid diagnostics become increasingly important in a variety of healthcare applications, detection techniques that enable large-scale multiplexing at low cost with high specificity and sensitivity are critical in both clinical and basic research environments. It is useful for testing pan-viruses, pan-bacteria, or pan-pathogens in a sample.

In certain exemplary embodiments, a detection CRISPR system is provided that includes an optical barcode of one or more target molecules, and a multiplex detection system that includes a microfluidic device. In some embodiments, the detection CRISPR system comprises a DNA or RNA target protein, one or more guide RNAs designed to bind to the corresponding target molecule, a masking construct, and an optical barcode. In some embodiments, the microfluidic device comprises an array of microwells and at least one flow channel beneath the microwells, the microwells being sized to capture at least two droplets.

Nucleic acid-based masking constructs, optionally, suppress the generation of detectable positive signals in some embodiments. In other embodiments, the RNA-based masking construct suppresses the generation of detectable positive signals by masking the detectable positive signal or instead producing a detectable negative signal. In one aspect, the masking construct is RNA based. In certain embodiments, the RNA-based masking construct comprises silencing RNA that suppresses the production of the gene product encoded by the reporting construct, which produces a detectable positive signal upon expression.

An RNA-based masking construct can, in one embodiment, be a ribozyme that produces a negative detectable signal, where a positive detectable signal is produced when the ribozyme is inactivated and is a substrate. Can be converted to the first color, and when the ribozyme is inactivated, the substrate is converted to the second color.

In some embodiments, the RNA-based masking construct comprises an RNA oligonucleotide to which a detectable ligand and masking component are attached. In some embodiments, the detectable ligand is a fluorophore and the masking component is a quencher molecule.

RNA-based masking constructs can contain nanoparticles aggregated and retained by cross-linking molecules, at least a portion of the cross-linking molecules contain RNA, and when the nanoparticles are dispersed in solution, the solution color shifts. And, optionally, the nanoparticles are colloidal metals and, in some cases, colloidal gold. RNA-based masking constructs can also contain quantum dots linked to one or more quencher molecules by a linking molecule, at least a portion of the linking molecule containing RNA.

In some cases, RNA-based masking constructs include RNA compounded with an insert, which alters the absorbance upon cleavage of the RNA. In some cases, the insert may be pyronin-Y or methylene blue.

RNA-based masking agents can also be RNA aptamers and / or include RNA anchoring inhibitors, in which cases the aptamer or RNA anchoring inhibitor sequesters the enzyme and the enzyme acts on the substrate. Generates a detectable signal upon release from an aptamer or RNA mooring inhibitor. In certain embodiments, the aptamer is an inhibitory aptamer that inhibits the enzyme and prevents the enzyme from catalyzing the production of a detectable signal from the substrate, or an RNA mooring inhibitor is an inhibitor of the enzyme and the enzyme. Prevents catalyzing the generation of detectable signals from the substrate. Enzymes are, in some cases, thrombin, protein C, neutrophil elastase, subtilisin, horseradish peroxidase, beta-galactosidase, or calf alkaline phosphatase. If the enzyme is thrombin, the substrate can be covalently bound to paranitroanilide to the thrombin peptide substrate or to covalently bind 7-amino-4-methylcoumarin to the thrombin peptide substrate. Aptamers can sequester pairs of drugs that bind when released from an aptamer to produce a detectable signal.

In one aspect, the embodiments disclosed herein are directed to a method of detecting a target nucleic acid in a sample. The method disclosed herein is, in some embodiments, a step of producing a first set of droplets, where each droplet in the first set of droplets is at least one target molecule. And a step comprising an optical bar code; a second set of droplets, each droplet of which is a Cas protein, eg, an RNA target protein, and a corresponding target. With one or more guide RNAs designed to bind to the molecule, an RNA-based masking construct, and optionally a detection CRISPR system containing an optical barcode; the first set and the second set. A step of combining droplets into a pool of droplets and flowing the pool of combined droplets onto an array of microwells and a microfluidic device containing at least one flow channel under the microwells. Is a size that captures at least two droplets; a step that captures the droplets in the microwells and a step that detects the optical barcode of the droplets captured in each microwell; The step of merging the droplet into the merged droplet formed at each microwell, wherein at least a subset of the merged droplet comprises the detection CRISPR system and the target sequence; and the step of initiating the detection reaction. including. The merged droplets are then maintained under conditions sufficient to bind one or more guide RNAs to one or more target molecules. When one or more guide RNAs bind to the target nucleic acid, they in turn activate the CRISPR protein. Upon activation, the CRISPR protein inactivates the masking construct, for example by cleaving the masking construct so that a detectable positive signal is unmasked, released, or produced. The detectable signal of each merged droplet can be detected and measured in one or more time cycles, eg, the presence of a positive detectable signal indicates the presence of a target molecule. The disclosed method can include the step of amplifying the target molecule, and the amplification can optionally be RPA or PCR.

The target molecule is included in a biological sample or an environmental sample in some embodiments. In some embodiments, the sample is of human origin. In some embodiments, the biological sample is blood, plasma, serum, urine, stool, sputum, mucus, lymph, synovial fluid, bile, ascites, pleural effusion, serous tumor, saliva, cerebrospinal fluid, aqueous humor or vitreous humor. , Or any body fluid, serum, exudate, or fluid obtained from a joint, or a swab on the surface of the skin or mucous membrane. The biological sample may be further treated, including, for example, enriching or isolating the cells of interest prior to further evaluation.

One or more guide RNAs are designed to bind to the corresponding target molecule, including the (synthetic) mismatch, where the mismatch is a single nucleotide polymorphism (SNP) or other single nucleotide mutation in the target molecule. It can be an upstream or downstream mismatch. One or more guide RNAs can be designed to detect single nucleotide polymorphisms in the target RNA or DNA, or spliced variants of RNA transcripts. In some cases, guide RNAs can be designed to detect drug-resistant SNPs in viral infections. In some embodiments, the guide RNA can also be designed to bind to one or more target molecules that are characteristic of the disease state. Optionally, the disease state can be characterized by the presence or absence of drug resistance or susceptibility genes or transcripts or polypeptides, and in some cases may be an infectious disease. In some cases, infections are caused by viruses, bacteria, fungi, protozoans, or parasites. Guide RNAs are designed to distinguish one or more microbial strains. The guide RNA can optionally include at least 90 guide RNAs.

The target protein can include one or more RuvC-like domains in some embodiments. In certain embodiments, the CRISPR protein is Cas12, and in embodiments, Cas12 is Cpf1 or C2c1. The target protein can, in some embodiments, include one or more HEPN domains, and optionally an RxxxxxxH motif sequence. In some cases, the RxxxH motif comprises an R {N / H / K] X ₁ X ₂ X ₃ H (SEQ ID NO: 1) sequence, wherein in some embodiments X ₁ is R, S, D, E, Q, N, G, or Y, X ₂ is independently I, S, T, V, or L, and X ₃ is independently L, F, N, Y, V, I, S, D, E, or A. In some specific embodiments, the CRISPR RNA target protein is Cas13. In certain embodiments, Cas13 is Cas13a, Cas13bl, Cas13b2, or Cas13c.

In some cases, performing an optical evaluation involves capturing an image of each microwell. In some embodiments, optical barcodes are detected by using light microscopy, fluorescence microscopy, Raman spectroscopy, or a combination thereof. In some embodiments, the optical barcode comprises particles of a particular size, shape, index of refraction, color, or a combination thereof. Optical barcodes containing particles can include colloidal metal particles, nanoshells, nanotubes, nanorods, quantum dots, hydrogel particles, liposomes, dendrimers, or metal-liposomal particles. Each optical barcode contains one or more fluorescent dyes, and the ratio of the fluorescent dyes may be different. The measurable detectable signal may optionally be the level of fluorescence.

Devices used in the methods of the system disclosed herein can include an array of at least 40,000 microwells or at least 190,000 microwells. In one embodiment, a detection CRISPR system comprising an RNA target protein, one or more guide RNAs designed to bind to the corresponding target molecule, an RNA-based masking construct, and an optical bar code, and one or more targets. Also disclosed is a multiplex detection system comprising an optical bar code of a molecule and a microfluidic device comprising an array of microwells and at least one flow channel between microwells sized to capture at least two droplets. A kit comprising a multiplex detection system is also provided in embodiments of this disclosed subject matter. The kit contains instructions for performing the diagnosis, reagents, microfluidic platform of the instrument, reagents, etc., and standards for calibrating or performing the method. The instructions provided in the kit according to the invention can be directed to the appropriate operating parameters in the form of signs or separate package inserts. Optionally, the kit further contains standard or control information and the test sample can be compared to the control information standard to determine if consistent results are obtained.

These and other aspects, objectives, features, and advantages of the exemplary embodiments will be apparent to those of skill in the art in light of the following detailed description of the exemplary embodiments presented.

An understanding of the features and advantages of the invention will be obtained by reference to the following detailed description illustrating exemplary embodiments in which the principles of the invention may be utilized, and the accompanying drawings thereof.

A schematic diagram of an exemplary method of droplet detection is provided. Detection of pathogens by SHERLOCK can be massively multiplexed by performing detection on droplets on a chip equipped with an array of microwells. The amplification reaction (using RPA or PCR) can be performed in standard tubes or microwells. The detection and amplification mixture is then lined up in microwells. A unique fluorescent barcode consisting of the ratio of fluorescent dyes can be added to each detection mix and each target. The barcoded reagents are emulsified in oil and the droplets from the emulsion are pooled together in one tube. The droplet pool is loaded into a PDMS chip equipped with a microwell array. Each microwell corresponds to two droplets and randomly creates a pairwise combination of all pooled droplets. The contents of each well are isolated by fixing the microwells to the glass, and the barcode of all droplets is read using a fluorescence microscope to determine the contents of each microwell. After imaging, the droplets are merged into an electric field, the detection mix and target are mixed, and the detection reaction begins. The chip is incubated to allow the reaction to proceed, and a fluorescence microscope is used to monitor the progress of the SHERLOCK (specifically sensitive enzymatic reporter unLOCKing) reaction.

Includes images showing that the detection reagent and target can be stably emulsified as droplets in oil. Left: White light image of the target aqueous solution emulsified in oil. Right: Fluorescent image of a microwell chip loaded with detection reagents and target library. Each has a unique fluorescent barcode. The content of each well can be determined from the fluorescent barcode.

Includes a graph showing that SHERLOCK works equally well on plates and droplets. Left: SHERLOCK sensitivity curve to Zika virus in the plate. Right: Sensitivity curve of the same SHERLOCK assay for Zika virus in droplets. The error bar on the left shows one standard deviation. The error bar on the right is S. E. M. Is.

Provides a graph showing that SHERLOCK distinguishes single nucleotide polymorphisms (SNPs) equally well in plates and droplets. Left: SHERLOCK distinction of SNP that occurred when Zika virus spread to the United States. Right: Droplet SHERLOCK detection of the same SNP. The error bar on the left shows one standard deviation. The error bar on the right is S. E. M. Is.

Includes a heatmap showing that SHERLOCK detection in droplets within a microwell array can distinguish influenza subtypes. The fold turn-on after background subtraction of the crRNA pool is shown in the heatmap.

Includes heatmap results for multiple detections of influenza H subtypes. Based on the sequences deposited since 2008, 41 crRNAs targeting the H segment of influenza have been designed. Boxes indicate the set of crRNAs designed for each subtype, and asterisks indicate crRNAs that align to the majority consensus sequence of each subtype with a mismatch of 0 or 1. Control crRNA pools for H4, H8, and H12 are shown.

A second design heatmap for multiple detection of influenza H subtypes is shown. Based on the sequences deposited since 2008, 28 crRNAs targeting the H segment of influenza were designed with preferential weighting to newer sequences. Boxes indicate the set of crRNAs designed for each subtype, and asterisks indicate crRNAs that align to the majority consensus sequence of each subtype with a mismatch of 0 or 1. Control crRNA pools for H4, H8, and H12 are shown.

Includes a heatmap for multiple detections of influenza N-subtypes. Based on the sequences deposited since 2008, 35 crRNAs targeting the H segment of influenza were designed with preferential weighting to newer sequences. Boxes indicate the set of crRNAs designed for each subtype, and asterisks indicate crRNAs that align to the majority consensus sequence of each subtype with a mismatch of 0 or 1. "CrRNA36" indicates a negative control without the addition of crRNA.

Includes multiple detection of 6 mutations in HIV reverse transcriptase using droplet SHERLOCK. Using synthetic targets of both ancestral and derived sequences, fluorescence at various time points is shown for the indicated mutations in the crRNA targeting the ancestral and derived alleles. Synthetic targets ⁽ 104 cp / μl) were amplified using multiplex PCR and detected using droplet SHERLOCK. Error bar: S. E. M.

It shows how the HIV-derived v0 and ancestor v1 tests work and can potentially be used together.

Includes the results of multiple detection of drug resistance mutations in TB using droplet SHERLOCK. For both alleles (reference and drug resistance), background-subtracted fluorescence is shown after 30 minutes.

It is a graph showing that the combination of SHERLOCK and microwell array chip technology provides the highest throughput in multiple detection to date.

It shows how a large amount of multiplexing is possible by expanding the number of barcodes and chip size. (Left) The current 64 barcode set was extended to 105 barcodes using 3 fluorochromes. The possibility of adding a fourth dye has been demonstrated on a small scale without compromising coding accuracy compared to existing systems and can easily be extended to hundreds of barcode scales. (Right) The existing chip size can be quadrupled, and the number of chips required for assay development can be reduced to one-fourth.

Includes a graph showing that with additional barcodes and enhanced chip size implementation, about 20 samples can be tested at once for all human-related viruses, as shown.

Combination sequence reaction (CARMEN) for multiple evaluation of nucleic acids. Identification of multiple pathogens circulating in human and animal populations represents a large-scale detection problem. Combination sequence reaction (CARMEN) for multiple evaluation of nucleic acids. Schematic diagram of the CARMEN workflow. Combination sequence reaction (CARMEN) for multiple evaluation of nucleic acids. Zika virus is detected by a single CARMEN-Cas13 assay with atomor sensitivity and dozens of duplicate droplet pairs (black dots). The red line shows the median of the graph and is used to create the heatmap below. A typical droplet image is displayed above the graph. Combination sequence reaction (CARMEN) for multiple evaluation of nucleic acids. Detection of Zika virus graphed by fluorescence pair input concentration.

Comprehensive identification of human-related viruses by CARMEN-cas13. A. Development and testing of a panel of all human-related viruses with 10 or more available genomic sequences. B. Experimental design and C.I. Comprehensive human-related virus panel testing using CARMEN-cas13. The heat map shows fluorescence with background subtracted 1 hour after detection. The PCR primer pool and the viral family are below and to the left of the heatmap, respectively. Gray line: crRNA not tested.

Identification of influenza subtypes by CARMEN-cas13. Schematic diagram of influenza A subtype identification using CARMEN-cas13. Identification of influenza subtypes by CARMEN-cas13. Identification of H1-H16 using CARMEN-cas13. The heat map shows the fluorescence with the background subtracted 1 hour after the detection of cas13. The synthetic target was used at 104 cp / ul. Identification of influenza subtypes by CARMEN-cas13. Identification of N1-N9 using CARMEN-cas13. The heat map shows the fluorescence with the background subtracted 3 hours after the detection of cas13. The synthetic target was used at 104 cp / ul. Identification of influenza subtypes by CARMEN-cas13. Identification of H and N subtypes from virus species stocks and synthetic targets. The heat map shows the fluorescence with the background subtracted 3 hours after the detection of cas13. The synthetic target was used at 104 cp / ul.

Multiplexed DRM identification by CARMEN-cas13. A. Schematic diagram of HIV drug resistance mutation (DRM) identification using CARMEN-cas13. B. Identification of 6 reverse transcriptase mutations using CARMEN-cas13. C. DRM identification in patient plasma samples using CARMEN-cas13. D. Identification of 21 integrase DRM using CARMEN-cas13. The heat map shows the SNP index 0.5 to 3 hours after the detection of cas13. B and D are normalized row by row. In BD, the synthetic target was used at 104 cp / ul. An asterisk in D indicates a mutated target. The box indicates multiple mutations within the same codon. E. The DRM frequency vs. SNP index for the K103N reverse transcriptase mutation is shown. F. DRM identification in patient plasma and serum samples using CARMEN-cas13. Multiplexed DRM identification by CARMEN-cas13. A. Schematic diagram of HIV drug resistance mutation (DRM) identification using CARMEN-cas13. B. Identification of 6 reverse transcriptase mutations using CARMEN-cas13. C. DRM identification in patient plasma samples using CARMEN-cas13. D. Identification of 21 integrase DRM using CARMEN-cas13. The heat map shows the SNP index 0.5 to 3 hours after the detection of cas13. B and D are normalized line by line. In BD, the synthetic target was used at 104 cp / ul. An asterisk in D indicates a mutated target. The box indicates multiple mutations within the same codon. E. The DRM frequency vs. SNP index for the K103N reverse transcriptase mutation is shown. F. DRM identification in patient plasma and serum samples using CARMEN-cas13. Multiplexed DRM identification by CARMEN-cas13. A. Schematic diagram of HIV drug resistance mutation (DRM) identification using CARMEN-cas13. B. Identification of 6 reverse transcriptase mutations using CARMEN-cas13. C. DRM identification in patient plasma samples using CARMEN-cas13. D. Identification of 21 integrase DRM using CARMEN-cas13. The heat map shows the SNP index 0.5 to 3 hours after the detection of cas13. B and D are normalized line by line. In BD, the synthetic target was used at 104 cp / ul. An asterisk in D indicates a mutated target. The box indicates multiple mutations within the same codon. E. The DRM frequency vs. SNP index for the K103N reverse transcriptase mutation is shown. F. DRM identification in patient plasma and serum samples using CARMEN-cas13. Multiplexed DRM identification by CARMEN-cas13. A. Schematic diagram of HIV drug resistance mutation (DRM) identification using CARMEN-cas13. B. Identification of 6 reverse transcriptase mutations using CARMEN-cas13. C. DRM identification in patient plasma samples using CARMEN-cas13. D. Identification of 21 integrase DRM using CARMEN-cas13. The heat map shows the SNP index 0.5 to 3 hours after the detection of cas13. B and D are normalized row by row. In BD, the synthetic target was used at 104 cp / ul. An asterisk in D indicates a mutated target. The box indicates multiple mutations within the same codon. E. The DRM frequency vs. SNP index for the K103N reverse transcriptase mutation is shown. F. DRM identification in patient plasma and serum samples using CARMEN-cas13. Multiplexed DRM identification by CARMEN-cas13. A. Schematic diagram of HIV drug resistance mutation (DRM) identification using CARMEN-cas13. B. Identification of 6 reverse transcriptase mutations using CARMEN-cas13. C. DRM identification in patient plasma samples using CARMEN-cas13. D. Identification of 21 integrase DRM using CARMEN-cas13. The heat map shows the SNP index 0.5 to 3 hours after the detection of cas13. B and D are normalized row by row. In BD, the synthetic target was used at 104 cp / ul. An asterisk in D indicates a mutated target. The box indicates multiple mutations within the same codon. E. The DRM frequency vs. SNP index for the K103N reverse transcriptase mutation is shown. F. DRM identification in patient plasma and serum samples using CARMEN-cas13. Multiplexed DRM identification by CARMEN-cas13. A. Schematic diagram of HIV drug resistance mutation (DRM) identification using CARMEN-cas13. B. Identification of 6 reverse transcriptase mutations using CARMEN-cas13. C. DRM identification in patient plasma samples using CARMEN-cas13. D. Identification of 21 integrase DRM using CARMEN-cas13. The heat map shows the SNP index 0.5 to 3 hours after the detection of cas13. B and D are normalized row by row. In BD, the synthetic target was used at 104 cp / ul. An asterisk in D indicates a mutated target. The box indicates multiple mutations within the same codon. E. The DRM frequency vs. SNP index for the K103N reverse transcriptase mutation is shown. F. DRM identification in patient plasma and serum samples using CARMEN-cas13.

Comprehensive identification of human-related viruses by CARMEN-cas13. A. Schematic of the development of a detection panel for human-related viruses with 10 or more genomic sequences available with one potential application for regional virus diagnosis and surveillance. B. Mild data filtering improves color code classification accuracy. C. Workflow for designing primers and crRNA using CATCH dx. D. Illustrative design. E. Comprehensive human-related virus panel testing using CARMEN-cas13. The heat map shows fluorescence with background subtracted 3 hours after Cas13 detection. Comprehensive identification of human-related viruses by CARMEN-cas13. A. Schematic of the development of a detection panel for human-related viruses with 10 or more genomic sequences available with one potential application for regional virus diagnosis and surveillance. B. Mild data filtering improves color code classification accuracy. C. Workflow for designing primers and crRNA using CATCH dx. D. Illustrative design. E. Comprehensive human-related virus panel testing using CARMEN-cas13. The heat map shows fluorescence with background subtracted 3 hours after Cas13 detection. Comprehensive identification of human-related viruses by CARMEN-cas13. A. Schematic of the development of a detection panel for human-related viruses with 10 or more genomic sequences available with one potential application for regional virus diagnosis and surveillance. B. Mild data filtering improves color code classification accuracy. C. Workflow for designing primers and crRNA using CATCH dx. D. Illustrative design. E. Comprehensive human-related virus panel testing using CARMEN-cas13. The heat map shows fluorescence with background subtracted 3 hours after Cas13 detection. Comprehensive identification of human-related viruses by CARMEN-cas13. A. Schematic of the development of a detection panel for human-related viruses with 10 or more genomic sequences available with one potential application for regional virus diagnosis and surveillance. B. Mild data filtering improves color code classification accuracy. C. Workflow for designing primers and crRNA using CATCH dx. D. Illustrative design. E. Comprehensive human-related virus panel testing using CARMEN-cas13. The heat map shows fluorescence with background subtracted 3 hours after Cas13 detection. Comprehensive identification of human-related viruses by CARMEN-cas13. A. Schematic of the development of a detection panel for human-related viruses with 10 or more genomic sequences available with one potential application for regional virus diagnosis and surveillance. B. Mild data filtering improves color code classification accuracy. C. Workflow for designing primers and crRNA using CATCH dx. D. Illustrative design. E. Comprehensive human-related virus panel testing using CARMEN-cas13. The heat map shows fluorescence with background subtracted 3 hours after Cas13 detection.

Schematic diagram of CARMEN. Includes a detailed molecular schematic of nucleic acid detection in CARMEN-Cas13. After amplification (optionally with reverse transcription), detection is performed on Cas13 using in vitro transcription that converts the amplified DNA to RNA. The resulting RNA is detected with exquisite sequence specificity by the Cas13-crRNA complex, and concomitant cleavage uses a cleavage reporter RNA to generate a signal. Schematic diagram of CARMEN. A detailed CARMEN schematic diagram is provided. (Step 1) The sample is amplified, color coded and emulsified. In parallel, the detection mix is assembled, color coded and emulsified. (Step 2) Droplets from each emulsion are pooled in a single tube and mixed by pipetting. (Step 3) The droplet is loaded onto the chip in a single pipetting step. Side view: Droplets are placed in the flow space between the chip and the glass via the load slot. Tilt the loader to move the pool of droplets around the flow space and lift the droplets into the microwells. (Step 4) The chip is fixed to glass, the contents of each microwell are separated and imaged with a fluorescence microscope to identify the color code and position of each droplet. (Step 5) The droplets are merged and the detection reaction is started. (Step 6) The detection reaction of each microwell is monitored over time (minutes to 3 hours) by a fluorescence microscope. Schematic diagram of CARMEN. It is a detailed side view of an acrylic loading device, a flow of droplets, an entry into a microwell, and the merging of two droplets.

Chip design, manufacturing, loading, and imaging. A. Microwell design optimized for droplets made from PCR products or detection mixes. B. Standard chip dimensions and layout. Light blue is the area covered by the microwell array. C. A photo of a standard chip. D. A photo of a standard chip sealed inside an acrylic loader, ready for imaging. E. MChip dimensions and layout compared to standard chips. The lilac is the area covered by the microwell array. F. Acrylic AutoCAD rendering used in the manufacture of mChip. G. A photo of mChip. H. (Left) AutoCAD rendering of each part of the mChip loader. (Center) AutoCAD rendering of mChip loader setup. (Right) AutoCAD rendering of mChip in a loader ready for loading. I. A photo of the loaded mChip. J. Load and Seal of mChip Corresponding to Step 20B: (Step 3) mChip Load: Droplets are placed at the edge of the chip in the flow space between the chip and the acrylic loader. Tilt the loader to move the pool of droplets around the flow space and lift the droplets into the microwells. (Step 4) Remove the chip and loader lids from the base and seal against the PCR film. No glass is used to seal the mChip. The sealed mChip suspended from the lid of the acrylic loader can be placed directly on the microscope for imaging. K. A photo of mChip that is sealed and ready for imaging.

Multiple detection of deca sequences using CARMEN-Details of deca experiments. A. Plate reader data for SHERLOCK detection of synthetic deer sequences at 3 hours. B. Comparison of data between plate reader (FIG. 20A) and droplet (FIG. 15C). C. Bootstrap analysis of deer detection in droplets. Figure D. Receiver operating characteristic (ROC) curve for deer detection in droplets. AUC: Area under the curve. Figure E. Assays, tests, and droplet pairs duplicate the naming. Each multiplexing assay consists of a matrix of tests, the size of which is M sample x N detection mix. Each test is the result of one sample evaluated by one detection mix. The result of the test is the median of a series of replicated droplet pairs in the microwell array.

Quantitative CARMEN-cas13. A. Schematic representation of amplification primers containing the T7 or T3 promoter, which results in increased signal for most (T7) products after Cas13 detection. Schematic of quantitative CARMEN-cas13 showing amplification primers containing the T7 or T3 promoter, which results in increased signal for most (T7) products after Cas13 detection. B. Expanding the dynamic range of detection using quantitative CARMEN-Cas13. Dynamic range is indicated using the colored bars above the graph. Error bars indicate SEM. C. The graph shows the linear correlation between the actual and calculated concentrations.

1050 color code design and characterization. A. 1050 color code design. B. Three-color characterization of 210 color codes and 1050 color codes. C. Performance of 210 color codes in 3 color spaces. D. Performance of 1050 color codes in 3 color spaces. E. Characterization of the 1050 color code in the fourth color dimension. F. It shows the extension of fluorescent barcodes in three and four color spaces, including performance in the fourth color dimension.

Design and manufacture of mChip. A. MChip dimensions and layout compared to standard chips. The lilac indicates the area covered by the microwell array. B. Acrylic AutoCAD rendering used in the manufacture of mChip. C. (Left) AutoCAD rendering of each part of the mChip loader. (Center) AutoCAD rendering of mChip loader setup. (Right) AutoCAD rendering of mChip in a loader ready for loading. D. A photo of mChip. E. A photo of the mChip loader with the mChip inside and ready to load (corresponding to the cartoon on the right side of C). F. A photo of the loaded mChip. G. Photograph of mChip sealed and ready for imaging (output of schematic diagram shown in D).

Detailed view of the primer and crRNA design of the human-related virus panel. NCBI has 576 human-related viral species with at least one genomic adjacency and 169 with 10 or more genomic adjacencies. The genome was sorted segment by segment and sequence diversity was analyzed using CATCH-dx to determine optimal primers and crRNA binding sites (see Methods for details).

Human-related virus panel design statistics. A. Species of each family in human-related virus panel design. B. The number of primer pairs required to capture at least 90% of the sequence diversity within the variety. The two species required the use of primer pairs containing degenerate bases. C. The number of crRNAs required to capture at least 90% of the sequence diversity within the variety. D. Percentage of sequences within the variety covered by each crRNA set designed. A small crRNA set could be designed with 90% or more coverage for 164 of the 169 species.

Performance of human-related virus panel version 1. A. Fluorescent heatmap with background subtracted from test version 1 of the human-related virus panel. B. crRNAs were classified as on-target, hypoactive, or cross-reactive by sequence analysis (black) or based on experimental data (orange). C. Potential cause of low activity or cross-reactivity.

Human-related virus panel: Comparison of rounds 1 and 2. A. Round 1, B. Round 2 comparison

Comparison of rounds 1 and 2 of the human-related virus panel test. A. Distribution of the number of replicating droplet pairs for each crRNA target in Round 1 (top) and Round 2 (bottom) of the test. A. Summary of crRNA performance in rounds 1 and 2.

Performance of individual guides in rounds 1 and 2 human-related virus panels. A. Performance of individual guides in Round 1 and Round 2 (x-axis). B. Area under the receiver operating characteristic (ROC) curve of on-target and off-target reactivity in round 1 of the test. Typical on-target and off-target distributions are shown for each range of performance (> 0.97, 0.89 to 0.97, and <0.89). C. Area under the receiver operating characteristic (ROC) curve of on-target and off-target reactivity in Round 2 of the test. Typical on-target and off-target distributions are shown for each range of performance (> 0.97, 0.89 to 0.97, and <0.89). D. Comparison of rounds 1 and 2 AUC. Mark a particularly poor guide in Round 2.

Overview and statistics of influenza A design. A. Design goals for the influenza A subtyping assay. B. An overview of the four rounds of the design process.

Performance of individual crRNAs of influenza A. A. Distribution of droplet fluorescence of each H subtype crRNA of influenza A with each target. The receiver operating characteristic (ROC) curve for on-target reactivity (eg, crRNA H1 with target H1) vs. all other off-target activity (eg, crRNA H1 with any other target) is shown on the right. B. Distribution of droplet fluorescence of each N-subtype crRNA of influenza A with each target. The receiver operating characteristic (ROC) curve for on-target reactivity vs. all other off-target activity is shown on the right. AUC = area under the curve

Identification of the N-subtype of influenza A. A heatmap showing the complete set of crRNAs designed to capture sequence diversity within the influenza A genomic segment containing neuraminidase. Thirty-five synthetic targets were tested ⁽ at 104 cp / μl) using the designed 35 crRNAs. Each subtype is indicated by an orange box, and the consensus sequence for each subtype is indicated using an asterisk.

HIV droplet fluorescence distribution for reverse transcriptase mutations. In most cases, the distribution of droplet fluorescence for each crRNA target pair after 30 minutes. For V106M and M184V, a time point of 3 hours is shown. The SNP index shown in FIG. 18B is calculated from the median of these distributions.

HIV low allele frequency for reverse transcriptase mutations. A bar graph showing 1: 3 serial dilutions of synthetic targets, including wild-type reverse transcriptase sequences or those of the 6 drug resistance mutations shown. Less than 30% of allele frequencies were detected in 5 of 6 cases and decreased to 3% in 2 cases.

Comprehensive human-related virus panel testing using CARMEN-cas13. The heat map shows fluorescence with background subtracted 1 hour after detection. The PCR primer pool and the viral family are below and to the left of the heatmap, respectively. Gray line: crRNA not tested in Round 2. "Dengue" is a sample from 4 patients infected with dengue fever virus, 274 "Zika" is a sample from 4 patients infected with Zika virus, "healthy" is plasma and serum pooled from healthy human donors. And a sample of urine is shown. The virus name when detected only in infected patients is displayed in black, and the virus name when detected in any of the negative controls is displayed in gray. The purple line with exe indicates the virus detected in the negative control. Additional clinical sample data are shown in FIGS. 41A-41F. TLMV: Torqueteno-like minivirus, HPV: human papillomavirus, HCV: hepatitis C virus, HBV: hepatitis B virus, HPIV-1: human parainfluenza virus 1, HIV: human immunodeficiency virus, B19 virus: parvovirus B19.

1,050 color code design and characterization. A. 1,050 color code design. B. The schematic diagram of the characteristic evaluation of three color dimensions of 210 color code and 1,050 color code. C. Raw data from 210 color code characterization. D. Performance of 210 color codes in 3 color spaces. E. Performance of 1,050 color codes in 3 color spaces. F. Illustration of a slide distance filter (circle) in a three-color space. G. Characteristic diagram and performance of 1,050 color codes in the fourth color dimension.

Blueprints and statistics for the Human-Related Virus (HAV) panel. A. NCBI has 576 human-related viral species with at least one genomic adjacency and 169 with 10 or more genomic adjacencies. The genome was sorted by segment and sequence diversity was analyzed using CATCH-dx to determine optimal primers and crRNA binding sites (see Methods for details). B. Species of each family in human-related virus panel design. C. The number of primer pairs required to capture at least 90% of the sequence diversity within the variety. The two species required the use of primer pairs containing degenerate bases. D. The number of crRNAs required to capture at least 90% of the sequence diversity within the variety. E. Percentage of sequences within the variety covered by each crRNA set designed. The small crRNA set was designed with 90% or more coverage for 164 of the 169 species. To compare the expected and observed performance of the HAV panel, F. Primer and G.M. crRNAs were classified as on-target, hypoactive, or cross-reactive by sequence analysis (blue or black) or based on experimental data (orange).

Performance of crRNA during testing of human-related virus panels. A. The performance of the individual guides in Round 1 and Round 2. Redesigns and redilutions between rounds of the test are shown between the data in rounds 1 and 2. "On target": Reactivity that exceeds the threshold for only the intended target. "Cross-reactivity": Off-target reactivity above the threshold. "Low activity": No reactivity above the threshold. B. Summary bar graph of crRNA performance in rounds 1 and 2. C. A summary table of redesigns, redilutions, and matches between rounds 1 and 2 of the unchanged trial. D. Round 1 and E.I. Round 2, the under-curve area (AUC) of the receiver operating characteristics of on-target and off-target reactivity in round 1 of the test. Typical on-target and off-target distributions are shown for the displayed ranks.

Testing of synthetic targets and clinical samples using the HAV panel. A. Sample processing and data analysis of unknown samples. Following 15 pools of multiplex PCR, the PCR products are grouped into 3 sets. Subsets of crRNA correspond to the primers of each PCR product pool, shown in color in the developed heatmap. Composite heatmaps are generated by combining data from the PCR product pool in the extended heatmap. B. Five synthetic targets (104 cp / μl) were amplified in all primer pools and detected using 169 crRNAs from the HAV panel + HCV crRNA2. The control was the same as that shown in c. C. Four HCV and four HIV clinical samples were tested using the HAV10 panel + HCV crRNA2. Shown as a composite heat map. D. Reactivity of 986 of the same sample from FIG. 41C containing only HCV crRNA. Shown in 1 hour and 3 hours. E. Comparison of PCR amplification scores and CARMEN fluorescence for a subset of viruses from dengue, deer, and healthy samples, shown in FIG. 37. F. Comparison of PCR amplification scores and CARMEN fluorescence for a subset of viruses from HIV, HCV, and healthy samples, shown in FIG. 41C. The fluorescence of CARMEN is the fluorescence minus the background after 1 hour, whereas the HCV crRNA2 is after 3 hours. Unless otherwise stated, heatmaps show fluorescence minus background after 1 hour. TLMV: Torqueteno-like minivirus, HPV: human papillomavirus, HCV: hepatitis C virus, HBV: hepatitis B virus, HPIV-1: human parainfluenza virus 1, HIV: human immunodeficiency virus, B19 virus: parvovirus B19.

Performance of influenza A subtyping and HIV reverse transcriptase (RT) mutation detection. A. Distribution of droplet fluorescence of each H subtype crRNA of influenza with each target. A receiver operating characteristic (ROC) curve for on-target reactivity (eg, crRNA H1 with target H1) vs. all off-target activity (eg, crRNA H1 with any other target) is shown. B. A heatmap showing the complete set of crRNAs designed to capture the diversity of influenza N sequences. Thirty-five synthetic targets (104 cp / μl) were tested using 35 crRNAs. Gray: below the detection threshold, green: fluorescence count above the threshold, orange outline: subtype, bottom row shows the detected target. C. In most cases, the distribution of droplet fluorescence of each HIV RT crRNA target pair at 30 minutes. At 3 hours for V106M and M184V. The SNP index of FIG. 4B is calculated from the median of these distributions.

The figures herein are for illustration purposes only and are not necessarily drawn to scale.

Detailed Description of Exemplary Embodiments General Definitions Unless otherwise defined, the technical and scientific terms used herein are identical to those generally understood by those of skill in the art to which this disclosure relates. Has the meaning of. The general terms and technical definitions of molecular biology are Molecular Cloning: A Laboratory Manual, ^2nd edition (1989) ( ^Sambrook , Fritsch, and Maniatis); Molecular Cloning: A Laboratory (A Laboratory) Green and Sambrook); Current Protocols in Molecular Biology (1987) (FM Ausubel et al. Eds.); The series Methods in Energy (Ac) J. MacPherson, BD Hames, and GR Taylor eds.): Antibodies, A Laboratory Manual (1988) ( ^Hallow and Lane, eds.): Antibodies A. A. Greenfield ed.); Animal Cell Culture (1987) (RI Frederick, ed.); Published by Benjamin Lewin, Genes IX, Jones and Bartlet, 2008 (ISBN 0763722223); Kend. (Eds.), The Encyclopedia of Molecular Biology, Blackwell Science Ltd. Published by 1994 (ISBN 0632021829); Robert A. et al. Meyers (ed.), Molecular Biology and Biotechnology: a Comprehensive Desk Reference, VCH Publishing, Inc. Published by 1995 (ISBN 9780471185710); Singleton et al. , Dictionary of Microbiology and Molecular Biology 2nd ed. , J. Wiley & Sons (New York, NY 1994), March, Advanced Organic Chemistry Reactions, Mechanisms and Structure 4th ed. , John Wiley & Sons (New York, NY 1992); and Martin H. et al. It can be found in Hofker and Jan Van ^Deursen , Transgenic Mouse Methods and Protocols, 2nd edition (2011).

As used herein, the singular forms "a", "an", and "the" are singular and unless the context explicitly indicates otherwise. Includes both of multiple referents.

The term "arbitrarily" or "arbitrarily" means that the event, situation, or substituent described subsequently may or may not occur, as well as the description that the event or situation occurs. It is meant to include examples of cases and cases where it does not occur.

The enumeration of numerical ranges by endpoints includes all numbers and fractions contained within each range, as well as the endpoints mentioned.

As used herein, the term "about" or "approximate" refers to measurable values such as parameters, quantities, time duration, etc., to refer to specific values and variations from specific values. As long as such variations are appropriate to make in the disclosed invention, for example, +/- 10% or less, +/- 5% or less, +/ It means that it includes fluctuations of -1% or less and +/- 0.1% or less. It should be understood that the value itself pointed to by the modifier "about" or "approximately" is also specific and preferably disclosed.

References to "one embodiment," "embodiments," and "examples of embodiments" throughout the specification are at least one embodiment of the invention with specific features, structures, or properties described in connection with embodiments. It means that it is included in the form. Accordingly, the appearance of the phrase "in one embodiment," "in one embodiment," or "example of an embodiment" at various locations throughout the specification does not necessarily all refer to the same embodiment. do not have. Moreover, certain features, structures, or properties may be combined in any suitable manner in one or more embodiments, as will be apparent to those of skill in the art from the present disclosure. Moreover, while some embodiments described herein include some rather than other features contained in other embodiments, combinations of features of different embodiments are within the scope of the invention. Means that. For example, in the appended claims, any of the claimed embodiments may be used in any combination.

"C2c2" is now referred to as "Cas13a" and these terms are interchangeably used herein unless otherwise indicated.

All publications, published patent documents, and patent applications cited herein are to the same extent as specifically and individually indicated that an individual publication, published patent document, or patent application is incorporated by reference. Incorporated herein by reference.

Summary The embodiments disclosed herein provide robust CRISPR-based diagnostics for large-scale multiplexed applications by utilizing RNA-targeted proteins to perform detection in droplets. do. The embodiments disclosed herein are capable of detecting both DNA and RNA at equivalent sensitivity levels and distinguishing targets from non-targets based on differences in single base pair at nanoliter volumes. Such embodiments include multiple scenarios in human health, including, for example, virus detection, bacterial strain typing, sensitive genotyping, multiplex SNP detection, multiplex strain identification, and detection of disease-related cell-free DNA. It is useful. For ease of reference, the embodiments disclosed herein are also referred to as SHERLOCK (specific sensitive enzymatic reporter unLOCKing). This is performed in some embodiments in a multiplexed droplet, advantageously allowing sensitive detection in small amounts.

The subject matter currently disclosed is a single RNA-induced RNase (Shmakov et al., 2015; Abdayyeh et al., 2016; Margon et al., 2017), which comprises C2c2, which provides a platform for specific RNA sensing. Utilizes programmable endonucleases, including. RNA-derived RNA endonucleases from CRISPR clustered equidistant short-chain batch repeats (CRISPR) and CRISPR-related (CRISPR-Cas) adaptive immune systems are easily and conveniently reprogrammed using CRISPR RNA (crRNA). , Can cleave the target RNA. RNA-induced RNases such as C2c2 remain active after cleavage of their RNA target, resulting in "incidental" cleavage of nearby non-target RNA (Abudayyeh et al., 2016). Concomitant RNA cleavage activity programmed with this crRNA can be used as a readout using RNA-induced RNase to induce in vivo programmed cell death or non-specific RNA degradation in vitro for specific RNA. Provides an opportunity to detect the presence of (Abdayyeh et al., 2016; East-Seletsky et al., 2016). The currently disclosed subject matter utilizes the cleavage activity in droplet application to allow multiple reactions with small samples.

In one aspect, a detection CRISPR system is provided that includes an optical barcode of one or more target molecules, and a multiplex detection system that includes a microfluidic device. In some embodiments, the detection CRISPR system comprises an RNA target effector protein, one or more guide RNAs designed to bind to the corresponding target molecule, an RNA-based masking construct, and an optical barcode. In some embodiments, the microfluidic device comprises an array of microwells and at least one flow channel beneath the microwells, the microwells being sized to capture at least two droplets. The system can be provided as a kit.

In one aspect, the embodiments disclosed herein are directed to a method of detecting a target nucleic acid in a sample. The method disclosed herein is, in some embodiments, a step of producing a first set of droplets, where each droplet in the first set of droplets is at least one target molecule. And a step that includes an optical barcode; a second set of droplets, each droplet of which is bound to an RNA target effector protein and a corresponding target molecule. A step and; a first set and a second set of droplets, including one or more guide RNAs, RNA-based masking constructs, and optionally a detection CRISPR system containing an optical bar code. A step of combining to form a pool of droplets and flowing the pool of combined droplets onto a microfluidic device containing an array of microwells and at least one flow channel under the microwells, wherein the microwells are at least. A step that is sized to capture two droplets; a step that captures the droplets in the microwells and a step that detects the optical barcode of the droplets captured in each microwell; the droplets captured in each microwell. To the merged droplets formed in each microwell, wherein at least a subset of the merged droplets comprises a detection CRISPR system and a target sequence; a step of initiating a detection reaction. obtain. The merged droplets are then maintained under conditions sufficient to bind one or more guide RNAs to one or more target molecules. When one or more guide RNAs bind to the target nucleic acid, they in turn activate the CRISPR effector protein. Upon activation, the CRISPR effector protein inactivates the masking construct, for example by cleaving the masking construct so that a detectable positive signal is unmasked, released, or produced. The detectable signal of each merged droplet can be detected and measured in one or more time cycles, eg, the presence of a positive detectable signal indicates the presence of a target molecule.

In certain embodiments, the system is highly targeted to a single sample and a second set of barcodes is either unnecessary or optional. In certain embodiments, advanced, improved, or more powerful preamplification methods allow the omission of optical barcodes within a set of droplets. Therefore, the optical barcode within the set of droplets is optional and can be included, among other variable elements, depending on the particular application, such as sample quality, target specificity, preamplification technique, etc. ..

Multiple Detection System Multiplex systems are also disclosed, including RNA target effector proteins, and one or more guide RNAs designed to bind to the corresponding target molecule, RNA-based masking constructs, and one or more target molecule optical barcodes. The microfluidic device comprises an array of microwells and at least one flow channel under the microwells, including a detection CRISPR system that includes an optical bar code that is. In an embodiment, the microwell is sized to capture at least two droplets.

In general, the CRISPR-Cas, or CRISPR system, is used herein and in documents such as WO2014 / 093622 (PCT / US2013 / 074667) and is a sequence encoding the Cas gene, tracr (trans activity). CRISPR) sequences (eg, tracrRNA or active partial tracrRNA), tracr-mate sequences (including "direct repeats" in the context of endogenous CRISPR systems and partial direct repeats treated with tracrRNA), guide sequences (intrinsic). Also referred to as "spacer" in the context of CRISPR systems), or "RNA (s)" as the term is used herein (eg, Cass-guided RNAs such as Cas9 (s), such as CRISPR RNA and Expression or induction of activity of CRISPR-related (“Cas”) genes, including trans-activated (tracr) RNA or single-guide RNA (sgRNA) (chimeric RNA)) or other sequences and transcripts from the CRISPR locus. Collectively refers to transcripts and other elements involved in. Generally, the CRISPR system is characterized by an element that promotes the formation of a CRISPR complex at the site of the target sequence (also called a protospacer in the context of the endogenous CRISPR system).

RNA Target Cas Protein If the Cas protein is a C2c2 protein, tracrRNA is not needed. C2c2 is described in Abdayyeh et al. (2016) “C2c2 is a single-component prober RNA-guided RNA-targeting CRISPR effector”; Science; DOI: 10.1126 / science. aaf5573 and Shmakov et al. (2015) “Discovery and characterization of Diverse Class 2 CRISPR-Cas Systems”, Molecular Cell, DOI: dx. doi. org / 10.1016 / j. molcel. Described by 2015.10.08, these are all incorporated herein by reference. Cas13b is described in Smargon et al. (2017) “Cas13b Is a Type VI-B CRISPR-Associated RNA-Guided RNases Differentially Regulated by Accessory Proteins Csx27 and Csx28,” Molecular C. 65, 1-13; dx. doi. org / 10.1016 / j. molcel. 2016.12.023, the entire contents of which are incorporated herein by reference. CRISPR effector proteins are described in International Application No. PCT / US2017 / 0654777, Tables 1-6, pages 40-52, and can be used in the methods, systems, and devices disclosed herein, by reference. Specifically incorporated herein.

The two or more CRISPR systems can be RNA target proteins, DNA target effector proteins, or a combination thereof. The RNA target protein can be a Cas13 protein such as Cas13a, Cas13b, or Cas13c. The DNA target protein can be a Cas12 protein such as Cpf1 and C2c1.

Cpf1 ortholog The present invention includes the use of a Cpf1 effector protein derived from the Cpf1 locus represented as subtype VA. As used herein, such effector proteins are also referred to as "Cpf1p", eg, Cpf1 proteins (and such effector proteins or Cpf1 proteins or proteins derived from the Cpf1 locus are also referred to as "CRISPR enzymes". Called). Currently, subtype VA loci include different genes called casl, cas2, Cpf1 and CRISPR arrays. Cpf1 (CRISPR-related protein Cpf1, subtype PREFRAN) is a large protein (approximately 1300 amino acids) that contains a RuvC-like nuclease domain homologous to the corresponding domain of Cas9 and a domain corresponding to the characteristic arginine-rich cluster of Cas9. .. However, Cpf1 lacks the HNH nuclease domain present in all Cas9 proteins, and in contrast to Cas9, which contains long insertions containing the HNH domain, the Cpf1 sequence is contiguous with the RuvC-like domain. Therefore, in certain embodiments, the CRISPR-Cas enzyme comprises only the RuvC-like nuclease domain.

Also, the programmable, specificity, and concomitant activity of RNA-induced Cpf1 makes it an ideal switchable nuclease for non-specific cleavage of nucleic acids. In one embodiment, the Cpf1 system is engineered to provide and utilize the accompanying non-specific cleavage of RNA. In another embodiment, the Cpf1 system is engineered to provide and utilize the associated non-specific cleavage of ssDNA. Therefore, the manipulated Cpf1 system provides a platform for nucleic acid detection and transcriptome manipulation. Cpf1 was developed for use as a knockdown and binding tool for mammalian transcripts. Cpf1 is capable of strong concomitant cleavage of RNA and ssDNA when activated by sequence-specific targeted DNA binding.

The terms "orthologue" (also referred to herein as "ortholog") and "homlog" (also referred to herein as "homologue") are well known in the art. Is. As additional guidance, a protein "homolog" as used herein is a protein of the same species that performs the same or similar function as a protein in a homologous relationship. Homological proteins are possible, but do not need to be structurally related, or their structural relevance is only partial. As used herein, a "ortholog" of a protein is a different species of protein that performs the same or similar function as a protein in an ortholog relationship. Orthologous proteins are possible, but do not need to be structurally related, or their structural relevance is only partial. Homologs and orthologs can be identified by homology modeling (eg, Greer, Structure vol. 228 (1985) 1055 and Blundell et al. Eur J Biochem vol 172 (1988), 513) or "trutical BLAST" (DeyF). , Cliff Zhang Q, Perry D, Hong B. Towerd a “Structural BLAST”: using structural resonances to infer faction. Protein Sci. 2013 Apr; 22. Please refer to). For applications in the field of the CRISPR-Cas locus, see Shmakov et al. See also (2015). Homological proteins are possible, but do not need to be structurally related, or their structural relevance is only partial.

The Cpf1 gene is found in several diverse bacterial genomes and is usually at the same locus as the CAS, cas2, and cass4 genes as well as the CRISPR cassette (eg, Francisella cf. novicida Fx1 FNFX1-1431-FNFX1-1428). Therefore, the arrangement of this presumed novel CRISPR-Cas system appears to be similar to that of type II-B. In addition, like Cas9, the Cpf1 protein contains an easily identifiable C-terminal region that is homologous to the transposon ORF-B, as well as an active RuvC-like nuclease, an arginine-rich region, and a Zn finger (present in Cas9). Does not include). However, unlike Cas9, Cpf1 is also present in some genomes that do not contain the CRISPR-Cas configuration and has a relatively high similarity to ORF-B, so it may be a transposon component. It is suggested. If this is a true CRISPR-Cas system, it has been suggested that Cpf1 is a functional analog of Cas9 and will be a novel CRISPR-Cas type (ie, V type) (Annotation and Classification of CRISPR-Cas Systems). . Makarova KS, Koonin EV. Methods Mol Biol. 2015; 1311: 47-75). However, as described herein, Cpf1 is referred to as the VA subtype to distinguish it from C2c1p which does not have the same domain structure, and thus C2c1p is referred to as the VB subtype. To.

In certain embodiments, the effector protein, Streptococcus, Campylobacter, Nitratifractor, Staphylococcus, Parvibaculum, Roseburia, Neisseria, Gluconacetobacter, Azospirillum, Sphaerochaeta, Lactobacillus, Eubacterium, Corynebacter, Carnobacterium, Rhodobacter, Listeria, Paludibacter, Clostridium, Lachnospiraceae, Clostridiaridium, Leptotrichia, a Francisella, Legionella, Alicyclobacillus, Methanomethyophilus, Porphyromonas, Prevotella, Bacteroidetes, Helcococcus, Letospira, Desulfovibrio, Desulfonatronum, Opitutaceae, Tuberibacillus, Bacillus, Brevibacilus, Cpf1 effector proteins derived from an organism from the genus including Methylobacterium or Acidaminococcus.

In a further specific embodiment, the Cpf1 effector protein is S.I. Mutans, S.M. agalactiae, S.A. equimimilis, S. sanguinis, S.A. pneumonia; C.I. jejuni, C.I. colli; N. salsuginis, N. et al. tergarcus; S. auricalis, S.A. carnosus; N. Mentingitides, N.M. gonorroea; L. gonorrhoeae. monocytogenes, L. ivanovii; C.I. Botulinum, C.I. Difficile, C.I. tetany, C.I. Derived from an organism selected from sordellii.

The effector protein comprises a first fragment derived from a first effector protein (eg, Cpf1) ortholog and a second fragment derived from a second effector protein (eg, Cpf1) ortholog. The effector protein ortholog and the second effector protein ortholog may contain different chimeric effector proteins. At least one of a first effector protein (eg, Cpf1) ortholog and a second effector protein (eg, Cpf1) ortholog is Streptococcus, Campylobacter, Nitratifragtor, Staphylococcus, Parvibaculum, Rose. , Lactobacillus, Eubacterium, Corynebacter, Camobacterium, Rhodobacter, Listeria, Paludibacter, Clostridium, Lachnospiraceae, Clostridiaridium, Leptotrichia, Francisella, Legionella, Alicyclobacillus, Methanomethyophilus, Porphyromonas, Prevotella, Bacteroidetes, Helcococcus, Letospira, Desulfovibrio, Desulfonatronum, Opitutaceae, Tuberibacillus, Bacillus Can include effector proteins (eg, Cpf1) from organisms including, Brevibacillus, Metylobactium or Acidaminococcus; for example, the chimeric effector protein comprises a first fragment and a second fragment, a first fragment and a second fragment. each, Streptococcus, Campylobacter is, Nitratifractor, Staphylococcus, Parvibaculum, Roseburia, Neisseria, Gluconacetobacter, Azospirillum, Sphaerochaeta, Lactobacillus, Eubacterium, Corynebacter, Camobacterium, Rhodobacter, Listeria, Paludibacter, Clostridium, Lachnospiraceae, Clostridiaridium, Leptotrichia, Francisella, Legionella, Alicyclobacillus , M ethanomethyophilus, Porphyromonas, Prevotella, Bacteroidetes, Helcococcus, Letospira, Desulfovibrio, Desulfonatronum, Opitutaceae, Tuberibacillus, Bacillus, Brevibacilus, selected from Cpf1 organisms including Methylobacterium or Acidaminococcus, the first fragment and the second fragment, the same bacteria Not derived from. For example, the chimeric effector protein comprises a first fragment and a second fragment, the first fragment and the second fragment being S.I. Mutans, S.M. agalactiae, S.A. equimimilis, S. sanguinis, S.A. pneumonia, C.I. jejuni, C.I. colli, N.M. salsuginis, N. et al. tergarcus, S.M. auricalis, S.A. carnosus, N. et al. Mentingitides, N.M. gonorroea, L. monocytogenes, L. ivanovii, C.I. Botulinum, C.I. Difficile, C.I. tetany, C.I. sordellii, Francisella tularensis 1, Prevotella albensis, Lachnospiraceae bacterium MC2017 1, Butyrivibrio proteoclasticus, Peregrinibacteria bacterium GW2011_GWA2_33_10, Parcubacteria bacterium GW2011_GWC2_44_17, Smithella sp. SCADC, Acidaminococcus sp. BV3L6, Lachnospiraceae bacterium MA2020, Candidatus Methanoplasma termitum, Eubacterium eligens, Moraxella bovoculi 237, Leptospira inadai, are selected from Lachnospiraceae bacterium ND2006, Porphyromonas crevioricanis 3, Prevotella disiens of and Porphyromonas macacae Cpf1, the first fragment and the second fragment, Not derived from the same bacteria.

In a more preferred embodiment, Cpf1p is, Francisella tularensis 1, Prevotella albensis, Lachnospiraceae bacterium MC2017 1, Butyrivibrio proteoclasticus, Peregrinibacteria bacterium GW2011_GWA2_33_10, Parcubacteria bacterium GW2011_GWC2_44_17, Smithella sp. SCADC, Acidaminococcus sp. BV3L6, Lachnospiraceae bacterium MA2020, Candidatus Methanoplasma termitum, Eubacterium eligens, Moraxella bovoculi 237, Leptospira inadai, from Lachnospiraceae bacterium ND2006, Porphyromonas crevioricanis 3, Prevotella disiens and bacterial species selected from Porphyromonas macacae. In certain embodiments, Cpf1p is defined as Acidaminococcus sp. It is derived from a bacterial species selected from BV3L6, Lachnospiraceae bacterium MA2020. In certain embodiments, the effector protein is derived from a variant of Francisella tularensis 1, and is not limited to, but is limited to, Francisella tularensis subspecies. Novicida is included.

In some embodiments, Cpf1p is derived from an organism from Eubacterium. In some embodiments, the CRISPR effector protein is a Cpf1 protein derived from an organism derived from a bacterial species of Eubacterium rectale. In some embodiments, the amino acid sequence of the Cpf1 effector protein corresponds to NCBI reference sequence WP_05522523.1, NCBI reference sequence WP_05523726.01, NCBI reference sequence WP_0552272206.1, or GenBank ID OLA16049.1. In some embodiments, the Cpf1 effector protein is at least 60% with NCBI reference sequence WP_05522523.1, NCBI reference sequence WP_055237260.1, NCBI reference sequence WP_0552272206.1, or at least 60%, more specifically at least 70. %, For example, at least 80%, more preferably at least 85%, even more preferably at least 90%, for example at least 95% sequence homology or sequence identity. One of skill in the art will appreciate that this comprises a shortened form of the Cpf1 protein, whereby sequence identity is determined over the length of the shortened form. In some embodiments, the Cpf1 effector recognizes the PAM sequence of TTTN or CTTN.

In certain embodiments, as referred to herein, the homolog or ortholog of Cpf1 is at least 80%, more preferably at least 85%, even more preferably at least 90%, eg, at least 95%, sequence of Cpf1. Has homology or sequence identity. In a further embodiment, as referred to herein, the homolog or ortholog of Cpf1 is at least 80%, more preferably at least 85%, even more preferably at least 90%, eg, at least 95% of wild-type Cpf1. Has sequence identity. When Cpf1 has (mutates) one or more mutations, when referred to herein, the homolog or ortholog of the Cpf1 is at least 80%, more preferably at least 85%, more preferably at least 85% with the variant Cpf1. More preferably, it has at least 90%, eg, at least 95%, sequence identity.

In one embodiment, the Cpf1 protein can be an ortholog of an organism of a genus, including, but not limited to, the Acidaminococcus sp, Lachnospiraceae bacterium or Moraxella bovoculi. In certain embodiments, the V-type Cas protein can be the ortholog of an organism of one species, including, but not limited to, the Acidaminococcus sp. Includes BV3L6, Lachnospiraceae bacteria ND2006 (LbCpf1) or Moraxella bovoculi 237. In certain embodiments, as referred to herein, the homolog or ortholog of Cpf1 is at least 80%, more preferably at least 85%, with one or more of the Cpf1 sequences disclosed herein. More preferably, it has at least 90%, eg, at least 95%, sequence homology or sequence identity. In a further embodiment, as referred to herein, the homolog or ortholog of Cpf is at least 80%, more preferably at least 85%, even more preferably at least 90%, eg, wild-type FnCpf1, AsCpf1, or LbCpf1. , Have at least 95% sequence identity.

In certain embodiments, the Cpf1 protein of the invention is at least 60%, more particularly at least 70%, such as at least 80%, more preferably 85%, even more preferably at least 90% with FnCpf1, AsCpf1, or LbCpf1. For example, it has at least 95% sequence homology or sequence identity. In a further embodiment, as referred to herein, the Cpf1 protein is at least 60%, eg, at least 70%, more particularly at least 80%, more preferably at least 85%, even more, with wild-type AsCpf1 or LbCpf1. It preferably has at least 90%, eg, at least 95%, sequence identity. In certain embodiments, the Cpf1 proteins of the invention have at least less than 60% sequence identity with FnCpf1. Those of skill in the art will appreciate that this comprises a shortened form of the Cpf1 protein, whereby sequence identity is determined over the length of the shortened form.

In the following specific ones, the Cpf1 amino acid is followed by a nuclear localization signal (NLS) (italic), a glycine-serine (GS) linker, and a 3 × HA tag. 1-Francisella tularensis subsp. novicida U112 (FnCpf1); 3-Lachnospiraceae bacterium MC2017 (Lb3Cpf1); 4-Butyri vibrio proteoclasticus (BpCpf1); 5-Peregrinibacteria bacterium GW2011_GWA_33_10 (PeCpf1); 6-Parcubacteria bacterium GWC2011_GWC2_44_17 (PbCpf1); 7-Smithella sp. SC_K08D17 (SsCpf1); 8-Acidaminococcus sp. BV3L6 (AsCpf1); 9-Lachnospiraceae bacterium MA2020 (Lb2Cpf1); 10-Candidatus Methanoplasma termitum (CMtCpf1); 11-Eubacterium eligens (EeCpf1); 12-Moraxella bovoculi 237 (MbCpf1); 13-Leptospira inadai (LiCpf1); 14- Lachnospiraceae bacterium ND2006 (LbCpf1); 15-Porphylomanas reviolicanis (PcCpf1); 16-Prevotella disiens (PdCpf1); XS5 (TsCpf1); 19-Moraxella bovoculi AAX08_00205 (Mb2Cpf1); 20-Moraxella bovoculi AAX11_00205 (Mb3Cpf1); and 21-Butylivrio sp. NC3005 (BsCpf1).

Further Cpf1 orthologs include NCBI WP_05522523.1, NCBI WP_05523726200.1, NCBI WP_0552272206.1, and GenBank OLA16049.1.

C2c1 ortholog The present invention includes the use of a C2c1 effector protein derived from the C2c1 locus represented as subtype V-B. As used herein, such effector proteins are also referred to as "C2c1p", eg, C2c1 proteins (and such effector proteins or C2c1 proteins or proteins derived from the C2c1 locus are also referred to as "CRISPR enzymes". Called). Currently, the subtype V-B locus includes a casl-Cas4 fusion, a different gene called cas2, C2c1, and a CRISPR array. C2c1 (CRISPR-related protein C2c1) is a large protein (approximately 1100-1300 amino acids) that contains a RuvC-like nuclease domain homologous to the corresponding domain of Cas9 and a domain corresponding to the characteristic arginine-rich cluster of Cas9. However, C2c1 lacks the HNH nuclease domain present in all Cas9 proteins, and in contrast to Cas9, which contains long insertions containing the HNH domain, the C2c1 sequence is contiguous with the RuvC-like domain. Therefore, in certain embodiments, the CRISPR-Cas enzyme comprises only the RuvC-like nuclease domain.

The C2c1 (also called Cas12b) protein is an RNA-inducing nuclease. The cleavage depends on the tracr RNA and recruits the guide RNA containing the guide sequence and the direct repeat, and the guide sequence hybridizes with the target nucleotide sequence to form a DNA / RNA heteroduplex. Based on current studies, C2c1 nuclease activity also needs to be dependent on recognition of PAM sequences. The C2c1 PAM sequence is a T-rich sequence. In some embodiments, the PAM sequence is 5'TTN3'or 5'ATTN3', where N is any nucleotide. In certain embodiments, the PAM sequence is 5'TTC3'. In certain embodiments, the PAM is in the sequence of Plasmodium falciparum.

C2c1 creates a staggered cut at the target locus with a 5'overhang, or "protruding end", distal to the PAM of the target sequence. In some embodiments, the 5'overhang is 7 nt. Lewis and Ke, Mol Cell. See 2017 Feb 2; 65 (3): 377-379.

The present invention provides C2c1 (type VB; Cas12b) effector proteins and orthologs. The terms "orthologue" (also referred to herein as "ortholog") and "homlogue" (also referred to herein as "homolog") are well known in the art. Is. As additional guidance, a protein "homolog" as used herein is a protein of the same species that performs the same or similar function as a protein in a homologous relationship. Homological proteins are possible, but do not need to be structurally related, or their structural relevance is only partial. As used herein, a "ortholog" of a protein is a different species of protein that performs the same or similar function as a protein in an ortholog relationship. Orthologous proteins are possible, but do not need to be structurally related, or their structural relevance is only partial. Homologs and orthologs can be identified by homology modeling (eg, Greer, Structure vol. 228 (1985) 1055 and Blundell et al. Eur J Biochem vol 172 (1988), 513) or "Structural BLAST" (DeyF). , Cliff Zhang Q, Perry D, Hong B. Towerd a “Structural BLAST”: using structural resonances to infer faction.Protein Sci.2013 / 22. Please refer to). For applications in the field of the CRISPR-Cas locus, see Shmakov et al. See also (2015). Homological proteins are possible, but do not need to be structurally related, or their structural relevance is only partial.

The C2c1 gene is found in several diverse bacterial genomes and is usually located at the same locus as the casl, cas2, and cas4 genes as well as the CRISPR cassette. Therefore, the arrangement of this presumed novel CRISPR-Cas system appears to be similar to that of type II-B. In addition, like Cas9, the C2c1 protein contains an active RuvC-like nuclease, an arginine-rich region, and a Zn finger (not present in Cas9).

In certain embodiments, effector proteins, Alicyclobacillus, Desulfovibrio, Desulfonatronum, Opitutaceae, Tuberibacillus, Bacillus, Brevibacillus, Candidatus, Desulfatirhabdium, Citrobacter, Elusimicrobia, Methylobacterium, Omnitrophica, Phycisphaerae, Planctomycetes, organisms from the genera comprising Spirochaetes, and Verrucomicrobiaceae It is a C2c1 effector protein derived from.

In a further embodiment, C2C1 effector proteins, Alicyclobacillus acidoterrestris (e.g., ATCC 49025), Alicyclobacillus contaminans (e.g., DSM 17975), Alicyclobacillus macrosporangiidus (e.g., DSM 17980), Bacillus hisashii strain C4, Candidatus Lindowbacteria bacterium RIFCSPLOWO2, Desulfovibrio inopinatus ( For example, DSM 10711), Desulfonatronum thiodismutans (e.g., strain MLF-1), Elusimicrobia bacterium RIFOXYA12, Omnitrophica WOR_2 bacterium RIFCSPHIGHO2, Opitutaceae bacterium TAV5, Phycisphaerae bacterium ST-NAGAB-D1, Planctomycetes bacterium RBG_13_46_10, Spirochaetes bacterium GWB1_27_13, Verrucomicrobiaceae bacterium UBA2429, Tubelibacillus calidus (eg, DSM 17572), Bacteria thermomylovorans (eg, strain B4166), Brevibacillus sp. CF112, Bacillus sp. NSP2.1, Desulfatirbdium butylativorans (eg, DSM 18734), Alicyclobacillus herbarius (eg, DSM 13609), Citrobacter freundii (eg, ATCC 8090), Brevibacillus, eg, Brevibacillus Derived from the species selected.

The effector protein comprises a first fragment derived from a first effector protein (eg, C2c1) ortholog and a second fragment derived from a second effector protein (eg, C2c1) ortholog. The effector protein ortholog and the second effector protein ortholog may contain different chimeric effector proteins. First and second effector proteins (e.g., C2C1) at least one of the orthologs, Alicyclobacillus, Desulfovibrio, Desulfonatronum, Opitutaceae, Tuberibacillus, Bacillus, Brevibacillus, Candidatus, Desulfatirhabdium, Elusimicrobia, Citrobacter, Methylobacterium, Omnitrophicai, Phycisphaerae, It may contain an organism-derived effector protein (eg, C2c1), including Planctomycetota, Spirochaetes, and Verucomimicrobiotae. For example, the chimeric effector protein comprises a first fragment and a second fragment, the first fragment and the second fragment being Alicyclobacillus, Desulfobibrio, Desulfonatronum, Optitaskae, Tuberibacillus, Bacillus, Brevibacillus, respectively. , Methylobacterium, Omnitropiciai, Phycisphaerae, Planctomycetota, Spirochaetes, and Verrucomimicrobiotae, selected from C2c1 of organisms, the first fragment and the second fragment are not derived from the same bacterium. For example, the chimeric effector protein comprises a first fragment and a second fragment, the first fragment and the second fragment being Alicyclobacillus acidoterrestris (eg, ATCC 49025), Alicyclobacillus contaminens (eg, DSM 17975), Alicyclobacillus, respectively. For example, DSM 17980), Bacillus hisashii strain C4, Candidatus Lindowbacteria bacterium RIFCSPLOWO2, Desulfovibrio inopinatus (e.g., DSM 10711), Desulfonatronum thiodismutans (e.g., strain MLF-1), Elusimicrobia bacterium RIFOXYA12, Omnitrophica WOR_2 bacterium RIFCSPHIGHO2, Opitutaceae bacterium TAV5, Phycisphaerae bacterium ST-NAGAB-D1, Planctomycetes bacterium RBG_13_46_10, Spirochaetes bacterium GWB1_27_13, Verrucomicrobiaceae bacterium UBA2429, Tuberibacillus calidus (e.g., DSM 17572), Bacillus thermoamylovorans (e.g., strain B4166), Brevibacillus sp. CF112, Bacillus sp. NSP2.1, Desulfatirbdium butyrativorans (eg, DSM 18734), Alicyclobacillus herbarius (eg, DSM 13609), Citrobacter freundii (eg, ATCC 8090), Brevibacillus, eg, Brevibacillus, Brevibacillus Selected from C2c1, the first and second fragments are not derived from the same bacterium.

In a more preferred embodiment, C2c1p is, Alicyclobacillus acidoterrestris (e.g., ATCC 49025), Alicyclobacillus contaminans (e.g., DSM 17975), Alicyclobacillus macrosporangiidus (e.g., DSM 17980), Bacillus hisashii strain C4, Candidatus Lindowbacteria bacterium RIFCSPLOWO2, Desulfovibrio inopinatus (e.g. , DSM 10711), Desulfonatronum thiodismutans (e.g., strain MLF-1), Elusimicrobia bacterium RIFOXYA12, Omnitrophica WOR_2 bacterium RIFCSPHIGHO2, Opitutaceae bacterium TAV5, Phycisphaerae bacterium ST-NAGAB-D1, Planctomycetes bacterium RBG_13_46_10, Spirochaetes bacterium GWB1_27_13, Verrucomicrobiaceae bacterium UBA2429, Tuberibacillus calidus (eg, DSM 17572), Bacteria thermomyloverans (eg, strain B4166), Brevibacillus sp. CF112, Bacillus sp. NSP2.1, Desulfatirbdium butyrativorans (eg, DSM 18734), Alicyclobacillus herbarius (eg, DSM 13609), Citrobacter freundii (eg, ATCC 8090), Brevibacillus, eg, Brevibacillus Derived from the selected bacterial species. In certain embodiments, C2c1p is derived from a bacterial species selected from Alicyclobacillus acidoterrestris (eg, ATCC 49025), Alicyclobacillus contaminens (eg, DSM 17975).

In certain embodiments, as referred to herein, the homolog or ortholog of C2c1 is at least 80%, more preferably at least 85%, even more preferably at least 90%, eg, at least 95%, sequence of C2c1. Has homology or sequence identity. In a further embodiment, as referred to herein, the homolog or ortholog of C2c1 is at least 80%, more preferably at least 85%, even more preferably at least 90%, eg, at least 95% of wild-type C2c1. Has sequence identity. When C2c1 has (mutates) one or more mutations, when referred to herein, the homolog or ortholog of the C2c1 is at least 80%, more preferably at least 85%, more preferably at least 85% with the variant C2c1. More preferably, it has at least 90%, eg, at least 95%, sequence identity.

In one embodiment, C2C1 protein is not limited Alicyclobacillus, Desulfovibrio, Desulfonatronum, Opitutaceae, Tuberibacillus, Bacillus, Brevibacillus, Candidatus, Desulfatirhabdium, Elusimicrobia, Citrobacter, Methylobacterium, Omnitrophicai, Phycisphaerae, Planctomycetes, the Spirochaetes, and including Verrucomicrobiaceae these It can be an ortholog of a genus of organisms. In certain embodiments, V type Cas proteins, Alicyclobacillus acidoterrestris (e.g., ATCC 49025), Alicyclobacillus contaminans (e.g., DSM 17975), Alicyclobacillus macrosporangiidus (e.g., DSM 17980), Bacillus hisashii strain C4, Candidatus Lindowbacteria bacterium RIFCSPLOWO2, Desulfovibrio Inopinatus (e.g., DSM 10711), Desulfonatronum thiodismutans (e.g., strain MLF-1), Elusimicrobia bacterium RIFOXYA12, Omnitrophica WOR_2 bacterium RIFCSPHIGHO2, Opitutaceae bacterium TAV5, Phycisphaerae bacterium ST-NAGAB-D1, Planctomycetes bacterium RBG_13_46_10, Spirochaetes bacterium GWB1_27_13, Verrucomicrobiaceae bacterium UBA2429, Tubibacillus calidus (eg, DSM 17572), Bactillus thermomyloverans (eg, strain B4166), Brevibacillus sp. CF112, Bacillus sp. NSP2.1, Desulfitirhabdium butylativorans (eg, DSM 18734), Alicyclobacillus herbarius (eg, DSM 13609), Citrobacter freundii (eg, ATCC 8090), Brevibacillus, eg, Brevibacillus, Brevibacillus It can be an ortholog of organisms of species including, but not limited to, these. In certain embodiments, as referred to herein, the homolog or ortholog of C2c1 is at least 80%, more preferably at least 85%, with one or more of the C2c1 sequences disclosed herein. More preferably, it has at least 90%, eg, at least 95%, sequence homology or sequence identity. In a further embodiment, as referred to herein, the homolog or ortholog of C2c1 is at least 80%, more preferably at least 85%, even more preferably at least 90%, eg, at least at least with wild-type AacC2c1 or BthC2c1. Has 95% sequence identity.

In certain embodiments, the C2c1 protein of the invention is at least 60%, more particularly at least 70%, more preferably at least 80%, more preferably 85%, even more preferably at least 90%, eg, AacC2c1 or BthC2c1. Have at least 95% sequence homology or sequence identity. In a further embodiment, as referred to herein, the C2c1 protein is at least 60%, eg, at least 70%, more specifically at least 80%, more preferably at least 85%, even more preferably wild-type AacC2c1. It has at least 90%, eg, at least 95%, sequence identity. In certain embodiments, the C2c1 protein of the invention has at least less than 60% sequence identity with AacC2c1. Those of skill in the art will appreciate that this comprises a shortened form of the C2c1 protein, whereby sequence identity is determined over the length of the shortened form.

In the particular method of the invention, the CRISPR-Cas protein is associated with the corresponding wild-type enzyme such that the mutant CRISPR-Cas protein lacks the ability to cleave one or both DNA strands of the target locus containing the target sequence. On the other hand, it is preferably mutated. In certain embodiments, one or more catalytic domains of the C2c1 protein are mutated to produce a mutant Cas protein that cleaves only one DNA strand of the target sequence.

In certain embodiments, the CRISPR-Cas protein may be mutated against the corresponding wild-type enzyme such that the mutated CRISPR-Cas protein lacks substantially all DNA cleavage activity. In some embodiments, the cleavage activity of the mutant enzyme is about 25%, 10%, 5%, 1%, 0.1%, 0.01%, or less than the non-mutant nucleic acid cleavage activity of the enzyme. If so, the CRISPR-Cas protein is considered to be substantially devoid of all DNA and / or RNA cleavage activity. An example may be when the mutant nucleic acid cleavage activity is zero or negligible compared to the non-mutant.

In certain embodiments of the methods provided herein, the CRISPR-Cas protein is a mutant CRISPR-Cas protein that cleaves only one DNA strand, i.e., a nickase. More specifically, in the context of the present invention, the nickase is on a non-target sequence, i.e., the DNA strand opposite the target sequence, ensuring cleavage within the 3'sequence of the PAM sequence. With further guidance, the substitution of arginine for alanine (R911A) in the Nuc domain of C2c1 from Alicyclobacillus acidoterrestris leads to C2c1 from a nuclease that cleaves both strands to a nicase (cleaves a single strand). Convert. It will be appreciated by those skilled in the art that if the enzyme is not AacC2c1, mutations can occur at the residue at the corresponding position.
In certain embodiments, the C2c1 protein is a catalytically inactive C2c1 containing a mutation in the RuvC domain. In some embodiments, the catalytically inert C2c1 protein comprises a mutation corresponding to the amino acid position D570, E848, or D977 of C2c1 of Alicyclobacillus acidoterrestris. In some embodiments, the catalytically inert C2c1 protein comprises a mutation corresponding to D570A, E848A, or D977A of C2c1 of Alicyclobacillus acidoterrestris.
Also, the programmable, specificity, and concomitant activity of RNA-induced C2c1 makes it an ideal switchable nuclease for non-specific cleavage of nucleic acids. In one embodiment, the C2c1 system is engineered to provide and utilize the accompanying non-specific cleavage of RNA. In another embodiment, the C2c1 system is engineered to provide and utilize the associated non-specific cleavage of ssDNA. Therefore, the engineered C2c1 system provides a platform for nucleic acid detection and transcriptome manipulation and induces cell death. C2c1 was developed for use as a knockdown and binding tool for mammalian transcripts. When activated by sequence-specific targeted DNA binding, C2c1 is capable of strong concomitant cleavage of RNA and ssDNA.
In certain embodiments, C2c1 is transiently or stably donated or expressed in an in vitro system or cell and is targeted or induced to cleave cellular nucleic acids non-specifically. In one embodiment, C2c1 is engineered to knock down ssDNA, eg, viral ssDNA. In another embodiment, C2c1 is engineered to knock down RNA. Systems can be devised such that knockdown depends on the target DNA present in the cell or in vitro system, or is caused by the addition of the target nucleic acid to the system or cell.
In one embodiment, the C2c1 system non-specifically cleaves RNA in a subset of cells distinguishable by the presence of aberrant DNA sequences, for example, if abnormal DNA cleavage may be incomplete or ineffective. It is operated to do. In one non-limiting example, DNA translocations that are present in cancer cells and promote cell transformation are targeted. Although chromosomal DNA and subpopulations of cells undergoing repair can survive, non-specific concomitant ribonuclease activity favors cell death of potential survivors.
Recently, an accompanying activity has been utilized in a sensitive and specific nucleic acid detection platform called SHERLOCK, which is useful for many clinical diagnoses (Goodenberg, J.S. et al. Nucleic acid detection with CRISPR-cas13a / C2c2.Science). 356,438-442 (2017)).
According to the invention, the engineered C2c1 system is optimized for DNA or RNA endonuclease activity, expressed in mammalian cells and effectively knocked down intracellular reporter molecules or transcripts. Can be targeted.
In certain embodiments, the protospacer flanking motif (PAM) or PAM-like motif dictates the binding of the effector protein complex disclosed herein to the target locus of interest. In some embodiments, the PAM can be a 5'PAM (ie, located upstream of the 5'end of the protospacer). In other embodiments, the PAM can be a 3'PAM (ie, located downstream of the 5'end of the protospacer). The term "PAM" may be used interchangeably with the terms "PFS" or "protospacer flanking sites" or "protospacer flanking sequences".
In a preferred embodiment, the CRISPR effector protein may recognize 3'PAM. In certain embodiments, the CRISPR effector protein may recognize 3'PAM, which is 5'H, where H is A, C or U. In certain embodiments, the effector protein may be C2c2p of Reptotricia shahii, more preferably C2c2 of Leptotricia shahii DSM 19757, where 3'PAM is 5'H.
In the context of CRISPR complex formation, "target sequence" refers to a sequence in which the guide sequence is designed to have complementarity, and hybridization between the target sequence and the guide sequence facilitates the formation of the CRISPR complex. The target sequence may include RNA polynucleotides. The term "target RNA" refers to an RNA polynucleotide that is or contains a target sequence. In other words, the target RNA is an RNA polynucleotide that is designed so that a portion of the gRNA, i.e., the guide sequence, has complementarity to which the effector function mediated by the complex containing the CRISPR effector protein and the gRNA is dictated. Or it can be part of an RNA polynucleotide. In some embodiments, the target sequence is located in the nucleus or cytoplasm of the cell.

The CRISPR effector protein, in particular the nucleic acid molecule encoding C2c2, is advantageously a codon-optimized CRISPR effector protein. Examples of codon-optimized sequences are, in this case, sequences optimized for expression in eukaryotes, eg, humans (ie, optimized for human expression), or herein. An array for another eukaryote, animal or mammal discussed in the book. See, for example, the SaCas9 human codon-optimized sequence of WO2014 / 093622 (PCT / US2013 / 074667). This is preferred, but other examples are possible and it will be appreciated that codon optimization for non-human host species, or codon optimization for specific organs, is known. In some embodiments, the enzyme coding sequence encoding the CRISPR effector protein is a codon optimized for expression in a particular cell, such as an eukaryotic cell. Eukaryotic cells include human or non-human eukaryotes, or the animals or mammals discussed herein, such as mice, rats, rabbits, dogs, domestic animals, or non-human mammals or primates. It can be, or is derived from, a particular organism such as a plant or mammal, not limited to these. In some embodiments, the process of altering the genetic identity of a human germline and / or the genetic identity of an animal that can cause distress without providing substantial medical benefit to the human or animal. Processes that alter sex, and the animals that result from such processes, can be excluded. In general, codon optimization involves at least one codon of the natural sequence (eg, about 1, 2, 3, 4, 5, 10, 15, 20, 25, 50, or more codons) of the natural amino acid. Refers to the process of modifying a nucleic acid sequence for enhanced expression in a host cell of interest by replacing it with a codon that is more frequently or most frequently used in the gene of that host cell while maintaining the sequence. Various species show a particular bias towards a particular codon of a particular amino acid. Codon bias (difference in codon usage between organisms) often correlates with the translation efficiency of messenger RNA (mRNA), which also, among other things, the properties of the codons being translated and the particular transfer RNA (tRNA). It is believed to depend on the availability of the molecule. The predominance of selected tRNAs in the cell reflects the codons commonly used most frequently in peptide synthesis. Therefore, genes may be adjusted for optimal gene expression in a particular organism based on codon optimization. The codon usage table is, for example, kazusa. It is readily available at "Codon Usage Database" at orjp / codon / and these tables can be adapted in a number of ways. Nakamura, Y. et al. , Et al. "Codon usage tagged from the international DNA sequence database: status for the year 2000" Nucl. Acids Res. 28: 292 (2000). Computer algorithms that codon-optimize specific sequences expressed in specific host cells, such as Gene Forge (Aptagen; Jacobus, PA), may also be utilized. In some embodiments, one or more codons in the sequence encoding Cas (eg, 1, 2, 3, 4, 5, 10, 15, 20, 25, 50 or more, or all codons). Corresponds to the most frequently used codons for a particular amino acid.

In certain embodiments, the methods described herein may include providing Cas transgenic cells, particularly C2c2 transgenic cells, wherein one or more encoding one or more guide RNAs. Nucleic acid is operably linked to a regulatory element containing the promoter of one or more genes of interest to provide or be introduced into the cell. As used herein, the term "Cas transgenic cell" refers to a cell, such as a eukaryotic cell, in which the Cas gene is genomically integrated. According to the present invention, the nature, type, or origin of the cell is not particularly limited. In addition, there can be various methods for introducing the Cas transgene into cells, and any method known in the art can be used. In certain embodiments, Cas transgenic cells are obtained by introducing the Cas transgene into isolated cells. In certain other embodiments, Cas transgenic cells are obtained by isolating the cells from a Cas transgenic organism. By way of example, the Cas transgenic cells referred to herein can be derived from Cas transgenic eukaryotes such as Cas knock-in eukaryotes. WO2014 / 093622 (PCT / US13 / 74667) is referenced and incorporated herein by reference. Sangamo BioSciences, Inc. aimed at targeting the Rosa locus. The methods of U.S. Patent Publication Nos. 20120017290 and 20110265198, which are attributed to, can be modified to utilize the CRISPR Cas system of the present invention. The method of US Patent Publication No. 20130236946 belonging to Cellectis aimed at targeting the Rosa locus can also be modified to utilize the CRISPR Cas system of the invention. As a further example, Cas9 knock-in mice are described, which are incorporated herein by reference, Platt et. al. (Cell; 159 (2): 440-455 (2014)). The Cas transgene can further include a Lox-Stop-polyA-Lox (LSL) cassette, which allows Cas expression to be induced by Cre recombinase. Alternatively, Cas transgenic cells can be obtained by introducing the Cas transgene into isolated cells. Transgene delivery systems are well known in the art. As an example, the Cast transgene can be used by vector (eg, AAV, adenovirus, lentivirus) and / or particle and / or nanoparticle delivery, and as described elsewhere herein, eg, true. It may be delivered to nuclear cells.

Cells, such as the Cas transgenic cells referred to herein, result from the sequence-specific action of Cas when complexed with an integrated Cas gene or RNA capable of directing Cas to a target locus. It will be appreciated by those skilled in the art that in addition to having mutations, it may include additional genomic changes.

In certain embodiments, the invention proliferates these components as well as to deliver or introduce into cells, for example, RNA capable of directing Cas and / or Cas to a target locus (ie, a guide RNA). Contains a vector to allow (eg, in the prokaryotic cell). As used herein, a "vector" is a tool that enables or facilitates the transfer of an entity from one environment to another. This is a replicon such as a plasmid, phage, or cosmid, and another DNA segment may be inserted to result in replication of the inserted segment. In general, the vector can replicate if bound to the appropriate regulator. In general, the term "vector" refers to a nucleic acid molecule capable of transporting another nucleic acid to which it is bound. Vectors are single-stranded, double-stranded, or partially double-stranded nucleic acid molecules, nucleic acid molecules containing one or more free ends, free-ended (eg, circular) nucleic acid molecules, DNA, RNA, or Nucleic acid molecules containing both, and various other polynucleotides known in the art, but are not limited thereto. Another type of vector is a "plasmid", which refers to a circular double-stranded DNA loop into which additional DNA segments can be inserted, such as by standard molecular cloning techniques. Another type of vector is a viral vector, in which a virally derived DNA or RNA sequence is transferred to a virus (eg, retrovirus, replication-deficient retrovirus, adenovirus, replication-deficient adenovirus, and adeno-associated virus (AAV)). Present in the vector for packaging. Viral vectors also contain polynucleotides carried by the virus for gene transfer into host cells. Certain vectors are capable of autonomous replication in the host cell into which they have been introduced (eg, a bacterial vector having a bacterial origin of replication and an episome mammalian vector). Other vectors (eg, non-episome mammalian vectors) integrate into the host cell's genome upon introduction into the host cell, thereby replicating with the host genome. In addition, certain vectors can drive the expression of genes to which they are operably linked. As used herein, such vectors are referred to as "expression vectors". Common expression vectors useful in recombinant DNA technology are often in the form of plasmids.

The recombinant expression vector may comprise the nucleic acid of the invention in a form suitable for expression of the nucleic acid in the host cell, wherein the recombinant expression vector may be selected based on the host cell used for expression. It is meant to include one or more regulatory elements that are operably linked to the nucleic acid sequence to be. In a recombinant expression vector, "operably linked" means that the nucleotide sequence of interest is expressed in a regulatory element (s) of the nucleotide sequence (eg, an in vitro transcription / translation system, or when the vector is introduced into a host cell). It is intended to mean that they are linked in a manner that allows (in the host). For recombination and cloning methods, reference is made to US Patent Application No. 10 / 815,730 published as US2004-0171156A1 on September 2, 2004, the contents of which are incorporated herein by reference in their entirety. .. Accordingly, embodiments disclosed herein may also include transgenic cells comprising a CRISPR effector system. In certain exemplary embodiments, transgenic cells can function as separate and distinct volumes. In other words, the sample containing the masking construct can be delivered, for example, to cells within the appropriate delivery vesicles, where if the target is present in the delivery vesicles, the CRISPR effector is activated and a detectable signal is generated. ..

The vector (s) can include regulatory elements (s), such as promoters (s). The vector (s) encodes a sequence encoding Cas and / or a single, but perhaps at least 3 or 8 or 16 or 32 or 48 or 50 guide RNA (s) (eg, sgRNA). Sequences such as 1-2, 1-3, 1-4, 1-5, 3-6, 3-7, 3-8, 3-9, 3-10, 3-16, 3-30, 3-32 It can contain 3 to 48, 3 to 50 RNAs (s) (eg, sgRNA). In a single vector, there may be a promoter for each RNA (eg, sgRNA), which is advantageous when there are up to about 16 RNAs (s). If a single vector provides more than 16 RNAs (s), one or more promoters (s) can drive the expression of RNAs (s) greater than 1. For example, if there are 32 RNAs (s), each promoter can drive the expression of 2 RNAs (s), and if there are 48 RNAs (s), each promoter has 3 RNAs (s). Can drive the expression of. With simple arithmetic and a well-established cloning protocol, and the teachings in the present disclosure, one of ordinary skill in the art will appreciate the RNA (s) for a suitable exemplary vector such as AAV and a suitable promoter such as the U6 promoter. The invention can be easily carried out. For example, the AAV packaging limit is about 4.7 kb. The length of a single U6-gRNA (and restriction site for cloning) is 361 bp. Thus, one of ordinary skill in the art can readily adapt about 12-16 U6-gRNA cassettes, eg 13 U6-gRNA cassettes, into a single vector. It can be assembled by any suitable means such as the golden gate strategy used in the TALE assembly (genome-enginging.org/talrefectors/). One of ordinary skill in the art can also use a tandem guide strategy to increase the number of U6-gRNA by about 1.5 times, eg 12-16, eg 13 to about 18-24, eg about 19 U6-gRNA. .. Thus, one of ordinary skill in the art can readily reach about 18-24, eg, about 19, promoter-RNAs, eg U6-gRNA, in a single vector, eg, AAV vector. A further means for increasing the number of promoters and RNAs in a vector is to use a single promoter (eg, U6) to express an array of RNAs separated by cleavable sequences. Yet another means for increasing the number of promoter-RNAs in a vector is to express an array of promoter-RNAs separated by a cleavable sequence within the coding sequence or intron of the gene. And in this case, it is advantageous to use the polymerase II promoter, which has increased expression and allows transcription of long RNA in a tissue-specific manner. (See, for example, nar.oxfordjoumals.org/content/34/7/e53.short, and nature.com/mt/joumal/vr6/n9/abs/mt2008144a.html). In an advantageous embodiment, the AAV can package a U6 tandem gRNA that targets up to about 50 genes. Accordingly, one of ordinary skill in the art expresses a plurality of RNAs or guides under the control of one or more promoters or operably or functionally linked thereto, based on the knowledge of the art and the teachings in the present disclosure. For example, a single vector can be easily prepared and used, and no undue experimentation is required, especially with respect to the number of RNAs or guides discussed herein.

The sequence encoding the guide RNA (s) and / or the sequence encoding Cas can be functionally or operably linked to the regulatory element (s), so that the regulatory element (s) drives expression. do. The promoter (s) can be a constitutive promoter (s) and / or a conditional promoter (s) and / or an inducible promoter (s) and / or a tissue-specific promoter (s). The promoters are RNA polymerase, pol I, pol II, pol III, T7, U6, H1, retrovirus Raus sarcoma virus (RSV) LTR promoter, cytomegalovirus (CMV) promoter, SV40 promoter, dihydrofolate reductase promoter, β. -You can choose from the group consisting of the actin promoter, the phosphoglycerol kinase (PGK) promoter, and the EF1α promoter. The advantageous promoter is promoter U6.

In some embodiments, one or more elements of the nucleic acid targeting system are derived from a particular organism, including an endogenous CRISPR RNA targeting system. In certain exemplary embodiments, the effector protein CRISPR RNA targeting system is recognized as a HEPN domain as compared to the HEPN domain described herein, the HEPN domain known in the art, and consensus sequence motifs. Includes, but is not limited to, at least one HEPN domain. Some of such domains are provided herein. In one non-limiting example, the consensus sequence can be derived from the sequence of C2c2 or Cas13b orthologs provided herein. In certain exemplary embodiments, the effector protein comprises a single HEPN domain. In certain other exemplary embodiments, the effector protein comprises two HEPN domains. One of skill in the art will appreciate that a shortened form of the C2c2 protein is available, thereby determining sequence identity over the length of the shortened form.

In one exemplary embodiment, the effector protein comprises one or more HEPN domains comprising the RxxxxxxH motif sequence. The RxxxxxxH motif sequence may be, but are not limited to, derived from the HEPN domain described herein or the HEPN domain known in the art. The RxxxxxxH motif sequence further includes a motif sequence created by combining parts of two or more HEPN domains. As mentioned above, the consensus sequence is PCT / US2017 / 038154, eg, pp. 256-264 and pp. 285-336, entitled "Novel CRISPR Orthologs and Systems", "Novel CRISPR Enzymes and tentative US patent application". 62 / 471,710, US Provisional Patent Application No. 62 / 484,786 entitled "Novel Type VI CRISPR Orthologs and Systems" filed March 15, 2017, and filed April 12, 2017. It can be derived from the sequence of orthologs disclosed in US Provisional Patent Application No. 62 / 484,786, entitled "Novell Type VI CRISPR Orthologs and Systems".

In one embodiment of the invention, the HEPN domain comprises at least one RxxxxxxH motif comprising the sequence of R {N / H / K} X1X2X3H (SEQ ID NO: 1). In one embodiment of the invention, the HEPN domain comprises an RxxxxxxH motif comprising the sequence of R {N / H} X1X2X3H (SEQ ID NO: 2). In one embodiment of the invention, the HEPN domain comprises the sequence of R {N / K} X1X2X3H (SEQ ID NO: 3). In certain embodiments, X1 is R, S, D, E, Q, N, G, Y, or H. In certain embodiments, X2 is I, S, T, V, or L. In certain embodiments, X3 is L, F, N, Y, V, I, S, D, E, or A.

Additional effectors for use according to the invention are identified by their proximity to the casl gene, eg, within the region 20 kb from the start of the casl gene and 20 kb from the end of the casl gene, but not limited to these. be able to. In certain embodiments, the effector protein comprises at least one HEPN domain and at least 500 amino acids, and the C2c2 effector protein is naturally present in the prokaryotic genome within 20 kb upstream or downstream of the Cas gene or CRISPR array. Non-limiting examples of Cas proteins include Casl, CaslB, Cas2, Cas3, Cas4, Cas5, Cas6, Cas7, Cas8, Cas9 (also known as Csnl and Csx12), Cas10, Csyl, Csy2, Csy3, Csel, Cse2. , Cscl, Csc2, Csa5, Csn2, Csm2, Csm3, Csm4, Csm5, Csm6, Cmrl, Cmr3, Cmr4, Cmr5, Cmr6, Csbl, Csb2, Csb3, Csx17, Csx1 , Csfl, Csf2, Csf3, Csf4, their homologs, or modifications thereof. In certain exemplary embodiments, the C2c2 effector protein is naturally present in the prokaryotic genome within 20 kb upstream or downstream of the Cas1 gene. The terms "orthologue" (also referred to herein as "ortholog") and "homlogue" (also referred to herein as "homolog") are well known in the art. Is. As additional guidance, a protein "homolog" as used herein is a protein of the same species that performs the same or similar function as a protein in a homologous relationship. Homological proteins are possible, but do not need to be structurally related, or their structural relevance is only partial. As used herein, a "ortholog" of a protein is a different species of protein that performs the same or similar function as a protein in an ortholog relationship. Orthologous proteins are possible, but do not need to be structurally related, or their structural relevance is only partial.

In certain embodiments, the RNA-targeted Cas enzyme of type VI is C2c2. In another embodiment, the RNA-targeted Cas enzyme of type VI is Cas13b. In certain embodiments, homologs or orthologs of VI-type proteins such as C2c2 referred to herein are C2c2 (eg, Leptotricia shii C2c2, Lachnospiraceae bacterium MA2020 C2c2, LachnospiraCi C2c2, Carnobacterium gallinarum (DSM 4847) C2c2, Paludibacter propionicigenes (WB4) C2c2, Listeria weihenstephanensis (FSL R9-0317) C2c2, Listeriaceae bacterium (FSL M6-0635) C2c2, Listeria newyorkensis (FSL M6-0635) C2c2, Leptotrichia wadei ( F0279) C2c2, Rhodobacter bacterium (SB 1003) C2c2, Rhodobacter bacterium (R121) C2c2, Rhodobacter bacterus (DE442) C2c2, Listeriaceae (DE442) C2c2, Listeriaceae With VI-type proteins such as, at least 30%, or at least 40%, or at least 50%, or at least 60%, or at least 70%, or at least 80%, more preferably at least 85%, even more preferably at least 90%. , For example, have at least 95% sequence homology or identity. In a further embodiment, homologs or orthologs of VI-type proteins such as C2c2 referred to herein are wild-type C2c2 (eg, Leptotricia shahii C2c2, Lachnospiraceae bacterium MA2020 C2c2, LachnoCirbi ) C2c2, Carnobacterium gallinarum (DSM 4847) C2c2, Paludibacter propionicigenes (WB4) C2c2, Listeria weihenstephanensis (FSL R9-0317) C2c2, Listeriaceae bacterium (FSL M6-0635) C2c2, Listeria newyorkensis (FSL M6-0635) C2c2, Leptotrichia wadei (F0279) C2c2, Rhodobacter bacterium (SB 1003) C2c2, Rhodobacter bacterium (R121) C2c2, Rhodobacter bacterium (DE442) C2c2, Listeriaceae (DE442) C2c2, Listeriaceae ) And at least 30%, or at least 40%, or at least 50%, or at least 60%, or at least 70%, or at least 80%, more preferably at least 85%, even more preferably at least 90%, for example, at least. Has 95% sequence identity.

In certain other exemplary embodiments, the CRISPR-based effector protein is a C2c2 nuclease. The activity of C2c2 may depend on the presence of two HEPN domains. These have been shown to be RNase domains, ie nucleases (especially endonucleases) cleavage RNAs. C2c2 HEPN can target DNA, or potentially DNA and / or RNA. The C2c2 effector protein preferably has an RNase function, based on the fact that the HEPN domain of C2c2 can bind at least RNA and can cleave RNA in wild type. Regarding the C2c2 CRISPR system, International Patent Publication No. WO / 2017/219027 entitled TYPE VI CRISPR ORDHOLOGS AND SYSTEMS, US Provisional Patent Application No. 62 / 351,662 filed on June 17, 2016, and 2016. See US Provisional Patent Application No. 62 / 376,377 filed on August 17th. See also US Provisional Patent No. 62 / 351,803 filed June 17, 2016. Also, Broad Institute No. 10035, filed on December 8, 2016. Also referred to is the US provisional patent entitled "Novel CRISPR Enzymes and Systems" on PA4 and agent docket number 47627.03.2133. Furthermore, East-Seletsky et al. "Two digital RNase actives of CRISPR-C2c2 enable guide-RNA processing and RNA detection" Nature doi: 10/1038 / nature 9802, and Abdayyeh et al. See also "C2c2 is a single-component probe RNA-guided RNA targeting CRISPR effector" bioRxiv doi: 10.1101 / 054742.

RNase function in the CRISPR system is known, for example, mRNA targets have been reported in specific type III CRISPR-Cas systems (Hale et al., 2014, Genes Dev, vol. 28, 2432-2443, Hale et al. , 2009, Cell, vol. 139, 945-956, Peng et al., 2015, Nucleic acids research, vol. 43, 406-417). In the Staphylococcus epidermis III-A system, transcription between targets results in cleavage of the target DNA and its transcripts mediated by an independent active site within the Cas10-Csm ribonucleoprotein effector protein complex (Samai et al.,. See 2015, Cell, vol. 151,1164-1174). Therefore, a CRISPR-Cas system, composition or method that targets RNA via the effector protein of the invention is provided.

In one embodiment, the Cas protein can be a C2c2 ortholog of an organism of the genus including, but not limited to: Leptococcus, Listeria, Corynebacter, Suterella, Legionella, Treponema, Filactor, Flavobacterium, Eubacterium, , Flavivola, Flavobacterium, Sphaerochaeta, Azospirillum, Gluconacetobacter, Neisseria, Rosebulia, Parvibaculum, Staphylococcus, Nittramycoplasma, Nittracytoplasma, Species of such genera may otherwise be as discussed herein.

In certain exemplary embodiments, the C2c2 effector proteins of the invention include, but are not limited to, the following 21 ortholog species (including multiple CRISPR loci: Lachnospiraceae; Lachnospiraceae (Lw2); Listeria). seeligeri; Lachnospiraceae bacterium MA2020; Lachnospiraceae bacterium NK4A179; [Clostridium] aminophilum DSM 10710; Carnobacterium gallinarum DSM 4847; Carnobacterium gallinarum DSM 4847 (second CRISPR locus); Paludibacter propionicigenes WB4; Listeria weihenstephanensis FSL R9-0317; Listeriaceae bacterium FSL M6 -0635; Leptotrichia wadei F0279; Rhodobacter capsulatus SB 1003; Rhodobacter capsulatus R121; Rhodobacter capsulatus DE442; Leptotrichia buccalis C-1013-b; Herbinix hemicellulosilytica; [Eubacterium] rectale; Eubacteriaceae bacterium CHKCI004; Blautia sp.Marseille-P2398; and Leptotrichia sp Further non-limiting examples of .oral taxon 879 str. F0557.12 are as follows: Lachnospiraceae bacterium NK4A144; Chloroflexus aggregans; Demequina auranattiaca; Blautia sp. Marsaille-P2398; Leptoricia s p. Marseille-P3007; Bacteroides ihuae; Bacteroides bacterium KH3CP3RA; Listeria riparia; and Insolitis piryllum peregrinum.

Several methods of identifying the ortholog of a CRISPR-Cas-based enzyme may include identifying the tracr sequence within the genome of interest. Identification of the tracr sequence may be relevant to the next step: Search the database for direct repeat or tracr mate sequences to identify the CRISPR region containing the CRISPR enzyme. Search for homologous sequences in the CRISPR region flanking the CRISPR enzyme in both sense and antisense directions. Look for a transfer terminator and secondary structure. Any sequence that is not a direct repeat or tracr mate sequence but has greater than 50% identity with a direct repeat or tracr mate sequence is identified as a potential tracr sequence. The potential tracr sequence is obtained and the associated transcription terminator sequence is analyzed.

It will be appreciated that any of the functions described herein can be engineered to CRISPR enzymes from other orthologs, including chimeric enzymes containing fragments from multiple orthologs. Examples of such orthologs are described elsewhere herein. Accordingly, a chimeric enzyme, Leptotrichia, Listeria, Corynebacter, Sutterella, Legionella, Treponema, Filifactor, Eubacterium, Streptococcus, Lactobacillus, Mycoplasma, Bacteroides, Flaviivola, Flavobacterium, Sphaerochaeta, Azospirillum, Gluconacetobacter, Neisseria, Roseburia, Parvibaculum, Staphylococcus, Nitratifractor, It may contain fragments of the CRISPR enzyme orthologs of organisms including, but not limited to, Mycoplasma, and Campylobacter. The chimeric enzyme can include a first fragment and a second fragment, which can be the CRISPR enzyme ortholog of the genus referred to herein or the species referred to herein. Advantageously, the fragment is derived from a different species of CRISPR enzyme ortholog.

In embodiments, the C2c2 protein referred to herein also includes a functional variant of C2c2 or a homolog or ortholog thereof. As used herein, a "functional variant" of a protein refers to a variant of such a protein that at least partially retains the activity of the protein. "Functional variants" can include variants (which can be insertions, deletions, or substitution variants), including polymorphs and the like. Functional variants also include fusion products of such proteins with other nucleic acids, proteins, polypeptides, or peptides that are normally unrelated. Functional variants may be naturally occurring or artificially occurring. Preferred embodiments may include engineered or non-naturally occurring VI-type RNA target effector proteins.

In one embodiment, the nucleic acid molecule (s) encoding C2c2 or its ortholog or homolog can be codon-optimized for expression in eukaryotic cells. Eukaryotes can be those discussed herein. Nucleic acid molecules (s) may be engineered or non-naturally occurring.

In one embodiment, C2c2 or its ortholog or homolog can contain one or more mutations (thus, the nucleic acid molecule (s) encoding it may have a mutation (s)). Mutations can be artificially introduced mutations and can include, but are not limited to, one or more mutations in the catalytic domain. Examples of catalytic domains for Cas9 enzymes can include, but are not limited to, RuvC I, RuvC II, RuvC III and HNH domains.

In one embodiment, C2c2 or its ortholog or homolog can contain one or more mutations. Mutations can be artificially introduced mutations and can include, but are not limited to, one or more mutations in the catalytic domain. Examples of catalytic domains for Cas enzymes include, but are not limited to, the HEPN domain.
In one embodiment, C2c2 or its ortholog or homolog can be used as a common nucleic acid binding protein that fuses with or is operably linked to a functional domain. Exemplary functional domains include translation initiators, translational activators, translational repressors, nucleases, especially ribonucleases, spliceosomes, beads, photoinducible / controllable domains, or chemically inducible / controllable domains. However, but not limited to these.

In certain exemplary embodiments, C2c2 effector proteins, Leptotrichia, Listeria, Corynebacter, Sutterella, Legionella, Treponema, Filifactor, Eubacterium, Streptococcus, Lactobacillus, Mycoplasma, Bacteroides, Flaviivola, Flavobacterium, Sphaerochaeta, Azospirillum, Gluconacetobacter, Neisseria, It may be derived from an organism selected from the group consisting of Rosebulia, Pavibaculum, Staphylococcus, Listeria, Mycoplasma, and Campylobactor.

In certain embodiments, the effector protein is Listeria sp. It can be C2c2p, preferably Listeria Seeligeria C2c2p, more preferably Listeria Seeligeria serotype 1 / 2b strain SLCC3954 C2c2p, the crRNA sequence containing 5'29 nt direct repeats (DR) and 15 nt-18 nt spacers, 44- It can be 47 nucleotides in length.

In certain embodiments, the effector protein is Leptotricia sp. It can be C2c2p, preferably Leptotricia shahii C2c2p, more preferably Leptotricia shahii DSM 19757 C2c2p, and the crRNA sequence is at least 24 nt with 5'direct iterations, including, for example, 24-28 nt direct repeats (DR) of 5'. At least 14 nt spacers, eg 14 nt-28 nt spacers, or at least 18 nt, eg 19, 20, 21, 22 or more nts, eg 18-28, 19-28, 20-28, 21-28. , Or 22-28 nt spacers and can be 42-58 nucleotides in length.

In certain exemplary embodiments, the effector protein is Leptotricia sp. , Leptotricia wadei F0279, or Listeria sp. , Preferably Listeria newyorkensis FSL M6-0635.

In certain embodiments, the C2c2 protein according to the invention is one of the orthologs, or is derived from it, or is two or more chimeric proteins of the orthologs described in this application, or one of the orthologs. Variants or variants (or chimeric variants or variants) such as dead C2c2, split C2c2, destabilized C2c2, etc. as defined elsewhere herein, with or without fusion with a heterologous / functional domain. including.

In certain exemplary embodiments, the RNA target effector protein is a VI-B type effector protein such as Cas13b and a Group 29 or Group 30 protein. In certain exemplary embodiments, the RNA target effector protein comprises one or more HEPN domains. In certain exemplary embodiments, the RNA target effector protein comprises a C-terminal HEPN domain, an N-terminal HEPN domain, or both. U.S. Patent Application No. 15 / 331,792, entitled "Novel CRISPR Enzymes and Systems," filed October 21, 2016, with respect to exemplary type VI-B effector proteins that can be used in connection with the present invention. International Patent Application No. PCT / US2016 / 0583032, entitled "Novel CRISPR Enzymes and Systems," filed October 21, 2016, and Margon et al. "Cas13b is a Type VI-B CRISPR-assisted RNA-Guided RNase digitally regulent by acknowledge protein Csx27 and Csx28" Molecular Cell, 65- doi. org / 10.1016 / j. molcel. See 2016.12.023, and the upcoming US provisional application entitled "Novell cass13b CRISPR Enzymes and System" filed March 15, 2017. In certain exemplary embodiments, the two Cas13a orthologs and the two Cas13b orthologs described in Tables 1-6 of International Application No. PCT / US2017 / 065477, pages 40-52, which are incorporated herein by reference. , Or different orthologs from the same class of CRISPR effector proteins, such as two Cas13c orthologs. In certain other exemplary embodiments, different orthologs with different nucleotide editing preferences, such as Cas13a and Cas13b orthologs, or Cas13a and Cas13c orthologs, or Cas13b and Cas13c orthologs, can be used.

The RNA target effector protein can, in some embodiments, contain one or more HEPN domains, which can optionally include the RxxxxxxH motif sequence. In some cases, the RxxxH motif comprises an R {N / H / K] X ₁ X ₂ X ₃ H sequence, which in some embodiments, X ₁ is R, S, D, E, Q, N, G, or Y, X ₂ is independently I, S, T, V, or L, and X ₃ is independently L, F, N, Y, V, I, S, D, E, or A. In some specific embodiments, the CRISPR RNA target effector protein is C2c2.

Non-specific ssDNA and RNA-oriented proteins inevitably, and also potentially, exhibit improved Cas proteins that may be used for detection, resulting in improved Cas proteins that can be used for detection. A large range can be provided by the detection of amplified and sensitive nucleic acid targets, especially the multiple detection of the SHERLOCK diagnostic system.

Guide As used herein, the "crRNA" or "guide RNA" or "single guide RNA" or "sgRNA" or "one or more nucleic acid constructs" of a V-type or VI-type CRISPR-Cas locus effector protein. The term "element" is any polynucleotide that hybridizes with the target nucleic acid sequence and has sufficient complementarity with the target nucleic acid sequence to direct the nucleic acid targeting complex to sequence-specific binding to the target nucleic acid sequence. Contains sequences. In some embodiments, the degree of complementarity is approximately 50%, 60%, 75%, 80%, 85%, 90%, 95%, when optimally aligned using an appropriate alignment algorithm. 97.5%, 99%, or more. Optimal alignment can be determined using any algorithm suitable for the alignment sequence, but non-limiting examples thereof include the Smith-Waterman algorithm, the Needleman-Wunsch algorithm, and algorithms based on the Burrows-Wheeler transformation (eg,). , Burrows Wheeler Algorithm), CrystalW, Crystal X, BLAT, Novoalign (Novocraft Technologies; available at www.novocraft.com), ELAND (Illumina, SanGe. ), And Maq (available at maq.Sourceforge.net). The ability of the guide sequence (within the nucleic acid targeting guide RNA) to direct sequence-specific binding of the nucleic acid targeting complex to the target nucleic acid sequence can be assessed by any suitable assay. For example, a component of the nucleic acid targeting CRISPR system sufficient to form a nucleic acid targeting complex containing a guide sequence to be tested is transfection with a vector encoding a component of the nucleic acid targeting complex, followed by transfection. , By evaluation of preferential targeting (eg, cleavage) within a target nucleic acid sequence, such as by the Surveyor assay described herein, can be provided to host cells having the corresponding target nucleic acid sequence. Similarly, cleavage of the target nucleic acid sequence provides, in vitro, a component of the nucleic acid targeting complex, which comprises the target nucleic acid sequence, the guide sequence to be tested and the control guide sequence different from the test guide. It can be assessed by comparison of binding or cleavage rates at the target sequence between the reaction of the test and control guide sequences. Other assays are also possible and will be apparent to those of skill in the art. Guide sequences, and thus nucleic acid targeting guides, may be selected to target any target nucleic acid sequence. The target sequence may be DNA. The target sequence may be any RNA sequence. In some embodiments, the target sequence is messenger RNA (mRNA), premRNA, ribosome RNA (rRNA), transfer RNA (tRNA), microRNA (miRNA), small interfering RNA (siRNA), nuclear small molecule. From the group consisting of RNA (snRNA), small nuclei body RNA (snoRNA), double-stranded RNA (dsRNA), non-coding RNA (ncRNA), long non-coding RNA (lncRNA), and small cytoplasmic RNA (scRNA). It may be a sequence within the selected RNA molecule. In some preferred embodiments, the target sequence may be a sequence within an RNA molecule selected from the group consisting of mRNA, pre-mRNA, and rRNA. In some preferred embodiments, the target sequence can be a sequence within an RNA molecule selected from the group consisting of ncRNA and lncRNA. In some more preferred embodiments, the target sequence may be an mRNA molecule or a sequence within a pre-mRNA molecule.

In some embodiments, the nucleic acid target guide is selected to reduce the degree of secondary structure within the nucleic acid target guide. In some embodiments, the proportion of nucleotides in the nucleic acid targeting guide that are involved in self-complementary base pairing when optimally folded is about 75% or less, about 50% or less, about 40. % Or less, about 30% or less, about 25% or less, about 20% or less, about 15% or less, about 10% or less, about 5% or less, about 1% or less, or less. Optimal folding can be determined by any suitable polynucleotide folding algorithm. Some programs are based on the calculation of the minimum Gibbs free energy. One example of such an algorithm is mFold, which is described by Zuker and Steegler (Nucleic Acids Res. 9 (1981), 133-148). Another example of the folding algorithm is an online web server RNAfold that uses a center of gravity structure prediction algorithm, which was developed in the Institute for Theoretical Chemistry at the University of Vienna (eg, AR Gruber). Al., 2008, Cell 106 (1): 23-24; and PA Carr and GM Structure, 2009, Nature Biotechnology 27 (12): 1151-62).

In certain embodiments, the guide RNA or crRNA may include, or may consist essentially of, a direct repeat (DR) sequence and a guide sequence or spacer sequence. In certain embodiments, the guide RNA or crRNA may include, or may consist essentially of, a direct repeat sequence fused or linked to a guide or spacer sequence. .. In certain embodiments, the direct repeat sequence may be located upstream (ie, 5') of the guide or spacer sequence. In other embodiments, the direct repeat sequence may be located downstream of the guide sequence or spacer sequence (ie, 3').

In certain embodiments, the crRNA comprises a stem loop, preferably a single stem loop. In certain embodiments, the direct repeat sequence forms a stem-loop, preferably a single stem-loop.

In certain embodiments, the spacer length of the guide RNA is 15-35 nt. In certain embodiments, the spacer length of the guide RNA is at least 15 nucleotides. In certain embodiments, the spacer length is 15 to 17 nt, such as 15, 16, or 17 nt, 17 to 20 nt, such as 17, 18, 19, or 20 nt, 20 to 24 nt, such as 20, 21, 22, 23, or. 24nt, 23-25nt, eg 23, 24, or 25nt, 24-27nt, eg 24, 25, 26, or 27nt, 27-30nt, eg 27, 28, 29, or 30nt, 30-35nt, eg 30, 31 , 32, 33, 34, or 35 nt, or 35 nt or more.

The "tracrRNA" sequence or similar term includes any polynucleotide sequence that has sufficient complementarity with the crRNA sequence to hybridize. In some embodiments, the degree of complementarity between the tracrRNA sequence and the crRNA sequence along the two shorter lengths when optimally aligned is approximately 25%, 30%, 40%, 50. %, 60%, 70%, 80%, 90%, 95%, 97.5%, 99%, or more. In some embodiments, the tracr sequence is approximately 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, 30, 40, Nucleotides with a length of 50 or more. In some embodiments, the tracr and crRNA sequences are contained within a single transcript, so that hybridization between the two produces a transcript with secondary structure such as a hairpin. In one embodiment of the invention, the transcript or transcribed polynucleotide sequence has at least two or more hairpins. In a preferred embodiment, the transcript has two, three, four or five hairpins. In a further embodiment of the invention, the transcript has up to 5 hairpins. In the hairpin structure, the last "N" 5'sequence, and part of the upstream of the loop corresponds to the tracr mate sequence, and part of the loop's 3'array corresponds to the tracr sequence.

In general, the degree of complementarity relates to the optimal alignment of the sca and tracr sequences along the shorter of the two sequences. Optimal alignment may be determined by any suitable alignment algorithm and may also take into account secondary structure such as self-complementarity within either the sca sequence or the tracr sequence. In some embodiments, the degree of complementarity between the tracr and sca sequences along the two shorter lengths when optimally aligned is approximately 25%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 97.5%, 99%, or more.

Generally, the CRISPR-Cas, CRISPR-Cas9, or CRISPR system is one used in the aforementioned documents such as WO2014 / 093622 (PCT / US2013 / 074667) and is a sequence encoding the Cas gene, especially the CRISPR-. In the case of Cas9, the Cas9 gene, tracr (trans-activated CRISPR) sequence (eg, tracrRNA or active partial CRISPRRNA), tracr-mate sequence ("direct repeat" and partially treated with tracrRNA in the context of an endogenous CRISPR system. A guide sequence (including direct repeats), a guide sequence (also referred to as a "spacer" in the context of an endogenous CRISPR system), or an "RNA (s)" as the term is used herein (eg, an RNA that guides Cas9 (eg, Cas9). Multiple), eg, CRISPR-related (“Cas”) genes, including CRISPR RNA and trans-activated (tracr) RNA or single-guide RNA (sgRNA) (chimera RNA)) or other sequences and transcripts from the CRISPR locus. Collectively refers to transcripts and other elements involved in the expression or induction of activity of. Generally, the CRISPR system is characterized by an element that promotes the formation of a CRISPR complex at the site of the target sequence (also called a protospacer in the context of the endogenous CRISPR system). In the context of CRISPR complex formation, "target sequence" refers to a sequence in which the guide sequence is designed to have complementarity, and hybridization between the target sequence and the guide sequence facilitates the formation of the CRISPR complex. .. The section of the guide sequence where complementarity to the target sequence is important for cleavage activity is referred to herein as the seed sequence. The target sequence may include any polynucleotide, such as a polynucleotide of DNA or RNA. In some embodiments, the target sequence may contain nucleic acids located in or derived from mitochondria, organelles, vesicles, liposomes or particles located in the nucleus or cytoplasm of the cell. In some embodiments, NLS is not preferred, especially for non-nuclear applications. In some embodiments, the CRISPR system comprises one or more nuclear export signals (NES). In some embodiments, the CRISPR system comprises one or more NLS and one or more NES. In some embodiments, direct repeats can be identified in in silico by searching for repetitive motifs that meet any or all of the following criteria: 1. Found in a 2 Kb window of genomic sequences flanking the type IICRISPR locus; ranges from 2.20 to 50 bp; and intervals from 3.20 to 50 bp. In some embodiments, two of these criteria, such as 1 and 2, 2 and 3, or 1 and 3, may be used. In some embodiments, all three criteria may be used.

In embodiments of the invention, the term guide sequences and guide RNAs, ie RNAs capable of guiding Cas to the target genomic locus, are interchangeable as in the aforementioned references such as WO2014 / 093622 (PCT / US2013 / 074667). used. In general, the guide sequence is any polynucleotide that has complementarity with the target polynucleotide sequence, sufficient to hybridize to the target sequence and induce sequence-specific binding of the CRISPR complex to the target sequence. It is an array. In some embodiments, the degree of complementarity between the guide sequence and its corresponding target sequence is about or about 50%, 60%, 75 when optimal alignment is made using a suitable alignment algorithm. %, 80%, 85%, 90%, 95%, 97.5%, 99% or more. Optimal alignment can be determined using any algorithm suitable for sequence alignment, but non-limiting examples include algorithms based on the Smith-Waterman algorithm, Needleman-Wunsch algorithm, and Burrows-Wheeler transformation ( For example, Burrows Wheeler Algorithm), CrystalW, Crystal X, BLAT, Novoalign (Novocraft Technologies; available at www.novocraft.com), ELAND (Illumina, SanGe. (Available), and Maq (available at maq.sourceforge.net). In some embodiments, the guide sequences are approximately 5, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, It has a nucleotide length of 28, 29, 30, 35, 40, 45, 50, 75, or longer. In some embodiments, the guide sequence has a nucleotide length of less than about 75, 50, 45, 40, 35, 30, 25, 20, 15, 12 or less. Preferably, the guide sequence is 1030 nucleotides in length. The ability of the guide sequence to direct sequence-specific binding of the CRISPR complex to the target sequence can be assessed by any suitable assay. For example, sufficient components of the CRISPR system to form the CRISPR complex, including the guide sequence to be tested, are subsequently described herein, such as by transfection with a vector encoding a component of the CRISPR sequence. Can be provided to host cells having the corresponding target sequence, such as by evaluation of preferential cleavage within the target sequence, such as by the Surveyoor assay. Similarly, cleavage of the target polynucleotide sequence provides components of the CRISPR complex containing the target sequence, the guide sequence to be tested, the control guide sequence different from the test guide sequence, and between the reactions of the test and control guide sequences. It can be evaluated in vitro by comparing the binding or cleavage rate at the target sequence. Other assays are possible and will be apparent to those of skill in the art.

In some embodiments of the CRISPR-Cas system, the degree of complementarity between the guide sequence and its corresponding target sequence is approximately 50%, 60%, 75%, 80%, 85%, 90%, 95. %, 97.5%, 99%, or 100% or more; the guide or RNA or sgRNA is about 5, 10, 11, 12, 13, 14, 15, 16, 17, 18, It may have a nucleotide length of 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 35, 40, 45, 50, 75, or longer; or a guide or The RNA or sgRNA may have a nucleotide length of about 75, 50, 45, 40, 35, 30, 25, 20, 15, 12 or less; advantageously, the tracr RNA is 30 or It is 50 nucleotides in length. However, one aspect of the invention is to reduce off-target interactions, eg, to reduce guides that interact with target sequences with low complementarity. In fact, in this example, the invention has a CRISPR-Cas system of more than 80% and up to about 95% complementarity, eg 83% -84% or 88-89% or 94-95% complementarity. , Is shown to contain mutations that can distinguish between a target sequence and an off-target sequence (eg, distinguishing a target having 18 nucleotides from an 18 nucleotide off-target having one, two or three mismatches). There is. Thus, in the context of the invention, the degree of complementarity between the guide sequence and its corresponding target sequence is 94.5% or 95% or 95.5% or 96% or 96.5% or 97% or Greater than 97.5% or 98% or 98.5% or 99% or 99.5% or 99.9%, or 100%. Off-targets are 100% or 99.9% or 99.5% or 99% or 99% or 98.5% or 98% or 97.5% or 97% or 96.5% between the sequence and the guide. Or 96% or 95.5% or 95% or 94.5% or 94% or 93% or 92% or 91% or 90% or 89% or 88% or 87% or 86% or 85% or 84% or Complementarity of 83% or 82% or 81% or less than 80% and the off-target is 100% or 99.9% or 99.5% or 99% or 99% or 98.5 between the sequence and the guide. % Or 98% or 97.5% or 97% or 96.5% or 96% or 95.5% or 95% or 94.5% complementarity is advantageous.

In a particularly preferred embodiment according to the invention, the guide RNA (which can guide Cas to the target locus) is (1) a guide sequence capable of hybridizing to the genomic target locus of eukaryotic cells; (2) tracr sequence; and (3) A tracr mate sequence may be included. All of (1) to (3) may be present in a single RNA, ie sgRNA (located in the 5'to 3'direction, or the tracr RNA is different from the RNA containing the guide and tracr sequences. May be. The tracr hybridizes to the tracr mate sequence and directs the CRISPR / Cas complex to the target sequence. If the tracr RNA is on a different RNA than the RNA containing the guide and tracr sequences, it should be done to optimize the length of each RNA, shorten it from its native length and protect it from degradation by cellular RNases. For example, each may be independently chemically modified to increase stability.

The methods according to the invention described herein include delivering the vectors discussed herein to the cells, the eukaryotic cells discussed herein (in vitro, i.e., isolated eukaryotic cells). ) Includes pointing to one or more mutations, including delivering to cells the vector as discussed herein. Mutations (s) can be introduced, deleted, or substituted with one or more nucleotides in each target sequence of the cell (s) via a guide RNA (s) or sgRNA (s). Can be included. Mutations can include the introduction, deletion, or substitution of 1-75 nucleotides in each target sequence of the cell (s) via a guide RNA (s) or sgRNA (s). Mutations include 1, 5, 10, 11, 12, 13, 14, 15, 16, 17 in each target sequence of the cell (s) via guide RNA (s) or sgRNA (s). , 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 35, 40, 45, 50 or 75 nucleotides can be introduced, deleted, or substituted. Mutations include 5, 10, 11, 12, 13, 14, 15, 16 in each target sequence of the cell (s) via a guide RNA (s) or sgRNA (s). , 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 35, 40, 45, 50, or 75 nucleotides introduced, deleted, or substituted. obtain. Mutations include 10, 11, 12, 13, 14, 15, 16, 17 of each target sequence of the cell (s) via a guide RNA (s) or sgRNA (s). , 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 35, 40, 45, 50, or 75 nucleotides introduced, deleted, or substituted. Mutations include 20, 21, 22, 23, 24, 25, 26, in each target sequence of the cell (s) via a guide RNA (s) or sgRNA (s). Introduction, deletion, or substitution of 27, 28, 29, 30, 35, 40, 45, 50, or 75 nucleotides may be included. Mutations include 40, 45, 50, 75, 100, 200, 300, 400 at each target sequence of the cell (s) via a guide RNA (s) or sgRNA (s). Alternatively, the introduction, deletion, or substitution of 500 nucleotides may be included.

It may be important to control the concentration of Cas mRNA and guide the RNA to be delivered in order to minimize toxicity and off-target effects. Optimal concentrations of Cas mRNA and guide RNA should be tested at different concentrations in cellular or non-human eukaryotic animal models and using deep sequences to analyze the extent of modification at potential off-target genomic loci. Can be determined by. Alternatively, Cas nickase mRNA (eg, S. pyogenes Cas9 with the D10A mutation) can be delivered with a pair of guide RNAs targeting the site of interest to minimize the level of toxicity and off-target effects. Guide sequences and strategies for minimizing toxicity and off-target effects are as per WO2014 / 093622 (PCT / US2013 / 074667); or may be via mutations herein.

Typically, in the context of an endogenous CRISPR system, the formation of a CRISPR complex, including a guide sequence that hybridizes to a target sequence and forms a complex with one or more Cas proteins, is within or in the vicinity of the target sequence. For example, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 50 or more base pairs apart) results in cleavage of one or both chains. Although not bound by theory, a tracr sequence (eg, about 20, 26, 32, 45, 48 of a wild-type tracr sequence) may include or consist of all or part of a wild-type tracr sequence. , 54, 63, 67, 85 or more nucleotides) of the CRISPR complex, such as by hybridization along at least a portion of the tracr sequence to all or part of the tracr mate sequence operably linked to the guide sequence. A portion may be formed.

Guide Modifications In certain embodiments, the guides of the invention include non-naturally occurring nucleic acids and / or non-naturally occurring nucleotides and / or nucleotide analogs, and / or chemical modifications. Examples of non-naturally occurring nucleic acids include naturally occurring nucleotides and mixtures of non-naturally occurring nucleotides. Non-naturally occurring nucleotides and / or nucleotide analogs can be modified with ribose moieties, phosphate moieties, and / or base moieties. In one embodiment of the invention, the guide nucleic acid comprises ribonucleotides and non-ribonucleotides. In one such embodiment, the guide comprises one or more ribonucleotides and one or more deoxyribonucleotides. In one embodiment of the invention, the guide is one or more non-naturally occurring nucleotides or nucleotide analogs, such as nucleotides with phosphorothioate linkages, 2'and 4'carbons of the ribose ring with boranophosphate linkage. Includes a locked nucleic acid (LNA) nucleotide, peptide nucleic acid (PNA), or bridged nucleic acid (BNA) containing a methylene bridge between and. Other examples of modified nucleotides include 2'-O-methyl analogs, 2'-deoxy analogs, 2'-thiouridine analogs, N6-methyladenosine analogs, or 2'-fluoro analogs. Examples of additional modified bases include, but are not limited to, ligation of the chemical moiety at the 2'position: peptide, nuclear localized sequence (NLS), peptide nucleic acid (PNA), polyethylene glycol (PEG). , Triethylene glycol, or tetraethylene glycol (TEG). Further examples of the modified base include, but are not limited to, ^{2-aminopurine, 5-bromo-uridine, pseudouridine (Ψ), N1-methylpseudouridine (me 1 Ψ} ), 5-methoxyuridine (5moU),. Examples include inosine and 7-methylguanosine. Examples of chemical modifications of guide RNA are, but are not limited to, 2'-O-methyl (M), 2'-O-methyl 3'phospholothioate (MS), phosphorothioate (PS), S-restricted ethyl ( cEt), 2'-O-methyl 3'thioPACE (MSP), or 2'-O-methyl-3'-phosphonoacetate (MP) may be incorporated into one or more terminal nucleotides. Such chemically modified guides provide improved stability and increased activity compared to unmodified guides, although the results of on-target and off-target specificity are unpredictable. May include (Hendel, 2015, Nat Biotechnol. 33 (9): 985-9, doi: 10.1038 / nbt. 3290; Ragdarm et al., 0215, PNAS, published online June 29, 2015. E7111-E7111; Allerson et al., J. Med. Chem. 2005, 48: 901-904; Bramsen et al., Front. Genet., 2012, 3: 154; Deng et al., PNAS, 2015, 112: 11870-11875; Sharma et al., MedChemComm., 2014,5:1454-1471; Hender et al., Nat. Biotechnol. (2015) 33 (9): 985-989; Li et al., Nature Biomedical Engine 2017, 1,0066 DOI: 10.1038 / s41551-017-0066; Ryan et al., Nuclear Acids Res. (2018) 46 (2): 792-803). In some embodiments, the 5'and / or 3'ends of the guide RNA are modified by various functional moieties such as fluorescent dyes, polyethylene glycols, cholesterol, proteins, or detection tags. Is included. (See Kelly et al., 2016, J. Biotech. 233: 74-83). In certain embodiments, the guide comprises a ribonucleotide in the region that binds to the target DNA and one or more deoxyribonucleotides and / or nucleotide analogs in the region that binds to Cas9, Cpf1, or C2c1. In one embodiment of the invention, deoxyribonucleotides and / or nucleotide analogs are incorporated into engineered guide structures such as, but not limited to, 5'and / or 3'ends, stem-loop regions and seed regions. .. In certain embodiments, such modifications are not present on the 5'handle of the stem-loop region. Chemical modification of the 5'handle in the stem-loop region of the guide can result in loss of guide function (see Li, et al., Nature Biomedical Enginering, 2017, 1: 0066). In certain embodiments, at least one, two, three, four, five, six, seven, eight, nine, ten, eleven, twelve, of the guide nucleotides, 13, 14, 15, 16, 17, 17, 18, 19, 20, 21, 21, 22, 23, 24, 25, 26, 27, 28, 29 , 30, 35, 40, 45, 50, or 75 nucleotides are chemically modified. In some embodiments, the 3-5 nucleotides located at either the 3'end or the 5'end of the guide are chemically modified. In some embodiments, minor modifications (such as 2'-F modifications) are introduced into the seed region. In some embodiments, a 2'-F modification is introduced at the 3'end of the guide. In certain embodiments, the 3-5 nucleotides located at the 5'and / or 3'ends of the guide are 2'-O-methyl (M), 2'-O-methyl 3'phosphorothioate (MS), It is chemically modified with S-restraint ethyl (cEt), 2'-O-methyl 3'-thioPACE (MSP) or 2'-O-methyl-3'-phosphonoacetate (MP). Such modifications can improve the efficiency of genome editing (Handel et al., Nat. Biotechnol. (2015) 33 (9): 985-989; Ryan et al., Nucleic Acids Res. (2018) 46 (2)). : See 792-803). In certain embodiments, all of the guide's phosphodiester bonds are replaced with phosphorothioates (PS) to increase the level of gene disruption. In certain embodiments, more than 5 nucleotides located at the 5'and / or 3'ends of the guide are chemically 2'-O-Me, 2'-F, or S-constrained ethyl (cEt). It will be modified. Such chemically modified guides may increase the level of mediated gene disruption (see Ragdalm et al., 0215, PNAS, E7110-E7111). In one embodiment of the invention, the guide is modified to include a chemical moiety at its 3'end and / or 5'end. Such moieties are, but are not limited to, amines, azides, alkynes, thios, dibenzocyclooctins (DBCO), rhodamines, peptides, nuclear localized sequences (NLS), peptide nucleic acids (PNA), polyethylene glycol (PEG). , Triethylene glycol, or tetraethylene glycol (TEG). In certain embodiments, the chemical moiety is attached to the guide by a linker (such as an alkyl chain). In certain embodiments, the chemical portion of the modification guide can be used to attach the guide to another molecule, such as DNA, RNA, protein, or nanoparticles. Such chemically modified guides can be used for cell identification or enrichment commonly edited by the CRISPR system (see Lee et al., ELife, 2017, 6: e25312, DOI: 10.7545). I want to be). In some embodiments, the 3 nucleotides are chemically modified at each of the 3'and 5'ends. In certain embodiments, this modification comprises a 2'-O-methyl or phosphorothioate analog. In certain embodiments, 12 nucleotides in the tetraloop and 16 nucleotides in the stem-loop region are replaced with 2'-O-methyl analogs. Such chemical modifications improve in vivo editing and stability. (See Finn et al., Cell Reports (2018), 22: 2227-2235). In some embodiments, more than 60 or 70 nucleotides in the guide are chemically modified. In some embodiments, the modification comprises substitution of the nucleotide with a 2'-O-methyl or 2'-fluoronucleotide analog, or a phosphodiester bond phosphorothioate (PS) modification. In some embodiments, the chemical modification is a 2'-O-methyl or 2'-fluoro modification of the guide nucleotide extending outside the nuclease protein when the CRISPR complex is formed, or a 20 at the 3'end of the guide. Contains PS modifications of more than 30 nucleotides. In certain embodiments, the chemical modification further comprises a 2'-O-methyl analog at the 5'end of the guide, or a 2'-fluoro analog at the seed and tail regions. Such chemical modifications improve stability to nuclease degradation and maintain or enhance genome editing activity or efficiency, but modifications of all nucleotides can negate the function of the guide (Yin et al., Nat. Biotech. (2018), 35 (12): 1179-1187). Such chemical modifications may be guided by knowledge of the structure of the CRISPR complex, including knowledge of a limited number of nucleases and RNA 2'-OH interactions (Yin et al., Nat. Biotech. ( 2018), 35 (12): 1179-1187). In some embodiments, one or more guide RNA nucleotides may be replaced with DNA nucleotides. In some embodiments, up to 2, 4, 6, 8, 10, or 12 RNA nucleotides in the 5'end tail / seed guide region are replaced with DNA nucleotides. In certain embodiments, the majority of guide RNA nucleotides at the 3'end are replaced with DNA nucleotides. In certain embodiments, the 16 guide RNA nucleotides at the 3'end are replaced with DNA nucleotides. In certain embodiments, 8 guide RNA nucleotides in the 5'end tail / seed region and 16 RNA nucleotides at the 3'end are replaced with DNA nucleotides. In certain embodiments, the guide RNA nucleotides that extend outside the nuclease protein when the CRISPR complex is formed are replaced with DNA nucleotides. This replacement of multiple RNA nucleotides with DNA nucleotides reduces off-target activity but leads to similar on-target activity compared to the unaltered guide; however, all RNA nucleotides at the 3'end If replaced, the function of the guide may be lost (see Yin et al., Nat. Chem. Biol. (2018) 14, 311-316). Such modifications may be guided by knowledge of the structure of the CRISPR complex, including knowledge of a limited number of nucleases and RNA 2'-OH interactions (Yin et al., Nat. Chem. Biol. (2018) 14, 311-316).

In one aspect of the invention, the guide comprises a modified crRNA of modified Cpf1, which has a 5'handle and a guide segment further comprising a seed region and a 3'end. In some embodiments, Acidaminococcus sp. BV3L6 Cpf1 (AsCpf1); Francisella tularensis subsp. Novicida U112 Cpf1 (FnCpf1); bacterium MC2017 Cpf1 (Lb3Cpf1); Butyrivibrio proteoclasticus Cpf1 (BpCpf1); Parcubacteria bacterium GWC2011_GWC2_44_17 Cpf1 (PbCpf1); Peregrinibacteria bacterium GW2011_GWA_33_10 Cpf1 (PeCpf1); Leptospira inadai Cpf1 (LiCpf1); Smithella sp. SC_K08D17 Cpf1 (SsCpf1); L. bacterium MA2020 Cpf1 (Lb2Cpf1); Porphyromonas crevioricanis Cpf1 (PcCpf1); Porphyromonas macacae Cpf1 (PmCpf1); Candidatus Methanoplasma termitum Cpf1 (CMtCpf1); Eubacterium eligens Cpf1 (EeCpf1); Moraxella bovoculi 237 Cpf1 (MbCpf1); Prevotella disiens Cpf1 (PdCpf1) ; Or L. A modification guide may be used with Cpf1 of any one of bacteria ND2006 Cpf1 (LbCpf1).

In some embodiments, the modification to the guide is a chemical modification, insertion, deletion, or division. In some embodiments, the chemical modification is not limited to, but is limited to, 2'-O-methyl (M) analog, 2'-deoxy analog, 2-thiouridine analog, N6-methyladenosin analog, 2'-fluoro analog. , 2-aminopurine, 5-bromo-pseudouridine, pseudouridine (Ψ), N1 ^{-methylpseudouridine (me 1 Ψ} ), 5-methoxyuridine (5moU), inosin, 7-methylguanosine, 2'-O- Methyl-3'-phospholothioate (MS), S-restraint ethyl (cEt), phosphorothioate (PS), 2'-O-methyl-3'-thioPACE (MSP), or 2'-O-methyl-3'- Incorporating phosphonoacetate (MP) is included. In some embodiments, the guide comprises one or more of the phosphorothioate modifications. In certain embodiments, at least one, two, three, four, five, six, seven, eight, nine, ten, eleven, twelve, of the guide nucleotides, 13, 14, 15, 16, 17, 17, 18, 19, 20, or 25 are chemically modified. In some embodiments, all nucleotides are chemically modified. In certain embodiments, one or more nucleotides in the seed region are chemically modified. In certain embodiments, one or more nucleotides at the 3'end are chemically modified. In certain embodiments, none of the nucleotides in the 5'handle is chemically modified. In some embodiments, the chemical modification in the seed region is a minor modification (such as incorporation of a 2'-fluoro analog). In certain embodiments, one nucleotide of the nucleotide in the seed region is replaced with a 2'-fluoro analog. In some embodiments, 5 or 10 nucleotides at the 3'end are chemically modified. Such chemical modification of the 3'end of Cpf1 CrRNA improves gene cleavage efficiency (see Li, et al., Nature Biomedical Engineering, 2017, 1: 0066). In certain embodiments, the 5 nucleotides at the 3'end are replaced with 2'-fluoro analogs. In certain embodiments, the 10 nucleotides at the 3'end are replaced with 2'-fluoro analogs. In certain embodiments, the 5 nucleotides at the 3'end are replaced with 2'-O-methyl (M) analogs. In some embodiments, the 3 nucleotides are chemically modified at each of the 3'and 5'ends. In certain embodiments, this modification comprises a 2'-O-methyl or phosphorothioate analog. In certain embodiments, 12 nucleotides in the tetraloop and 16 nucleotides in the stem-loop region are replaced with 2'-O-methyl analogs. Such chemical modifications improve in vivo editing and stability (see Finn et al., Cell Reports (2018), 22: 2227-2235).

In some embodiments, the loop of the guide's 5'handle is modified. In some embodiments, the loop of the guide's 5'handle is modified to have a deletion, insertion, splitting, or chemical modification. In certain embodiments, the loop comprises three, four, or five nucleotides. In certain embodiments, the loop comprises the sequence UCUU, UUUU, UAUU, or UGUU. In some embodiments, the guide molecule forms a stem-loop with another non-covalently linked sequence, which may be DNA or RNA.

Syntheticly Linked Guides In one aspect, guides include tracr and tracr mate sequences that are chemically linked or linked via non-phosphodiester bonds. In one aspect, the guide comprises tracr and tracr mate sequences chemically linked or linked via non-nucleotide loops. In some embodiments, the tracr and tracr mate sequences are linked via a non-phosphodiester covalent linker. Examples of covalent linkers include, but are not limited to, carbamate, ether, ester, amide, imine, amidin, aminotridin, hydrozone, disulfide, thioether, thioester, phosphorothioate, phosphorodithioate, sulfonamide, sulfonate, Selected from the group consisting of fluphons, sulfoxides, ureas, thioureas, hydrazides, oximes, triazoles, photolabile bonds, CC bond-forming groups such as Deals-Alder ring-added or closed metacesipare, and Michael reaction pairs. Chemical groups are mentioned.

In some embodiments, the tracr and tracr mate sequences are first synthesized using a standard phosphoramidite synthesis protocol (Herdewijn, P., ed., Methods in Molecular Biology Col 288, Orangelusetides S). : Methods and Applications, Humana Press, New Jersey (2012)). In some embodiments, the tracr and tracr mate sequences may be functionalized to include functional groups suitable for ligation using standard protocols known in the art (Hermanson, G. et al. T., Bioconjugate Technologies, Academic Press (2013)). Examples of functional groups include, but are not limited to, hydroxyls, amines, carboxylic acids, carboxylic acid halides, carboxylic acid active esters, aldehydes, carbonyls, chlorocarbonyls, imidazolylcarbonyls, hydrazides, semicarbazides, thiosemicarbazides, thiols, Examples include maleimide, haloalkyl, sulfonyl, allyl, propargyl, diene, alkyne, and azide. Once the tracr and tracr mate sequences are functionalized, covalent bonds or linkages can be formed between the two oligonucleotides. Examples of chemical bonds include, but are not limited to, carbamate, ether, ester, amide, imine, amidine, aminotriazine, hydrozone, disulfide, thioether, thioester, phosphorothioate, phosphorodithioate, sulfonamide, Sulfonates, fulfones, sulfoxides, ureas, thioureas, hydrazides, oximes, triazoles, photosensitive bonds, CC bond-forming groups (Deals alder-added cyclization pairs or closed-ring metasessis pairs, and Michael reaction pairs, etc.) ) Is mentioned.

In some embodiments, the tracr and tracr mate sequences can be chemically synthesized. In some embodiments, in this chemical synthesis, 2'-acetoxyethyl orthoester (2'-ACE) chemistry et al., J. Am. Chem. Soc. (1998) 120: 11820-11821; Scaringe , Methods Enzymol. (2000) 317: 3-18), or 2'-thionocarbamate (2'-TC) chemistry (Dellinger et al., J. Am. Chem. Soc. (2011) 133: 11540-11546. An automated solid phase oligonucleotide synthesizer using Hender et al., Nat. Biotechnol. (2015) 33: 985-989) is used.

In some embodiments, tracr and tracr mate sequences undergo various bioconjugate reactions, loops, crosslinks, and non-nucleotide linkages via sugar, internucleotide phosphodiester bonds, and modification of purine and pyrimidine residues. May be covalently combined using. Setten et al. , Angew. Chem. Int. Ed. (2009) 48: 6974-6998; Manoharan, M. et al. Curr. Opin. Chem. Biol. (2004) 8: 570-9; Behlke et al. , Oligonucleotides (2008) 18: 305-19; Watts, et al. , Drug. Discov. Today (2008) 13: 842-55; Shukla, et al. , ChemMedChem (2010) 5: 328-49.

In some embodiments, the tracr and tracr mate sequences may be covalently coupled using click chemistry. In some embodiments, the tracr and tracr mate sequences can be covalently linked using a triazole linker. In some embodiments, tracr and tracr mate sequences may be covalently linked using a Huisgen 1,3-dipole cycloaddition reaction containing an alkyne and azide to produce a highly stable triazole linker (). He et al., ChemBioChem (2015) 17: 1809-1812; WO2016 / 186745). In some embodiments, the tracr and tracr mate sequences are covalently linked by ligating 5'-hexyne tracrRNA and 3'-azidocrRNA. In some embodiments, either or both of the 5'-hexyne tracrRNA and the 3'-azido crRNA may be protected with a 2'-acetoxyethyl ortho ester (2'-ACE) group, which may then be protected by Dharmacon. It may be removed using a protocol (Scaringe et al., J. Am. Chem. Soc. (1998) 120: 11820-11821; Scaringe, Methods Enzymol. (2000) 317: 3-18).

In some embodiments, the tracr and tracr mate sequences include moieties such as spacers, deposits, bioconjugates, chromophores, reporter groups, dye-labeled RNAs and non-naturally occurring nucleotide analogs (eg, non-next). Can be covalently linked via a nucleotide loop). More specifically, the spacer suitable for the object of the present invention is, but is not limited to, a polyether (for example, polyethylene glycol, polyalcohol, polypropylene glycol or a mixture of ethylene glycol and propylene glycol), a polyamine group (for example). For example, spenin, spermidin and its polymer derivatives), polyesters (eg, poly (ethyl acrylate)), polyphosphodiesters, alkylenes, and combinations thereof. Suitable bindings include, but are not limited to, any moiety that may add additional properties to the linker, such as fluorescent labels. Suitable bioconjugates include, but are not limited to, peptides, glycosides, lipids, cholesterol, phospholipids, diacylglycerols and dialkylglycerols, fatty acids, hydrocarbons, enzyme substrates, steroids, biotin, digoxigenin, carbohydrates, polysaccharides. Can be mentioned. Suitable chromophores, reporter groups, and dye-labeled RNAs include, but are not limited to, fluorescent dyes such as fluorescein and rhodamine, chemiluminescent, electrochemiluminescent, and bioluminescent marker compounds. The design of an exemplary linker that binds two RNA components is also described in WO2004 / 015075.

The linker (eg, non-nucleotide loop) can be of any length. In some embodiments, the linker has a length equal to about 0-16 nucleotides. In some embodiments, the linker has a length equal to about 0-8 nucleotides. In some embodiments, the linker has a length equal to about 0-4 nucleotides. In some embodiments, the linker has a length corresponding to about 2 nucleotides. An example of a linker design is also described in WO2011 / 008730.

A typical Type II Cas9 sgRNA contains (from 5'to 3'directions): guide sequence, poly U region (tract), first complementary stretch ("repetition"), loop (tetraloop), A second complementary stretch (“anti-repeat” complements the repeat), stem, as well as stem loops and stems, and poly A (often poly U in RNA) tail (terminator). In a preferred embodiment, certain aspects of the guide structure are retained, certain aspects of the guide structure can be modified, for example, by adding, subtracting, or replacing features, while certain other aspects of the guide structure are maintained. Will be done. Preferred locations for designed sgRNA modifications, including but not limited to insertions, deletions, and substitutions, are the guide ends and exposed when combined with CRISPR proteins and / or targets such as tetraloop and / or loop 2. The region of sgRNA to be used is mentioned.

In certain embodiments, the guide of the invention comprises a specific binding site for an adapter protein (eg, an aptamer), which may include one or more functional domains (eg, via a fusion protein). When such a guide forms a CRISPR complex (ie, a CRISPR enzyme that binds to the guide and target), the adapter protein binds and the functional domain associated with the adapter protein is spatially oriented and attributed. It is advantageous to be effective. For example, if the functional domain is a transcriptional activator (eg, VP64 or p65), the transcriptional activator is spatially oriented to allow it to influence the transcription of the target. Similarly, transcriptional repressors are favorably placed to affect the transcription of the target, and nucleases (eg, Fok1) are favorably placed to cleave or partially cleave the target.

Those skilled in the art allow the binding of adapters + functional domains, but do not allow proper placement of adapters + functional domains (eg, due to steric hindrance within the three-dimensional structure of the CRISPR complex). However, you will understand that it is an unintended modification. As described herein, the one or more modification guides are tetraloop, stemloop 1, stemloop 2, or stemloop 3, preferably either tetraloop or stemloop 2, most preferably. It can be modified in both tetraloop and stemloop 2.

Repeat: The anti-repeat double chain will be apparent from the secondary structure of the sgRNA. This is usually the first complementary stretch after the poly U region (tract) (5'to 3'direction) and before the tetraloop; and after the tetraloop and before the poly A region (5'). Can be the second complementary stretch (from 3'direction). The first complementary stretch (“repeat, repeat”) is complementary to the second complementary stretch (“anti-repeat / anti-repetition”). As such, they form Watson-Crick base pairs when folded together to form double chains of dsRNA. As such, the fact that the anti-repeat sequence is a repeating complementary sequence for AU or CG base pairs, but the anti-repeat is in the opposite direction due to the tetraloop. The same applies to.

In one embodiment of the invention, modification of the guide structure comprises replacing the base of stem-loop 2. For example, in some embodiments, the "actt" ("acuu" for RNA) and "agut" ("agu" for RNA) bases are replaced with "cgcc" and "gcgg" in stem-loop 2. In some embodiments, the "actt" and "agt" bases of stemloop2 are replaced with a complementary GC-rich region of 4 nucleotides. In some embodiments, the complementary GC-rich regions of 4 nucleotides are "cgcc" and "gcgg" (both in the 5'to 3'direction). In some embodiments, the complementary GC-rich regions of 4 nucleotides are "gcgg" and "cgcc" (both in the 5'to 3'direction). Other combinations of C and G in the complementary GC-rich region of 4 nucleotides are evident, including CCCC and GGGG.

In one embodiment, the stem loop 2, eg, "ACTTgttAAGT", may be replaced by "XXXXXgtttYYYY", eg, XXXX and YYYY are any set of complementary nucleotides that base pair with each other to form a stem. Represents.

In one embodiment, the stem comprises at least about 4 bp containing complementary X and Y sequences, but more, eg, 5, 6, 7, 8, 9, 10, 11 or 12 or less stems, eg 3, 3. Two base pairs are also possible. Thus, for example, X2-12 and Y2-12 (where X and Y represent any complementary set of nucleotides) can be considered. In one aspect, a stem made of X and Y nucleotides, together with "gttt", forms a complete hairpin throughout the secondary structure; and this can be advantageous and the amount of base pair is complete. It may be any amount that forms a hairpin. In one aspect, any complementary X: Y base pairing sequence (eg, with respect to length) is acceptable as long as the secondary structure of the entire sgRNA is preserved. In one aspect, the stem can be a form of X: Y base pairing that does not disrupt the secondary structure of the entire sgRNA in that it has a DR: tracr double chain and three stem loops. In one aspect, the "gttt" tetraloop connecting ACTT and AAGT (or any alternative stem made up of X: Y base pairs) has the same length (4 base pairs, etc.) without interrupting the entire secondary structure of the sgRNA. ) Or any higher sequence. In one aspect, the stem loop may be something that further lengthens the stem loop 2, eg, an MS2 aptamer. In one aspect, the stem loop 3 "GGCACCGagtCGGTGC" may also take the form "XXXXXXXXagtYYYYYYYY", eg, X7 and Y7 represent any complementary set of nucleotides that base pairs with each other to form a stem. In one aspect, the stem comprises about 7 bp containing complementary X and Y sequences, but stems with more or less base pairs are also contemplated. In one aspect, the stem made of X and Y nucleotides, together with the "agt", forms a complete hairpin throughout the secondary structure. In one aspect, any complementary X: Y base pairing sequence is acceptable as long as the secondary structure of the entire sgRNA is preserved. In one aspect, the stem may be in the form of X: Y base pairing that does not disrupt the secondary structure of the entire sgRNA in that it has a DR: tracr double chain and three stem loops. In one aspect, the "agt" sequence of stem-loop 3 may be extended or replaced by an aptamer, eg, an MS2 aptamer or otherwise a sequence that generally preserves the structure of stem-loop 3. In one embodiment of the alternative stem-loop 2 and / or 3, each X and Y pair may point to any base pair. In one aspect, non-Watson-Crick base pairing is contemplated, otherwise such pairing generally preserves the structure of the stemloop at that location.

In one embodiment, the DR: tracrRNA double strand may be replaced in the form gYYYYag (N) NNNNxxxxxxNNNN (AAN) uuRRRRRu (using the standard IUPAC nomenclature for nucleotides), where (N) and (AAN). Represents part of a double chain bulge and "xxxxx" represents a linker sequence. The direct repeat NNNN may be any as long as it base pairs with the corresponding NNNN portion of the tracrRNA. In one aspect, the DR: tracrRNA duplex can be linked with a linker of any length (xxxxxx ...), of any base composition, as long as the overall structure is not altered.

In one aspect, the structural requirement of the sgRNA is to have a double strand and three stem loops. In most embodiments, the structure of the DR: tracrRNA duplex should be preserved, but in fact for many of the specific base requirements in that the sequences that make up the structure such as stems, loops, bulges, etc. can be altered. Arrangement requirements are loose.

Aptamer One guide with a first aptamer / RNA binding protein pair may be linked or fused to an activator, while a second guide with a second aptamer / RNA binding protein pair is to the repressor. It may be linked or fused. Since the guides are for different targets (loci), this allows one gene to be activated and one gene to be suppressed. For example, the following schematic diagram shows such an approach.
Guide 1-MS2 aptamer -------- MS2 RNA-binding protein -------- VP64 activator; and Guide 2-PP7 aptamer -------- PP7 RNA-binding protein --- --SID4x repressor.

The invention also relates to orthogonal PP7 / MS2 gene targeting. In this example, to recruit MS2-VP64 or PP7-SID4X, sgRNAs targeting different loci are modified in different RNA loops, activating and suppressing those target loci, respectively. PP7 is a bacteriophage Pseudomonas RNA-binding coat protein. Similar to MS2, it binds to specific RNA sequences and secondary structures. The PP7 RNA recognition motif is different from that of MS2. As a result, PP7 and MS2 may be multiplexed to simultaneously mediate different effects at different genomic loci. For example, an sgRNA targeting locus A may be modified in an MS2 loop that recruits an MS2-VP64 activator, but another sgRNA targeting locus B may be modified with a PP7-SID4X repressor domain. It may be modified with a recruiting, PP7 loop. Thus, within the same cell, dCas9 can mediate orthogonal locus-specific modifications. This principle may be extended to incorporate other orthogonal RNA binding proteins such as Q-beta.

Alternative options for orthogonal inhibition include incorporating a non-coding RNA loop with transactivation inhibitory function into the guide (either at a location similar to the MS2 / PP7 loop incorporated into the guide or at the 3'end of the guide). .. For example, the guide is designed using a non-coding (but known to be inhibitory) RNA loop (eg, an Alu repressor (intraRNA) that interferes with RNA polymerase II in mammalian cells). use). The Alu RNA sequence was located below: instead of the MS2 RNA sequence used herein (eg, in tetraloop and / or stemloop 2); and / or at the 3'end of the guide. This gives a possible combination of MS2, PP7 or Alu at the position of the tetraloop and / or stemloop 2, as well as optionally adding Alu to the 3'end of the guide (with or without a linker). figure).

By using two different aptamers (separate RNAs), activator-adapter protein fusions and repressor-adapter protein fusions are used with different guides to activate expression of one gene and suppress the other. It will be possible to do. They can be applied together, or substantially together, in a multiplexed approach, with different guides. A large number of such modification guides may be used all at the same time, eg, 10 or 20 or 30, but only one Cas9 can be used as a relatively small number of Cas9s can be used with a large number of modified guides. Deliver (or at least the minimum number). The adapter protein can be bound (preferably bound or fused) to one or more activators or one or more repressors. For example, the adapter protein may be associated with a first activator and a second activator. The first and second activators may be the same, but are preferably different activators. For example, one may be VP64 and the other may be p65, but these are just examples and other transcriptional activators are envisioned. Three or more, or four or more activators (or repressors) may be used, but the size of the package may limit more than five different functional domains. It is preferable to use the linker rather than direct fusion to the adapter protein in which two or more functional domains are attached to the adapter protein. Suitable linkers may include GlySer linkers.

It is also envisioned that the entire enzyme-guide complex may be associated with more than one functional domain. For example, there may be more than one functional domain associated with an enzyme, or more than one functional domain associated with a guide (via one or more adapter proteins). Alternatively, there may be one or more functional domains associated with the enzyme and one or more functional domains associated with the guide (via one or more adapter proteins).

The fusion between the adapter protein and the activator or repressor may include a linker. For example, the GlySer linker GGGS may be used. It may be used in 3 ((GGGGS) ₃ ) or 6, 9 or 12 or more iterations to provide the appropriate length as needed. Linkers may be used between RNA-binding proteins and functional domains (activators or repressors) or between CRISPR enzymes (Cas9) and functional domains (activators or repressors). The linker gives the user the right amount of "mechanical flexibility".

Dead guide: A guide RNA containing a dead guide sequence can be used in the present invention.
In one aspect, the invention allows for the formation of a CRISPR complex and successful binding to a target, while at the same time not allowing successful nuclease activity (ie, no nuclease activity / no indel activity) modified guide sequences. I will provide a. For illustration purposes, such modified guide sequences are referred to as "dead guides" or "dead guide sequences." These dead guides or dead guide sequences can be considered catalytically inactive or sterically inactive with respect to nuclease activity. Nuclease activity can be measured using surveyor analysis or deep sequencing, preferably surveyor analysis commonly used in the art. Similarly, dead guide sequences may not be fully involved in productive base pairing in terms of their ability to promote catalytic activity or distinguish between on-target and off-target binding activities. Briefly, the surveyor assay involves purifying and amplifying the CRISPR target site of a gene and forming a heteroduplex with a primer that amplifies the CRISPR target site. After reannealing, the product is treated with SURVEYOR nuclease and SURVEYOR Enhancer S (Transgenemics) according to the manufacturer's recommended protocol, analyzed on a gel and quantified based on relative band strength.

Thus, in a related aspect, the invention is a non-naturally occurring or engineered composition Cas9 CRISPR-Cas system comprising the functional Cas9 described herein, and a guide in which the gRNA comprises a dead guide sequence. An RNA (gRNA), which allows the gRNA to hybridize to a target sequence, so that the Cas9 CRISPR-Cas system becomes the nuclease activity of the non-mutated Cas9 enzyme of this system, as detected by the SURVEYOR assay. It provides a gRNA that is directed to a genomic locus of interest in a cell without the resulting detectable indel activity. For simple purposes, the gRNA contains a dead guide sequence in which the gRNA can hybridize to the target sequence, so that the Cas9 CRISPR-Cas system is detected by the SURVEYOR assay referred to herein as the "dead gRNA". With no detectable result of indel activity from the nuclease activity of the non-mutated Cas9 enzyme of this system, it relates to the genomic locus of interest in the cell. It should be appreciated that any of the gRNAs according to the invention described elsewhere herein can be used as dead gRNAs / gRNAs comprising the dead guide sequences described below herein. Any of the methods, products, compositions, and uses described elsewhere herein are equally applicable to dead gRNAs / gRNAs containing dead guide sequences further detailed below. Further guidance provides the following specific embodiments and embodiments:

The ability of the dead guide sequence to direct sequence-specific binding of the CRISPR complex to the target sequence can be assessed by any suitable assay. For example, transfection of a CRISPR system component sufficient to form a CRISPR complex, including the dead guide sequence to be tested, with a vector encoding a component of the CRISPR sequence, followed by preferred within the target sequence. Cleavage assessments, such as the Surveyor assay described herein, may be provided to host cells with the corresponding target sequence. Similarly, cleavage of the target polynucleotide sequence provides in vitro a component of the CRISPR complex containing the target sequence, the dead guide sequence to be tested and a control guide sequence different from the test dead guide sequence, as well as with the test. It may be evaluated by comparing the rate of binding or cleavage at the target sequence with the control guide sequence reaction. Other assays are also possible and will be apparent to those of skill in the art. A dead guide sequence may be selected to target any target sequence. In some embodiments, the target sequence is a sequence within the genome of a cell.

As further described herein, some structural parameters allow the appropriate framework to reach such dead guides. The dead guide sequences are shorter than the respective guide sequences, resulting in the formation of active Cas9-specific indels. Dead guides are 5%, 10%, 20%, 30%, 40%, 50% shorter than their respective guides directed to the same Cas9, leading to active Cas9-specific indel formation.

As described below and known in the art, one aspect of gRNA-Cas9 specificity is a direct repeat sequence that is appropriately linked to such a guide. In particular, this means that direct repeat sequences are designed depending on the origin of Cas9. Therefore, structural data that can be used for validated dead guide sequences may be used to design Cas9-specific equivalents. For example, structural similarities between the orthologous nuclease domain RuvC of two or more Cas9 effector proteins can be used to introduce equivalent dead guides for the design. Therefore, the dead guides herein may be appropriately modified in length and sequence to reflect such Cas9-specific equivalents, which are successful for the formation and targeting of CRISPR complexes. Allows binding, but at the same time does not allow successful nuclease activity.

The use of dead guides in the context of this specification and in the latest technology provides a surprising and unexpected platform for network biology and / or systems biology in both in vitro, ex vivo, and in vivo applications. Allows gene targeting multiplexing, especially bidirectional multiplex gene targeting. Prior to the use of dead guides, it was difficult and in some cases impossible to address multiple targets, such as activation, suppression, and / or silencing of gene activity. With dead guides, multiple targets, and thus multiple activities, can be addressed, for example, within the same cell, within the same animal, or within the same patient. Such multiplexing may occur simultaneously or may be staggered in the desired time frame.

For example, dead guides here allow the first use of gRNA as a means of gene targeting without the consequences of nuclease activity, while at the same time providing directed means for activation or suppression. Guide RNAs, including dead guides, may be modified to include additional elements in a manner that allows activation or suppression of gene activity, particularly the protein adapters (eg, aptamers) described herein. Allows functional placement of gene effectors (eg, activators or repressors of gene activity). One example is the incorporation of aptamers, as described herein and in the latest technology. By manipulating a gRNA containing a dead guide that incorporates a protein-interaction aptamer (Konermann et al., "Genome-scale transition activation by an engineered CRISPR-Cas9 complex," doi: 10.1038 / nator 14 It is possible to assemble a synthetic transcriptional activation complex consisting of multiple different effector domains. Such can be modeled after a natural transcriptional activation process. For example, an aptamer or effector (eg, activation) that selectively binds to an effector (eg, an activator or repressor; a dimerized MS2 bacteriophage coat protein as a fusion protein with the activator or repressor). A protein that itself binds to a factor or repressor) can be added to the dead gRNA tetraloop and / or stemloop 2. In the case of MS2, the fusion protein MS2-VP64 binds to tetraloop and / or stemloop 2 and then mediates upregulation of transcription of, for example, Neurog2. Other transcriptional activators are, for example, VP64, P65, HSF1, and MyoD1. As a mere example of this concept, the repressive element can be recruited by replacing the MS2 stemloop with a PP7 interaction stemloop.

Accordingly, one embodiment is a gRNA of the invention comprising a dead guide, which further comprises a modification that provides gene activation or suppression as described herein. A dead gRNA may contain one or more aptamers. Aptamers can be specific for gene effectors, gene activators or gene repressors. Alternatively, the aptamer may then be specific for a particular gene effector, gene activator or gene repressor and for the protein that recruits / binds them. If there are multiple sites for recruiting the activator or repressor, the sites are preferably specific for either the activator or the repressor. If there are multiple sites for activator or repressor binding, the sites can be specific for the same activator or repressor. The site can also be specific for different activators or different repressors. Gene effectors, gene activators, and gene repressors may be present in the form of fusion proteins.

In one embodiment, the dead gRNA described herein or the Cas9 CRISPR-Cas complex described herein each protein is associated with one or more functional domains and the adapter protein is at least the dead gRNA thereof. Includes a non-naturally occurring or engineered composition comprising two or more adapter proteins that bind to a separate RNA sequence (s) inserted in one loop.

Accordingly, one embodiment provides a naturally non-existent or engineered composition comprising a guide RNA (gRNA) containing a dead guide sequence capable of hybridizing to a target sequence within a target genomic locus of interest in a cell. However, here the dead guide sequence is Cas9 containing at least one nuclear localization sequence, as defined herein, Cas9 optionally containing at least one mutation, dead gRNA. At least one loop of is modified by the insertion of a separate RNA sequence (s) that bind to one or more adapter proteins, where the adapter protein is associated with one or more functional domains; or Here, the dead gRNA is modified to have at least one non-coding functional loop, where the composition comprises two or more adapter proteins, each protein associated with one or more functional domains.

In certain embodiments, the adapter protein is a fusion protein comprising a functional domain, the fusion protein optionally comprising a linker between the adapter protein and the functional domain, the linker being optionally selected. Includes a GlySer linker.

In certain embodiments, at least one loop of dead gRNA is not modified by insertion of a separate RNA sequence (s) that bind to two or more adapter proteins.

In certain embodiments, the one or more functional domains associated with the adapter protein are transcriptional activation domains.

In certain embodiments, the one or more functional domains associated with the adapter protein are transcriptional activation domains comprising VP64, p65, MyoD1, HSF1, RTA or SET7 / 9.

In certain embodiments, the one or more functional domains associated with the adapter protein are transcriptional repressor domains.

In certain embodiments, the transcriptional repressor domain is the KRAB domain.

In certain embodiments, the transcriptional repressor domain is a NuE domain, NcoR domain, SID domain or SID4X domain.

In certain embodiments, at least one of the one or more functional domains associated with the adapter protein is methylase activity, demethylase activity, transcriptional activation activity, transcriptional repression activity, transcriptional release factor activity, histone modification activity, DNA binding. It has one or more activities including activity, RNA cleavage activity, DNA cleavage activity, or nucleic acid binding activity.

In certain embodiments, the DNA cleavage activity is due to the Fok1 nuclease.

In certain embodiments, the dead gRNA is modified to be in a spatial orientation that allows the functional domain to function in its assigned function after the dead gRNA binds to the adapter protein and further to Cas9 and the target. To.

In certain embodiments, the at least one loop of dead gRNA is a tetraloop and / or loop 2. In certain embodiments, the dead gRNA tetraloop and loop 2 are modified by insertion of separate RNA sequences (s).

In certain embodiments, the insertion of a separate RNA sequence (s) that bind to one or more adapter proteins is an aptamer sequence. In certain embodiments, the aptamer sequence is two or more aptamer sequences specific for the same adapter protein. In certain embodiments, the aptamer sequence is two or more aptamer sequences specific for different adapter proteins.

In certain embodiments, the adapter proteins are MS2, PP7, Qβ, F2, GA, fr, JP501, M12, R17, BZ13, JP34, JP500, KU1, M11, MX1, TW18, VK, SP, FI, ID2, Includes NL95, TW19, AP205, ΦCb5, ΦCb8r, ΦCb12r, ΦCb23r, 7s, PRR1.

In certain embodiments, the cells are eukaryotic cells. In certain embodiments, the eukaryotic cell is a mammalian cell, optionally a mouse cell. In certain embodiments, the mammalian cell is a human cell.

In certain embodiments, the first adapter protein is associated with the p65 domain and the second adapter protein is associated with the HSF1 domain.

In certain embodiments, the composition comprises a Cas9 CRISPR-Cas complex having at least three functional domains, of which at least one is associated with Cas9 and at least two are associated with dead gRNA.

In certain embodiments, the composition further comprises a second gRNA, wherein the second Cas9 CRISPR-Cas system is due to the nuclease activity of the Cas9 enzyme in that system. A raw gRNA that can hybridize to a second target sequence so that it is directed to the second genomic locus of interest in cells with detectable indel activity at the loci.

In certain embodiments, the composition further comprises a plurality of dead gRNAs and / or a plurality of live gRNAs.

One aspect of the invention utilizes the modularity and customizability of a gRNA scaffold to establish a series of gRNA scaffolds with different binding sites (particularly aptamers) for recruiting distinct types of effectors in an orthogonal fashion. That is. Similarly, in a broader conceptual example and description issue, the replacement of MS2 stemloops with PP7 interaction stemloops can be used to bind / recruit inhibitory elements to allow multiplexed bidirectional transcriptional control. You may do it. Therefore, in general, gRNAs containing dead guides can be used to provide multiple transcriptional control and preferred bidirectional transcriptional control. This transcriptional regulation is most preferred among genes. For example, one or more gRNAs containing a dead guide (s) can be used to target activation of one or more target genes. At the same time, one or more gRNAs containing a dead guide (s) may be used in targeting suppression of one or more target genes. Such sequences may be applied in a variety of different combinations, for example, if the target gene is first suppressed and then another target is activated or the selected gene is suppressed at the appropriate time. At the same time, the selected gene is suppressed, followed by further activation and / or suppression. As a result, multiple components of one or more biological systems can be advantageously addressed together.

In some embodiments, the invention provides a nucleic acid molecule (s) encoding a dead gRNA or Cas9 CRISPR-Cas complex or composition described herein.

In one aspect, the invention provides a vector system comprising a nucleic acid molecule encoding a dead guide RNA as defined herein. In certain embodiments, the vector system further comprises a nucleic acid molecule (s) encoding Cas9. In certain embodiments, the vector system further comprises a nucleic acid molecule (s) encoding a (raw) gRNA. In certain embodiments, the nucleic acid molecule or vector is capable of functioning as a nucleic acid molecule encoding a guide sequence (gRNA) and / or Cas9 and / or optionally a nucleic acid molecule encoding a nuclear localization sequence (s). It further contains regulatory elements (s) that can be actuated on eukaryotic cells linked to.

In another embodiment, structural analysis may be used to study the interaction between dead guides and active Cas9 nucleases (which allow DNA binding but not DNA cleavage). In this way, amino acids important for Cas9 nuclease activity are determined. Such amino acid modifications allow for the improvement of the Cas9 enzyme used for gene editing.

A further aspect is to combine the use of the dead guides described herein with other uses of CRISPR as described herein and known in the art. For example, as described herein, a gRNA containing a dead guide (s) for target multiplex gene activation or suppression or target multiplex bidirectional gene activation / suppression, including a guide for maintaining nuclease activity. It may be combined with gRNA. Such gRNAs, including guides that maintain nuclease activity, may or may not further contain modifications (eg, aptamers) that allow suppression of gene activity. Such gRNAs, including guides that maintain nuclease activity, may or may not further contain modifications (eg, aptamers) that allow activation of gene activity. In such a manner, additional means for multiple gene regulation are introduced (eg, multiple gene target activation without nuclease activity / without indel activity simultaneously or in combination with gene target suppression with nuclease activity. Provided).

For example, 1) one or more (eg, 1-50, 1-40) containing a dead guide (s) that are targeted to one or more genes and further modified with a suitable aptamer for recruiting gene activators. Using gRNAs from 1 to 30, 1 to 20, preferably 1 to 10, more preferably 1 to 5); 2) with suitable aptamers targeted to one or more genes and for recruiting gene repressors. With one or more (eg, 1-50, 1-40, 1-30, 1-20, preferably 1-10, more preferably 1-5) gRNAs comprising further modified dead guides (s). It may be combined. 1) and / or 2) are 3) one or more gRNAs targeted by one or more genes (eg, 1-50, 1-40, 1-30, 1-20, preferably 1-10, More preferably, it may be combined with 1 to 5). This combination was then targeted to one or more genes, along with 1) + 2) + 3) and 4), and further modified with the appropriate aptamer for recruitment of gene activators (1) or more ( For example, it is carried out using 1 to 50, 1 to 40, 1 to 30, 1 to 20, preferably 1 to 10, more preferably 1 to 5) gRNA. This combination was then targeted to one or more genes, along with 1) + 2) + 3) + 4) and 5), and further modified with the appropriate aptamer for recruiting gene repressors. (For example, 1 to 50, 1 to 40, 1 to 30, 1 to 20, preferably 1 to 10, more preferably 1 to 5) gRNA is used. As a result, various uses and combinations are included in the present invention. For example, combination 1) +2); combination 1) +3); combination 2) +3); combination 1) +2) +3); combination 1) +2) +3) +4); combination 1) +3) +4); combination 2) +3 ) +4); Combination 1) +2) +4); Combination 1) +2) +3) +4) +5); Combination 1) +3) +4) +5); Combination 2) +3) +4) +5); Combination 1) +2) +4 ) +5); Combination 1) +2) +3) +5); Combination 1) +3) +5); Combination 2) +3) +5); Combination 1) +2) +5).

In one aspect, the invention provides an algorithm for designing, evaluating, or selecting a dead guide RNA targeting sequence (dead guide sequence) for directing the Cas9 CRISPR-Cas system to a target locus. In particular, it was determined that the specificity of the dead guide RNA is related to and can be optimized i) the content of GC and ii) the length of the targeted sequence. In one aspect, the invention provides an algorithm for designing or evaluating a dead guide RNA target sequence that minimizes off-target binding or interaction of dead guide RNA. In one embodiment of the invention, the algorithm for selecting a dead guide RNA targeting sequence to direct a CRISPR system to a locus in an organism a) locates one or more CRISPR motifs within the locus. Then, the 20 nt sequence downstream of each CRISPR motif is i) determine the GC content of the sequence; and ii) whether there is an off-target match of the 15 downstream nucleotides closest to the CRISPR motif in the genome of the organism. And c) if the GC content of the sequence is 70% or less and no off-target match is identified, it involves analysis by selecting the 15 nucleotide sequence to be used in the dead guide RNA. In one embodiment, if the GC content is 60% or less, the sequence is selected for the target sequence. In certain embodiments, when the GC content is 55% or less, 50% or less, 45% or less, 40% or less, 35% or less or 30% or less, the sequence is selected for the target sequence. In one embodiment, two or more sequences of loci are analyzed and the sequence with the lowest GC content, or the next lowest GC content, or the next lowest GC content is selected. In one embodiment, if an off-target match is not identified in the genome of the organism, the sequence is selected for the target sequence. In one embodiment, if no off-target match is identified in the regulatory sequence of the genome, the targeting sequence is selected.

In one aspect, the invention provides a method of selecting a dead guide RNA targeting sequence for directing a functionalized CRISPR system to an organism's locus, wherein a) one or more loci. Place the CRISPR motifs of; b) 20 nt sequences downstream of each CRISPR motif as follows: i) determine the GC content of the sequence; and ii) off the first 15 nt of the sequence within the genome of the organism. Determining if there is a target match; c) If the GC content of the sequence is 70% or less and no off-target match is identified, analyze by selecting the sequence to be used in the guide RNA. Including. In one embodiment, if the GC content is 50% or less, the sequence is selected. In one embodiment, if the GC content is 40% or less, the sequence is selected. In one embodiment, if the GC content is 30% or less, the sequence is selected. In one embodiment, two or more sequences are analyzed and the sequence with the lowest GC content is selected. In one embodiment, off-target matching is determined in the regulatory sequence of the organism. In some embodiments, the locus is a regulatory region. One aspect provides a dead guide RNA containing a targeted sequence selected according to the method described above.

In one aspect, the invention provides a dead guide RNA for targeting a functionalized CRISPR system to an organism locus. In one embodiment of the invention, the dead guide RNA has a CG content of 70% or less in the target sequence and the first 15 nt of the target sequence is an off-target downstream from the CRISPR motif of the regulatory sequence of another locus of the organism. Contains target sequences that do not match the sequence. In certain embodiments, the GC content of the targeted sequence is 60% or less, 55% or less, 50% or less, 45% or less, 40% or less, 35% or less or 30% or less. In certain embodiments, the GC content of the targeted sequence is 70% -60% or 60% -50% or 50% -40% or 40% -30%. In one embodiment, the target sequence has the lowest CG content of any potential target sequence at the locus.

In embodiments of the invention, the first 15nt of the dead guide coincides with the target sequence. In another embodiment, the first 14 nt of the dead guide matches the target sequence. In another embodiment, the first 13nt of the dead guide matches the target sequence. In another embodiment, the first 12 nt of the dead guide matches the target sequence. In another embodiment, the first 11nt of the dead guide matches the target sequence. In another embodiment, the first 10 nt of the dead guide matches the target sequence. In one embodiment of the invention, the first 15 nt of the dead guide does not coincide with the off-target sequence downstream of the CRISPR motif within the regulatory region of another locus. In other embodiments, the first 14 nt of the dead guide, or the first 13 nt, or the first 12 nt of the guide, or the first 11 nt of the dead guide, or the first 10 nt of the dead guide is a regulatory region of another locus. Does not match the off-target sequence downstream of the CRISPR motif. In other embodiments, the first 15 nt, or 14 nt, or 13 nt, or 12 nt, or 11 nt of the dead guide does not match the off-target sequence downstream from the CRISPR motif of the genome.

In certain embodiments, the dead guide RNA comprises an additional nucleotide at the 3'end that does not match the target sequence. Therefore, dead guide RNAs containing the first 15 nt, or 14 nt, or 13 nt, or 12 nt, or 11 nt downstream of the CRISPR motif have 3'end lengths of 12 nt, 13 nt, 14 nt, 15 nt, 16 nt, 17 nt, 18 nt, 19 nt. , 20 nt, or more can be extended.

The present invention provides a method of directing a Cas9 CRISPR-Cas system to a locus, including but not limited to a dead Cas9 (dCas9) or a functionalized Cas9 system (which may include a functionalized Cas9 or a functionalized guide). In one aspect, the invention provides a method of selecting a dead guide RNA targeting sequence and directing a functionalized CRISPR system to an organism locus. In one aspect, the invention provides a method for selecting a dead guide RNA targeting sequence and achieving gene regulation of a target locus by a functionalized Cas9 CRISPR-Cas system. In certain embodiments, this method is used to result in target gene regulation with minimal off-target effects. In one aspect, the invention provides a method of selecting two or more dead guide RNA targeting sequences by a functionalized Cas9 CRISPR-Cas system to achieve gene regulation of two or more target loci. In certain embodiments, this method is used to achieve regulation of two or more target loci while minimizing off-target effects.

In one aspect, the invention provides a method of selecting a dead guide RNA targeting sequence for directing functionalized Cas9 to an organism's locus, which method: a) one or more CRISPRs at the locus. Placing the motifs; b) the downstream sequence of each CRISPR motif, i) selecting 10 to 15 nt adjacent to the CRISPR motif, ii) determining the GC content of this sequence; and c) this. When the GC content of the sequence is 40% or more, it comprises analyzing by selecting a sequence of 10-15 nt as the targeting sequence used in the guide RNA. In one embodiment, if the GC content is 50% or greater, the sequence is selected. In one embodiment, if the GC content is 60% or higher, the sequence is selected. In one embodiment, if the GC content is 70% or higher, the sequence is selected. In one embodiment, two or more sequences are analyzed and the sequence with the highest GC content is selected. In one embodiment, the method further comprises adding a nucleotide to the 3'end of a selected sequence that does not match the sequence downstream of the CRISPR motif. One aspect provides a dead guide RNA containing a targeted sequence selected according to the method described above.

In one aspect, the invention provides a dead guide RNA for directing a functionalized CRISPR system to an organism's locus, where the target sequence of the dead guide RNA is 10-15 flanking the CRISPR motif of the locus. It consists of nucleotides, where the CG content of the target sequence is greater than or equal to 50%. In certain embodiments, the dead guide RNA further comprises a nucleotide added to the 3'end of a targeting sequence that does not match the sequence downstream of the CRISPR motif at the locus.

In one aspect, the invention provides a single effector that is induced at one or more, or two or more loci. In certain embodiments, the effector is associated with Cas9, and one or more, or two or more selected dead guide RNAs are used to select one or more Cas9-related effectors. Instruct the target locus. In certain embodiments, the effector, when complexed with the Cas9 enzyme, is associated with one or more or two or more selected dead guide RNAs, each of which is a selected dead guide RNA. Localize the associated effector to a dead guide RNA target. One non-limiting example of such a CRISPR system regulates the activity of one or more or two or more loci that are regulated by the same transcription factor.

In one aspect, the invention provides two or more effectors that are directed to one or more loci. In certain embodiments, two or more dead guide RNAs are used, each of the two or more effectors is associated with a selected dead guide RNA, and each of the two or more effectors is a selection of that dead guide RNA. Localized to the targeted target. One non-limiting example of such a CRISPR system regulates the activity of one or more or two or more loci that are regulated by different transcription factors. Thus, in one non-limiting embodiment, two or more transcription factors are localized to different regulatory sequences of a single gene. In another non-limiting embodiment, two or more transcription factors are localized to different regulatory sequences of different genes. In certain embodiments, one transcription factor is an activator. In certain embodiments, one transcription factor is an inhibitor. In certain embodiments, one transcription factor is an activator and another is an inhibitor. In certain embodiments, loci expressing different components of the same regulatory pathway are regulated. In certain embodiments, loci expressing components of different regulatory pathways are regulated.

In some embodiments, the invention also provides methods and algorithms for designing and selecting dead guide RNAs specific for target DNA cleavage or target binding and gene regulation mediated by the active Cas9 CRISPR-Cas system. In certain embodiments, the Cas9 CRISPR-Cas system provides orthogonal gene regulation using active Cas9 that cleaves the target DNA at one locus and at the same time binds to another locus to promote regulation.

In some embodiments, the invention provides a method of selecting a dead guide RNA targeting sequence for directing to an organism's locus without cleaving functionalized Cas9, which a) one or more at the locus. CRISPR motifs are placed; b) downstream sequences of each CRISPR motif are analyzed by i) selecting 10 to 15 nt adjacent to the CRISPR motif, ii) determining the GC content of the sequence. C) When the GC content of the sequence is 30% or more and 40% or more, it includes selecting a 10 to 15 nt sequence as the targeting sequence to be used in the dead guide RNA. In certain embodiments, the GC content of the targeted sequence is 35% or greater, 40% or greater, 45% or greater, 50% or greater, 55% or greater, 60% or greater, 65% or greater, or 70% or greater. In certain embodiments, the GC content of the targeted sequence is 30% -40% or 40% -50% or 50% -60% or 60% -70%. In one embodiment of the invention, two or more sequences of loci are analyzed and the sequence with the highest GC content is selected.

In one embodiment of the invention, the portion of the target sequence for which the GC content is assessed is 10-15 contiguous nucleotides of the 15 target nucleotides closest to PAM. In certain embodiments of the invention, some of the guides are 10-11 nucleotides or 11-12 nucleotides or 12-13 nucleotides out of the 15 nucleotides with the closest GC content to PAM, or 13 or 14 or 15 contiguous nucleotides. Is considered to be.

In one aspect, the invention further provides an algorithm for identifying dead guide RNAs that promote CRISPR locus cleavage while avoiding functional activation or inhibition. It has been observed that an increase in GC content of 16-20 nucleotide dead guide RNA is consistent with an increase in DNA cleavage and a decrease in functional activation.

It is also demonstrated herein that the efficiency of functionalized Cas9 can be increased by adding nucleotides to the 3'end of the guide RNA that does not match the target sequence downstream of the CRISPR motif. For example, in the case of a dead guide RNA having a length of 11 to 15 nt, the shorter the guide, the less likely it is to promote target cleavage, but the efficiency of promoting binding and functional control of the CRISPR system may also decrease. In certain embodiments, the addition of nucleotides that do not match the target sequence to the 3'end of the dead guide RNA increases activation efficiency, but does not increase unwanted target cleavage. In some embodiments, the invention also provides methods and algorithms for identifying improved dead guide RNAs that effectively promote CRISPRP system functions in DNA binding and gene regulation and do not promote DNA cleavage. Thus, in certain embodiments, the invention comprises the first 15 nt, or 14 nt, or 13 nt, or 12 nt, or 11 nt downstream of the CRISPR motif and targets 12 nt, 13 nt, 14 nt, 15 nt, 16 nt, 17 nt, 18 nt. , 19 nt, 20 nt, or more mismatched nucleotides provide a dead guide RNA whose length is extended at the 3'end.

In one aspect, the invention provides a method of performing selective orthogonal gene regulation. As understood from the disclosure herein, the dead guide selection according to the invention is a functional Cas9 CRISPR-for regulating locus transcription, eg, by activation or inhibition, given the guide length and GC content. It provides effective and selective transcriptional control by the Cas system and minimizes off-target effects. Accordingly, the present invention also provides effective orthogonal regulation of two or more target loci by providing effective regulation of individual target loci.

In certain embodiments, orthogonal gene regulation is by activation or inhibition of two or more target loci. In certain embodiments, orthogonal gene regulation is by activation or inhibition of one or more target loci, and cleavage of one or more target loci.

In one aspect, the invention is naturally present, comprising one or more dead guide RNAs disclosed or made according to the methods or algorithms described herein in which the expression of one or more gene products has been altered. Don't provide cells containing the Cas9 CRISPR-Cas system. In one embodiment of the invention, the intracellular expression of two or more gene products is altered. The present invention also provides cell lines derived from such cells.

In one aspect, the invention comprises one or more cells comprising a non-naturally occurring Cas9 CRISPR-Cas system comprising one or more dead guide RNAs disclosed or made according to the methods or algorithms described herein. Provides multicellular organisms, including. In one aspect, the invention is a cell, cell line, or cell line comprising a non-naturally occurring Cas9 CRISPR-Cas system comprising one or more dead guide RNAs disclosed or made according to the methods or algorithms described herein. Provides products derived from multicellular organisms.

A further aspect of the invention is the use of a gRNA comprising the dead guides (s) described herein, optionally with a gRNA comprising the guides (s) described herein or in the latest art. Combined systems such as cells, transgenic animals, transgenic mice, inducible transgenic animals, inducible transgenic mice (manipulated for either overexpression of Cas9 or preferably knock-in of Cas9). Combined use. As a result, a single system (eg, transgenic animals, cells) can serve as the basis for multiple genetic modification in system / network biology. For dead guide reasons, this is now possible both in vitro, in vivo and in vivo.

For example, once Cas9 is provided, one or more dead gRNAs may be provided to direct multiple gene regulation, preferably multiple bidirectional gene regulation. One or more dead gRNAs can be provided in a spatially and temporally appropriate manner where necessary or desirable (eg, tissue-specific induction of Cas9 expression). Both gRNAs containing dead guides or gRNAs containing guides are equally effective because the transgenic / inducible Cas9 is provided (eg, expressed) to the cells, tissues, and animals of interest. Similarly, a further aspect of the invention is a gRNA comprising a dead guide (s) described herein, optionally in combination with a gRNA comprising a guide (s) described herein, or. It is used in combination with the latest technology and systems designed for knockout Cas9 CRISPR-Cas (eg cells, transgenic animals, transgenic mice, inducible transgenic animals, inducible transgenic mice).

As a result, the combination of the dead guides described herein with the CRISPR applications described herein and the CRISPR applications known in the art is highly for multiple screening of systems (eg, network biology). It provides efficient and accurate means. Such screening allows, for example, to identify specific combinations of gene activity to identify diseases (eg, on / off combinations), especially genes responsible for gene-related diseases. A preferred use for such screening is cancer. Similarly, screening for the treatment of such diseases is also included in the invention. Cells or animals are exposed to abnormal conditions and may have disease or pathological effects. Candidate compositions may be provided and screened for efficacy in the desired multiple environment. For example, a patient's cancer cells may be screened for which gene combination leads to death and this information may be used to establish appropriate treatments.

In one aspect, the invention provides a kit comprising one or more of the components described herein. The kit may include the dead guides described herein with or without the guides described herein.

The structural information provided herein allows the investigation of dead gRNA interactions with the target DNA and Cas9, allowing manipulation or modification of the dead gRNA structure and optimizing the functionality of the entire Cas9 CRISPR-Cas system. do. For example, by inserting an adapter protein that can bind to RNA, the loop of dead gRNA may be extended without colliding with the Cas9 protein. These adapter proteins may further recruit effector proteins or fusions containing one or more functional domains.

In some preferred embodiments, the functional domain is a transcriptionally activated domain, preferably VP64. In some embodiments, the functional domain is a transcriptional repression domain, preferably KRAB. In some embodiments, the transcriptional repression domain is a SID, or a concatemer of the SID (eg, SID4X). In some embodiments, the functional domain is an epigenetic modification domain, which results in the provision of an epigenetic modification enzyme. In some embodiments, the functional domain is the activation domain, which may be the P65 activation domain.

Aspects of the invention are that the above elements are included in a single composition or in individual compositions. These compositions may advantageously be applied to the host to elicit a functional effect at the genomic level.

In general, dead gRNAs are modified in a manner that provides a binding site (eg, an aptamer) specific for an adapter protein (eg, via a fusion protein) that contains one or more functional domains that bind. The modified dead gRNA is bound to the adapter protein when the dead gRNA forms a CRISPR complex (ie, when Cas9 binds to the dead gRNA to the target), and the functional domain of the adapter protein is valid for the attributed function. It is modified so that it is arranged in a spatial orientation that is favorable to the protein. For example, if the functional domain is a transcriptional activator (eg, VP64 or p65), the transcriptional activator is spatially oriented to allow it to influence the transcription of the target. Similarly, transcriptional repressors are favorably placed to affect the transcription of the target, and nucleases (eg, Fok1) are favorably placed to cleave or partially cleave the target.

Those of skill in the art allow binding of adapters + functional domains, but do not allow proper positioning of adapters + functional domains (eg, due to steric hindrance within the three-dimensional structure of the CRISPR complex). Understand that the modification to is an unintended modification. As described herein, the one or more modified dead gRNAs are tetraloop, stemloop 1, stemloop 2, or stemloop 3, preferably tetraloop or stemloop 2, most preferably. It may be modified with both tetraloop and stemloop 2.

As described herein, functional domains include, for example, methylase activity, demethylase activity, transcriptional activation activity, transcriptional repressive activity, transcriptional release factor activity, histone modification activity, RNA cleavage activity, DNA cleavage activity, nucleic acid. It can be one or more domains from the group consisting of binding activity and molecular switches (eg, photoinducible). In some cases, it is advantageous to further provide at least one NLS. In some cases, it is advantageous to place the NLS at the N-terminus. When two or more functional domains are included, the functional domains may be the same or different.

The dead gRNA may be designed to contain multiple binding recognition sites (eg, aptamers) specific for the same or different adapter proteins. The dead gRNA may be designed to bind to the promoter region of the -1000- + 1 nucleic acid, preferably -200 nucleic acid, upstream of the transcription initiation site (ie, TSS). A modified dead gRNA that improves the functional domain that affects gene activation (eg, transcriptional activator) or gene inhibition (eg, transcriptional repressor) by this arrangement is included in the composition. It may be one or more modified dead gRNAs targeting one or more target loci (eg, at least 1 gRNA, at least 2 gRNA, at least 5 gRNA, at least 10 gRNA, at least 20 gRNA, at least 30 gRNA, at least 50 gRNA).

The adapter protein can be any number of proteins that bind to an aptamer or recognition site introduced into a modified dead gRNA and allow proper positioning of one or more functional domains, once the dead gRNA is a CRISPR. When incorporated into a complex, it affects the target with an attributed function. As described in detail in this application, it may be a coat protein, preferably a bacteriophage coat protein. Functional domains associated with such adapter proteins (eg, fusion protein morphology) include, for example, methylase activity, demethylase activity, transcriptional activation activity, transcriptional repression activity, transcriptional release factor activity, histone modification activity, RNA cleavage. It may include one or more domains from the group consisting of activity, DNA cleavage activity, nucleic acid binding activity, and molecular switch (eg, photoinducible, etc.). Preferred domains are Fok1, VP64, P65, HSF1 and MyoD1. If the functional domain is a transcriptional activator or transcriptional repressor, it is advantageous that at least NLS is preferably further donated to the N-terminus. When two or more functional domains are included, the functional domains may be the same or different. Adapter proteins may utilize known linkers to bind such functional domains.

Therefore, the modified dead gRNA, Cas9 (with or without functional domain) (with or without functional domain), and the binding protein with one or more functional domains are each individually included in the composition. It can be administered to the host individually or collectively. Alternatively, these components may be provided in a single composition for administration to a host. Administration to the host can be performed via viral vectors known to those of skill in the art or described herein for delivery to the host (eg, lentiviral vector, adenoviral vector, AAV vector). .. As described herein, the use of different selectable markers (eg, for lentiviral gRNA selection) and the concentration of gRNA (eg, depending on whether multiple gRNAs are used) are improved. It can be advantageous to bring out the effect.

Based on this concept, several variations, including DNA cleavage, gene activation, or gene inactivation, are suitable for inducing genomic locus events. Using the provided composition, one of ordinary skill in the art will advantageously and specifically induce one or more genomic locus events by targeting a single or multiple loci having the same or different functional domains. Can be. The compositions are screened in an intracellular library and functional modeling in vivo (eg, gene activation and functional identification of lincRNA; functional acquisition modeling; loss of function modeling; cell lines and trans for optimization and screening purposes. It can be applied to a wide variety of methods for the use of the compositions of the invention to establish a genetic animal).

The invention includes the use of the compositions of the invention for establishing and utilizing conditional or inducible CRISPR transgenic cells / animals that were not considered prior to the invention or filing. For example, the target cell contains Cas9 conditionally or inducibly (eg, in the form of a Cre-dependent construct) and / or conditionally or inductively contains an adapter protein of a vector that is introduced into the target cell. Upon expression, the vector expresses what induces or triggers the state of Cas9 expression and / or adapter expression in the target cell. Induced genomic events that are affected by functional domains by applying the teachings and compositions of the invention to known methods of creating CRISPR complexes are also embodiments of the invention. An example of this is the creation of a CRISPR knock-in / conditional transgenic animal (eg, a mouse comprising a Lux-Stop-polyA-Lox (LSL) cassette), as well as one or more modified dead described herein. Subsequent delivery of one or more compositions that provide gRNA (eg, about -200 nucleotides to the TSS of the target gene of interest for gene activation) (eg, recognized by a coat protein such as MS2 1). Modified dead gRNAs containing one or more aptamers), one or more adapter proteins described herein (MS2-binding proteins linked to one or more VP64s) and means for inducing conditional animals ( For example, Cre recombinase to make Cas9 expression inducible. Alternatively, the adapter protein may be provided as a conditional or inducible element with a conditional or inducible Cas9 to provide an effective model for screening purposes, which is a particular dead in a number of applications. It is advantageous that it requires minimal design and administration of gRNA.

In another aspect, the dead guide is further modified to improve specificity. Protected dead guides may be synthesized, which introduces secondary structure at the 3'end of the dead guides and improves specificity. The protected guide RNA (pgRNA) contains a guide sequence that can hybridize to the target sequence of the genomic locus of interest in the cell, and a protector strand, which is optionally complementary to the guide sequence. This guide sequence may be partially hybridizable to the protector chain. The pgRNA optionally contains extended sequences. The thermodynamics of pgRNA-target DNA hybridization is determined by the number of complementary bases between the guide RNA and the target DNA. By adopting "thermodynamic protection", the specificity of dead gRNA can be improved by adding a protector sequence. For example, one method adds complementary protector strands of various lengths to the 3'end of the guide sequence within the dead gRNA. As a result, the protector strand binds to at least a portion of the dead gRNA to provide a protected gRNA (pgRNA). The dead gRNA reference herein can then be readily protected using the described embodiments, resulting in a pgRNA. The protector strand can be either a separate RNA transcript or a strand bound to the 3'end of the dead gRNA guide sequence or a chimeric form.

Use in tandem guides and multiplex (tandem) targeting approaches We have shown that the CRISPR enzyme defined herein can use more than one RNA guide without loss of activity. .. Thereby, the CRISPR enzyme, system as defined herein for targeting multiple DNA targets, genes or loci using a single enzyme, system or complex as defined herein. Or the complex can be used. Guide RNAs may be sequenced in tandem or, optionally, separated by nucleotide sequences such as direct repeats as defined herein. The position of the different guide RNAs is that the tandem does not affect the activity. Note that the terms "CRISPR-Cas", "CRISPR-Cas complex", "CRISPR complex" and "CRISPR" are used interchangeably. The terms "CRISPR enzyme", "Cas enzyme", or "CRISPR-Cas enzyme" may also be used interchangeably. In a preferred embodiment, the CRISPR enzyme, CRISP-Cas enzyme or Cas enzyme is Cas9, or any one of its modifications or mutation variants described elsewhere herein.

In one aspect, the invention is a non-naturally occurring or engineered CRISPR enzyme, preferably a class 2 CRISPR enzyme, preferably a V-type or VI-type CRISPR enzyme, as described elsewhere herein. , For example, Cas9, as described elsewhere herein, used for tandem or multiple targeting, without limitation. It should be appreciated that any of the CRISPR (or CRISPR-Cas or Cas) enzymes, complexes, or systems according to the invention described elsewhere herein can be used in such an approach. Any method, product, composition and use described elsewhere herein is equally applicable to the multiplex or tandem targeting approaches further detailed below. Further guidance provides the following specific embodiments and embodiments:

In one aspect, the invention provides the use of Cas9 enzymes, complexes or systems as defined herein for targeting multiple loci. In one embodiment, this can be established by using multiple (tandem or multiplex) guide RNA (gRNA) sequences.

In one aspect, the invention provides a method of using one or more elements of a Cas9 enzyme, complex or system as defined herein for tandem or multiplex targeting, wherein the CRISPR system. Contains a large number of guide RNA sequences. Preferably, the gRNA sequence is separated by a nucleotide sequence such as a direct repeat sequence as defined elsewhere herein.

The Cas9 enzyme, system or complex as defined herein provides an effective means for modifying multiple target polynucleotides. Cas9 enzymes, systems or complexes as defined herein are diverse, including modification (eg, deletion, insertion, translocation, inactivation, activation) of one or more target polynucleotides in multiple cell types. It has great usefulness. Thus, Cas9 enzymes, systems, or complexes as defined herein include targeting multiple loci within a single CRISPR system, eg, gene therapy, drug screening, disease diagnosis, etc. And has a wide range of uses in prognosis.

In one aspect, the invention comprises multiple nucleic acids such as Cas9 enzymes, systems or complexes as defined herein, i.e., Cas9 proteins having at least one destabilizing domain associated thereto, and DNA molecules. A Cas9 CRISPR-Cas complex having a plurality of targeting guide RNAs is provided, whereby each of the plurality of guide RNAs specifically targets its corresponding nucleic acid molecule, eg, a DNA molecule. Each nucleic acid molecule target, eg, a DNA molecule, may encode a gene product or contain a locus. Therefore, multiple guide RNAs can be used to target multiple loci or genes. In some embodiments, the Cas9 enzyme can cleave the DNA molecule encoding the gene product. In some embodiments, the expression of the gene product is altered. Cas9 protein and guide RNA do not occur naturally together. The present invention includes a guide RNA containing a guide sequence arranged in tandem. The invention further comprises the coding sequence for the Cas9 protein, which is codon-optimized for expression in eukaryotic cells. In a preferred embodiment, the eukaryotic cell is a mammalian cell, a plant cell or a yeast cell, and in a more preferred embodiment, the mammalian cell is a human cell. Expression of gene products may be reduced. The Cas9 enzyme can form part of a CRISPR system or complex and further exceeds a series of 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 25, 25, 30, or 30. It contains guide RNAs (gRNAs) located in tandem containing guide sequences, each of which can specifically hybridize to the target sequence of the genomic locus of interest in the cell. In some embodiments, the functional Cas9 CRISPR system or complex binds to multiple target sequences. In some embodiments, the functional CRISPR system or complex may edit multiple target sequences, eg, the target sequence may contain genomic loci, and in some embodiments there are changes in gene expression. obtain. In some embodiments, the functional CRISPR system or complex may comprise additional functional domains. In some embodiments, the invention provides a method of altering or altering the expression of a plurality of gene products. The method may include introducing into a cell comprising or expressing the target nucleic acid, eg, a DNA molecule; eg, the target nucleic acid may encode a gene product. And may provide expression of a gene product (eg, a regulatory sequence).

In a preferred embodiment, the CRISPR enzyme used for multiple targeting is Cas9, or the CRISPR system or complex comprises Cas9. In some embodiments, the CRISPR enzyme used for multiple targeting is AsCas9, or the CRISPR system or complex used for multiple targeting comprises AsCas9. In some embodiments, the CRISPR enzyme is LbCas9, or the CRISPR system or complex comprises LbCas9. In some embodiments, the Cas9 enzyme used for multiple targeting cleaves both strands of DNA to produce double-strand breaks (DSBs). In some embodiments, the CRISPR enzyme used for multiple targeting is nickase. In some embodiments, the Cas9 enzyme used for multiple targeting is dual nickase. In some embodiments, the Cas9 enzyme used for multiple targeting is a Cas9 enzyme, such as the DD Cas9 enzyme defined elsewhere herein.

In some common embodiments, the Cas9 enzyme used for multiple targeting is associated with one or more functional domains. In some more specific embodiments, the CRISPR enzyme used for multiple targeting is dead Cas9 as defined elsewhere herein.

In some embodiments, the invention provides a means of delivering a Cas9 enzyme, system or complex for use with multiple targeting or polynucleotides defined herein. Non-limiting examples of such delivery means are, for example, particles (s) that deliver the components of the complex (s), vectors containing the polynucleotides (s) discussed herein (s). Multiple) (eg, providing a nucleotide encoding a CRISPR enzyme and encoding a CRISPR complex). In some embodiments, the vector may be a plasmid or viral vector, such as AAV, or a lentivirus. Temporary transfection with plasmids, eg, to HEK cells, especially given the size limitation of AAV and the potential for additional guide RNA to reach the upper limit while Cas9 is compatible with AAV. Can be advantageous.

Also provided are models that constitutively express the Cas9 enzyme, complex or system used herein for use in multiple targeting. The organism may be transgenic, transfected with this vector, or may be a progeny of such transfected organism. In a further aspect, the invention provides a composition comprising the CRISPR enzymes, systems and complexes defined herein, or the polynucleotides or vectors described herein. Also provided are Cas9 CRISPR systems or complexes containing multiple guide RNAs, preferably in tandem-arranged form. The different guide RNAs may be separated by a nucleotide sequence such as a direct repeat sequence.

Also, a method of treating a subject, eg, a subject in need thereof, transforming the subject with a Cas9 CRISPR system or complex or a polynucleotide encoding any polynucleotide or vector described herein. Also provided are methods that include directing gene editing and administering them to a subject. Suitable repair templates may also be provided and may be delivered, for example, by a vector containing the repair template. A method of treating a subject, eg, a subject in need thereof, which directs transcriptional activation or suppression of multiple target loci by transforming the subject with the polynucleotides or vectors described herein. Also provided is that the polynucleotide or vector encodes or comprises a Cas9 enzyme, complex or system containing multiple guide RNAs, preferably in a tandem arrangement. For example, in cell culture, it will be understood that the term "subject" may be replaced by the phrase "cell or cell culture" if any treatment is being performed with Exvivo.

A composition comprising a Cas9 enzyme, complex or system, preferably comprising multiple guide RNAs sequenced in tandem, for use in any of the therapeutic methods defined herein, or preferably. Also provided is a polynucleotide or vector encoding or containing the Cas9 enzyme, complex or system comprising multiple guide RNAs sequenced in tandem. Kits of parts containing such compositions may be provided. The use of such compositions in the manufacture of pharmaceuticals for such therapeutic methods is also provided. The use of the Cas9 CRISPR system in screening is also provided by the present invention, eg, gain of function screening. Cells that are artificially forced to overexpress a gene can downregulate (reestablish equilibrium) the gene over time, for example, through a negative feedback loop. By the time screening is initiated, unregulated genes may be reduced again. Inducible Cas9 activators allow transcription to be directed immediately prior to screening, thus minimizing the possibility of false negative hits. Therefore, by using the present invention in screening, such as gain of function screening, the chances of false negative results can be minimized.

In one aspect, the invention provides an engineered non-naturally occurring CRISPR system comprising a Cas9 protein and multiple guide RNAs, each specifically targeting a DNA molecule encoding an intracellular gene product. Each of the numerous guide RNAs targets a specific DNA molecule that encodes the gene product, and the Cas9 protein cleaves the target DNA molecule that encodes the gene product, thereby altering the expression of the gene product; and CRISPR. Proteins and guide RNAs do not naturally occur together. The present invention comprises a plurality of guide RNAs comprising a plurality of guide sequences, preferably separated by a nucleotide sequence such as a direct repeat sequence and optionally fused to a tracr sequence. In one embodiment of the invention, the CRISPR protein is a V-type or VI-type CRISPR-Cas protein, and in a more preferred embodiment, the CRISPR protein is a Cas9 protein. The invention further includes Cas9 proteins that are codon-optimized for expression in eukaryotic cells. In a preferred embodiment, the eukaryotic cell is a mammalian cell, and in a more preferred embodiment, the mammalian cell is a human cell. In a further embodiment of the invention, the expression of the gene product is reduced.

In another aspect, the invention is a first regulatory element operably linked to multiple Cas9 CRISPR-based guide RNAs, each specifically targeting a DNA molecule encoding a gene product, and a CRISPR protein. Provided is an engineered non-naturally occurring vector system comprising one or more vectors containing a second regulatory element operably linked to encode. Both regulatory elements can be located in the same or different vectors of the system. Multiple guide RNAs target multiple DNA molecules encoding multiple gene products in the cell, and the CRISPR protein can cleave multiple DNA molecules encoding the gene product (if one or both strands are cleaved). It may or may not have substantially nuclease activity), thereby altering the expression of multiple gene products; and the CRISPR protein and multiple guide RNAs are not naturally present together. In a preferred embodiment, the CRISPR protein is a Cas9 protein, an optionally optimized codon for expression in eukaryotic cells. In a preferred embodiment, the eukaryotic cell is a mammalian cell, a plant cell or a yeast cell, and in a more preferred embodiment, the mammalian cell is a human cell. In a further embodiment of the invention, the expression of each of the plurality of gene products is altered, preferably reduced.

In one aspect, the invention provides a vector system comprising one or more vectors. In some embodiments, the system is (a) a first regulatory element operably linked to the direct repeat sequence, and 1 upstream or downstream (if applicable) of the direct repeat sequence. One or more insertion sites for inserting one or more guide sequences, and when expressed, one or more guide sequences (s) are one or more target sequences (s) of eukaryotic cells. ) Is induced for sequence-specific binding of the CRISPR complex, and the CRISPR complex is complexed with one or more guide sequences (s) that hybridize to one or more target sequences (s). Insertion site comprising Cas9 enzyme; and (b) operably linked to an enzyme coding sequence encoding the Cas9 enzyme, preferably comprising at least one nuclear localization sequence and / or at least one NES. Includes a second regulatory element; where components (a) and (b) are placed in the same or different vectors of the system. If applicable, tracr sequences are also provided. In some embodiments, the component (a) further comprises two or more guide sequences operably linked to the first regulatory element, where, when expressed, two or more. Each of the guide sequences directs sequence-specific binding of the Cas9 CRISPR complex to different target sequences in eukaryotic cells. In some embodiments, the CRISPR complex has one or more nuclear localizations of sufficient intensity to drive the accumulation of the Cas9 CRISPR complex in a detectable amount in or out of the nucleus of the eukaryotic cell. Includes a chemical sequence and / or one or more NES. In some embodiments, the first regulatory element is the polymerase III promoter. In some embodiments, the second regulatory element is the polymerase II promoter. In some embodiments, each guide sequence is at least 16, 17, 18, 19, 20, 25 nucleotides, or 16-30, or 16-25, or 16-20 nucleotides in length.

The recombinant expression vector may contain a polynucleotide encoding a Cas9 enzyme, system or complex for use in multiple targets as defined herein in a form suitable for nucleic acid expression in host cells. This recombinant expression vector contains one or more regulatory elements that can be selected based on the host cell used for expression, which is operably linked to the nucleic acid sequence to be expressed. Means that. In a recombinant expression vector, "operably linked" means that the nucleotide sequence of interest is expressed in a regulatory element (s) of the nucleotide sequence (eg, an in vitro transcription / translation system, or when the vector is introduced into a host cell). It is intended to mean that they are linked in a manner that allows (in the host).

In some embodiments, the host cell is transiently or in one or more vectors comprising a polynucleotide encoding a Cas9 enzyme, system or complex for use in multiple targets as defined herein. Transfected non-temporarily. In some embodiments, cells are transfected when they occur spontaneously in a subject. In some embodiments, the cells to be transfected are harvested from the subject. In some embodiments, the cells are derived from cells taken from a subject, such as a cell line. A wide variety of cell lines for tissue culture are known in the art and are exemplified elsewhere herein. Cell lines are available from a variety of sources known to those of skill in the art (see, eg, American Type Culture Collection (ATCC) (Manassas, Va.)). In some embodiments, cells transfected with one or more vectors containing a polynucleotide encoding a Cas9 enzyme, system or complex for use in multiple targets as defined herein are used. To establish a new cell line containing one or more vector-derived sequences. In some embodiments, it is transiently transfected with a component of the Cas9 CRISPR system or complex for use in multiple targets described herein (transient transfection of one or more vectors). , Or transfection with RNA), and cells modified through the activity of the Cas9 CRISPR system or complex to establish new cell lines containing cells containing modifications but lacking other exogenous sequences. In some embodiments, transiently or non-temporarily with one or more vectors containing a polynucleotide encoding a Cas9 enzyme, system or complex for use in multiple targets as defined herein. Transfected cells, or cell lines derived from such cells, are used to evaluate one or more test compounds.

The term "regulatory element" is as defined elsewhere herein.

Advantageous vectors include lentiviruses and adeno-associated viruses, and the type of such vector may be selected to target specific types of cells.

In one aspect, the invention is (a) a first regulatory element operably linked to a direct repeat sequence, and one or more guide RNA sequences upstream or downstream of the direct repeat sequence (either applicable). A eukaryotic host cell containing one or more insertion sites for insertion, where expressed, the guide sequence (s) is each in the eukaryotic cells of the Cas9 CRISPR complex. Inducing sequence-specific binding to the target sequence (s), the Cas9 CRISPR complex formed a complex with one or more guide sequences (s) that hybridize to each target sequence (s). A second regulation operably linked to a Cas9 enzyme containing; and / or (b) preferably an enzyme coding sequence encoding the Cas9 enzyme, including at least one nuclear localization sequence and / or NES. Provides eukaryotic host cells, including the element. In some embodiments, the host cell comprises components (a) and (b). If applicable, tracr sequences are also provided. In some embodiments, the components (a), components (b), or components (a) and (b) are stably integrated into the genome of the host eukaryotic cell. In some embodiments, the component (a) is functionally linked to a first regulatory element and further comprises and is expressed by two or more guide sequences optionally separated by direct repeat. If so, each of the two or more guide sequences directs sequence-specific binding of the Cas9 CRISPR complex to various target sequences in eukaryotic cells. In some embodiments, the Cas9 enzyme has one or more nuclear localizations in a detectable amount in and / or out of the nucleus of eukaryotic cells that are strong enough to drive the accumulation of the CRISPR enzyme. Includes chemical sequences and / or nuclear export sequences or NES.

In some embodiments, the Cas9 enzyme is a V-type or VI-type CRISPR-based enzyme. In some embodiments, the Cas9 enzyme is a Cas9 enzyme. In some embodiments, the Cas9 enzyme is Francisella tularensis 1, Francisella tularensis subsp. novicida, Prevotella albensis, Lachnospiraceae bacteria MC2017 1, Butyrivio proteoclasticus, Peregrinibacteria bacterium GW2011_GWA2 SCADC, Acidaminococcus sp. BV3L6, Lachnospiraceae bacterium MA2020, Candidatus Methanoplasma termitum, Eubacterium eligens, Moraxella bovoculi 237, Leptospira inadai Cas9 which, derived from Lachnospiraceae bacterium ND2006, Porphyromonas crevioricanis 3, Prevotella disiens or Porphyromonas macacae Cas9,, as defined in any of the herein Can include further modifications or modifications of, and may be chimeric Cas9. In some embodiments, the Cas9 enzyme is codon-optimized for expression in eukaryotic cells. In some embodiments, the CRISPR enzyme directs the cleavage of one or two strands at the position of the target sequence. In some embodiments, the first regulatory element is the polymerase III promoter. In some embodiments, the second regulatory element is the polymerase II promoter. In some embodiments, the one or more guide sequences (s) are (each) at least 16, 17, 18, 19, 20, 25 nucleotides, or 16-30, or 16-25, or 16-20. Nucleotide length. When multiple guide RNAs are used, they are preferably separated by direct repeat sequences. In one aspect, the invention provides a non-human eukaryote; preferably a multicellular eukaryote comprising a eukaryotic host cell according to any of the described embodiments. In another aspect, the invention provides a eukaryote; preferably a multicellular eukaryote comprising a eukaryotic host cell according to any of the described embodiments. The organism in some embodiments of these embodiments may be an animal, eg a mammal. Similarly, the organism may be an arthropod such as an insect. The organism may also be a plant. In addition, the organism may be a fungus.

In one aspect, the invention provides a kit comprising one or more of the components described herein. In some embodiments, the kit comprises a vector system and instructions for using the kit. In some embodiments, the vector system is (a) a first regulatory element operably linked to the direct repeat sequence and one upstream or downstream (if applicable) of the direct repeat sequence. When expressed at one or more insertion sites for inserting the above guide sequences, the guide sequences induce sequence-specific binding of the Cas9 CRISPR complex to the target sequence of eukaryotic cells. Here, the Cas9 CRISPR complex comprises an insertion site comprising a Cas9 enzyme complexed with a guide sequence that hybridizes to the target sequence; and / or an enzyme coding sequence encoding the Cas9 enzyme comprising (b) a nuclear localization sequence. Includes a second adjusting element, which is operably linked to. If applicable, tracr sequences are also provided. In some embodiments, the kit comprises components (a) and (b) placed on the same or different vectors of the system. In some embodiments, the component (a) further comprises two or more guide sequences operably linked to the first regulatory element, where, when expressed, two or more. Each of the guide sequences directs sequence-specific binding of the CRISPR complex to different target sequences in eukaryotic cells. In some embodiments, the Cas9 enzyme comprises one or more nuclear localization sequences of sufficient intensity to induce the accumulation of a detectable amount of the CRISPR enzyme in the nucleus of eukaryotic cells. In some embodiments, the CRISPR enzyme is a V-type or VI-type CRISPR-based enzyme. In some embodiments, the CRISPR enzyme is a Cas9 enzyme. In some embodiments, the Cas9 enzyme is Francisella tularensis 1, Francisella tularensis subsp. novicida, Prevotella albensis, Lachnospiraceae bacteria MC2017 1, Butyrivio proteoclasticus, Peregrinibacteria bacterium GW2011_GWA2 SCADC, Acidaminococcus sp. BV3L6, Lachnospiraceae bacterium MA2020, Candidatus Methanoplasma termitum, Eubacterium eligens, Moraxella bovoculi 237, Leptospira inadai, Lachnospiraceae bacterium ND2006, Porphyromonas crevioricanis 3, Prevotella disiens or Porphyromonas macacae Cas9 (e.g., either modified to have at least one DD , Or associated with at least one DD), may contain further modifications or variations of Cas9, or may be chimeric Cas9. In some embodiments, the DD-CRISPR enzyme is codon-optimized for expression in eukaryotic cells. In some embodiments, the DD-CRISPR enzyme directs cleavage of one or two strands at the location of the target sequence. In some embodiments, the DD-CRISPR enzyme lacks or substantially lacks DNA strand cleavage activity (eg, wild-type enzyme or enzyme without mutations or alterations that reduce nuclease activity). Nuclease activity of 5% or less). In some embodiments, the first regulatory element is the polymerase III promoter. In some embodiments, the second regulatory element is the polymerase II promoter. In some embodiments, the guide sequence is at least 16, 17, 18, 19, 20, 25 nucleotides, or 16-30, or 16-25, or 16-20 nucleotides in length.

In one aspect, the invention provides a method of modifying a plurality of target polynucleotides in a host cell such as a eukaryotic cell. In some embodiments, the method binds the Cas9 CRISPR complex to a plurality of target polynucleotides, for example, causing cleavage of the plurality of target polynucleotides, thereby modifying the plurality of target polynucleotides. Thus, the Cas9 CRISPR complex comprises Cas9 enzymes complexed with a plurality of guide sequences, each of which is hybridized to a particular target sequence within the target polynucleotide and the plurality of guide sequences. Is concatenated to a direct repeat sequence. If applicable, tracr sequences may also be provided (eg, to provide a single guide RNA, sgRNA). In some embodiments, the cleavage comprises cleaving one or two strands at the position of each target sequence by the Cas9 enzyme. In some embodiments, the cleavage reduces transcription of multiple target genes. In some embodiments, the method further comprises repairing one or more of the cleaved target polynucleotides by homologous recombination with an extrinsic template polynucleotide, wherein the repair is one or more of the relevant. It results in mutations involving insertions, deletions, or substitutions of one or more nucleotides of the target polynucleotide. In some embodiments, the mutation results in one or more amino acid changes in a protein expressed from a gene containing one or more of the target sequences (s). In some embodiments, the method further comprises delivering one or more vectors to the eukaryotic cell, wherein the one or more vectors are a Cas9 enzyme and a multiplex guide RNA linked to a direct repeat sequence. Drives expression of one or more of the sequences. If applicable, tracr sequences are also provided. In some embodiments, the vector is delivered to eukaryotic cells of interest. In some embodiments, the modification is performed on the eukaryotic cell in a cell culture. In some embodiments, the method further comprises isolating the eukaryotic cell from the subject prior to the modification. In some embodiments, the method further comprises returning the eukaryotic cell and / or cells derived thereof to the subject.

In one aspect, the invention provides a method of modifying the expression of multiple polynucleotides in eukaryotic cells. In some embodiments, the method comprises binding the Cas9 CRISPR complex to multiple polynucleotides such that the binding results in increased or decreased expression of the polynucleotide; where the Cas9 CRISPR complex is. Contains a Cas9 enzyme complexed with a plurality of guide sequences, each of which specifically hybridizes to its own target sequence within the polynucleotide, and the guide sequence is linked to a direct repeat sequence. If applicable, tracr sequences are also provided. In some embodiments, the method further comprises delivering one or more vectors to the eukaryotic cell, wherein the one or more vectors are linked to a Cas9 enzyme and a direct repeat sequence. Drives the expression of one or more of the guide sequences of. If applicable, tracr sequences may also be provided.

In one aspect, the invention provides a recombinant polynucleotide comprising a plurality of guide RNA sequences upstream or downstream (if applicable) of a direct repeat sequence, where each guide sequence is expressed as a Cas9 CRISPR complex. Induces sequence-specific binding of the body to its corresponding target sequence present in eukaryotic cells. In some embodiments, the target sequence is a viral sequence present in eukaryotic cells. If applicable, tracr sequences may also be provided. In some embodiments, the target sequence is a proto-oncogene or an oncogene.

Aspects of the invention include a guide RNA comprising a guide sequence capable of hybridizing to a target sequence of a genomic locus of interest in a cell as defined herein, which may comprise at least one nuclear localized sequence. Includes non-naturally occurring or artificial compositions that may contain (gRNA) and Cas9 enzymes.

One aspect of the invention includes a method of modifying a genomic locus of interest to alter intracellular gene expression by introducing any of the compositions described herein into a cell.

Aspects of the invention are that the above elements are included in a single composition or in individual compositions. These compositions may advantageously be applied to the host to elicit a functional effect at the genomic level.

The terms "guide RNA" or "gRNA" as used herein tend to be used herein and are fully complementary to the target nucleic acid sequence for hybridization with the target nucleic acid sequence. Includes any polynucleotide sequence having sex and direct sequence-specific binding of the nucleic acid target complex to the target nucleic acid sequence. Each gRNA may be designed to contain multiple binding recognition sites (eg, aptamers) specific for the same or different adapter proteins. Each gRNA may be designed to bind to the promoter region of the -1000- + 1 nucleic acid (ie, TSS), preferably -200 nucleic acid, upstream of the transcription initiation site. This arrangement improves functional domains that affect gene activation (eg, transcriptional activators) or gene inhibition (such as transcriptional repressors). The modified gRNA may be one or more modified gRNAs that target one or more target loci contained in the composition (eg, at least 1 gRNA, at least 2 gRNA, at least 5 gRNA, at least 10 gRNA, at least 20 gRNA, At least 30 gRNA, at least 50 gRNA). The plurality of gRNA sequences may be arranged in tandem, preferably separated by direct repeat.

Therefore, the gRNA and CRISPR enzymes defined herein are each individually included in the composition and may be administered to the host individually or collectively. Alternatively, these components may be provided in a single composition for administration to a host. Administration to the host can be performed via viral vectors known to those of skill in the art or described herein for delivery to the host (eg, lentiviral vector, adenoviral vector, AAV vector). .. As described herein, the use of different selectable markers (eg, for lentivirus sgRNA selection) and the concentration of gRNA (eg, depending on whether multiple gRNAs are used) are improved. It can be advantageous to bring out the effect. Based on this concept, several variations, including DNA cleavage, gene activation, or gene inactivation, are suitable for inducing genomic locus events. Using the provided composition, one of ordinary skill in the art will advantageously and specifically induce one or more genomic locus events by targeting a single or multiple loci having the same or different functional domains. Can be. The compositions are screened in an intracellular library and functional modeling in vivo (eg, gene activation and functional identification of lincRNA; functional acquisition modeling; loss of function modeling; cell lines and trans for optimization and screening purposes. It can be applied to a wide variety of methods for the use of the compositions of the invention to establish a genetic animal).

The invention includes the use of the compositions of the invention to establish and utilize conditional or inducible CRISPR transgenic cells / animals; eg, Platt et al. , Cell (2014), 159 (2): 440-455, or WO 2014/093622 (PCT / US2013 / 074667), etc., see PCT patent publications cited herein. For example, cells or animals such as non-human animals such as vertebrates or mammals such as rodents such as rodents such as mice, rats or other laboratory or field animals such as cats, dogs, sheep and the like. , May be "knocked in", whereby the animal conditionally or inductively expresses Cas9 as well as Platt et al. Thus, the target cell or animal contains the CRISPR enzyme (eg, Cas9) conditionally or inductively (eg, in the form of a Cre-dependent construct) upon expression of the vector introduced into the target cell and into the target cell. Upon expression of the introduced vector, the vector expresses one that induces or enhances the state of expression of the CRISPR enzyme (eg, Cas9) in the target cell. Genomic events that can be induced by applying the teachings and compositions defined herein to known methods of making CRISPR complexes are also embodiments of the invention. Examples of such induced events are described elsewhere herein.

In some embodiments, changes in phenotype are preferably the result of genomic modification targeting a genetic disease, preferably in a method of treatment, and preferably provided with a repair template that modifies or alters the phenotype. Is.

In some embodiments, the disease that can be targeted includes diseases associated with the splice defect that causes the disease.

In some embodiments, cell targets include hematopoietic stem cells / progenitor cells (CD34 +); human T cells; and eyes (retinal cells)-eg, photoreceptor progenitor cells.

In some embodiments, gene targets include: human betaglobin-HBB, which comprises stimulating gene conversion (using the closely related HBD gene as an endogenous template) for sickle cell anemia. (Therapeutic); CD3 (T cells); and CEP920-retina (eye).

In some embodiments, disease targets also include: cancer; sickle cell anemia (based on point mutations); HBV, HIV; beta-thalassemia; and eye disease or eye disease-eg, Leber congenital cyst (LCA). ) -Cause of splice defects.

In some embodiments, delivery methods include: cationic lipid-mediated "direct" delivery of the enzyme-guided complex (RiboNucleoProtein) and electroporation of plasmid DNA.

The methods, products and uses described herein may be used for non-therapeutic purposes. In addition, any of the methods described herein may be applied in vitro and in Exvivo.

In one aspect, a non-naturally occurring or engineered composition is provided that includes:
I. Two or more CRISPR-Cas-based polynucleotide sequences including: (a) A first guide sequence capable of hybridizing to a first target sequence at a polynucleotide locus,
(B) A second guide sequence that can hybridize to a second target sequence at the polynucleotide locus,
(C) Direct repeat sequence,
And II. Cas9 enzyme or a second polynucleotide sequence encoding it,
Here, when transcribed, the first and second guide sequences induce sequence-specific binding of the first and second Cas9 CRISPR complexes to the first and second target sequences, respectively.
Here, the first CRISPR complex comprises a Cas9 enzyme complexed with a first guide sequence capable of hybridizing to the first target sequence.
Here, the second CRISPR complex comprises a Cas9 enzyme complexed with a second guide sequence capable of hybridizing to the second target sequence, where the first guide sequence is the first target sequence. The second guide sequence directs the cleavage of one strand of the nearby DNA duplex and the second guide sequence directs the cleavage of the other strand near the second target sequence that induces double-strand breaks, thereby biological or non-biological. Modify human or non-human organisms. Similarly, compositions containing three or more guide RNAs can be envisioned, for example, each of which is specific for one target and is tandemly arranged in the compositions or CRISPR systems or complexes described herein. obtain.

In another embodiment Cas9 is delivered to cells as a protein. In another particularly preferred embodiment, Cas9 is delivered to the cell as a protein or a nucleotide sequence encoding it. Delivery to cells as a protein may include delivery of a ribonucleoprotein (RNP) complex in which the protein is complexed with multiple guides.

In some embodiments, host cells and cell lines modified by or containing the compositions, systems or modified enzymes of the invention, including stem cells and their progeny, are provided.

In one aspect, for example, a method of cell therapy in which a single cell or population of cells is sampled or cultured is provided, the cells (s) being modified with Exvivo as described herein. It is either or modified and then reintroduced (sampled cells) or introduced (cultured cells) into the organism. Embryonic stem cells or pluripotent stem cells or stem cells that induce totipotent stem cells are also particularly preferred in this regard. However, of course, in vivo embodiments are also envisioned.

The method of the invention may further comprise delivery of a template, such as a repair template, which may be dsODN or ssODN (see below). Template delivery may be via simultaneous or separate delivery of either or all of the CRISPR enzyme or guide RNA, and may be via the same delivery mechanism or different delivery. In some embodiments, the template is preferably delivered with a guide RNA and preferably a CRISPR enzyme. An example can be an AAV vector in which the CRISPR enzyme is AsCas9 or LbCas9.

The method of the invention may further include: (a) delivering to the cell a double-stranded oligodeoxynucleotide (dsODN) containing an overhang complementary to the overhang caused by the double-strand break. Here, the dsODN is a delivery integrated at a locus of interest; or-(b) delivery of a single-stranded oligodeoxynucleotide (ssODN) to a cell, wherein the ssODN is the second. Serves as a template for homology for repair of main-strand breaks. The methods of the invention can be for the prevention or treatment of a disease in an individual, and optionally, the disease is caused by a defect in the locus of interest. The method of the invention can be performed in vivo in an individual or in vivo against cells harvested from an individual, and optionally the cells are returned to the individual.

The present invention also uses the CRISPR enzyme or Cas enzyme or Cas9 enzyme or CRISPR-CRISPR enzyme or CRISPR-Cas or CRISPR-Cas9 system for use in tandem or multiple targeting as defined herein. Includes the resulting product.

Cas9 CRISPR-Cas-based escorted guides according to the present invention In one aspect, the invention provides an escort-type Cas9 CRISPR-Cas system, or a complex, particularly a system comprising an escort-type Cas9 CRISPR-Cas-based guide. .. An "escorted" is when the Cas9 CRISPR-Cas system or complex or guide is delivered intracellularly at a selected time or to a selected location within the cell, as a result. Cas9 CRISPR-Cas means that the activity of the system or complex or guide is spatially or temporally regulated. For example, the activity and destination of the Cas9 CRISPR-Cas system or complex or guide can be controlled by an escort RNA aptamer sequence that has a binding affinity for an aptamer ligand, such as a cell surface protein or other localized cell component. .. Alternatively, the escort aptamer may be responsive to an intracellular or intracellular aptamer effector, such as a transient effector (such as an external energy source applied to a cell at a particular time).

The escort-type Cas9 CRISPR-Cas system or C complex has a gRNA having a functional structure designed to improve the structure, structural mode, stability, genetic expression, or any combination thereof of the gRNA. Such structures may include aptamers.

Aptamers are biomolecules that are designed or may be selected to bind tightly to other ligands, with such design or selection being, for example, systematic evolution of ligands by exponential enrichment (SELEX; Tuerk C). , Gold L: "Systematic evolution of ligands by exponental enrichment: RNA ligands to bacteriophage T4 DNA polymerase." Science (1990, 249: 505-10). Nucleic acid aptamers may be selected, for example, from a pool of random sequence oligonucleotides, as these oligonucleotides have high binding affinity and specificity for a wide range of biomedically relevant targets. It has been suggested that the therapeutic usefulness of Nucleotide is widespread (Keefe, Anthony D., Supriya Pai, and Andrew Ellington. “Aptamers as therapeutics.” Nature Review5: 7 (37.Views. These features also suggest that aptamers as a drug delivery medium have a wide range of uses (Levy-Nissenbaum, Etgar, et al. "Nanotechnology and aptamers: applications in drug delivery." Trends in Biotechnology. "Trends in Biotechnology." ): 442-449; and Hicke BJ, Stephens AW. "Escort aptamers: a delivery service for disease and therapy." J Clin Invest 2000, 106: 923-928. Aptamers that function as molecular switches may be constructed in response to characterization cues, such as RNA aptamers that bind to the fluorophore and mimic the activity of green fluorescent protein (Paige, Jeremy S). , Karen Y. Wu, and Samie R. Jaffrey. "RNA mimics of green fluororescent protein." Science 333.6042 (2011): 642-646). It has also been suggested that aptamers may be used as components of targeted siRNA therapeutic delivery systems, in which, for example, cell surface proteins are targeted (Zhou, Jiehua, and John J. Rossi. Rossi. "Aptamer-targeted cell-specific RNA interference." Silence 1.1 (2010): 4).

Accordingly, provided herein is one or more aptamers designed to improve gRNA delivery, including, for example, crossing the cell membrane, subcellular compartment, or to the nucleus. It is a modified gRNA according to (possible). Such structures add a portion (s) to one or more aptamers (s) or so to make the guide deliverable, inducible, or responsive to the selective effector. One or more aptamer (s) portions (s) may be included without being included. Accordingly, the invention includes gRNAs that respond to normal or pathological physiological conditions, including, but not limited to, pH, hypoxia, _O2 concentration, temperature, protein concentration, enzyme concentration, and the like. Includes lipid structure, exposure to light, mechanical disruption (eg, ultrasound), magnetic fields, electric fields, or electromagnetic radiation.

Aspects of the invention provide a non-naturally occurring or engineered composition comprising an escort-type guide RNA (egRNA) comprising:
RNA-guided sequences that can hybridize to the target sequence of the genomic locus of interest in the cell;
Escort RNA aptamer sequences, where escort aptamers have binding affinity for intracellular or intracellular aptamer ligands, or escort aptamers respond to intracellular or intracellular localized aptamer effectors. The presence of aptamer ligands or effectors in or within cells is spatially or temporally restricted.

Escort aptamers can, for example, change their conformation depending on their interaction with intracellular aptamer ligands or effectors.

Escort aptamers can have specific binding affinities for aptamer ligands.

Aptamer ligands may be localized to cell locations or compartments, such as on or within the cell membrane. Therefore, the binding of the escort aptamer to the aptamer ligand may induce the egRNA to a desired position in the cell such as inside the cell by binding to the aptamer ligand which is a cell surface ligand. In this way, various spatially restricted locations within the cell, such as the cell nucleus or mitochondria, may be targeted.

Once the intended changes have been introduced, such as by editing the intended copy of the gene within the cell's genome, continuous CRISPR / Cas9 expression in the cell is no longer necessary. In fact, sustained expression is not desirable in certain cases, such as for off-target effects such as at unintended genomic sites. Therefore, time-limited expression is useful. Induced expression provides one approach, but in addition, Applicants have engineered a self-inactivating Cas9 CRISPR-Cas system that relies on the use of non-coding guide target sequences within the CRISPR vector itself. Therefore, after the onset of expression, the CRISPR system leads to its own disruption, but before the disruption is complete, there is time to edit the genomic copy of the target gene (in normal point mutations in diploid cells). Only two edits are required at most). Simply put, the self-inactivating Cas9 CRISPR-Cas system targets one or more non-generic sequences that target the coding sequence of the CRISPR enzyme itself or are present in one or more of the following: Coding guides Contains additional RNA (ie, guide RNA) that targets the target sequence: (a) within a promoter that promotes expression of non-coding RNA elements, (b) within a promoter that promotes expression of the Cas9 gene, (C) within 100 bp of the ATG translation initiation codon of the Cas9 coding sequence, (d) within the reverse terminal repeat sequence (iTR) of the virus delivery vector, eg, within the AAV genome.

The egRNA may include an RNA aptamer ligation sequence that operably links the escort RNA sequence to the RNA guide sequence.

In embodiments, the egRNA may contain one or more photolabile bindings or non-naturally occurring residues.

In one aspect, the escort RNA aptamer sequence can be complementary to the target miRNA, which may or may not be present in the cell, so that the escort RNA aptamer sequence to the target miRNA only if the target miRNA is present. Binds, resulting in cleavage of the egRNA by intracellular RNA-induced silencing complex (RISC).

In embodiments, the escort RNA aptamer sequence can be, for example, 10-200 nucleotides in length, and the egRNA may comprise two or more escort RNA aptamer sequences.

It should be appreciated that any RNA guide sequence described elsewhere herein can be used for the egRNA described herein. In certain embodiments of the invention, the guide RNA or mature crRNA comprises, consists of, or consists of direct repeat sequences and guide sequences or spacer sequences. In certain embodiments, the guide RNA or mature crRNA comprises, consists essentially of, or consists of a direct repeat sequence linked to a guide sequence or spacer sequence. In certain embodiments, the guide RNA or mature crRNA comprises 19 nt partial direct repeats followed by 23-25 nt guide or spacer sequences. In certain embodiments, the effector protein is a FnCas9 effector protein with a guide sequence of at least 16 nt to achieve detectable DNA cleavage and a guide sequence of at least 17 nt to achieve efficient DNA cleavage in vitro. Needs. In certain embodiments, the direct repeat sequence is located upstream (ie, 5') of the guide or spacer sequence. In a preferred embodiment, the seed sequence of the FnCas9 guide RNA (ie, the sequence essential for recognition and / or hybridization of the target locus sequence) is approximately within the first 5 nt of the 5'end of the guide sequence or spacer sequence. be.

The egRNA has at least one mutation, eg Cas9 has at least 5% or less of the nuclease activity of Cas9 without at least one mutation, eg, at least 97% or 100% compared to Cas9 without at least one mutation. It may be included in a naturally absent or engineered Cas9 CRISPR-Cas complex, along with Cas9 which may have mutations such as having reduced nuclease activity. Cas9 may also contain one or more nuclear localization sequences. Mutant Cas9 enzymes with regulated activity, such as reduced nuclease activity, are described elsewhere herein.

The engineered Cas9 CRISPR-Cas composition may be provided in cells such as eukaryotic cells, mammalian cells, or human cells.

In embodiments, the compositions described herein comprise a Cas9 CRISPR-Cas complex having at least three functional domains, at least one of which is associated with Cas9 and at least two of which are associated with egRNA.

The compositions described herein are used to introduce genomic locus events in vivo into eukaryotic cells, especially mammalian cells, or host cells such as non-human eukaryotes, especially non-human mammals such as mice. You may use it. Genomic locus events can include affecting gene activation, gene inhibition, or cleavage of a locus. The compositions described herein may also be used to modify the genomic locus of interest to alter intracellular gene expression. Methods for introducing genomic locus events into host cells using the Cas9 enzyme provided herein are described in detail elsewhere herein. Delivery of the composition is, for example, by delivery of the nucleic acid molecule (s) encoding the composition, the nucleic acid molecule (s) being operably linked to a regulatory sequence (s). , Nucleic acid molecules (s) are expressed in vivo, eg, by lentivirus, adenovirus, or AAV.

The present invention provides compositions and methods to which gRNA-mediated gene editing activity can be adapted. The present invention provides gRNA secondary structure that improves cleavage efficiency by increasing gRNA and / or increasing the amount of RNA delivered to cells. The gRNA may contain a slightly unstable or inducible nucleotide.

To increase the effectiveness of gRNAs, such as gRNAs delivered by viral or non-viral techniques, Applicants have added secondary structures to gRNAs that improve their stability and improve gene editing. Separately, to overcome the lack of effective delivery, Applicants modified gRNAs with cell-permeable RNA aptamers; aptamers bind to cell surface receptors and promote the entry of gRNAs into cells. .. In particular, cell-permeable aptamers may be designed to target specific cell receptors in order to mediate cell-specific delivery. Applicants have also created a guide that can be guided.

The photoresponsiveness of the inducible system can be achieved via activation and binding of cryptochrome-2 and CIB1. Stimulation with blue light induces activation of the conformational change of cryptochrome-2, resulting in recruitment of its binding partner, CIB1. This binding is rapid and reversible, reaching saturation in less than 15 seconds after pulse stimulation and returning to baseline in less than 15 minutes after the end of stimulation. This rapid binding kinetics thus constrains the system only in the rate of transcription / translation and transcription / proteolysis, not inducible uptake and clearance. Activation of cryptochrome-2 is also highly sensitive, allowing for lower light intensity used for irritation and reducing the risk of phototoxicity. In addition, in situations such as the intact mammalian brain, the ability to use light at varying intensities to control the size of the stimulating region provides higher accuracy compared to what can be obtained with vector delivery alone. Can be possible.

The present invention contemplates an energy source for guiding a guide (such as electromagnetic radiation, sound energy, or thermal energy). Advantageously, electromagnetic radiation is a component of visible light. In a preferred embodiment, the light is blue light having a wavelength of about 450-about 495 nm. In a particularly preferred embodiment, the wavelength is about 488 nm. In another preferred embodiment, the photostimulation is via a pulse. The light output can be in the range of about 0-9 mW / cm ² . In a preferred embodiment, the stimulation sequence is as short as 0.25 seconds every 15 seconds to maximize activation.

The cells involved in the practice of the present invention may be prokaryotic cells or eukaryotic cells, preferably animal cells, plant cells or yeast cells, and even mammalian cells. It can be advantageous to be.

A guide for chemical or energy sensitivity can act as a guide by changing the conformation when induced by the binding or energy of a chemical source and has the function of a Cas9 CRISPR-Cas system or complex. Can be. The invention may include applying a chemical source or energy to have guide function and function of the Cas9 CRISPR-Cas system or complex; and optionally further determining changes in the expression of genomic loci.

There are several different designs for this chemical induction system: 1. 2. ABI-PYL-based system inducible by abscisic acid (ABA) (see, eg, http: //stke.sciencemag.org/cgi/content/abstract/sigtrans; 4/164 / rs2). See FKBP-FRB-based system (eg, http://www.nature.com/nmeth/journal/v2/n6/full/nmeth763.html) that can be induced by rapamycin (or related chemicals based on rapamycin). ), 3. A GID1-GAI-based system that can be induced by gibberellin (GA) (see, eg, http: //www.nature.com/nchembio/journal/v8/n5/full/nchembio.922.html).

Another system contemplated by the present invention is a chemically induced system based on changes in intracellular localization. Applicants have also developed a system in which the polypeptide comprises a DNA binding domain containing at least 5 or more Transcription activator-like effector (TALE) monomers and at least one effector domain. At least one half-monomer specifically ordered to target the genomic locus of interest linked to is further a linker to a chemical or energy sensitive protein. This protein leads to altered intracellular localization of the entire polypeptide (ie, transport of the entire polypeptide from the cytoplasm to the nucleus) upon binding of chemical or energy transfer to the chemical or energy sensitive protein. Due to the lack of substrate in the effector domain, this transport of the entire polypeptide from one intracellular compartment or organelle whose activity is isolated to another in which the substrate is present causes the polypeptide. The whole can be contacted with its desired substrate (ie, genomic DNA in the nucleus of the mammal), resulting in activation or suppression of target gene expression.

This type of system can also be used to direct cleavage of the genomic locus of interest in the cell if the effector domain is a nuclease.

The chemical induction system can be an estrogen receptor (ER) -based system that can be induced by 4-hydroxytamoxifen (4OHT) (eg, http: //www.pnas.org/content/104/3/1027. See abstract). The mutated ligand-binding domain of the estrogen receptor (called ERT2) translocates to the cell nucleus upon binding of 4-hydroxytamoxifen. In another embodiment of the invention, any of any nuclear receptor, thyroid hormone receptor, retinoic acid receptor, estrogen receptor, estrogen-related receptor, glycocorticoid receptor, progesterone receptor, androgen receptor. Naturally occurring or engineered derivatives can be used in induction systems similar to ER-based induction systems.

Another induction system is based on a design that uses a transient receptor potential channel (TRP) ion channel-based system that can be induced by energy, heat, or radio frequency (eg, http: // www. See sciencemag.org/content/336/6801/604). These proteins in the TRP family respond to different stimuli, including light and heat. When this protein is activated by light or heat, ion channels open, allowing the influx of ions (such as calcium) into the cell membrane. This influx ion binds to the intracellular ion interaction partner linked to the polypeptide, including the guide and other components of the Cas9 CRISPR-Cas complex or system, which binds the polypeptide. Changes in the intracellular localization of the peptide are induced, and the entire polypeptide enters the nucleus of the cell. The guide protein and other components of the Cas9 CRISPR-Cas complex become active upon entry into the nucleus and regulate the expression of the target gene in the cell.

It should be noted that this type of system may also be used to direct cleavage of the genomic locus of interest in the cell; and in this regard, the Cas9 enzyme is a nuclease. Light may be generated by a laser or other form of energy source. Heat can be generated as a result of temperature rise from an energy source or from nanoparticles that release heat after absorbing energy from an energy source supplied in the form of radio waves.

While light activation can be an advantageous embodiment, it can also be disadvantageous, especially in in vivo applications where light cannot penetrate the skin or other organs. In this case, other energy activation methods are contemplated, specifically electric field energy and / or ultrasonic waves having similar effects.

Electric field energy is preferably applied substantially as described in the art using one or more electrical pulses from about 1 volt / cm to about 10 kvolt / cm under in vivo conditions. The electric field can be delivered in a continuous fashion instead of or in addition to the pulse. The electrical pulse can be applied for 1 μs to 500 ms, preferably 1 μs to 100 ms. The electric field can be applied continuously or in pulse form for about 5 minutes.

As used herein, "electric field energy" is the electrical energy to which a cell is exposed. Preferably, the electric field has an intensity of about 1 volt / cm to about 10 kvolt / cm or more than about 10 kvolt / cm under in vivo conditions (see WO 97/49450).

As used herein, the term "electric field" includes one or more pulses with variable capacitance and voltage, such as exponential and / or rectangular and / or modulated waveforms. / Or those with a square waveform to be modulated are included. References to electric fields and electricity should be construed as including references to the presence of potential differences in the cellular environment. Such an environment can be constructed by static electricity, alternating current (AC), direct current (DC), etc., as is known in the art. The electric field may be in uniform, non-uniform, or other conditions and may change in intensity and / or direction in a time-dependent manner.

The electric field can be applied once or multiple times, or the ultrasonic waves can be applied once or multiple times, and such application is performed in any order and in any combination. The ultrasonic and / or electric field may be delivered as a single or multiple continuous application, or may be delivered as a pulse (pulse delivery).

Electroporation has been used in both in vitro and in vivo procedures to introduce foreign materials into living cells. When applied in vitro, a sample of living cells is first mixed with the substance of interest and placed between electrodes (such as parallel plates). The electrodes then apply an electric field to the cell / introduction mixture. Examples of systems for performing electroporation in vitro include the Electro Cell Manipulator ECM600 product and the Electro Quaire Portor T820, both manufactured by Genetronics, Inc. BTX Division (US Pat. No. 5, Inc.). See 869,326).

Known electroporation techniques (both in vitro and in vivo) work by applying high voltage short pulses to the electrodes placed around the treatment area. The electric field generated between the electrodes temporarily makes the cell membrane porous, where the molecule of the target substance is introduced into the cell. In known electroporation applications, this electric field has a duration of about 100. mu. Includes a single square wave pulse on the order of 1000 V / cm in s. Such a pulse can be generated, for example, by a known application method of the ElectroSquare Motorator T820.

Preferably, the electric field has an intensity of about 1 V / cm to about 10 kV / cm under in vitro conditions. Therefore, the electric field is 1V / cm, 2V / cm, 3V / cm, 4V / cm, 5V / cm, 6V / cm, 7V / cm, 8V / cm, 9V / cm, 10V / cm, 20V / cm, 50V. / Cm, 100V / cm, 200V / cm, 300V / cm, 400V / cm, 500V / cm, 600V / cm, 700V / cm, 800V / cm, 900V / cm, 1kV / cm, 2kV / cm, 5kV / cm It can have an intensity of more than 10 kV / cm, 20 kV / cm, 50 kV / cm, or 50 kV / cm. More preferably, it is from about 0.5 kV / cm to about 4.0 kV / cm under in vitro conditions. Preferably, the electric field has an intensity of about 1 V / cm to about 10 kV / cm under in vivo conditions. However, if the number of pulses delivered to the target site is increased, the strength of the electric field can be reduced. Therefore, pulsed electric field delivery with reduced electric field strength is assumed.

Preferably, the application of an electric field is in the form of multiple pulses, such as the form of double pulses with the same intensity and capacitance, or continuous pulses with different intensities and / or capacitances. And so on. As used herein, the term "pulse" includes one or more electrical pulses with variable capacitance and voltage, such electrical pulses as exponential and / or square waveforms and / or modulated. Waveform / modulated square waveforms are included.

Preferably, the electrical pulse is delivered as a waveform selected from an exponential waveform, a square waveform, a modulated waveform, and a modulated square waveform.

In a preferred embodiment, a direct current is utilized at a low voltage. Therefore, the applicant discloses the use of an electric field applied to a cell, tissue or tissue mass for 100 milliseconds or more, more preferably 15 minutes or more at an electric field intensity of 1 V / cm to 20 V / cm.

Ultrasound is advantageously applied at an output level of about 0.05 W / cm ² to about 100 W / cm ² . Diagnostic or therapeutic ultrasound may be used, or a combination thereof may be used.

As used herein, the term "ultrasonic" refers to energy in the form of mechanical vibrations at frequencies higher than human audible. The lower limit of the frequency of the ultrasonic spectrum can generally be about 20 kHz. Frequencies in the range of 1 to 15 MHz'are used in many ultrasonic diagnostic applications (From Londonics in Clinical Diagnostics, PNT Wells, ed., 2nd. Edition, Publ. Churchill Livingstone [Edinburgh]. London & NY, 1977]).

Ultrasound is used in both diagnostic and therapeutic applications. When used as a diagnostic tool (“diagnostic ultrasound”), ultrasound is typically used in an energy density range of up to about 100 mW / cm ² (FDA recommended range), but up to 750 mW / cm. An energy density of cm ² is used. In physiotherapy, ultrasound is typically used as an energy source in the range of up to about 3-4 W / cm ² (WHO recommended range). In other therapeutic applications, higher intensity ultrasound may be utilized, for example, HIFU (or even higher intensity ones) of 100 W / cm up to 1 kW / cm ² is used for short periods of time. The term "ultrasound" as used herein is intended to include diagnostic ultrasound, therapeutic ultrasound, and focused ultrasound.

Focused ultrasound (FUS) makes it possible to deliver thermal energy without the use of invasive probes (Morochz et al 1998 Journal of Magnetic Resonance Imaging Vol. 8, No. 1, pp. See 136-142). Another form of focused ultrasound is high intensity focused ultrasound (HIFU), which is described in Mousetov et al in Ultrasonics (1998) Vol. 36, No. 8, pp. 893-900, and TranHuuHue et al in Acoustica (1997) Vol. 83, No. 6, pp. It is outlined by 1103-1106.

Preferably, diagnostic ultrasound and therapeutic dose ultrasound are used in combination. This combination is not intended to be limiting, but rather one of skill in the art will appreciate that ultrasound can be used in any variety of combinations. In addition, energy densities, ultrasonic frequencies, and exposure times can vary.

Preferably, exposure to an ultrasonic energy source takes place at a power density of about 0.05 to about 100 Wcm ^-2 . Even more preferably, exposure to an ultrasonic energy source takes place at a power density of about 1 to about 15 Wcm ^-2 .

Preferably, the exposure to the ultrasonic energy source is at a frequency of about 0.015 to about 10.0 MHz. More preferably, exposure to ultrasonic energy sources takes place at frequencies of about 0.02 to about 5.0 MHz or about 6.0 MHz. Most preferably, the ultrasonic waves are applied at a frequency of 3 MHz.

Preferably, the exposure time is from about 10 ms to about 60 minutes. Preferably, the exposure time is from about 1 second to about 5 minutes. More preferably, the ultrasonic waves are applied for about 2 minutes. However, depending on the particular target cell to be destroyed, the exposure time can be long, for example 15 minutes.

Advantageously, the target tissue is exposed to an ultrasonic energy source with an acoustic output density of about 0.05 Wcm ^-2 to about 10 Wcm ^-2 using frequencies in the range of about 0.015 to about 10 MHz (WO98 / 52609). checking). However, alternative conditions are also possible, for example, the acoustic output density is greater than 100 Wcm ^-2 , but the exposure to the ultrasonic energy source is carried out for a shorter period of time, for example, 1000 Wcm ^- with the time in the millisecond range or less. Exposure is done at ² .

Preferably, the application of ultrasonic waves is in the form of multiple pulses, so both continuous and pulsed waves (pulse delivery of ultrasonic waves) can be utilized in any combination. For example, a continuous wave ultrasonic wave may be applied followed by a pulsed wave ultrasonic wave, and vice versa. This application may be repeated any number of times in any order and in any combination. A pulsed ultrasonic wave may be applied to a continuous wave ultrasonic background and any number of pulses may be used in any number of groups.

Preferably, the ultrasonic waves may include ultrasonic waves of pulse waves. In a highly preferred embodiment, the ultrasonic waves are applied as a continuous wave with an output density of 0.7 ^{Wcm -2} or 1.25 Wcm-2. Higher power densities may be utilized if pulsed ultrasonic waves are used.

It is advantageous to use ultrasound because it can focus exactly on the target, just like light. Moreover, ultrasound, unlike light, is advantageous because it can focus on deeper parts of the tissue. Therefore, ultrasound is more suitable for permeation of all tissues (such as, but not limited to, liver lobe) or treatment of all organs (such as, but not limited to, whole liver or whole muscle (such as heart)). Another important advantage is that ultrasound is a non-invasive stimulus used in a wide variety of diagnostic and therapeutic applications. As an example, ultrasound is well recognized in orthopedic treatment in addition to medical contrast techniques. In addition, devices suitable for applying ultrasound to target vertebrates are widely available and their use is well known in the art.

The rapid transcriptional response and endogenous targeting of the present invention make an ideal system for the study of transcriptional dynamics. For example, the present invention may be used to study the kinetics of variant production by induced expression of a target gene. At the other end of the transcription cycle, studies of mRNA degradation are often performed in response to strong extracellular stimuli that cause changes in the expression levels of many genes. The present invention can be utilized to reversibly direct transcription of an endogenous target, after which point stimulation can be stopped and the degradation kinetics of the unique target can be traced.

The temporal accuracy of the present invention may provide the ability to time regulate genetic regulation in coordination with experimental intervention. For example, targets suspected of being involved in long-term potentiation (LTP) can be tuned in organ-type or dissociative neuronal cultures, but only during stimuli that direct LTP so as not to interfere with the normal development of cells. Similarly, in cell models that represent disease phenotypes, targets suspected of being involved in the efficacy of a particular treatment are regulated only during treatment. Conversely, genetic targets may be regulated only during pathological stimuli. Numerous experiments involving the timing of genetic cues to external experimental stimuli may benefit from the usefulness of the invention.

The in vivo situation provides an equally abundant opportunity for the invention to control gene expression. Photoinducibility offers the possibility of spatial accuracy. Utilizing the development of optode technology, stimulating fiber optic readings may be placed in the correct brain region. The size of the stimulation area may be adjusted by the intensity of light. This may be done in conjunction with the delivery of the Cas9 CRISPR-Cas system or complex of the invention, or in the case of transgenic Cas9 animals, the guide RNA of the invention may be delivered and is accurate by optrol technology. It may be possible to regulate gene expression in various brain regions. A clear Cas9 expressing organism may have a guide RNA of the invention administered to it, followed by highly accurate laser-induced local gene expression changes.

As the medium for culturing the host cells, especially M199-earle base, Eagle MEM (E-MEM), Dulbecco MEM (DMEM), SC-UCM102, UP-SFM (GIBCO BRL), EX-CELL302 (Nichirei), Examples thereof include media generally used for tissue culture such as EX-CELL293-S (Nichirei), TFBM-01 (Nichirei), and ASF104. Culture media suitable for a particular cell type can be found in the American Type Culture Collection (ATCC) or the European Collection of Cell Cultures (ECACC). The culture medium may be supplemented with amino acids such as L-glutamine, salts, antifungal or antibacterial agents such as fungizone®, penicillin-streptomycin, animal serum and the like. The cell culture medium may be optionally serum-free.

The invention may also provide valuable temporal accuracy in vivo. The present invention can be used to alter gene expression during a particular developmental stage. The present invention can be used to time a genetic signal to a particular experimental window. For example, learning-related genes may be overexpressed or suppressed only during learning stimuli in the exact region of the brain of an intact rodent or primate. In addition, the invention can be used to induce changes in gene expression only at specific stages of disease onset. For example, oncogenes can be overexpressed only when the tumor reaches a certain size or metastatic stage. Conversely, proteins suspected of developing Alzheimer's disease can only be knocked down in the life of an animal and at defined times within a particular brain region. These examples do not exhaustively list the potential uses of the invention, but highlight some of the areas in which the invention can be a powerful technique.

Protected Guide: The Cas protein according to the invention can be used in combination with a protected guide RNA. In one aspect, the object of the invention is to individually adjust the binding specificity of the guide RNA to the target DNA. Is to further enhance the specificity of Cas9 given the guide RNA of. It is a complementary base pair mismatched base shared between a genomic target and its potential off-target locus to provide a thermodynamic advantage to the targeted genomic locus on the off-target of the genome. A common approach is to introduce a guide sequence mismatch, extension or cleavage to increase or decrease the number of loci.

In one aspect, the invention provides a guide sequence that is modified by secondary structure to enhance the specificity of the Cas9 CRISPR-Cas system, thereby protecting this secondary structure from exonuclease activity and into the guide sequence. 3'addition is possible.

In one aspect, the invention provides to hybridize a "protector RNA" to a guide sequence, which "protector RNA" is an RNA strand complementary to the 5'end of the guide RNA (gRNA). This partially produces double-stranded gRNA. In embodiments of the invention, protecting the mismatched base with a fully complementary protector sequence reduces the likelihood of target DNA binding to the mismatched base pair at the 3'end. In embodiments of the invention, there may also be additional sequences containing extended lengths.

Guide RNA (gRNA) elongation that matches the genomic target provides gRNA protection and enhances specificity. Elongation of gRNAs using sequences that match distal ends of spacer seeds of individual genomic targets is envisioned for increased specificity. Fits for gRNA elongation that enhance specificity have been observed in cells without cleavage. Predictions of gRNA structure associated with these stable length extensions indicate that due to spacer elongation and the complementary sequences of spacer seeds, stable morphology arises from the protected state in which the elongation forms a closed loop with the gRNA seed. There is. These results indicate that the concept of protection guides also includes sequences that match the genomic target sequences distal to the 20-mer spacer binding region. Thermodynamic predictions can be used to predict fully or partially matched guide dilations and protect the state of gRNA. This extends the concept of protected gRNA to the interaction between X and Z, where X is generally 17-20 nt in length and Z is 1-30 nt in length. Thermodynamic predictions can be used to determine the optimal elongation state of Z and introduce a potentially small number of mismatches into Z to facilitate the formation of a protected conformation between X and Z. .. Throughout this application, the term "X" and the seed length (SL) are used interchangeably with the term exposure length (EpL), which indicates the number of nucleotides available for binding of the target DNA; the term "Y". And the protector length (PL) are used interchangeably to represent the protector length, and the terms "Z", "E", "E'" and "EL" extend the target sequence. Used interchangeably to correspond to the term extended length (ExL), which represents the number of nucleotides.

The extended sequence corresponding to the extended length (ExL) may optionally be added directly to the guide sequence at the 3'end of the protected guide sequence. The extension sequence may be 2-12 nucleotides in length. Preferably, ExL can be shown as 0, 2, 4, 6, 8, 10, or 12 nucleotides in length. In a preferred embodiment, ExL is shown as 0 or 4 nucleotides in length. In a more preferred embodiment, ExL is 4 nucleotides in length. The extended sequence may or may not be complementary to the target sequence.

The extension sequence may further optionally bind directly to the guide sequence at the 5'end of the protected guide sequence and also to the 3'end of the protected sequence. As a result, the extended sequence acts as a concatenated sequence between the protected sequence and the protected sequence. Although not bound by theory, such links place the protected sequence close to the protected sequence in order to improve the binding of the protected sequence to the protected sequence. You may. The above relationship of seed, protector, and elongation applies when the distal end of the guide (ie, the targeted end) is the 5'end, for example, it is understood that the functioning guide is the Cas9 system. .. In embodiments where the distal end of the guide is the 3'end, the relationship is reversed. In such an embodiment, the invention hybridizes a "protector RNA" to a guide sequence, wherein the "protector RNA" is an RNA strand complementary to the 3'end of the guide RNA (gRNA), thereby partially. Double-stranded gRNA is produced.

Addition of a gRNA mismatch to the distal end of the gRNA may demonstrate enhanced specificity. The introduction of an unprotected distal mismatch of Y or the elongation of a gRNA with a distal mismatch (g) can demonstrate enhanced specificity. This concept described above is linked to the components of X, Y, and Z used in protected gRNAs. The concept of unprotected mismatch can be further generalized to the concepts of X, Y, and Z that describe protected guide RNAs.

Cas9. In one aspect, the invention provides enhanced Cas9 specificity and the double-stranded 3'end of a protective guide RNA (pgRNA) allows for two possible outcomes: (1) RNA target DNA strand exchange. Guide RNA protector RNA is generated that guides the guide RNA, either because it binds completely to the target, or (2) the guide RNA cannot bind completely to the target, and Cas9 target cleavage activates the Cas9-catalyzed DSB. In addition, a guide RNA: a multi-step rhythmic reaction that requires target DNA binding, where Cas9 cleavage does not occur if the guide RNA does not bind properly. According to certain embodiments, the protected guide RNA improves the specificity of target binding as compared to the naturally occurring CRISPR-Cas system. According to certain embodiments, the protected modified guide RNA improves stability compared to naturally occurring CRISPR-Cas. According to certain embodiments, the protector sequence has a length of 3 to 120 nucleotides and comprises three or more contiguous nucleotides complementary to another sequence of guides or protectors. According to certain embodiments, the protector array forms a hairpin. According to certain embodiments, the guide RNA further comprises a protected sequence and an exposed sequence. According to certain embodiments, the exposed sequence is 1-19 nucleotides. More specifically, the exposed sequence is at least 75%, at least 90% or about 100% complementary to the target sequence. According to certain embodiments, the guide sequence is at least 90% or about 100% complementary to the protector strand. According to certain embodiments, the guide sequence is at least 75%, at least 90% or about 100% complementary to the target sequence. According to certain embodiments, the guide RNA further comprises an extended sequence. More specifically, if the distal end of the guide is a 3'end, the extension sequence is operably linked to the 3'end of the protected guide sequence and optionally protected at the 3'end of the guide sequence. Directly linked to. According to certain embodiments, the extension sequence is 1-12 nucleotides. According to certain embodiments, the extended sequence is operably linked to the guide sequence at the 3'end of the protected guide sequence and the 5'end of the protector chain, optionally at the 3'end of the protected guide sequence. , And directly linked to the 5'end of the protector chain, where the extension sequence is the linking sequence between the protected sequence and the protected chain. According to certain embodiments, the extended sequences are not 100% complementary to the protector strand and are optionally at least 95%, at least 90%, at least 80%, at least 70%, at least 60%, or at least 50%. It is non-complementary to the protector chain. According to certain embodiments, the guide sequence further comprises a mismatch added to the end of the guide sequence, which thermodynamically optimizes the specificity.

According to the present invention, in certain embodiments, it is desirable to modify the guide to prevent chain entry. For example, in certain embodiments, it may be desirable to design or modify guides that prevent chain entry at off-target sites in order to minimize off-target activity. In certain such embodiments, it may be acceptable or useful to design or modify the guide at the expense of on-target coupling efficiency. In certain embodiments, guided target mismatches at the target site may be tolerated, which substantially reduces off-target activity.

In certain embodiments of the invention, it is desirable to adjust the binding properties of the protected guides to minimize off-target CRISPR activity. Therefore, a thermodynamic prediction algorithm is used to predict the strength of on-target and off-target coupling. Alternatively, or in addition, the selection method is used to reduce or minimize off-target effects by absolute scale or relative to on-target effects.

Design options include, but are not limited to, i) adjusting the length of the protector strand that binds to the protected strand, ii) adjusting the length of the exposed protected strand portion, iii). Extends a protected strand with a stem-loop located externally (distal) to the protected strand (ie, the stem loop is designed to be outside the protected strand at the distal end) That, iv) extending the chain protected by the addition of a protected chain that forms a stem loop with all or part of the protected chain, v) mismatching one or more bases and / or one or more. Adjusting the binding of the protector strand to the protected strand by designing a non-standard base pair, vi) Adjusting the position of the stem formed by the hybridization of the protector strand to the protected strand. And vii) the addition of an unstructured protector to the end of the protective chain.

In one aspect, the invention provides an engineered, non-naturally occurring CRISPR-Cas system comprising a protected guide RNA targeting a Cas protein and a DNA molecule encoding an intracellular gene product. The guide RNA thus protected targets the DNA molecule encoding the gene product, and the Cas protein cleaves the DNA molecule encoding this gene product, thereby altering the expression of the gene product; Here, the Cas9 protein and the protected guide RNA are not naturally present together. The present invention includes a protected guide RNA containing a guide sequence fused to a direct repeat sequence. The invention further includes CRISPR proteins that are codon-optimized for expression in eukaryotic cells. In a preferred embodiment, the eukaryotic cell is a mammalian cell, a plant cell or a yeast cell, and in a more preferred embodiment, the mammalian cell is a human cell. In a further embodiment of the invention, the expression of the gene product is reduced. In some embodiments, the CRISPR protein is Cas12 or Cas13. In some embodiments, the CRISPR protein is Cas12a. In some embodiments, the Cas12a protein is a Cidaminococcus sp. BV3L6, Lachnospiraceae bacterium or Francisella Novicida Cas12a, which may include mutated Cas12a from these organisms. The protein can be an additional Cas12a homolog or ortholog. In some embodiments, the nucleotide sequence encoding the Cas protein is codon-optimized for expression in eukaryotic cells. In some embodiments, the Cas9 or Cas12a protein directs the cleavage of one or two strands at the position of the target sequence. In some embodiments, the first regulatory element is the polymerase III promoter. In some embodiments, the second regulatory element is the polymerase II promoter. In general, and throughout the specification, the term "vector" refers to a nucleic acid molecule capable of transporting another nucleic acid to which it is linked. Vectors include, but are not limited to, single-stranded, double-stranded, or partially double-stranded nucleic acid molecules; nucleic acid molecules containing one or more free ends and no free ends (eg, circular). ); Nucleic acid molecules containing DNA, RNA, or both; and other types of polynucleotides known in the art. One type of vector is a "plasmid", which refers to a circular double-stranded DNA loop into which additional DNA segments can be inserted, such as by standard molecular cloning techniques. Another type of vector is a viral vector in which a virus-derived DNA or RNA sequence is present in the vector for packaging into the virus (eg, retrovirus, replication-deficient retrovirus, adenovirus, replication-deficient adenovirus, and Adenovirus). Viral vectors also include polynucleotides carried by the virus for transfection into host cells. Certain vectors are capable of autonomous replication within the host cell into which they are introduced (eg, a bacterial vector having a bacterial origin of replication and an episome mammalian vector). Other vectors (eg, non-episome mammalian vectors) integrate into the host cell's genome upon introduction into the host cell, thereby replicating with the host genome. In addition, certain vectors can induce the expression of genes to which they are operably linked. Such vectors are referred to herein as "expression vectors". Common expression vectors useful in recombinant DNA technology are often in the form of plasmids.

The recombinant expression vector may comprise the nucleic acid of the invention in a form suitable for expression of the nucleic acid in the host cell, wherein the recombinant expression vector is operably linked to the nucleic acid sequence to be expressed. , Means to include one or more regulatory elements that may be selected based on the host cell used for expression. Within a recombinant expression vector, "operably linked" is a method by which the nucleotide sequence of interest allows expression of the nucleotide sequence (eg, in an in vitro transcription / translation system). Alternatively, when the vector is introduced into a host cell, it is intended to mean that it is linked to a regulatory element (s) (s) within the host cell.

Advantageous vectors include lentiviruses and adeno-associated viruses, and the type of such vector may be selected to target specific types of cells.

In one aspect, the invention is a eukaryotic host cell in which (a) a first regulatory element operably linked to a direct repeat sequence and one or more guide sequences downstream of the direct repeat sequence. One or more insertion sites for insertion, where expressed, the guide sequence induces sequence-specific binding of the CRISPR complex to the target sequence of eukaryotic cells, the CRISPR complex. To be capable of functioning into a CRISPR enzyme complexed with a guide RNA comprising a guide sequence that hybridizes to the target sequence and / or (b) an enzyme coding sequence encoding the Cas9 enzyme comprising a nuclear localized sequence. Provided is a eukaryotic host cell containing a second regulatory element linked to. In some embodiments, the host cell comprises a component (a), and a component (b). In some embodiments, the components (a), components (b), or components (a) and (b) are stably integrated into the genome of the host eukaryotic cell. In some embodiments, the component (a) further comprises two or more guide sequences operably linked to the first regulatory element and, when expressed, of the two or more guide sequences. Each directs the sequence-specific binding of the CRISPR complex to different target sequences in eukaryotic cells. In some embodiments, the Cas9 enzyme directs the cleavage of one or two strands at the location of the target sequence. In some embodiments, the Cas9 enzyme lacks DNA strand cleavage activity. In some embodiments, the first regulatory element is the polymerase III promoter. In some embodiments, the second regulatory element is the polymerase II promoter.

In one aspect, the invention provides a non-human eukaryote; preferably a multicellular eukaryote comprising a eukaryotic host cell according to any of the described embodiments. In another aspect, the invention provides a eukaryote; preferably a multicellular eukaryote comprising a eukaryote host cell according to any of the described embodiments. The organism in some embodiments of these embodiments may be an animal; for example, a mammal. The organism may also be an arthropod such as an insect. The organism may also be a plant or a yeast. In addition, the organism may be a fungus.

In one aspect, the invention provides a kit comprising one or more of the components described herein. In some embodiments, the kit comprises a vector system and instructions for using the kit. In some embodiments, the vector system is (a) for inserting a first regulatory element operably linked to the direct repeat sequence and one or more guide sequences downstream of the direct repeat sequence. At one or more insertion sites, when expressed, the guide sequence directs sequence-specific binding of the Cas9 CRISPR complex to the target sequence of eukaryotic cells, where the CRISPR complex is directed to the target sequence. Those containing a Cas9 enzyme complexed with a protected guide RNA containing a hybridizing guide sequence and / or (b) operably linked to an enzyme coding sequence encoding the Cas9 enzyme containing a nuclear localization sequence. Includes a second adjusting element, which has been made. In some embodiments, the kit comprises components (a) and (b) arranged on the same or different vectors of the system. In some embodiments, the component (a) further comprises two or more guide sequences operably linked to the first regulatory element and, when expressed, of the two or more guide sequences. Each directs sequence-specific binding of the CRISPR complex to different target sequences in eukaryotic cells. In some embodiments, the Cas9 enzyme comprises one or more nuclear localization sequences of sufficient intensity to drive the accumulation of the Cas9 enzyme in a detectable amount in the nucleus of the eukaryotic cell. In some embodiments, the Cas9 enzyme is an Acidaminococcus sp. It is BV3L6, Lachnospiraceae bacterium MA2020 or Francisella tularensis 1 Novicida Cas9, and may contain mutant Cas9 derived from these organisms. The enzyme can be a Cas9 homolog or ortholog. In some embodiments, the CRISPR enzyme is codon-optimized for expression in eukaryotic cells. In some embodiments, the CRISPR enzyme directs the cleavage of one or two strands at the position of the target sequence. In some embodiments, the CRISPR enzyme lacks DNA strand cleavage activity. In some embodiments, the first regulatory element is the polymerase III promoter. In some embodiments, the second regulatory element is the polymerase II promoter.

In one aspect, the invention provides a method of modifying a target polynucleotide in a eukaryotic cell. In some embodiments, the method comprises attaching a CRISPR complex to a target polynucleotide to cleave the target polynucleotide, thereby modifying the target polynucleotide, wherein the CRISPR complex is: , Includes Cas9 enzyme complexed with a protected guide RNA containing a guide sequence hybridized to the target sequence within the target polynucleotide. In some embodiments, the cleavage comprises cleavage of one or two strands at the position of the target sequence by the Cas9 enzyme. In some embodiments, the cleavage results in a decrease in transcription of the target gene. In some embodiments, the method repairs the cleaved target polynucleotide by a non-homologous end joining (NHEJ) -based gene insertion mechanism, more specifically using an exogenous template polynucleotide. Further comprising, where the repair results in a mutation comprising the insertion, deletion, or substitution of one or more nucleotides of the target polynucleotide. In some embodiments, the mutation results in one or more amino acid changes in the protein expressed from the gene containing the target sequence. In some embodiments, the method further comprises delivering one or more vectors to the eukaryotic cell, wherein the one or more vectors are a guide sequence linked to a Cas9 enzyme, a direct repeat sequence. Drives the expression of one or more of the protected guide RNAs, including. In some embodiments, the vector is delivered to eukaryotic cells of interest. In some embodiments, the modification is performed on the eukaryotic cell in a cell culture. In some embodiments, the method further comprises isolating the eukaryotic cell from the subject prior to the modification. In some embodiments, the method further comprises returning the eukaryotic cell and / or cells derived thereof to the subject.

In one aspect, the invention provides a method of modifying the expression of a polynucleotide in eukaryotic cells. In some embodiments, the method comprises binding the Cas9 CRISPR complex to a polynucleotide, which results in an increase or decrease in expression of the polynucleotide; where the CRISPR complex is said. Includes a Cas9 enzyme complexed with a protected guide RNA containing a guide sequence hybridized to a target sequence within a polynucleotide. In some embodiments, the method further comprises delivering one or more vectors to the eukaryotic cell, wherein the one or more vectors are one or more of Cas9 enzymes and protected guide RNAs. Drives the expression of.

In one aspect, the invention provides a method of producing a model eukaryotic cell containing a mutant disease gene. In some embodiments, the disease gene is any gene that is associated with an increased risk of having or developing the disease. In some embodiments, the method is (a) introducing one or more vectors into eukaryotic cells, the one or more vectors being linked to a Cas9 enzyme and a direct repeat sequence. Driving the expression of one or more of the protected guide RNAs containing the sequence; and (b) binding the CRISPR complex to the target polynucleotide to achieve cleavage of the target polynucleotide within the disease gene. Thus, the CRISPR complex comprises a Cas9 enzyme complexed with a guide RNA comprising a sequence that hybridizes to a target sequence within a target polynucleotide, thereby a model eukaryotic cell comprising a mutated disease gene. Including, to generate. In some embodiments, the cleavage comprises cleavage of one or two strands at the position of the target sequence by the Cas9 enzyme. In some embodiments, the cleavage results in a decrease in transcription of the target gene. In some embodiments, the method further comprises repairing the cleaved target polynucleotide by a non-homologous end joining (NHEJ) -based gene insertion mechanism with an extrinsic template polynucleotide. It results in a mutation involving the insertion, deletion, or substitution of one or more nucleotides of the target polynucleotide. In some embodiments, the mutation results in one or more amino acid changes in protein expression from the gene containing the target sequence.

In one aspect, the invention provides a method of developing a biologically active agent that regulates cellular signaling events associated with a disease gene. In some embodiments, the disease gene is any gene that has or is associated with an increased risk of developing the disease. In some embodiments, the method involves contacting the test compound with (a) the model cell of any one of the described embodiments; and (b) cell signaling associated with the mutation in the disease gene. It involves developing the bioactive agent that detects changes in readings that indicate a decrease or increase in the event, thereby regulating the cellular signaling event associated with the disease gene.

In one aspect, the invention provides a recombinant polynucleotide comprising a protected guide sequence downstream of a direct repeat sequence, wherein the protected guide sequence is present in eukaryotic cells when expressed. Directs sequence-specific binding of the CRISPR complex to the corresponding target sequence. In some embodiments, the target sequence is a viral sequence present in eukaryotic cells. In some embodiments, the target sequence is a proto-oncogene or an oncogene.

In one aspect, the invention provides a method of selecting one or more cells (s) by introducing one or more mutations into the gene of one or more cells (s). Is to introduce one or more vectors into a cell (s), where the one or more vectors are among Cas9 enzymes, protected guide RNAs containing guide sequences, and editing templates. Drive one or more expression; where this editing template contains one or more mutations that negate Cas9 enzymatic cleavage; the editing template using the target polynucleotide in the selected cell (s). To enable a non-homologous end binding (NHEJ) -based gene insertion mechanism; by binding the CRISPR complex to a target polynucleotide and allowing cleavage of the target polynucleotide within the gene to be achieved. Here, the CRISPR complex comprises a Cas9 enzyme complexed with a protected guide RNA containing a guide sequence that is hybridized to the target sequence within the target polynucleotide, where the target poly of the CRISPR complex. Binding to a nucleotide comprises inducing cell death, thereby allowing the selection of one or more cells (s) into which one or more mutations have been introduced. In a preferred embodiment of the invention, the cells selected may be eukaryotic cells. Aspects of the invention allow for the selection of specific cells without the need for selectable markers or allow for a two-step process that may include an adverse selection system.

With respect to mutations in the Cas9 enzyme, if the enzyme is not FnCas9, the mutation may be as described elsewhere in this specification; conservative substitutions of any of the substituted amino acids are also envisioned. In one aspect, the invention comprises at least one or more mutations in the CRISPR enzyme, and at least one or more mutations or at least two or more mutations in any other of the specification. Provided with respect to any or each or all embodiments discussed herein, selected from those described.

In a further aspect, the invention is a computer-assisted method (including potential) for identifying or designing compounds that may match or bind to the CRISPR-Cas9 system or functional portions thereof (including vice versa). A computer-assisted method for identifying or designing a CRISPR-Cas9 system or its functional part for binding to a desired compound) or a computer-assisted method for identifying or designing a potential CRISPR-Cas9 system (eg, eg, eg. With respect to predicting regions of the CRISPR-Cas9 system that can be manipulated based on crystal structure data or based on Cas9 ortholog data, or by binding a functional group such as an activator or repressor to the CRISPR-Cas9 system. Involved in obtaining, or in Cas9 cleavage, or in designing nickases), the methods include:

The following steps using a programmed computer including a computer system, such as a processor, data storage system, input device, and output device:

(A) Optional choices, for example, in a CRISPR-Cas9-based binding domain or alternative, or in addition, in a domain that changes based on changes in the Cas9 ortholog, or with respect to Cas9s, with respect to nickase, or with respect to the functional group. The input device data, including the three-dimensional coordinates of a subset of atoms from the CRISPR-Cas9 crystal structure or related to the CRISPR-Cas9 crystal structure, using structural information from the CRISPR-Cas9 system complex (s). Input to a computer programmed through, thereby generating a dataset;

(B) It is desirable to use the processor to bind, presumably, or bind the data set to a computer database having a structure stored in the computer data storage system, for example, a CRISPR-Cas9 system. Comparing the structure of a compound with respect to Cas9 orthologs (eg, different domains or regions between Cas9s or Cas9 orthologs) or CRISPR-Cas9 crystal structures or nickases or functional groups;

(C) Using computer techniques, from the above database, structures-eg, CRISPR-Cas9 structures that can bind to a desired structure, desired structures that can bind to a particular CRISPR-Cas9 structure, CRISPR that can be manipulated-. Part of the Cas9 system (eg, derived from other parts of the CRISPR-Cas9 crystal structure and / or Cas9 ortholog, cleaved Cas9s, novel nickase or specific functional group, or functional group or functional group CRISPR-Cas9 system attached. (Based on the data from the position to do);

(D) Building a model of the selected structure (s) using computer methods;

(E) Output the selected structure (s) to the output device;

And, optionally, synthesize one or more of the selected structures (s);

Also, optionally, the synthesized selected structure (s) may be further tested as a CRISPR-Cas9 system or in a CRISPR-Cas9 system;

Alternatively, the method comprises the coordinates of at least two atoms of the CRISPR-Cas9 crystal structure, eg, the coordinates of at least two atoms in the crystal structure table herein of the CRISPR-Cas9 crystal structure, or at least the coordinates of the CRISPR-Cas9 crystal structure. Provide subdomain coordinates (“selected coordinates”), including binding molecules that can be manipulated, eg, based on data from other parts of the CRISPR-Cas9 crystal structure and / or from Cas9 orthologs. CRISPR-Cas9 structures, specific CRISPR-Cas9 structures that can provide a candidate structure or part of the CRISPR-Cas9 system, as well as fit the candidate structure to selected coordinates and thereby bind to the desired structure. A desired structure that can be attached to, a portion of the CRISPR-Cas9 system that can be manipulated, a cleaved Cas9, a novel nickase, or a specific functional group, or a functional group or a position for attaching to the functional group CRISPR-Cas9 system. And to obtain product data including its output using its output; and optionally synthesize a compound (s) from the above product data and optionally as a CRISPR-Cas9 system or CRISPR. -Includes testing the synthetic compound (s) in a Cas9 system.

The test may include analyzing the CRISPR-Cas9 system resulting from the synthesized selected structure (s), eg, with respect to binding or performing the desired function.

The output in the aforementioned method is data transmission, eg telecommunications, telephone, video conferencing, mass communication, eg presentations such as computer presentations (eg POWERPOINT), internet, email, document communications, eg computer programs (eg computer programs). : WORD) May include transmission of information via documents and the like. Accordingly, the present invention also includes atomic coordinate data according to the crystal structure referred to herein, atomic coordinate data defining the three-dimensional structure of CRISPR-Cas9 or at least one subdomain thereof, or structural factor data of CRISPR-Cas9. Including a computer-readable medium comprising, the structural factor data can be derived from the atomic coordinate data of the crystal structure referred to herein. The computer-readable medium may also include any data from the methods described above. The invention further includes methods of computer systems for generating or performing rational designs, such as those described above, including any of the following: Atomic coordinate data in crystal structure cited herein. , The data provides the three-dimensional structure of CRISPR-Cas9 or at least one subdomain thereof, or the structural factor data of CRISPR-Cas9, which is the atomic coordinates of the crystal structure referred to herein. It can be derived from the data. The invention further embraces a method of doing business comprising providing a user with a three-dimensional structure of a computer system or medium or CRISPR-Cas9 or at least one subdomain thereof, or structural factor data of CRISPR-Cas9. The structure is shown and the structural factor data can be derived from the atomic coordinate data of the crystal structure referenced herein, or from the computer media herein or data transmission herein.

A "binding site" or "active site" is a site in a binding cavity or region that can bind to a compound such as a nucleic acid molecule involved in the binding (atom, functional group of amino acid residues or multiple such atoms and / Or groups, etc.), or essentially consist of, or consist of them.

"Fit, fit, fit" means determining the interaction between one or more atoms of a candidate molecule and at least one atom of the structure of the invention by automatic or semi-automatic means, and such. It means that the interaction is stable and calculates to some extent. Interactions include attraction and repulsion brought about by charge, steric considerations, and the like. Various computer-based methods for fitting are further described.

"Root mean square (or rms) deviation" means the arithmetic mean square root of the square root of the deviation from the mean.

"Computer system" means hardware means, software means, and data storage means used to analyze atomic coordinate data. Minimal hardware means of a computer-based system of the present invention typically include a central processing unit (CPU), input means, output means and data storage means. It is desirable to have a display or monitor to visualize the structural data. The data storage means may be RAM or means for accessing the computer-readable medium of the present invention. Examples of such systems are computers and tablet devices running the Unix, Windows, or Apple operating systems.

A "computer-readable medium" is, for example, any medium (s) that can be read and accessed directly or indirectly by a computer, for example, as a result of which the medium is used in the computer system described above. Means a suitable medium. Such media include, but are not limited to, magnetic storage media; for example, floppy disks, hard disk storage media, and magnetic tapes; optical storage media such as optical disks or CD-ROMs; electrical storage such as RAMs and ROMs. Media; thumb drive devices; cloud storage devices and hybrids of these categories such as magnetic / optical storage media.

The invention includes the use of the above protection guides herein in the optimized functional CRISPR-Cas enzyme system described herein.

Set Cover Approach In certain embodiments, primers and / or probes that can identify, for example, all viruses and / or microbial species within a defined set of viruses and microorganisms are designed. Such methods are described in certain exemplary embodiments. The set cover solution can identify the minimum number of target sequence probes or primers required to cover the entire target sequence or set of target sequences, such as a set of genomic sequences. Set cover approaches have previously been used to identify primers and / or microarray probes, typically in the range of 20-50 base pairs. For example, Pearson et al. , Cs. Virginia. edu / ~ robins / papers / primers_damll_fmal. pdf, Jabado et al. Nucleic Acids Res. 2006 34 (22): 6605-ll, Jabado et al. Nucleic Acids Res. 2008, 36 (l): e3 doi10.1093 / nar / gkmll06, Duitama et al. Nucleic Acids Res. 2009, 37 (8): 2483-2492, Phillippy et al. BMC Bioinformatics. 2009, 10: 293 doi: 10.1186 / 1471-2105-10-293. Such an approach generally treats each primer / probe as a kmer and either searches for an exact match or uses a suffix array to allow inaccurate matches. Moreover, these methods generally only require that each input sequence be bound by one primer or probe, and the primer or probe is selected so that the position of this binding along the sequence is irrelevant. Takes a binary approach to detect hybridization. Alternatively, the target genome can be divided into predefined windows and each window can be effectively treated as a separate input sequence under a binary approach. That is, it is necessary to determine whether a particular probe or guide RNA binds within each window and all windows are bound by the state of some primers or probes. In effect, these approaches treat each element of the "universe" of the set cover problem as either the entire input sequence or a predefined window of the input sequence, where each element has the start of a probe or guide RNA. When combined within, it is considered "covered".

In some embodiments, the methods disclosed herein can be used to identify all variants of a given virus, or multiple different viruses, in a single assay. Further, the methods disclosed herein treat each element of the "universe" in the set cover problem as a nucleotide of the target sequence, as long as the probe or guide RNA binds to several segments of the target genome containing the element. , Each element is considered "covered". In addition to asking if a given primer or probe binds or does not bind to a given window, such an approach can be used to detect hybridization patterns. That is, when a given primer or probe binds to a single target sequence or multiple target sequences, their hybridization pattern is sufficient to allow both enrichment from the sample and sequencing of any target sequence. To some extent determine the minimum number of primers or probes needed to cover a set of target sequences. These hybridization patterns can be determined by defining specific parameters that minimize the loss function, thereby varying the parameters relative to each other, eg, to reflect different varieties. Minimal, in a way that enables, and in a computer-efficient way that cannot be achieved using simple applications of setcover solutions, such as those previously applied in the design context of primers or probes. Allows identification of a set of probes or guide RNAs.

The ability to detect the abundance of multiple transcripts can allow the generation of unique viral or microbial signatures that exhibit a particular phenotype. Various machine learning techniques can be used to derive gene signatures. Thus, the primers and / or probes of the invention can be used to identify and / or quantify the relative levels of biomarkers defined by the gene signature to detect a particular phenotype. In certain exemplary embodiments, the gene signature indicates susceptibility to a particular treatment, resistance to treatment, or a combination thereof.

In one aspect of the invention, the method comprises detecting one or more pathogens. In this way, it is possible to obtain a distinction between infections of the subject by individual microorganisms. In some embodiments, such a distinction allows the clinician to detect or diagnose a particular disease, eg, various variants of the disease. Preferably, the virus or pathogen sequence is a genome or fragment thereof of the virus or pathogen. This method may further include determining the evolution of the pathogen. Determining the evolution of a pathogen can include the identification of pathogen mutations, such as nucleotide deletions, nucleotide insertions, and nucleotide substitutions. The latter include non-synonymous, synonymous, and non-code substitutions. Mutations are often non-synonymous during an outbreak. This method may further comprise determining the substitution rate between the two pathogen sequences analyzed as described above. Whether the mutation is harmful or adaptive requires functional analysis, but the proportion of non-synonymous mutations suggests that continued progression of this epidemic may provide opportunities for pathogen adaptation. Emphasizes the need for prompt containment. Therefore, this method can further include assessing the risk of viral adaptation and the number of non-synonymous mutations is determined. (Gire, et al., Science 345, 1369, 2014). This method can include diagnostic guide designs described elsewhere herein.

RNA-Based Masking Constructs As used herein, "masking constructs" refers to molecules that can be cleaved or otherwise inactivated by the activated CRISPR-based effector proteins described herein. The term "masking construct" may instead be referred to as "detection construct". In certain exemplary embodiments, the masking construct is an RNA-based masking construct. RNA-based masking constructs contain RNA elements that can be cleaved by the CRISPR effector protein. Cleavage of the RNA element produces a structural change that allows the drug to be released or a detectable signal to be generated. Exemplary constructs are described below showing how RNA elements can be used to prevent or mask the generation of detectable signals, and embodiments of the invention include modifications thereof. Prior to cleavage, or if the masking construct is in the "active" state, the masking construct blocks the generation or detection of a detectable positive signal. It will be appreciated that in certain exemplary embodiments, minimal background signal can be generated in the presence of an active RNA masking construct. The positive detectable signal can be optical, fluorescent, chemiluminescent, electrochemical, or any signal that can be detected using other detection methods known in the art. The term "detectable positive signal" is used to distinguish it from other detectable signals that may be detectable in the presence of masking constructs. For example, in certain embodiments, the first signal can be detected in the presence of the masking agent (ie, a detectable negative signal), which is then activated and at the time of detection of the target molecule. Upon cleavage or deactivation of the masking agent by the CRISPR effector protein, it is converted to a second signal (eg, a detectable positive signal).

Thus, in certain embodiments of the invention, the RNA-based masking construct suppresses the generation of detectable positive signals, or the RNA-based masking construct masks the detectable positive signal, or Instead, it suppresses the generation of detectable positive signals by producing detectable negative signals, or RNA-based masking constructs suppress the production of gene products encoded by the reporting constructs with silencing RNA. Including, the gene product produces a detectable positive signal upon expression.

In a further embodiment, the RNA-based masking construct is a ribozyme that produces a detectable negative signal, and when the ribozyme is inactivated, a detectable positive signal is produced or the ribozyme is the substrate. It is converted to the first color and the substrate is converted to the second color when the ribozyme is inactivated.

In other embodiments, the RNA-based masking agent is an RNA aptamer, or the aptamer sequesters the enzyme, and the enzyme acts on the substrate to generate a detectable signal upon release from the aptamer, or the aptamer. Isolates a pair of agents that bind when released from an aptamer to produce a detectable signal.

In another embodiment, the RNA-based masking construct comprises an RNA oligonucleotide to which a detectable ligand and masking component are attached. In another embodiment, the detectable ligand is a fluorophore and the masking component is a reagent that amplifies a target RNA molecule, such as, but not limited to, a quencher molecule, or NASBA or RPA reagent.

In certain exemplary embodiments, the masking construct may suppress the production of gene products. The gene product can be encoded by a reporter construct added to the sample. The masking construct can be interfering RNA involved in the RNA interference pathway, such as short hairpin RNA (SHRNA) or small interfering RNA (siRNA). Masking constructs can also include microRNAs (miRNAs). Suppresses the expression of gene products during the presence of masking constructs. The gene product can be a fluorescent protein or other RNA transcript, or a protein that can be detected by a labeled probe, aptamer, or antibody in the absence of a masking construct. When the effector protein is activated, the masking construct is cleaved or otherwise silenced, allowing expression and detection of the gene product as a detectable positive signal.

In certain exemplary embodiments, the masking construct isolates one or more reagents required to generate a detectable positive signal, thereby detecting the release of one or more reagents from the masking construct. Can result in the production of positive signals. Any one or more reagents that can be combined to produce a colorimetric signal, chemiluminescent signal, fluorescent signal, or any other detectable signal and is known to be suitable for such purposes. Reagents can be included. In certain exemplary embodiments, one or more reagents are isolated by RNA aptamers that bind to one or more reagents. When the effector protein is activated upon detection of the target molecule and the RNA aptamer is degraded, one or more reagents are released.

In certain exemplary embodiments, the masking construct is immobilized on a solid substrate within separate separate volumes (further defined below), allowing a single reagent to be isolated. For example, the reagent can be beads containing a dye. When isolated by immobilization reagents, individual beads are too diffused to produce a detectable signal, but upon release from the masking construct, for example by aggregation or a simple increase in solution concentration, produce a detectable signal. can. In certain exemplary embodiments, the immobilized masking agent is an RNA-based aptamer that can be cleaved by the activated effector protein upon detection of the target molecule.

In certain other exemplary embodiments, the masking construct binds to the reagent immobilized in solution, thereby blocking the ability of the reagent to bind to a separate labeled binding partner free in solution. do. Therefore, applying the wash step to the sample can wash the labeled binding partner from the sample in the absence of the target molecule. However, when the effector protein is activated, the masking construct is cleaved to such an extent that it interferes with the ability of the masking construct to bind to the reagent, thereby allowing the labeled binding partner to bind to the immobilization reagent. It will be like. Therefore, the labeled binding partner remains after the wash step, indicating the presence of the target molecule in the sample. In certain embodiments, the masking construct that binds to the immobilization reagent is an RNA aptamer. The immobilization reagent may be a protein and the labeled binding partner may be a labeled antibody. Alternatively, the immobilization reagent may be streptavidin and the labeled binding partner may be labeled biotin. The label on the binding partner used in the above embodiments can be any detectable label known in the art. In addition, other known binding partners can be used according to the overall design described herein.

In certain exemplary embodiments, the masking construct may include a ribozyme. Ribozymes are RNA molecules with catalytic properties. Ribozymes are natural and engineered and contain or consist of RNA that can be targeted by the effector proteins disclosed herein. Ribozymes can be selected or manipulated to catalyze a reaction that produces a detectable negative signal or prevents the production of a positive control signal. Inactivation of the ribozyme by the activating effector protein eliminates reactions that produce negative control signals or interfere with the production of detectable positive signals, allowing the generation of detectable positive signals. do. In one exemplary embodiment, the ribozyme can catalyze the colorimetric reaction and make the solution appear as a first color. When the ribozyme is inactivated, the solution changes to a second color, which becomes a detectable positive signal. Examples of methods in which ribozymes can be used to catalyze colorimetric reactions are described in Zhao et al. "Signal amplification of glucosamine-6-phosphate based on ribozyme glmS," Biosensor Biosensor. 2014; 16: 337-42, and provides an example of how such a system can be modified to function in the context of the embodiments disclosed herein. Alternatively, ribozymes, if present, can produce cleavage products of, for example, RNA transcripts. Therefore, detection of a detectable positive signal may include detection of uncleaved RNA transcripts produced only in the absence of ribozymes.

In certain exemplary embodiments, the one or more reagents are proteins, such as enzymes, that can facilitate the production of detectable signals such as colorimetric, chemiluminescent, or fluorescent signals. Binding of one or more RNA aptamers to a protein inhibits or isolates it from producing a detectable signal. Upon activation of the effector proteins disclosed herein, RNA aptamers are cleaved or degraded to such an extent that they no longer interfere with the protein's ability to produce detectable signals. In certain exemplary embodiments, the aptamer is a thrombin inhibitor aptamer. In certain exemplary embodiments, the thrombin inhibitor aptamer has the sequence of GGGAACAAAGCUGAAGUACUUACCC (SEQ ID NO: 4). When this aptamer is cleaved, thrombin is activated and cleaves the colorimetric or fluorescent substrate of the peptide. In certain exemplary embodiments, the colorimetric substrate is paranitroanilide (pNA) covalently attached to the peptide substrate of thrombin. When cleaved by thrombin, pNA is released and turns yellow, making it more visible. In certain exemplary embodiments, the fluorescent substrate is 7-amino-4-methylcoumarin, a blue phosphor that can be detected using a fluorescence detector. Inhibitor aptamers can also be used for horseradish peroxidase (HRP), beta-galactosidase, or calf alkaline phosphatase (CAP), within the scope of the general principles described above.

In certain embodiments, RNase activity is detected colorimetrically via cleavage of the enzyme inhibitor aptamer. One potential mode of converting RNase activity to a colorimetric signal is to combine cleavage of the RNA aptamer with reactivation of an enzyme capable of producing a colorimetric output. In the absence of RNA cleavage, intact aptamers bind to enzyme targets and inhibit their activity. The advantage of this readout system is that the enzyme provides an additional amplification step: when released from the aptamer via associated activity (eg Cas13a associated activity), the chromogen continues to produce chromophore. Causes signal proliferation.

In certain embodiments, existing aptamers that inhibit enzymes with colorimetric readout are used. There are several aptamer / enzyme pairs with colorimetric readout, such as thrombin, protein C, neutrophil elastase, and subtilisin. These proteases have pNA-based colorimetric substrates and are commercially available. In certain embodiments, novel aptamers targeting common colorigenic enzymes are used. Common and robust enzymes such as beta galactosidase, horseradish peroxidase, or calf intestinal alkaline phosphatase can be targets for engineered aptamers designed by selection strategies such as SELEX. Such a strategy allows rapid selection of aptamers with nanomolar binding efficiency and can be used to develop additional enzyme / aptamer pairs for colorimetric readout.

In certain embodiments, RNase activity is detected colorimetrically through cleavage of the RNA mooring inhibitor. Many common colorigenic enzymes have competitive and reversible inhibitors. For example, beta-galactosidase can be inhibited by galactose. Many of these inhibitors are weak, but their effectiveness can be enhanced by increasing local concentrations. By associating the local concentration of the inhibitor with the RNase activity, the colorimetric enzyme-inhibitor pair can be manipulated and incorporated into the RNase sensor. Small molecule inhibitor-based colorimetric RNase sensors include three components: a colorigenic enzyme, an inhibitor, and a cross-linked RNA that covalently binds to both the inhibitor and the enzyme to anchor the inhibitor to the enzyme. In the uncleaved configuration, the enzyme is inhibited by an increase in the local concentration of small molecules. When RNA is cleaved (eg, by cass13a-associated cleavage), the inhibitor is released and the colorigenic enzyme is activated.

In certain embodiments, RNase activity is detected colorimetrically through the formation and / or activation of G quadruplexes. The G quadruplex of DNA can form a complex with heme (iron (III) -protoporphyrin IX) to form a DNAzyme with peroxidase activity. When supplied with a peroxidase substrate (eg, ABTS: (2,2'-azinobis [3-ethylbenzothiazolin-6-sulfonic acid] -diammonate)), G quadruplex in the presence of hydrogen peroxide- The heme complex causes oxidation of the substrate, which forms a green color in solution. An example of a DNA sequence forming a G quadruplex is GGGTAGGGCGGGGTTGGA (SEQ ID NO: 5). Hybridization of the RNA sequence to this DNA aptamer limits the formation of the G quadruplex structure. RNase-associated activation (such as C2c2 complex-side subactivation) cleaves RNA staples, forms G quadruplexes, and binds heme. This strategy is particularly attractive. This is because color development is enzymatic, meaning that there is additional amplification beyond RNase activation.

In certain exemplary embodiments, the masking construct is immobilized on a solid substrate within separate separate volumes (further defined below), allowing a single reagent to be isolated. For example, the reagent can be beads containing a dye. When isolated by immobilization reagents, individual beads are too diffused to produce a detectable signal, but upon release from the masking construct, for example by aggregation or a simple increase in solution concentration, produce a detectable signal. can. In certain exemplary embodiments, the immobilized masking agent is an RNA-based aptamer that can be cleaved by the activated effector protein upon detection of the target molecule.

In one exemplary embodiment, the masking construct comprises a detector that changes color depending on whether the detector is aggregated or dispersed in solution. Certain nanoparticles, such as colloidal gold, undergo a visible color shift from purple to red as they move from aggregates to dispersed particles. Thus, in certain exemplary embodiments, such detection agents can be aggregated and retained by one or more cross-linking molecules. At least some of the cross-linking molecules contain RNA. Upon activation of the effector proteins disclosed herein, the RNA portion of the cross-linking molecule is cleaved, the detection agent is dispersed, resulting in a corresponding color change. In certain exemplary embodiments, the cross-linking molecule is an RNA molecule. In certain exemplary embodiments, the detector is a colloidal metal. Colloidal metal materials can include water-insoluble metal particles or metal compounds dispersed in liquids, hydrosols, or metal sol. Colloidal metals can be selected from Group IA, IB, IIB and IIIB metals in the Periodic Table, as well as transition metals, especially Group VIII metals. Preferred metals include gold, silver, aluminum, ruthenium, zinc, iron, nickel and calcium. Other suitable metals include all of the following in various oxidation states: lithium, sodium, magnesium, potassium, scandium, titanium, vanadium, chromium, manganese, cobalt, copper, gallium, strontium, niobium, Molybdenum, palladium, indium, tin, tungsten, rhenium, platinum, and gadolinium. The metal is preferably provided as an ion form, eg, an ion of Al ³⁺ , Ru ³⁺ , Zn ²⁺ , Fe ³⁺ , Ni ²⁺ , and Ca ²⁺ , derived from a suitable metal compound.

When the RNA bridge is cleaved by the activated CRISPR effector, the aforementioned color shift is observed. In certain exemplary embodiments, the particles are colloidal metals. In certain other exemplary embodiments, the colloidal metal is colloidal gold. In certain exemplary embodiments, the colloidal nanoparticles are 15 nm gold nanoparticles (AuNP). Due to the unique surface properties of colloidal gold nanoparticles, maximum absorbance is observed at 520 nm when completely dispersed in solution and appear red to the naked eye. When AuNP aggregates, it shifts red at maximum absorbance, darkens in color, and finally precipitates from solution as dark purple aggregates. In certain exemplary embodiments, the nanoparticles are modified to include a DNA linker that extends from the surface of the nanoparticles. The individual particles are linked to each other by a single-strand RNA (ssRNA) bridge that hybridizes to at least a portion of the DNA linker at each end of RNA. Thus, the nanoparticles form a network of aggregates with the linked particles and appear as a dark precipitate. Upon activation of the CRISPR effector disclosed herein, the ssRNA bridge is cleaved and the AUNPS is released from the ligated mesh, producing a visible red color. Examples of DNA linkers and RNA bridge sequences are shown below. The thiol linker at the end of the DNA linker can be used for surface conjugates to AuNPS. Other forms of conjugates may be used. In certain exemplary embodiments, two populations of AuNP can be generated, one for each DNA linker. This facilitates proper binding of the ssRNA bridge in the proper direction. In certain exemplary embodiments, the first DNA linker is conjugated by the 3'end and the second DNA linker is conjugated by the 5'end.

In certain other exemplary embodiments, the masking construct may include a detectable label and an RNA oligonucleotide to which the masking agent for the detectable label is attached. An example of such a detectable label / masking agent pair is a fluorophore and fluorophore quencher. Quenching of the fluorophore can occur as a result of the formation of a non-fluorescent complex between the fluorophore and another fluorophore or non-fluorescent molecule. This mechanism is known as ground state complex formation, static quenching, or contact quenching. Therefore, RNA oligonucleotides can be designed so that the fluorophore and quencher are close enough for contact quenching to occur. Fluorophores and similar quenchers thereof are known in the art and can be selected by one of ordinary skill in the art for this purpose. The particular fluorophore / quencher pair is not important in the context of the present invention, only the selection of the fluorophore / quencher pair ensures fluorofore masking. Upon activation of the effector proteins disclosed herein, RNA oligonucleotides are cleaved, thereby breaking the accessibility between the fluorophore and the quencher required to maintain the contact quenching effect. .. Therefore, fluorophore detection can be used to determine the presence of a target molecule in a sample.

In certain other exemplary embodiments, the masking construct may include one or more RNA oligonucleotides to which one or more metal nanoparticles, such as gold nanoparticles, are attached. In some embodiments, the masking construct comprises multiple metal nanoparticles crosslinked by multiple RNA oligonucleotides forming a closed loop. In one embodiment, the masking construct comprises three gold nanoparticles crosslinked by three RNA oligonucleotides forming a closed loop. In some embodiments, cleavage of the RNA oligonucleotide by the CRISPR effector protein results in a detectable signal produced by the metal nanoparticles.

In certain other exemplary embodiments, the masking construct may include one or more RNA oligonucleotides to which one or more quantum dots are attached. In some embodiments, cleavage of the RNA oligonucleotide by the CRISPR effector protein results in a detectable signal produced by the quantum dots.

In one exemplary embodiment, the masking construct may include quantum dots. Quantum dots may have a plurality of linker molecules attached to the surface. At least some of the linker molecules contain RNA. The linker molecule binds to one or more quenchers at one end of the quantum dot and along the length of the linker or at the end of the linker and is close enough for quantum dot quenching to occur. Ensure that the quencher is maintained. The linker may be branched. As mentioned above, the quantum dot / quencher pair is not important and simply selecting the quantum dot / quencher pair guarantees fluorofore masking. Quantum dots and similar quenchers thereof are known in the art and can be selected by one of ordinary skill in the art for this purpose. Upon activation of the effector proteins disclosed herein, the RNA portion of the linker molecule is cleaved, thereby the proximity between the quantum dots and one or more quenchers required to maintain the quenching effect. Gender is excluded. In certain exemplary embodiments, the quantum dots are streptavidin conjugates. RNA is linked via a biotin linker to sequence the quenching molecule / 5Biosg / UCUCGUACGUUC / 3IAbRQSp / (SEQ ID NO: 9) or / 5Biosg / UCUCGUACGUUCUCUCGUACGUUC / 3IAbRQSp / (SEQ ID NO: 10). Is a biotin tag and / 31AbRQSp / is an Iowa black quencher. Upon cleavage, the activation effectors disclosed herein cause the quantum dots to emit visible fluorescence.

Similarly, fluorescence energy transfer (FRET) can be used to generate a detectable positive signal. FRET is a higher vibration level of the singlet state in which photons from an energetically excited fluorophore (ie, "donor fluorofore") excite the electron energy state of another molecule (ie, "acceptor"). It is a non-radiative process. The donor fluorophore returns to the ground state without emitting the fluorescence peculiar to the fluorophore. The acceptor can be another fluorophore or non-fluorescent molecule. If the acceptor is a fluorophore, the transferred energy is emitted as the fluorescent property of that fluorophore. If the acceptor is a non-fluorescent molecule, the absorbed energy is lost as heat. Thus, in the context of the embodiments disclosed herein, a fluorophore / quencher pair is replaced with a donor fluorophore / acceptor pair bound to an oligonucleotide molecule. When intact, the masking construct produces the first signal (detectable negative signal) detected by fluorescence or heat emitted from the acceptor. Activation of the effector proteins disclosed herein cleaves RNA oligonucleotides, disrupts FRET, and thus detects donor fluorophore fluorescence (detectable positive signal).

In certain exemplary embodiments, masking constructs include the use of insert dyes that alter their absorbance in response to cleavage of long RNA into short nucleotides. There are several such pigments. For example, pyronin-Y forms a complex with RNA, forming a complex with an absorbance at 572 nm. Cleavage of RNA causes loss of absorbance and color change. Methylene blue can be used in a similar manner, with a change in absorbance at 688 nm upon RNA cleavage. Thus, in certain exemplary embodiments, the masking construct comprises RNA and an inserted dye complex that alters the absorbance upon cleavage of RNA by the effector proteins disclosed herein.

In certain exemplary embodiments, the masking construct may include an initiator for the HCR reaction. For example, Dirks and Piece. See PNAS 101, 15275-15728 (2004). The HCR reaction utilizes the potential energy of two hairpin species. When a single-stranded initiator having a complementary portion to one corresponding region of a hairpin is released into a previously stable mixture, one type of hairpin is opened. This process in turn exposes the single-stranded area that opens the hairpins of other species. In turn, this process exposes the same single-stranded region as the original initiator. The resulting chain reaction can result in the formation of a nicked double helix that grows until the hairpin supply is depleted. Detection of the resulting product can be performed on a gel or chromatically. Examples of the colorimetric detection method include, for example, Lu et al. "Ultra-sensitive colorimetric assay system based on the hybridization chain reaction-triggered enzyme cascade amplification ACS Appl Mater Interfaces, 2017,9 (1):. 167-175, Wang et al" An enzyme-free colorimetric assay using hybridization chain reaction amplification and split adapters "Anallyst 2015, 150, 7657-7662, and Song et al." Non covalent fluorescent labeling of colorimetry DNA product grouped withimetry. "Applied Spectroscopy, 70 (4): 686-694 (2016).

In certain exemplary embodiments, the masking construct may include an HCR initiator sequence and a cleavable structural element such as a loop or hairpin that prevents the initiator from initiating the HCR reaction. When structural elements are cleaved by the activated CRISPR effector protein, the initiator is released and triggers an HCR reaction, the detection of which indicates the presence of one or more targets in the sample. In certain exemplary embodiments, the masking construct comprises a hairpin with an RNA loop. When the activated CRISRP effector protein cleaves the RNA loop, the initiator can be released and the HCR reaction can be triggered.

Optical barcodes, barcodes, and unique molecular identifiers (UMIs)
The system disclosed herein may include optical barcodes of one or more target molecules, as well as optical barcodes associated with the detection CRISPR system. For example, the barcode of the target sample containing one or more target molecules and the target molecule can be merged with a droplet containing a CRISPR detection system containing an optical barcode.

As used herein, the term "barcode" is used as an identifier for a related molecule such as a target molecule and / or a target nucleic acid, or as an identifier for a source of a related molecule such as a cell of origin. Refers to a short sequence (eg, DNA or RNA). Barcodes can also refer to any unique, non-naturally occurring nucleic acid sequence that can be used to identify the origin of a nucleic acid fragment. Although it is not necessary to understand the mechanism of the invention, barcode sequences are high quality individual readings of barcodes associated with single cells, viral vectors, labeled ligands (eg, aptamers), proteins, shRNAs, sgRNAs, or cDNAs. Is believed to allow multiple species to be sequenced together.

Barcoding can be performed on the basis of any of the compositions or methods disclosed in Japanese Patent Publication WO2014047561 A1, Combinations and methods for labeling of agents, which is incorporated herein in its entirety. In certain embodiments, bar coding uses an error correction scheme (TK Moon, Error Correction Coding: Mathematic Methods and Algorithms (Wiley, New York, ed. 1, 2005)). Without being bound by theory, amplified sequences from a single cell are sequenced and determined together based on the barcode associated with each cell.

The optically coded particles may be randomly delivered to individual volumes resulting in a random combination of optically coded particles within each well, or the optically coded particles. A unique combination of can be specifically assigned to each individual volume. An observable combination of optically coded particles can then be used to identify each individual volume. Optical evaluations such as phenotypes can be created and recorded for each individual volume. In some cases, the barcode can be an optically detectable barcode that can be visualized with a light or fluorescence microscope. In certain exemplary embodiments, the optical barcode comprises a subset of fluorophores or quantum dots of color distinguishable from a set of defined colors. In some cases, the optically coded particles may be randomly delivered to individual volumes resulting in a random combination of optically coded particles within each well, or optically coded. A unique combination of optics may be specifically assigned to each individual volume.

In an exemplary embodiment, 105 barcodes can be generated with three fluorescent dyes, such as different levels of Alexa Fluor 555, 594, 647. A fourth dye can be added and used and expanded to the scale of hundreds of unique barcodes. Similarly, the five colors can increase the number of unique barcodes that can be achieved by varying the color ratio. By labeling with different ratios of dye, the dye ratio can be selected so that the dyes are evenly spaced in logarithmic coordinates after normalization.

In one embodiment, an assigned or random subset (s) of fluorophores received in each droplet or individual volume are observable of individual optically coded particles in each individual volume. The pattern is determined, thereby allowing each individual volume to be identified independently. Each individual volume is imaged with appropriate imaging techniques to detect optically coded particles. For example, if the optically coded particles are fluorescently labeled, each individual volume is imaged using a fluorescence microscope. In another example, if the optically coded particles are colorimetrically labeled, each individual volume has one or more filters that match the wavelength or absorption spectrum or emission spectrum unique to each color label. Is imaged using a microscope equipped with. Other detection methods suitable for the optical system used, such as those known in the art for detecting quantum dots, dyes, etc., are contemplated. The pattern of the individual optically coded particles observed for each individual volume can be recorded for later use.

The optical barcode can optionally contain a unique oligonucleotide sequence, and the generation method is described, for example, in International Patent Application Publication No. WO / 2014/047561 [050] to [0115]. Can be. In one exemplary embodiment, the primer particle identifier is incorporated into the target molecule. Next-generation sequencing (NGS) techniques known in the art can be used for sequencing involving clustering by sequence similarity of one or more target sequences. Alignment by sequence variation allows identification of optically coded particles delivered to individual volumes based on the particle identifier incorporated in the aligned sequence information. In one embodiment, the particle identifier of each primer incorporated into the aligned sequence information indicates a pattern of optically encoded particles that can be observed in the corresponding individual volumes in which the amplicon is generated. In this way, changes in the nucleic acid sequence can be correlated to the original individual volume and further matched to optical evaluations such as phenotypes made with specimens containing nucleic acid in that individual volume.

In a preferred embodiment, the sequencing is performed using a unique molecular identifier (UMI). As used herein, the term "unique molecular identifier" (UMI) is a subsequence of a sequencing linker or nucleic acid barcode used in methods of detecting and quantifying unique amplification products using molecular tags. Refers to the type. UMI is used to distinguish between the effects of a single clone and the effects of multiple clones. As used herein, the term "clone" can refer to a single mRNA or target nucleic acid to be sequenced. UMI can also be used to determine the number of transcripts that produced the amplification product, or, in the case of the target barcodes described herein, the number of binding events. In a preferred embodiment, amplification is by PCR or multiplex substitution amplification (MDA).

In certain embodiments, a UMI with a random sequence of 4-20 base pairs is added to the template, amplified and sequenced. In a preferred embodiment, the UMI is added to the 5'end of the template. Sequencing allows for high resolution readings and accurate detection of true variants. As used herein, a "true variant" is present in all amplification products from the original clone and is identified by aligning all products with UMI. Each amplified clone has a different random UMI indicating that the amplified product is derived from that clone. Since the true variant is present in all amplified products and the background representing random errors is present only in a single amplified product, the background due to the fidelity of the amplification process can be eliminated (eg Islam S). . Et al., 2014. Nature Methods No: 11,163-166). Without being bound by theory, UMI is designed to generate an assignment to the original even if up to 4-7 errors occur during amplification or sequencing. Without being bound by theory, UMI can be used to identify true barcode sequences.

The unique molecular identifier can be used, for example, to normalize a sample of variable amplification efficiency. For example, in various embodiments, each of the barcodes further comprises a solid or semi-solid support (eg, hydrogel beads) to which a nucleic acid barcode (eg, multiple barcodes sharing the same sequence) is attached. , All barcodes on a particular solid or semi-solid support may be bound to a unique molecular identifier so that they receive a unique unique molecular identifier. The unique molecular identifier is then given to the target molecule, along with the associated barcode, so that, for example, the target molecule receives not only the nucleic acid barcode but also an identifier unique among the identifiers derived from its solid or semi-solid support. Can be transferred.

Nucleic acid barcodes or UMIs are, for example, at least 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, It is 24, 25, 26, 27, 28, 29, 30, 35, 40, 45, 50, 60, 70, 80, 90, or 100 nucleotides in length and can be in single- or double-stranded form. The target molecule and / or the target nucleic acid can be labeled with multiple nucleic acid barcodes in a combinatorial fashion such as a nucleic acid barcode concatemer. Typically, nucleic acid barcodes, target molecules and / or target nucleic acids, derived from specific individual volumes, having specific physical properties (eg, affinity, length, sequence, etc.), Or used to identify as being subject to specific therapeutic conditions. Target molecules and / or target nucleic acids can be associated with multiple nucleic acid barcodes to provide information on all these features (and more). On the other hand, each member of a particular population of UMI is usually associated with an individual member of the same particular set of nucleic acid barcodes (eg, individual volumes, physical properties, or processing conditions specific). (For example, covalently attached to or a component of the same molecule). Thus, for example, each member of a set of origin-specific nucleic acid barcodes having the same or matching barcode sequence, or other nucleic acid identifiers or connector oligonucleotides, may be associated with distinguishable or different UMIs (for example). For example, it is covalently attached to or a component of the same molecule).

As disclosed herein, unique nucleic acid identifiers are used to label target molecules and / or target nucleic acids, such as origin-specific barcodes. Nucleic acid identifiers, nucleic acid barcodes can include short sequences of nucleotides that can be used as identifiers for related molecules, positions, or states. In certain embodiments, the nucleic acid identifier further comprises one or more unique molecular identifiers and / or barcode accepting adapters. Nucleic acid identifiers are, for example, about 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25. , 26, 27, 28, 29, 30, 35, 40, 45, 50, 60, 70, 80, 90, or 100 base pairs (bp) or nucleotides (nt) in length. In certain embodiments, nucleic acid identifiers are combinatorial by combining randomly selected indexes (eg, about 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 indexes). Can be constructed in any style. Each such index is a short sequence of nucleotides with different sequences (eg, DNA, RNA, or a combination thereof). The index is, for example, about 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 bp. Alternatively, it may have a length of nt. Nucleic acid identifiers can be generated, for example, by split pool synthesis methods such as those described in International Patent Publication Nos. WO2014 / 047556 and WO2014 / 143158, each of which is incorporated herein by reference in its entirety. can.

One or more nucleic acid identifiers (eg, nucleic acid barcodes) can be attached or "tagged" to the target molecule. This binding can be direct (eg, covalent or non-covalent binding of the nucleic acid identifier to the target molecule) or indirectly (eg, via an additional molecule). Such indirect attachment includes, for example, a barcode bound to a specific binder that recognizes the target molecule. In certain embodiments, the barcode adheres to protein G and the target molecule is an antibody or antibody fragment. Barcode attachment to target molecules (eg, proteins and other biomolecules) can be performed using standard methods well known in the art. For example, barcodes can be linked via cysteine residues (eg, C-terminal cysteine residues). In another example, a suitable group-specific reagent can be used to chemically introduce the barcode into the polypeptide (eg, an antibody) via various functional groups on the polypeptide (eg, www.drmr). See .com / abcon). In certain embodiments, barcode tagging can occur via a barcode receiving adapter associated (eg, attached) with a target molecule, as described herein.

The target molecule can optionally label multiple barcodes in a combinatorial manner (eg, using multiple barcodes bound to one or more specific binding agents that specifically recognize the target molecule). Therefore, it greatly expands the number of unique identifiers possible within a particular barcode pool. In certain embodiments, barcodes are added, for example, one at a time to a growing barcode concatemer attached to a target molecule. In other embodiments, multiple barcodes are assembled prior to attachment to the target molecule. Compositions and methods for concatenating multiple barcodes are described, for example, in International Patent Publication No. WO2014 / 047561, which is incorporated herein by reference in its entirety.

In some embodiments, nucleic acid identifiers (eg, nucleic acid barcodes) may be added to sequences that allow amplification and sequencing (eg, SBS3 and P5 elements for Illumina sequencing). In certain embodiments, the nucleic acid barcode can further include a hybridization site for a primer (eg, a single-stranded DNA primer) attached to the end of the barcode. For example, the origin-specific barcode can be a nucleic acid containing a hybridization site for the barcode and specific primers. In certain embodiments, the set of origin-specific barcodes comprises a unique primer-specific barcode created using, for example, the randomized oligotype NNNNNNNNNNNNNN (SEQ ID NO: 11).

The nucleic acid identifier can further include, for example, a unique molecular identifier and / or additional barcode specific to a common support to which one or more of the nucleic acid identifiers attach. Thus, pools of target molecules can be added, for example, to individual volumes containing multiple solid or semi-solid supports (eg, beads) representing different processing conditions (and / or, eg, one or more). Additional solid or semi-solid supports can be added continuously to individual volumes after introduction of the target molecule pool), so that the exact combination of conditions to which a particular target molecule is exposed is followed by it. It can be determined by sequencing the associated unique molecular identifier.

Origin-specific nucleic acid barcodes associated with labeled target molecules and / or target nucleic acids (optionally in combination with other nucleic acid barcodes described herein) are such as the polymerase chain reaction (PCR). It can be amplified by a method known in the art. For example, nucleic acid barcodes can include universal primer recognition sequences to which PCR primers can bind for PCR amplification and subsequent high-throughput sequencing. In certain embodiments, the nucleic acid barcode comprises or is bound to a sequencing adapter (eg, a universal primer recognition sequence) such that both the barcode and the sequencing adapter element bind to the target molecule. In certain examples, the sequence of origin-specific barcodes is amplified using, for example, PCR. In some embodiments, the origin-specific barcode further comprises a sequencing adapter. In some embodiments, the origin-specific barcode further comprises a universal priming site. Nucleic acid barcodes (or concatemers thereof), target nucleic acid molecules (eg, DNA or RNA molecules), nucleic acids encoding target peptides or polypeptides, and / or nucleic acids encoding specific binding agents are optionally such techniques. It is sequenced by any method known in the art, for example, high throughput sequencing methods also known as next-generation sequencing or deep sequencing. Barcode-labeled nucleic acid target molecules (eg, origin-specific barcodes) are barcoded and a single read and / or contig containing both the target molecule and the barcode sequence or a portion thereof. Can be generated. Exemplary next-generation sequencing techniques include, among others, Illumina sequencing, Ion Torrent sequencing, 454 sequencing, SOLiD sequencing, nanopore sequencing, and the like. In some embodiments, the sequence of the labeled target molecule is determined by a non-sequencing based method. For example, barcodes that use variable length probes or primers to label different target molecules, for example, depending on the length of the barcode, the length of the target nucleic acid, or the length of the nucleic acid encoding the target polypeptide. For example, origin-specific barcodes) can be distinguished. In another example, the barcode can include, for example, a sequence that identifies the type of molecule of a particular target molecule (eg, a polypeptide, nucleic acid, small molecule, or lipid). For example, in a pool of labeled target molecules containing multiple types of target molecules, the polypeptide target molecule can receive one discriminant sequence and the target nucleic acid molecule can receive different discriminant sequences. Such discriminant sequences selectively amplify barcodes that label a particular type of target molecule, for example by using PCR primers specific for the particular type of target molecule. Can be used for. For example, the barcode labeling the polypeptide target molecule can be selectively amplified from the pool, thereby extracting only the barcode from the polypeptide subset of the target molecule pool.

Nucleic acid barcodes can be sequenced, for example, after cleavage to determine the presence, amount, or other characteristics of the target molecule. In certain embodiments, the nucleic acid barcode can be further attached to additional nucleic acid barcodes. For example, nucleic acid barcodes are cleaved from the specific binder after the specific binder binds to the target molecule or tag (eg, a encoded polypeptide identifier element cleaved from the target molecule) and then the nucleic acid. Barcodes can be linked to origin-specific barcodes. The resulting nucleic acid barcode concatemer can be pooled and sequenced with other such concatemers. Sequencing reads can be used to identify which target molecule was originally present in which individual volume.

Barcodes Reversibly Bound to Solid Substrates In some embodiments, origin-specific barcodes are reversibly bound to solid or semi-solid substrates. In some embodiments, the origin-specific barcode further comprises a nucleic acid capture sequence that specifically binds to the target nucleic acid and / or a specific binding agent that specifically binds to the target molecule. In certain embodiments, the origin-specific barcode comprises two or more populations of origin-specific barcodes, the first population comprises a nucleic acid capture sequence and the second population specifically binds to a target molecule. Contains specific binders. In some examples, the first population of origin-specific barcodes further comprises a target nucleic acid barcode, which identifies the population as a label for the nucleic acid. In some examples, a second population of origin-specific barcodes further comprises a target molecule barcode, which identifies the population as a label for the target molecule.

Barcodes with cleavage sites Nucleic acid barcodes may be cleaved from the specific binder, for example, after the specific binder has bound to the target molecule. In some embodiments, the origin-specific barcode further comprises one or more cleavage sites. In some examples, at least one cleavage site is oriented such that the cleavage at that site emits an origin-specific barcode from the substrate to which it is attached, such as a hydrogel bead. In some examples, at least one cleavage site is oriented such that cleavage at that site releases an origin-specific barcode from the target molecule-specific binder. In some examples, the cleavage site is an enzyme cleavage site, such as an endonuclease site present in a particular nucleic acid sequence. In other embodiments, the cleavage site is a peptide cleavage site such that a particular enzyme can cleave the amino acid sequence. In yet another embodiment, the cleavage site is the site of chemical cleavage.

Barcode Adapter In some embodiments, the target molecule is attached to a source-specific barcode accepting adapter such as nucleic acid. In some examples, origin-specific barcode accepting adapters include overhangs, and origin-specific barcodes contain sequences that can hybridize to overhangs. Barcode acceptance adapters are molecules configured to receive or receive nucleic acid barcodes, such as origin-specific nucleic acid barcodes. For example, a barcode accepting adapter is one that can hybridize to a given barcode (eg, origin-specific barcode), for example, via a sequence that complements the barcode in part or in whole of the nucleic acid barcode. Chain nucleic acid sequences (eg, overhangs) can be included. In certain embodiments, this portion of the barcode is a standard sequence that is held constant between the individual barcodes. Hybridization causes the barcode receiving adapter to bind to the barcode. In some embodiments, the barcode accepting adapter may be associated (eg, attached) to the target molecule. Thus, the barcode accepting adapter can serve as a means of attaching origin-specific barcodes to the target molecule. The barcode accepting adapter can be attached to the target molecule according to a method known in the art. For example, a barcode accepting adapter can attach to a polypeptide target molecule at a cysteine residue (eg, a C-terminal cysteine residue). Barcode receiving adapters can be used to identify specific conditions associated with one or more target molecules, such as cells of origin or individual volumes of origin. For example, the target molecule can be a cell surface protein expressed by a cell and accepts a cell-specific barcode accepting adapter. When a cell is exposed to one or more conditions, the barcode accepting adapter can be attached to one or more barcodes, and the original origin cell of the target molecule and each state to which the cell is exposed are then , Can be determined by identifying the sequence of the barcode accepting adapter / barcode concatemer.

Barcodes with Captive Instances In some embodiments, origin-specific barcodes further include captive moieties covalently or non-covalently coupled. Thus, in some embodiments, origin-specific barcodes, including capture moieties, and either bound or attached thereto, are captured with a specific binder that specifically binds to the capture moiety. In some embodiments, the capture portion is adsorbed or otherwise captured on the surface. In certain embodiments, the target probe is labeled with biotin, for example by incorporating biotin-16-UTP during in vitro transcription, allowing later capture with streptavidin. Other means of labeling, capturing, and detecting origin-specific barcodes include aminoallyl-labeled nucleotide uptake, sulfhydryl-labeled nucleotide uptake, allyl or azide-containing nucleotide uptake, and specifically incorporated herein by reference. ^Bioconjugate Technologies (2nd Ed), Greg T. et al. Hermanson, Elsevier (2008) includes a number of other methods described. In some embodiments, the target probe is a carboxy-activated solid support of 1-ethyl-3- (3-dimethylaminopropyl) carbodiimide (EDC) following uptake of aminoallyl labeled nucleotides prior to contact with the sample. Covalently coupled to a solid support or other capture device using a method such as coupling to or using other methods described in Bioconjugate Technologies. In some embodiments, the specific binder is immobilized, for example, on a solid support, thereby isolating the origin-specific barcode.

Other Barcoding Embodiments DNA barcoding is also a taxonomic technique that uses short genetic markers in the DNA of an organism to identify it as belonging to a particular species. It differs from molecular phylogenetics in that its main purpose is not to determine classification, but to identify unknown samples for known classifications. Kless et al. , "Use of DNA barcodes to identify flowering plants" Proc. Natl. Acad. Sci. U. S. A. 102 (23): 8369-8374 (2005). Barcodes are often used to identify unknown species or to assess whether species need to be combined or separated. Koch H. , "Combining morphology and DNA barcoding resolves the taxonomy of Western Malagasy Liotrigona Moure, 1961" African Invertebrates 51 (2): 10 (2): 10 (2). , "How many loci does it take to DNA barcode a crocus?" PLOS One 4 (2): e4598 (2009). For example, to identify plant leaves even when flowers and fruits are not available, to identify animal diets based on stomach contents and feces, or to identify commercial products (such as herbal supplements or wood). , Barcode is used. Soininen et al. , "Analysing diet of small herbivores: the efficiency of DNA barcoding coupled with high-throughput200

It has been suggested that the desired loci for DNA bar coding need to be standardized so that a large database of sequences of those loci can be developed. Most of the taxa of interest have loci that can be sequenced without species-specific PCR primers. CBOL Plant Working Group, "A DNA barcode for land plants" PNAS 106 (31): 12794-1297 (2009). Moreover, these putative barcode loci are believed to be short enough to be easily sequenced with current technology. Kless et al. , "DNA barcodes: Genes, genomics, and bioinformatics" PNAS 105 (8): 2761-2762 (2008). Therefore, these loci, in combination with relatively small intraspecific variability, provide large interspecies variability. Lahaye et al. , "DNA barcoding the floras of biodiversity hotspots" Proc Natl Acad Sci USA 105 (8): 2923-2928 (2008).

DNA barcodes are based on a relatively simple concept. For example, most eukaryotic cells contain mitochondria, and the rate of mutation of mitochondrial DNA (mtDNA) is relatively high, resulting in large changes in the mtDNA sequence between species, and in principle, relatively small within the species. There will be a difference. The 648-bp region of the mitochondrial cytochrome c oxidase subunit 1 (CO1) gene has been proposed as a potential "barcode". As of 2009, the database of CO1 sequences contains at least 620,000 specimens from more than 58,000 animal species, which is larger than the databases available for any other gene. Is. Ausubel, J. et al. , "A botanical macroscope" Proceedings of the National Academia of Sciences 106 (31): 12569 (2009).

DNA bar coding software includes field information management systems (FIMS), lab information management systems (LIMS), sequence analysis tools, workflow tracking for connecting field and lab data, database transmission tools, and ecosystem scale. Need to integrate pipeline automation to scale up to your project. Geneius Pro can be used for sequence analysis components, and two plug-ins, Biocode LIMS and Genbank Submission plug-ins, which are available free of charge through the Moorea Biocode Project, handle integration with FIMS, LIMS, workflow tracking, and database transmission.

In addition, other barcode designs and tools have been described (eg, Birrell et al., (2001) Proc. Natl Acad. Sci. USA 98, 12608-12613, Giaever, et al., (2002) Nature. 418, 387-391, Windzeler et al., (1999) Science 285,901-906, and Xu et al., (2009) Proc Natl Acad Sci USA. Feb 17; 106 (7): 2289-94. sea bream).

The target molecules described herein can include any target nucleic acid sequence so that, in embodiments, one or more guide RNAs bind to one or more target molecules that are characteristic of the disease state. Designed. In a further embodiment, the disease state is acquired by an infectious disease, organ disease, blood disease, immune system disease, cancer, brain and nervous system disease, endocrine disease, pregnancy or childbirth-related disease, hereditary disease, or environment. It is a disease. In still further embodiments, the disease state is an infectious disease, including a microbial infection.

In a further embodiment, the infection is caused by a virus, bacterium, or fungus, or the infection is a viral infection. In certain embodiments, viral infection is caused by double-stranded RNA virus, plus-strand RNA virus, minus-strand RNA virus, retrovirus, or a combination thereof. In certain embodiments, the application can achieve multiplexed strain identification. In some embodiments, pathogen subtyping can be detected, and in one embodiment, influenza subtyping, staff or strept subtyping, and bacterial coinfection subtypes can be detected. In one preferred embodiment, multiple detection and identification of all H and N subtypes of influenza A virus can be performed. In one embodiment, the pooled (or sequenced) crRNA is used to capture variations within the subtype. In certain cases, the infection is HIV. In one embodiment, drug resistance mutations in HIV reverse transcriptase can be made via SNP detection. In some embodiments, the mutation may be K65R, K103N, V106M, Y181C, M184V, G190A. Similarly, SNP detection in other infectious diseases such as tuberculosis can be performed. In some embodiments, the mutation may be katG, 315ACC; isoniazid resistant, rpoB, 513TTG: rifampin resistant, gyrA, 94GGC: fluoroquinolone resistant, rs, 1401G: aminoglycoside resistant. In addition, co-infection with HIV / TB can be detected. Large-scale multiplexing for detection of pan-virus, virus zone pan-virus, pan-bacteria, or pan-pathogen can be achieved.

As described herein, samples containing target molecules for use in the present invention include food samples (fresh fruit or vegetables, meat), beverage samples, paper surfaces, fabric surfaces, metal surfaces, etc. It can be a biological or environmental sample such as a wood surface, a plastic surface, a soil sample, a freshwater sample, a wastewater sample, a saltwater sample, an air exposure or other gas sample, or a combination thereof. For example, household / commercial / industrial surfaces made of any material, including but not limited to metal, wood, plastic, rubber, etc., can be wiped with a cotton swab and tested for contaminants. Soil samples can be tested for the presence of pathogenic bacteria or parasites, or other microorganisms for environmental purposes and / or for testing for human, animal, or plant diseases. Water samples, such as freshwater samples, wastewater samples, or saltwater samples, can be evaluated for cleanliness and safety, and / or portability to detect, for example, the presence of Cryptosporidium paravum, Giardia lambda, or other microbial contamination. In a further embodiment, the biological sample is a tissue sample, saliva, blood, plasma, serum, stool, urine, sputum, mucous membrane, lymph, synovial fluid, cerebrospinal fluid, ascites, pleural effusion, seroma, pus, or skin or mucous membrane. Obtained from sources including, but not limited to, surface swabs. In some specific embodiments, the environmental or biological sample can be a crude sample, and / or one or more target molecules need not be purified or amplified from the sample prior to application of the method. Identification of microorganisms is useful and / or necessary for a variety of applications, and therefore any type of sample from any source deemed appropriate by one of ordinary skill in the art can be used in accordance with the present invention.

The biological sample may be further treated, including, for example, enriching or isolating the cells of interest prior to further evaluation. In one aspect, cells in a biological sample are first concentrated or sorted prior to further processing and / or library preparation. In embodiments, cells are sorted by fluorescence activated cell sorting (FACS) or magnetically activated cell sorting (MACS). In an exemplary embodiment, cells are first classified using, for example, antibody-coated (paramagnetic) magnetic beads to classify antigen-specific T cells. Both tube-based and column-based methods of MACS can be used to isolate rare cell populations or further concentrate cell (sub) populations of interest. Multiple rounds of MACS can further concentrate the cells, concentrating with the same epitope tag or different epitope tags in successive rounds. For example, Lee et al. , J. Biomol. Tech. See 2012 Jull 23 (2): 69-77. If necessary, the magnetic beads can be removed to elute the cells and further concentrate the cells for further treatment. In one embodiment, T cells can be isolated from peripheral blood by lysing red blood cells and, for example, by depleting monocytes by centrifugation over a PERCOLL ™ gradient. Certain subpopulations of T cells, such as CD28 +, T cells, can be further isolated by positive or negative selection techniques. For example, in a preferred embodiment, the T cells are anti-CD3 / such as DYNABEADS® M-450 CD3 / CD28 T or XCYTE DYNABEADS ™ over a period of time sufficient to positively select the desired T cells. Isolated by incubation with anti-CD28 (ie, 3x28) conjugated beads. In one embodiment, the period is about 30 minutes. In a further embodiment, the period is in the range of 30 minutes to 36 hours or more and all integer values in between. In a further embodiment, the period is at least 1, 2, 3, 4, 5, or 6 hours. In yet another embodiment, the period is 10 to 24 hours. In one preferred embodiment, the incubation time is 24 hours. Once the cells of interest have been sorted, concentrated and / or isolated, the sample can be further processed, for example, by nucleic acid extraction, barcode addition, droplet formation and analysis.

In some embodiments, the biological sample includes blood, plasma, serum, urine, stool, sputum, mucus, lymph, synovial fluid, bile, ascites, pleural effusion, serum tumor, saliva, cerebrospinal fluid, tufts. Or vitreous fluid, or any body fluid, synovial fluid, exudate (eg, fluid obtained from an abscess or any other infected or inflamed site), or joint (eg, normal joint or disease, eg joint). It may include, but is not limited to, body fluids from (joints affected by rheumatism, osteoarthritis, gout or septic arthritis, etc.), or swabs on the surface of the skin or mucous membranes. In certain embodiments, the sample can be blood, plasma, or serum obtained from a human patient.

In some embodiments, the sample can be a plant sample. In some embodiments, the sample can be a crude sample. In some embodiments, the sample can be a purified sample.

Microfluidic device containing an array of microwells A microfluidic device comprises an array of microwells with at least one flow channel beneath the microwells. In certain exemplary embodiments, the device is a microfluidic device that produces and / or merges different droplets (ie, individual individual volumes). For example, a first set of droplets containing the sample to be screened may be formed and a second set of droplets containing the elements of the system described herein may be formed. Next, the first and second droplet sets are merged, and then the diagnostic method described herein is performed on the merged droplet set.

Microfluidic devices disclosed herein are silicone-based chips, including but limited to hot embossing, elastomer molding, injection molding, LIGA, soft lithography, silicon processing, and related thin film processing techniques. It can be manufactured using various techniques that are not. Suitable materials for making microfluidic devices include cyclic olefin copolymers (COCs), polycarbonates, poly (dimethylsiloxane) (PDMS), and poly (methylacrylates) (PMMA). Not limited. In one embodiment, soft lithography in PDMS can be used to prepare a microfluidic device. For example, a mold can be created using photolithography that defines the location of flow channels, valves, and filters within the substrate. The substrate material is poured into a mold and cured to create a stamp. The stamp is then sealed on a solid support such as, but not limited to, glass. Immobilization agents may be required due to the hydrophobicity of some polymers, such as PDMS, which can absorb some proteins and interfere with certain biological processes (Schoffner et al. Nucleic Acids Research, 1996, 24: 375-379). Suitable immobilizers are known in the art, such as silane, parylene, n-dodecyl-b-D-matoside (DDM), Pluronic, Tween-20, other similar surfactants, polyethylene glycol ( PEG), albumin, collagen, and other similar proteins and peptides, but not limited to these.

Examples of microfluidic devices that can be used in the context of the present invention are incorporated herein by reference in Kulesa, et al. PNAS, 115, 6685-6690.

In certain exemplary embodiments, the device may include individual wells, such as microplate wells. The microplate well size may be a standard 6, 24, 96, 384, 1536, 3456, or 9600 size well size. In certain embodiments, the number of microwells may be greater than 40,000 or greater than 190,000. In certain exemplary embodiments, the elements of the system described herein may be lyophilized and applied to the surface of the well prior to distribution and use.

Microwell chips can be designed as disclosed in Agent Reference No. 52199-505P03US, or US Patent Application No. 15 / 559,381, which is incorporated herein by reference. In one embodiment, the microwell chip is designed in a format of about 6.2 x 7.2 cm containing 49,200 microwells, or a large format of 7.4 x 10 cm containing 97,194 microwells. Can be done. The array of microwells can be formed, for example, into two circles with a diameter of about 50-300 μm and, in certain embodiments, a diameter of 150 μm set to 10% overlap. The array of microwells can be arranged in a hexagonal grid with a well spacing of 50 μm. In some cases, microwells can be placed in other shapes, spacings, and sizes to hold different numbers of droplets. Microwell chips, in some embodiments, are advantageously of a size that can be used in standard experimental equipment, including imaging devices such as microscopes.

In an exemplary method, the compounds can be mixed in a unique ratio of fluorescent dyes (eg, Alexa Fluor 555, 594, 647). Each mixture of target molecule and dye mixture can be emulsified into droplets. Similarly, each detection CRISPR system with optical barcodes can be emulsified into droplets. In some embodiments, each droplet is about 1 nL. The droplets of the CRISPR detection system and the droplets of the target molecule can then be combined and applied to a microwell chip. The droplets can be combined by simple mixing or other combination methods. In one exemplary embodiment, the microwell tip is suspended on a platform such as a hydrophobic glass slide with removable spacers that can be clamped from above and below by a clamp or other fixing means that may be, for example, a neodymium magnet. .. It is possible to load oil into the gap between the chip and the glass created by the spacer, inject a pool of droplets into the chip, and then inject more oil to expel excess droplets to keep the droplets flowing. can. Once loading is complete, the tip can be oiled, the spacer removed, the microwell sealed against the glass slide and the clamp closed. The chip can be imaged, for example, with an epifluorescence microscope, merging the droplets and mixing the compounds in each microwell, for example by applying an AC electric field supplied by a corona processor, followed by the desired Can be processed according to the protocol of. In one embodiment, the microwells can be incubated at 37 ° C. while measuring fluorescence using an epifluorescence microscope. Following the manipulation of the droplet, the droplet can be eluted from the microwell as described herein for further analysis, processing, and / or manipulation.

The disclosed device can further include inlet and outlet ports, or openings, which are valves, tubes, channels, chambers, and syringes for introducing and extracting fluid from the device. And / or can be connected to a pump. The device may be connected to a fluid flow actuator that allows the directional movement of the fluid within the microfluidic device. Examples of actuators include, but are not limited to, syringe pumps, mechanically actuated recirculation pumps, electroosmotic pumps, valves, bellows, diaphragms, or bubbles for forcing fluid movement. In certain exemplary embodiments, the device is connected to a controller with programmable valves that work together to move fluid through the device. In certain exemplary embodiments, the device is connected to a controller, which is discussed in more detail below. The device can be connected to a flow actuator, controller, and sample loading device by a tube ending with a metal pin for insertion into the device's inlet port.

The present invention can be used in conjunction with a radio frequency lab-on-chip (LOC) diagnostic sensor system (see, eg, US Pat. No. 9,470,699, "Radio frequency identification sensor and applications theorof"). In certain embodiments, the invention is performed in a LOC controlled by a wireless device (eg, a mobile phone, personal digital assistant (PDA), tablet) and the results are reported to said device.

The radio frequency identification (RFID) tag system includes an RFID tag that transmits data for reception by an RFID reader (also known as an interrogator). In a typical RFID system, individual objects (eg, store merchandise) are equipped with relatively small tags, including transponders. The transponder has a memory chip to which a unique electronic product code is assigned. The RFID reader uses a communication protocol to send a signal that activates the transponder in the tag. Therefore, the RFID reader can read and write data to and from the tag. In addition, RFID tag readers process data according to RFID tag system applications. Currently, there are passive and active RFID tags. Passive RFID tags do not contain an internal power source, but are powered by radio frequency signals received from RFID readers. Alternatively, the active RFID tag includes an internal power source that allows the active RFID tag to have a larger transmission range and memory capacity. The use of passive and active tags depends on the particular application.

Lab-on-the-chip technology is well documented in the scientific literature and consists of multiple microfluidic channels, inputs or chemical wells. Conductive leads from RFID electronic chips can be connected directly to each test well, so reaction within the well can be measured using radio frequency identification (RFID) tag technology. The antenna can be printed or mounted on another layer of the electronic chip or mounted directly on the back of the device. Further, since the lead, the antenna, and the electronic chip can be embedded in the LOC chip, a short circuit of the electrode or the electronic device can be prevented. Because LOC allows for the separation and analysis of complex samples, this technology allows LOC testing to be performed independently of complex or expensive readers. Rather, simple wireless devices such as mobile phones or PDAs can be used. In one embodiment, the wireless device also controls the separation and control of microfluidic channels for more complex LOC analysis. In one embodiment, LEDs and other electronic measurement or sensing devices are included in the LOC-RFID chip. Without being bound by theory, this technique is disposable, allowing complex tests that require separation and mixing to be performed outside the laboratory.

In a preferred embodiment, the LOC can be a microfluidic device. The LOC may be a passive chip, which is powered and controlled via a wireless device. In certain embodiments, the LOC comprises a microfluidic channel for holding reagents and a channel for introducing samples. In certain embodiments, a signal from the radio device powers the LOC and activates a mixture of sample and assay reagents. Specifically, in the case of the present invention, the system may include a masking agent, a CRISPR effector protein, and a guide RNA specific for the target molecule. Once the LOC is activated, the microfluidic device can mix the sample with the assay reagent. Once mixed, the sensor detects the signal and sends the result to the wireless device. In certain embodiments, the demasking agent is a conductive RNA molecule. Conductive RNA molecules can attach to conductive materials. Conductive molecules can be conductive nanoparticles, conductive proteins, metal particles attached to proteins or latex, or other conductive beads. In certain embodiments, when DNA or RNA is used, the conductive molecule can attach directly to the matching DNA or RNA strand. Emissions of conductive molecules can be detected throughout the sensor. The assay can be a one-step process.

Since the electrical conductivity of the surface area can be accurately measured, quantitative results are possible with a disposable wireless RFID electroassay. In addition, the test area can be very small, allowing more tests to be performed in a particular area, resulting in cost savings. In certain embodiments, separate sensors and guide RNAs immobilized on the sensors, each associated with a different CRISPR effector protein, are used to detect multiple target molecules. Without being bound by theory, the activation of various sensors is distinguished by wireless devices.

In addition to the conductive methods described herein, RFID or other methods that rely on Bluetooth can be used as the basic low-cost communication and power platform for disposable RFID assays. For example, optical means can be used to assess the presence and level of a given target molecule. In certain embodiments, the optical sensor detects the unmasking of the fluorescent masking agent.

In certain embodiments, the device of the invention can include a handheld portable device for diagnostic reading of the assay (eg, Vashist et al., Commercial Smartphone-Based Devices and Smart Applications For Personmental , Diagnostics 2014, 4 (3), 104-128; mReader from Mobile Assay; and Diagnostic Rapid Digital Test Reader).

As described herein, certain embodiments are utilized in resource-poor environments where access to more complex detection devices for reading POC conditions and / or signals may be restricted. When done, it allows detection by color change with certain accompanying advantages. However, the portable embodiments disclosed herein can also be coupled with a handheld spectrophotometer that allows detection of signals outside the visible range. Examples of handheld spectrophotometer devices that can be used in combination with the present invention are described in Das et al. "Ultra-portable, wireless smartphone spectrophotometer for rapid, non-destructive testing of fruit ripens." Nature Scientific Reports. 2016, 6: 32504, DOI: 10.1038 / rep32504. Finally, in certain embodiments utilizing quantum dot-based masking constructs, the use of handheld UV light or other suitable device has been successfully used for the near-perfect quantum yield provided by quantum dots. The signal can be detected.

Individual Individual Volumes In some embodiments, the CRISPR system is contained within an individual individual volume, where each individual volume is designed to bind to the CRISPR effector protein, the corresponding target molecule. Includes one or more guide RNAs, and RNA-based masking constructs. In some cases, each of these individual individual volumes is a droplet. In a particularly preferred embodiment, the droplets are provided as a first set of droplets, each droplet comprising a CRISPR system. In some embodiments, the target molecule or sample is contained in an individual individual volume, and each individual individual volume comprises a target molecule. In some cases, each of these individual individual volumes is a droplet. In a particularly preferred embodiment, the droplets are provided as a second set of droplets, each droplet containing a target molecule.

In one aspect, the embodiments disclosed herein amplify the CRISPR system, one or more guide RNAs designed to bind to the corresponding target molecule, the masking construct, and the target nucleic acid molecule in the sample. Can include a first set of droplets directed to a nucleic acid detection system containing an optional reagent for. In certain exemplary embodiments, the system may further comprise one or more detection aptamers. One or more detection aptamers may include an RNA polymerase site or a primer binding site. One or more detection aptamers are configured to specifically bind to one or more target polypeptides and expose the RNA polymerase or primer binding sites only upon binding of the detection aptamer to the target peptide. Exposure of the RNA polymerase site facilitates the generation of triggered RNA oligonucleotides using the aptamer sequence as a template. Therefore, in such an embodiment, one or more guide RNAs are configured to bind to the trigger RNA.

"Individual individual volumes" prevent the movement of individual volumes or individual spaces, such as containers, containers, or nucleic acids, CRISPR detection systems, and the reagents required to perform the methods disclosed herein. And / or other defined volume or space that can be defined by the inhibiting property, eg, impermeable or semi-permeable, such as a wall, eg, a well wall, a tube wall, or a liquid. Volume or space defined by physical properties such as the surface of the droplet, or by other means such as chemical, restricted diffusivity, electromagnetic, or light irradiation, or any combination thereof. Is. In a particularly preferred embodiment, the individual individual volumes are droplets. "Limited diffusion rate" (eg, volume defined by diffusion) means a space accessible only to a particular molecule or reaction. This is because diffusion constraints effectively define space or volume, as in the case of two parallel layered streams where diffusion limits the movement of target molecules from one stream to another. .. A volume or space as defined as "chemical" means a space in which only certain target molecules can be present due to chemical or molecular properties such as size, eg, gel beads, surface charge, matrix size, etc. Alternatively, other physical properties of the bead that allow the selection of species that may enter the inside of the bead can prevent certain species from invading the bead. An "electromagnetically" defined volume or space is a space that captures magnetic particles directly in a magnetic field or on a magnet using the electromagnetic properties of the target molecule or its support, such as charge or magnetic properties. It means a space in which a specific area can be defined. An "optically" defined volume means any area of space that can be defined by irradiating it with visible, ultraviolet, infrared, or other wavelengths of light, within the defined space or volume. Only target molecules of can be labeled. One of the advantages of using a wallless or semipermeable membrane is that some reagents, such as buffers, chemical activators, or other reagents, pass through or through individual volumes. Other materials, such as target molecules, can be maintained in separate volumes or spaces. As described herein, the droplet system allows separation of the compound until the reaction is desired to initiate. Typically, the individual volumes are suitable fluid media (eg, aqueous solutions, oils, buffers, and / or cell proliferation) suitable for labeling target molecules with indexable nucleic acid identifiers under conditions that allow labeling. Will include media that can support). Illustrative individual volumes or spaces useful in the disclosed methods include, among other things, droplets (eg, microfluidic droplets and / or emulsion droplets), hydrogel beads or other polymer structures (eg, polyethylene glycol di). Acrylic beads or agarose beads), tissue slides (eg, fixed formalin paraffin-embedded tissue slides in which specific regions, volumes, or spaces are defined by chemical, optical, or physical means), ordered arrays or random. Microscope slides, tubes (centrifugal tubes, microcentrifugal tubes, test tubes, cuvettes, conical tubes, etc.), bottles (glass bottles, plastic bottles, ceramic bottles, triangular flasks, scintillations, etc.) whose areas are defined by depositing reagents in a pattern. Includes vials, etc.), wells (plate wells, etc.), plates, pipettes, or pipette tips. In certain exemplary embodiments, the individual individual volumes are droplets.

Droplets The droplets provided herein are typically water-in-oil microemulsions formed by an oil input channel and an aqueous input channel. Droplets can be formed by various dispersion methods known in the art. In one particular embodiment, a large number of uniform droplets in the oil phase can be made by microemulsion. An exemplary method is, for example, an R-junction shape in which the aqueous phase is sheared by oil, thereby producing droplets; a flow-focused shape in which droplets are produced by shearing the water stream from two directions. It also includes a co-flow shape coaxially arranged inside a large capillary tube in which the aqueous phase is drained through a thin capillary tube and oil is pumped.

The use of monodisperse aqueous droplets can be produced by microfluidic devices as water-in-oil emulsions. In one embodiment, the droplets are carried into the liquid oil phase and stabilized by a surfactant. In one aspect, a single cell or organelle or single molecule (protein, RNA, DNA) is encapsulated in uniform droplets from an aqueous solution / dispersion. In a related embodiment, multiple cells or molecules can substitute for a single cell or single molecule.

Aqueous droplets in volumes ranging from 1 pL to 10 nL serve as individual reactors. ^{104-105 single} cells in a droplet can be processed and analyzed in a single run. To utilize microdroplets for rapid large-scale chemical screening or identification of complex biological libraries, microscopic species of different species, each containing a particular chemical compound or biological probe cell or molecular barcode of interest. It is necessary to generate droplets and combine them under favorable conditions such as mixing ratio, concentration and compounding order. A variety of droplets are introduced from the individual inlet microfluidic channels to the confluence of the major microfluidic channels. Preferably, the volume of the droplet is of some sort, as disclosed in US Publication No. US2007 / 0195127 and International Publication No. WO2007 / 089541, each of which is incorporated herein by reference in its entirety. It is selected by a design that allows it to move in the carrier fluid at a different rate than the species, usually at a slower rate than the other species. The width and length of the channel are chosen so that the fast droplet species catches up with the slowest species. Channel size constraints prevent fast-moving droplets from passing through slow-moving droplets, resulting in a series of droplets entering the merge zone. Multi-step chemistry, biochemical reactions, or assay detection chemistry often require a certain reaction time before adding different types of species to the reaction. The multi-step reaction is achieved by repeating the process multiple times at a second, third, or higher confluence, each containing a different merge point. Very efficient and accurate reaction if the frequency of droplets from the inlet channel matches the optimized ratio and the seed volume is adapted to provide optimized reaction conditions for the combined droplets. And reaction analysis is achieved. Fluid droplets can be screened or classified within the fluid system of the invention by altering the flow of the liquid containing the droplets. For example, in a set of embodiments, the fluid droplets can be guided or classified by directing the liquid surrounding the fluid droplets to a first channel, a second channel, and the like. In another set of embodiments, the pressure within the fluid system, eg, within different channels or within different parts of the channel, can be controlled to direct the flow of fluid droplets. For example, the droplet may be directed at a channel junction that contains multiple options for further flow directions (eg, directed at a branch or branch within the channel that defines an optional downstream flow channel). The pressure in one or more optional downstream flow channels can be controlled to selectively direct the droplet to one of the channels, and the change in pressure causes the continuous droplet to reach the junction. The downstream flow path of each successive droplet can be controlled independently because it can affect the order of time required for.

In one configuration, expansion and / or contraction of the liquid reservoir can be used to guide or classify a fluid droplet into a channel, for example by causing a directed movement of the liquid, including the fluid droplet. Alternatively, the expansion and / or contraction of the liquid reservoir can be combined with other flow control devices and methods, eg, as described herein. Non-limiting examples of devices that can cause expansion and / or contraction of a liquid reservoir include a piston. Key factors for processing droplets using microfluidic channels include: (1) produce droplets of the correct volume, (2) produce droplets at the correct frequency, (3) Combine the first stream of the sample droplets with the second stream of the sample droplets so that the frequency of the first stream of the sample droplets matches the frequency of the second stream of the sample droplets. To. Preferably, the stream of sample droplets is combined with the stream of prefabricated library droplets so that the frequency of the library droplets matches the frequency of the sample droplets. Methods of producing droplets of uniform volume at a constant frequency are well known in the art. One method uses hydrodynamic focusing of dispersed phase fluids and immiscible carrier fluids to generate droplets, as disclosed in US Publications US 2005/0172476 and WO 2004/002627. It is to be. One of the species introduced into the confluence is preferably a library of pre-prepared droplets, which contains multiple reaction conditions. For example, a library may contain multiple different compounds of varying concentrations encapsulated as separate library elements for screening for effects on cells or enzymes. Alternatively, the library may consist of a plurality of different primer pairs encapsulated as different library elements for targeted amplification of a collection of loci. Alternatively, the library may include multiple different antibody species encapsulated as different library elements to perform multiple binding assays. Introduction of the reaction conditions into the substrate is accomplished by extruding a prefabricated collection of library droplets from the vial with a driving fluid. The driving fluid is a continuous fluid. The driving fluid can include the same material as the carrier fluid (eg, fluorocarbon oil). For example, if the library is composed of 10 picolitre droplets, the driving fluid at a rate of 10,000 picolitres per second is driven into the inlet channel on the microfluidic substrate, thus the droplets merge. The expected frequency of entering a point is nominally 1000 per second. However, in reality, the oil is clogged between the droplets and slowly flows out. Over time, carrier fluid will flow out of the droplets in the library, increasing the number density (number / mL) of the droplets. Therefore, the simple fixed rate of injection of the drive fluid does not provide a uniform rate of introduction of the droplet into the microfluidic channel within the substrate. In addition, variations in the average library droplet volume between libraries result in a shift in the frequency of droplet introduction at the confluence. Thus, the lack of droplet uniformity due to sample variability and oil discharge poses another problem to be solved. For example, if the nominal droplet volume is expected to be 10 picolitres within the library, but fluctuates between 9-11 picolitres between libraries, an injection rate of 10,000 picolitres / sec is nominal. Above, it produces a frequency range of 900 to 1100 droplets per second. That is, variations between samples in the composition of the dispersed phase of the droplets produced on the chip, the tendency for the number density of library droplets to increase over time, and variations between libraries in average droplet volume. Using only a constant injection rate severely limits the range in which the frequency of droplets can be reliably matched in phase. In addition, these limitations also affect the range of reproducible combinations of volumes. Combined with general variations in pump flow accuracy and variations in channel dimensions, the system is severely limited without means of compensating for each run. The above facts not only explain the problem to be solved, but also indicate the need for a method of instantaneously controlling microfluidic control for microdroplets within the microfluidic channel.

Develop a combination of surfactant (s) and oil to facilitate droplet generation, storage, and manipulation, and unique chemical / biochemical / biological within each droplet of a diverse library. It is necessary to maintain the target environment. Thus, the combination of surfactant and oil stabilizes the droplet against (1) uncontrolled aggregation during the droplet formation process and subsequent collection and storage, and (2) to the oil phase and / or droplets. Minimize the transport of any droplet content between and (3) maintain chemical and biological inactivity in the content of each droplet (eg, encapsulated content at the oil-water interface). No adsorption or reaction and no adverse effects on biological or chemical components in the droplets). In addition to the functional and stability requirements of the droplet library, the surfactant solution in oil needs to be combined with the fluid physics and materials associated with the platform. Specifically, the oil solution must not swell, dissolve, or degrade the material used to build the microfluidic chip, and the physical properties of the oil (eg, viscosity, boiling point, etc.) are platform. It is necessary to be suitable for the flow and operating conditions of. Since droplets formed of oil without detergent are not stable to aggregate, it is necessary to dissolve the detergent in the oil used as the continuous phase of the emulsion library. Surfactant molecules are amphipathic, some of the molecules are oil-soluble, and some of the molecules are water-soluble. For example, in the inlet module described herein, when a water-oil interface is formed on the nozzle of a microfluidic chip, the surfactant molecules dissolved in the oil phase are adsorbed on the interface. The hydrophilic part of the molecule is inside the droplet and the fluorophilic part of the molecule modifies the outside of the droplet. The presence of a surfactant at the interface reduces the surface tension of the droplets, thus improving the stability of the emulsion. In addition to stabilizing the droplets against agglomeration, the surfactant should be inert to the contents of each droplet, and the surfactant should be the oil or other liquid of the encapsulated component. Do not facilitate transport to the drops. A droplet library may consist of a number of library elements pooled together in a single collection (see, eg, US Patent Publication No. 2010002241).

Libraries can vary in complexity, from a single library element to more than ¹⁰¹⁵ library elements. Each library element may be one or more specific components of fixed concentration. Elements can be, but are not limited to, cells, organellas, viruses, bacteria, yeasts, beads, amino acids, proteins, polypeptides, nucleic acids, polynucleotides, or small molecule chemical compounds. The element may include an identifier such as a sign. The term "droplet library" or "droplet library" is also referred to herein as "emulsion library" or "emulsion library". These terms are used interchangeably throughout this specification. Cell library elements include, but are not limited to, hybridomas, B cells, primary cells, cultured cell lines, cancer cells, stem cells, cells derived from tissues, or any other cell type. Cell library elements are prepared by encapsulating a large number of cells, ranging from one to hundreds of thousands, into individual droplets. The number of encapsulated cells is usually given by Poisson statistics from the cell number density and the volume of the droplet. However, in some cases, Edd et al. , "Controlled encapsulation of single-cells into monodisperse picolitre drops." Lab Chip, 8 (8): 1262-1264, 2008, the numbers deviate from Poisson statistics. Due to the individual nature of the cells, a large library can be prepared in which multiple cell variants are all present in a single starting medium, which medium is divided into individual droplet capsules containing up to one cell. These individual droplet capsules are then combined or pooled to form a library composed of unique library elements. Following encapsulation, or in some embodiments, cell division after encapsulation produces clonal library elements.

In certain embodiments, the bead-based library element can include one or more beads of a given type and can also include other reagents such as antibodies, enzymes, or other proteins. If all library elements contain different types of beads, but contain the same surrounding medium, then all library elements can be prepared from a single starting fluid or have different starting fluids. For cell libraries prepared in large quantities from a collection of variants such as genome-modified yeast or bacterial cells, the library elements are prepared from a variety of starting fluids. Often, when starting with multiple cells or yeast or bacteria engineered to produce a variant of the protein, have exactly one cell per droplet, one for only a few droplets. It may be desirable to include more cells. In some cases, variations from Poisson statistics have been achieved, the load of droplets has been enhanced, more droplets have exactly one cell per droplet, including empty droplets or more than one cell. There are almost no exceptions to droplets. An example of a droplet library is a collection of droplets with various contents such as beads, cells, small molecules, DNA, primers, antibodies and the like. Smaller droplets are droplets as large as femtolitre (fL) and are particularly conceivable in droplet dispensers. The capacity can be in the range of about 5 to about 600 fL. The size of the larger droplets ranges from about 0.5 micron to 500 micron in diameter, which corresponds to about 1 picolitre to 1 nanoliter. However, the droplet may be as small as 5 microns or as large as 500 microns. Preferably, the droplets are less than 100 microns and have a diameter of about 1 micron to about 100 microns. The most preferred size is about 20-40 microns (10-100 picolitres) in diameter. Preferred properties considered for the droplet library include osmotic balance, uniform size, and size range. The droplets in the emulsion library of the present invention may be contained in immiscible oils which may contain at least one fluorosurfactant. In some embodiments, the fluorosurfactant in an immiscible fluorocarbon oil is a block copolymer consisting of one or more perfluorinated polyether (PFPE) blocks and one or more polyethylene glycol (PEG) blocks. Can be. In another embodiment, the fluorosurfactant is a triblock copolymer consisting of a PEG center block covalently bonded to two PFPE blocks by an amide bond group. The presence of fluorosurfactant (similar to the uniform size of the droplets in the library) is important for maintaining the stability and completeness of the droplets and the various biological organisms described herein. And it is also essential for subsequent use of the droplets in the library of chemical assays. The fluids available in the droplet library of the invention (eg, aqueous fluids, immiscible oils, etc.) and other surfactants are described in more detail herein.

Accordingly, the present invention may include an emulsion library capable of containing a plurality of aqueous droplets in an immiscible oil (eg, fluorocarbon oil) which may contain at least one fluorosurfactant, where each droplet is uniform in size. And may contain the same aqueous fluid and may contain different library elements. The invention also provides a single aqueous fluid that may contain different library elements and encapsulates each library element in aqueous droplets in an immiscible fluorocarbon oil that may contain at least one fluorosurfactant. Where each droplet is uniform in size and may contain the same aqueous fluid, may contain different library elements, may contain encapsulation and may contain at least one fluorosurfactant. Provided are a method of pooling an aqueous droplet in an immiscible fluorocarbon oil, thereby forming an emulsion library, and forming an emulsion library containing. For example, in one type of emulsion library, all different types of elements (eg, cells or beads) can be pooled in a single source contained in the same medium. After the initial pooling, the cells or beads are encapsulated in droplets, a library of droplets is generated, and each droplet containing different types of beads or cells is a different library element. Dilution of the initial solution allows for the encapsulation process. In some embodiments, the droplets formed contain either a single cell or beads, or nothing, i.e. empty. In other embodiments, the droplets formed include multiple copies of the library elements. Encapsulated cells or beads are usually variants of the same type of cells or beads. In another example, the emulsion library can contain multiple aqueous droplets in an immiscible fluorocarbon oil, with 20-60 droplets produced by encapsulating a single molecule (eg, 25). , 30, 35, 40, 45, 50, 55, 60 droplets, or any integer in between) can be such that a single molecule is contained within the droplet. A single molecule can be encapsulated by diluting the solution containing the molecule to a low concentration that allows encapsulation of the single molecule. The formation of these libraries may depend on limiting dilution.

The present invention also comprises at least a first aqueous droplet and at least a second aqueous droplet in an oil that may contain at least one surfactant, a fluorosurfactant in one embodiment, and a fluorocarbon oil in one embodiment. Provide an emulsion library that may contain, at least the first and at least the second droplets are uniform in size and contain different aqueous fluids and different library elements. The present invention also provides at least a first aqueous fluid that may contain at least a first element library, and at least a second aqueous fluid that may contain at least a second element library. Encapsulating each element of at least the first library into at least a first aqueous droplet in an immiscible fluorocarbon oil that may contain at least one fluorosurfactant and said at least the second library. By encapsulating each element of the above in at least a second aqueous droplet in an immiscible fluorocarbon oil that may contain at least one fluorosurfactant, at least the first and at least the second droplets. At least the first aqueous droplet and at least the first in an immiscible fluorocarbon oil which is uniform in size and can contain different aqueous fluids and different library elements, which can contain encapsulation and at least one fluorosurfactant. Provided is a method of forming an emulsion library, which may include pooling the aqueous droplets of 2 and thereby forming an emulsion library.

Those skilled in the art will appreciate that the methods and systems of the invention need not be limited to any particular type of sample and that the methods and systems of the invention can be used with any type of organic, inorganic or biomolecule. You will recognize (see, eg, US Patent Publication No. 20120122714).

In certain embodiments, the sample may comprise a nucleic acid target molecule. Nucleic acid molecules may be synthetic or derived from naturally occurring sources. In one embodiment, nucleic acid molecules can be isolated from biological samples containing various other components such as proteins, lipids, and non-template nucleic acids. Nucleic acid target molecules can be obtained from any cellular material obtained from animals, plants, bacteria, fungi, or any other cellular organism. In certain embodiments, the nucleic acid target molecule may be obtained from a single cell. The biological sample used in the present invention may contain viral particles or preparations. Nucleic acid target molecules can be obtained directly from or from biological samples obtained from the organism, such as blood, urine, cerebrospinal fluid, semen, saliva, sputum, feces, and tissues. Any tissue or body fluid specimen can be used as a source of nucleic acid for use in the present invention. Nucleic acid target molecules can also be isolated from cultured cells such as primary cultured cells or cell lines. The cell or tissue from which the target nucleic acid is obtained may be infected with a virus or other intracellular pathogen. The sample may be a biological specimen, a cDNA library, a virus, or total RNA extracted from genomic DNA. In general, nucleic acids are described in Maniatis, et al. , Molecular Cloning: A Laboratory Manual, Cold Spring Harbor, N. et al. Y. , Pp. It can be extracted from a biological sample by various techniques such as those described in 280-281 (1982). Nucleic acid molecules can be single-stranded, double-stranded, or double-stranded with single-stranded regions (eg, stem and loop structures). Nucleic acid obtained from a biological sample can typically be fragmented to produce fragments suitable for analysis. The target nucleic acid can be fragmented or sheared to the desired length using a variety of mechanical, chemical and / or enzymatic methods. DNA can be randomly sheared by sonication, eg, Covaris method, short exposure to DNase, or the use of a mixture of one or more restriction enzymes or a transposase or nicking enzyme. RNA can be fragmented by RNase, short exposure to heat + magnesium, or shear. RNA may be converted to cDNA. When using fragmentation, RNA may be converted to cDNA before or after fragmentation. In one embodiment, nucleic acids from biological samples are fragmented by sonication. In another embodiment, the nucleic acid is fragmented by a hydraulic shear device. In general, individual nucleic acid target molecules can be from about 40 bases to about 40 kb. Nucleic acid molecules can be single-stranded, double-stranded, or double-stranded with single-stranded regions (eg, stem and loop structures). The biological samples described herein can be homogenized or fractionated in the presence of detergents or detergents. The concentration of detergent in the buffer can be from about 0.05% to about 10.0%. The concentration of the detergent may be at most the amount at which the detergent remains dissolved in the solution. In one embodiment, the detergent concentration is 0.1% to about 2%. Detergents, especially non-denaturing, mild ones, can act to solubilize the sample. The detergent may be ionic or nonionic. Examples of nonionic detergents include Triton ™ X-series (Triton ™ X-100 t-Oct-C6H4- (OCH2-CH2) xOH, x = 9-10, Triton ™ X- 100R, Triton ™ X-114 x = 7-8) and other triton, octyl glucoside, polyoxyethylene (9) dodecyl ether, diditonin, IGEPAL ™ CA630 octylphenyl polyethylene glycol, n-octyl-beta-D -Glucopyranoside (betaOG), n-dodecyl-beta, Tween ™ 20 polyethylene glycol sorbitan monolaurate, Tween ™ 80 polyethylene glycol sorbitan monooleate, polydocanol, n-dodecyl beta-D-maltoside (DDM), NP-40 nonylphenyl polyethylene glycol, C12E8 (octaethylene glycol n-dodecyl monoether), hexaethylene glycol mono-n-tetradecyl ether (C14E06), octyl-beta-thioglucopyranoside (octylthioglucoside, OTG), emalgen, And polyoxyethylene 10 lauryl ether (C12E10). Examples of ionic surfactants (anionic or cationic) include deoxycholic acid, sodium dodecyl sulfate (SDS), N-lauroyl sarcosine, and cetyltrimethylammonium bromide (CTAB). Zwitterionic reagents such as Chaps, zwitterion 3-14, and 3-[(3-colamidepropyl) dimethylammonio] -1-propanesulfonic acid can also be used in the purification schemes of the invention. It is also conceivable that urea can be added with or without another detergent or surfactant. The lysing or homogenizing solution may further contain other agents such as reducing agents. Examples of such reducing agents include salts of dithiothreitol (DTT), β-mercaptoethanol, DTE, GSH, cysteine, cysteamine, tricarboxyethylphosphine (TCEP), or sulfite. Nucleic acid size selection can be made to remove very short or very long fragments. Nucleic acid fragments can be divided into fractions that may contain the desired number of fragments using any suitable method known in the art. Suitable methods for limiting the fragment size of each fragment are known in the art. In various embodiments of the invention, the size of the fragment is limited to about 10 to about 100 Kb and above. Samples in or in the invention may include individual target proteins, protein complexes, proteins with translational modifications, and protein / nucleic acid complexes. Protein targets include peptides, including enzymes, hormones, structural components such as viral capsid proteins, and antibodies. The protein target may be synthetic or derived from a naturally occurring source. The protein targets of the invention can be isolated from biological samples containing lipids, non-template nucleic acids, and various other components including nucleic acids. Protein targets can be obtained from animals, bacteria, fungi, cell organisms, and single cells. Protein targets can be obtained directly from the organism or from biological samples obtained from the organism, including body fluids such as blood, urine, cerebrospinal fluid, semen, saliva, sputum, feces, and tissues. Protein targets can also be obtained from cell and tissue lysates and biochemical fractions. The individual protein is an isolated polypeptide chain. The protein complex comprises two or more polypeptide chains. Samples include proteins with post-translational modifications including, but not limited to, phosphorylation, methionine oxidation, deamidation, glycosylation, ubiquitination, carbamylation, s-carboxymethylation, acetylation, and methylation. It can be. Protein / nucleic acid complexes include cross-linked or stable protein-nucleic acid complexes. Extraction or isolation of individual proteins, protein complexes, proteins with translational modifications, and protein / nucleic acid complexes is performed using methods known in the art.

Therefore, the invention can include forming sample droplets. The droplet is an aqueous droplet surrounded by an immiscible carrier fluid. Methods for forming such droplets include, for example, Link et al. (US Patent Application Nos. 2008/0014589, 2008/0003142, and 2010/0137163), Stone et al. (US Pat. No. 7,708,949 and US Patent Application No. 2010/0172803), Anderson et al. (US Pat. No. 7,041,481 reissued as RE41,780), and Raindance Technologies Inc. Shown in European Publication No. EP2047910. Each content is incorporated herein by reference in its entirety. The present invention may also relate to systems and methods for manipulating droplets within a high-throughput microfluidic system. Microfluidic droplets can encapsulate differentiated cells, the cells are lysed, and their mRNAs are all hybridized inside the droplets onto capture beads containing a surface-barcoded oligo dT primer. Be soybeans. The barcode is covalently attached to the capture beads via a flexible polyatomic linker such as PEG. In a preferred embodiment, the droplets are destroyed, washed and collected by the addition of a fluorosurfactant (such as perfluorooctanol). A reverse transcription (RT) reaction is then performed to convert the mRNA of each cell into the cDNA of the first strand, covalently attached to the mRNA capture beads, with a unique barcode. The universal primer via the template switching reaction is then modified using a conventional library preparation protocol to prepare the RNA-Seq library. All mRNAs from any particular cell have a unique barcode, so a single library is sequenced and computer-resolved to determine which mRNA comes from which cell. do. In this way, tens of thousands (or more) of identifiable transcriptomes can be obtained simultaneously in a single sequence determination run. Oligonucleotide sequences can be generated on the bead surface. During these cycles, beads were removed from the synthetic column, pooled and equally divided into 4 equal parts by mass. The aliquots of these beads were then placed in another synthetic column and reacted with either dG, dC, dT, or dA phosphoramidite. In other examples, longer dinucleotides, trinucleotides, or oligonucleotides are used, in other examples the oligo dT tail is a particular target (s), any for all or a particular RNA capture. Replaced with gene-specific oligonucleotides to prime random sequences of length. This process was repeated 12 times to create a unique barcode array with a total of 4 ¹² = 16,777,216. At the completion of these cycles, 8 cycles of degenerate oligonucleotide synthesis were performed on all beads, followed by 30 cycles of dT addition. In other embodiments, degenerate synthesis is omitted, shortened (less than 8 cycles), or extended (more than 8 cycles), in which 30 cycles of dT addition are gene-specific primers (single target or multiple targets). ) Or is replaced by a degenerate array. The microfluidic system described above is considered to be the reagent delivery system microfluidic library printer or droplet library printing system of the present invention. Droplets are formed as the sample fluid flows from the droplet generator containing the dissolving reagent and the barcode through the microfluidic outlet channel containing the oil towards the junction. A defined volume of loaded reagent emulsion, corresponding to a defined number of droplets, is distributed on demand to the flow stream of the carrier fluid. The sample fluid is typically ultrapure water (eg, 18 megaohm resistance obtained by column chromatography), 10 mM Tris HCl and 1 mM EDTA (TE) buffer, phosphate buffered saline (PBS). ), Or may contain an aquatic buffer solution such as acetate buffer. Any liquid or buffer that is physiologically compatible with the nucleic acid molecule can be used. The carrier fluid may include one that is immiscible with the sample fluid. The carrier fluid can be a non-polar solvent, a decane (eg, tetradecane or hexadecane), a fluorocarbon oil, a silicone oil, an inert oil such as a hydrocarbon, or another oil (eg, mineral oil). The carrier fluid may contain one or more additives such as agents that reduce surface tension (surfactants). Surfactants include Tween, Span, fluorosurfactants, and other agents that are more soluble in oil than water. In some applications, the addition of a second detergent to the sample fluid will improve performance. Surfactants help control or optimize droplet size, flow, and uniformity, for example by reducing the shear forces required to push or inject droplets into intersecting channels. This can affect the volume and periodicity of the droplets, or the speed or frequency at which the droplets split into intersecting channels. Further, the surfactant can serve to stabilize the aqueous emulsion in the fluorinated oil from coalescence. The droplets may be surrounded by a surfactant that stabilizes the droplets by reducing the surface tension at the aqueous oil interface. Preferred surfactants that can be added to the carrier fluid include sorbitan monolaurate (Span 20), sorbitan monopalmitate (span 40), sorbitan monostearate (span 60) and sorbitan monooleate (span 80). Includes surfactants such as sorbitan-based carboxylic acid esters (eg, "Span" surfactants, FlukaChemika), perfluorinated polyethers (eg, DuPont Krytox 157 FSL, FSM, and / or FSH). Not limited to these. Other non-limiting examples of nonionic surfactants that can be used include polyoxyethyleneylated alkylphenols (eg, nonyl-, p-dodecyl-, and dinonylphenols), polyoxyethyleneylated linear alcohols, polyoxy. Ethylene polyoxypropylene glycol, polyoxyethylene mercaptan, long-chain carboxylic acid esters (eg, natural fatty acids glyceryl and polyglyceryl esters, propylene glycol, sorbitol, polyoxyethylene sorbitol esters, polyoxyethylene glycol esters, etc.) and alkanols. Amines (eg, diethanolamine-fatty acid condensates and isopropanolamine-fatty acid condensates) are included. In some cases, a device for creating a single cell sequencing library via a microfluidic system provides a volume driven flow in which a fixed amount is injected over time. The pressure of the fluid channel is a function of the injection rate and the dimensions of the channel. In one embodiment, the device is an oil / surfactant inlet; an inlet for an analyte; a filter, an inlet for mRNA trapping microbeads and a lysing reagent; a carrier fluid channel connecting the inlet; a resistor; for pinch-off of droplets. Provides an outlet for stenosis; mixer; and droplets. In one embodiment, the invention is a device for creating a single cell sequencing library via a microfluidic system, which may include a filter and a carrier fluid channel, wherein the carrier fluid channel further resists. An oil-surfactant inlet, which can include a vessel; an inlet for an analyte, which can include a filter and a carrier fluid channel, wherein the carrier fluid channel can further include a resistor; a filter and a carrier fluid. The carrier fluid channel can include an inlet for mRNA capture microbeads and a lysis reagent, which can include a channel, the carrier fluid channel can further include a resistor, and the carrier fluid channel can be adjustable or a predetermined flow rate. Provided is an apparatus having carrier fluids flowing in, each said carrier fluid channel merging at a junction, the junction being connected to a mixer containing an outlet for droplets. Therefore, an apparatus for creating a single cell sequencing library via a microfluidic flow scheme of a microfluidic system for single cell RNA-seq is envisioned. Two channels meet at the junction, one carrying the cell suspension and the other holding the uniquely barcoded mRNA capture beads, lysis buffer, and library preparation reagents, one per droplet. It is immediately co-encapsulated in the inert carrier oil at the rate of one cell and one bead. In each droplet, a beaded barcode-tagged oligonucleotide is used as the cDNA template and each mRNA is tagged with a unique cell-specific identifier. The invention also includes the use of a Drop-Seq library of a mixture of mouse and human cells. The carrier fluid may be flushed through the outlet channel such that the surfactant in the carrier fluid coats the channel wall. Fluorosurfactants can be prepared by reacting the perfluorinated polyether DuPont Krytox 157 FSL, FSM, or FSH in an aqueous solution of ammonium hydroxide in a volatile fluorinated solvent. The solvent, residual water and ammonia can be removed with a rotary evaporator. Next, the surfactant is dissolved in a fluorinated oil (eg, Fluorinert (3M)) (eg, 2.5% by weight) to allow it to function as a carrier fluid. Activation of the sample fluid reservoir to generate reagent droplets is based on the concept of dynamic reagent delivery via on-demand features (eg, combinatorial bar coding). The on-demand function can be provided by one of a variety of technical capabilities for ejecting a delivery droplet into a primary droplet, as described herein.

It is within the skill of ordinary skill in the art to develop flow rates, channel lengths, and channel geometries from the present disclosure and the documents cited herein and knowledge of the art. Droplets containing random or specified reagent combinations can be established, generated on demand and merged with "reaction chamber" droplets containing the desired sample / cell / substrate. Encoding and recording the conditions under which a primary droplet is exposed by incorporating multiple unique tags into additional droplets and binding the tags to a solid support designed to be unique to the primary droplet. Can be done. For example, nucleic acid tags can be continuously ligated to create sequences that reflect the conditions and the same order. Alternatively, tags can be added individually to add to the solid support. Non-limiting examples of dynamic labeling systems that can be used to record bioinformatics are the "Composions and Methods for United Labeling of" filed September 21, 2012 and November 29, 2012. It can be found in the US provisional patent application entitled "Agents". In this way, two or more droplets can be exposed to a variety of different conditions, and each time the droplet is exposed to a condition, the nucleic acid encoding the condition is added to the droplet, each ligated together. Or added to a unique individual support bound to a droplet so that the conditions of each droplet remain available via different nucleic acids even if droplets with different histories are later combined. To. Non-limiting examples of methods for assessing response to exposure to multiple conditions are the US provisional patent application filed September 21, 2012, and the "Systems and Methods for Droplet Tagging" filed April 17, 2015. It can be found in US Patent Application No. 15/303874 entitled. Thus, in the present invention or with respect to the present invention, the dynamic generation of molecular barcodes (eg, DNA oligonucleotides, fluorophores, etc.) can control various compounds of interest (siRNA, CRISPR guide RNA, reagents, etc.). It is envisioned that it may exist independently of or in conjunction with delivery. For example, unique molecular barcodes can be created in one nozzle array and individual compounds or combinations of compounds can be created in another nozzle array. The barcode / compound of interest can then be merged with the droplet containing the CRISPR detection system. Electronic records can be retained in the form of computer log files to correlate the delivered barcode with the delivered downstream reagent (s). This methodology makes it possible to efficiently screen a large population of samples according to the methods disclosed herein. The devices and techniques of the disclosed invention facilitate efforts to carry out studies that require data degradation at the single cell (or single molecule) level in a cost-effective manner. Using monodisperse aqueous droplets produced one by one on a microfluidic chip as a water-in-oil emulsion, a reagent for individual emulsion droplets that may contain a sample of the target molecule for further evaluation. High throughput and high resolution delivery.

Protein Detection The systems, devices, and methods disclosed herein include the detection of nucleic acids, as well as the detection of polypeptides (or other molecules), through the incorporation of specifically constructed polypeptide detection aptamers. It can also be adapted for detection. The polypeptide detection aptamer is different from the masking construction aptamer described above. First, aptamers are designed to specifically bind to one or more target molecules. In one embodiment, the target molecule is the target polypeptide. In another exemplary embodiment, the target molecule is a target chemical compound, such as a target therapeutic molecule. Methods of designing and selecting aptamers that have specificity for a given target, such as SELEX, are known in the art. In addition to specificity for a given target, aptamers are further designed to incorporate the RNA polymerase promoter binding site. In certain exemplary embodiments, the RNA polymerase promoter is the T7 promoter. Before the aptamer binding binds to the target, the RNA polymerase site cannot access or otherwise recognize the RNA polymerase. However, the aptamer is configured so that the structure of the aptamer undergoes a conformational change upon binding of the target, exposing the RNA polymerase promoter. The aptamer sequence downstream of the RNA polymerase promoter serves as a template for the generation of triggered RNA oligonucleotides by RNA polymerase. Therefore, the template portion of the aptamer may further incorporate a barcode or other discriminant sequence that identifies a given aptamer and its target. The guide RNAs described above can then be designed to recognize these specific trigger oligonucleotide sequences. Binding of the guide RNA to the trigger oligonucleotide activates the CRISPR effector protein, subsequently inactivating the masking construct and producing a positive detectable signal as described herein.

Thus, in certain exemplary embodiments, the method disclosed herein is an additional step of distributing a sample or a set of samples to a set of individual individual volumes, each individual individual volume. Contains additional steps including peptide detection aptamer, CRISPR effector protein, one or more guide RNAs, masking constructs, and conditions sufficient to allow binding of the detection aptamer to one or more target molecules. Including an additional step of incubating a sample or set of samples, binding of the aptamer to the corresponding target results in exposure of the RNA polymerase promoter binding site, and synthesis of the trigger RNA is performed by the RNA polymerase by the RNA polymerase promoter binding site. It is made to start by binding to.

In another exemplary embodiment, aptamer binding can expose the primer binding site when the aptamer binds to the target polypeptide. For example, the aptamer may expose the RPA primer binding site. Therefore, the addition or inclusion of primers is provided for amplification reactions such as the RPA reaction outlined above.

In certain exemplary embodiments, the aptamer may be a conformation switching aptamer that, upon binding to a target of interest, can alter secondary structure and expose new regions of single-stranded DNA. In certain exemplary embodiments, these new regions of single-stranded DNA extend ligation, aptamers, and longer ssDNA molecules that can be specifically detected using the embodiments disclosed herein. It can be used as a substrate to produce. Aptamer designs can be further combined with ternary complexes for the detection of low epitope targets such as glucose (Yang et al. 2015: pubs.ax.org/doi/abs/10.1021/acs.analcem). .5b01634). An example of a conformation shift aptamer and a corresponding guide RNA (crRNA) is shown below.

Amplification In certain exemplary embodiments, the target RNA and / or DNA can be amplified prior to activating the CRISPR effector protein. In some cases, amplification is performed prior to the formation of a droplet set containing the target molecule. Other embodiments allow the formation of a droplet set containing the target molecule to be followed by amplification, and thus the nucleic acid amplification reagent may be included in the droplet containing the target molecule. Any suitable RNA or DNA amplification technique can be used. In certain exemplary embodiments, RNA or DNA amplification is isothermal amplification. In certain exemplary embodiments, the isothermal amplification is nucleic acid sequence based amplification (NASBA), recombinase polymerase amplification (RPA), loop-mediated isothermal amplification (LAMP), chain substitution amplification (SDA), helicase-dependent amplification (HDA). ), Or a nicking enzyme amplification reaction (NEAR). In certain exemplary embodiments, non-isothermal amplification methods can be used, including but not limited to PCR, multiple substitution amplification (MDA), rolling circle amplification (RCA), ligase chain reaction (LCR). ), Or a branch amplification method (RAM). In some preferred embodiments, the RNA or DNA amplification is RPA or PCR.

In certain exemplary embodiments, RNA or DNA amplification is NASBA and is initiated by reverse transcription of the target RNA with a sequence-specific reverse primer to generate the RNA / DNA double strand. RNA templates are then degraded using RNase H and forward primers containing promoters such as the T7 promoter bind to initiate complementary strand elongation to produce double-stranded DNA products. Transcription of the DNA template via the RNA polymerase promoter then makes a copy of the target RNA sequence. Importantly, each of the new target RNAs can be detected by the guide RNA, further increasing the sensitivity of the assay. Binding of the target RNA by the guide RNA results in activation of the CRISPR effector protein, and the method proceeds as outlined above. The NASBA reaction has the added benefit of being able to proceed under moderate isothermal conditions, such as about 41 ° C, making it suitable for systems and devices deployed for early direct detection in the field far from the clinical laboratory. ing.

In certain other exemplary embodiments, the recombinase polymerase amplification (RPA) reaction can be used to amplify the target nucleic acid. The RPA reaction uses a recombinase capable of pairing a sequence-specific primer with a homologous sequence of double-stranded DNA. If the target DNA is present, DNA amplification is initiated and no other sample manipulation such as thermal cycle or chemical melting is required. The entire RPA amplification system is stable as a dry formulation and can be safely transported without refrigeration. The RPA reaction can also be carried out at an isothermal temperature of the optimum reaction temperature of 37-42 ° C. Sequence-specific primers are designed to amplify the sequence containing the detected target nucleic acid sequence. In certain exemplary embodiments, an RNA polymerase promoter, such as the T7 promoter, is added to one of the primers. This gives an amplified double-stranded DNA product containing the target sequence and the RNA polymerase promoter. RNA polymerase that produces RNA from the double-stranded DNA template is added after or during the RPA reaction. The amplified target RNA, in turn, can be detected by the CRISPR effector system. In this way, the target DNA can be detected using the embodiments disclosed herein. The RPA reaction can also be used to amplify the target RNA. The target RNA is first converted to cDNA using reverse transcriptase, followed by second-strand DNA synthesis, at which point the RPA reaction proceeds as outlined above.

Thus, in certain exemplary embodiments, the systems disclosed herein can include amplification reagents. Different components or reagents useful for nucleic acid amplification are described herein. For example, the amplification reagents described herein can include buffers such as Tris buffer. The Tris buffer contains concentrations such as, for example, 1 mM, 2 mM, 3 mM, 4 mM, 5 mM, 6 mM, 7 mM, 8 mM, 9 mM, 10 mM, 11 mM, 12 mM, 13 mM, 14 mM, 15 mM, 25 mM, 50 mM, 75 mM, 1 M and the like. , Any concentration, not limited to these, can be used in the desired application or use. One of ordinary skill in the art will be able to determine the appropriate concentration of buffer such as Tris for use in the present invention.

Salts such as magnesium chloride (MgCl ₂ ), potassium chloride (KCl), or sodium chloride (NaCl) can be included in amplification reactions such as PCR to improve the amplification of nucleic acid fragments. The salt concentration depends on the particular reaction and application, but in some embodiments, nucleic acid fragments of a particular size may give optimal results at a particular salt concentration. Larger products may require modified salt concentrations, usually lower salts, to obtain the desired results, while amplification of smaller products may produce better results at higher salt concentrations. Those skilled in the art will appreciate that the presence and / or concentration of salt can change the stringency of biological or chemical reactions with changes in salt concentration. Therefore, any salt can be used that provides suitable conditions for the reactions of the invention described herein.

Other components of a biological or chemical reaction may include cytolytic components for disrupting or lysing cells for analysis of intracellular substances. Examples of the cytolytic component include, but are not limited to, the above-mentioned salts such as surfactants, NaCl, KCl, and ammonium sulfate [(NH ₄ ) ₂ SO ₄ ]. Surfactants suitable for the present invention include Triton X-100, sodium dodecyl sulfate (SDS), CHAPS (3-[(3-colamidepropyl) dimethylammonio] -1-propanesulfonate), ethyltrimethylammonium bromide. , Nonylphenoxypolyethoxylethanol (NP-40) may be included. The concentration of detergent may be specific to the particular application and, in some cases, specific to the reaction. For the amplification reaction, 100 nM, 150 nM, 200 nM, 250 nM, 300 nM, 350 nM, 400 nM, 450 nM, 500 nM, 550 nM, 600 nM, 650 nM, 700 nM, 750 nM, 800 nM, 850 nM, 900 nM, 950 nM, 1 mM, 2 mM, 3 mM, 4 mM, 5 mM. , 6 mM, 7 mM, 8 mM, 9 mM, 10 mM, 20 mM, 30 mM, 40 mM, 50 mM, 60 mM, 70 mM, 80 mM, 90 mM, 100 mM, 150 mM, 200 mM, 250 mM, 300 mM, 350 mM, 400 mM, 450 mM, 500 mM, etc. , But may include dNTPs and nucleic acid primers used at any concentration suitable for the present invention. Similarly, polymerases useful in accordance with the present invention can be any particular or general polymerase known in the art and useful or of the present invention, including Taq polymerase, Q5 polymerase and the like.

In some embodiments, the amplification reagents described herein may be suitable for use in hot start amplification. In some embodiments, to reduce or eliminate dimerization of the adapter molecule or oligo, or to prevent unwanted amplification products or artifacts, to obtain optimal desired product amplification. Hot start amplification can be beneficial. Many of the components described herein for use in amplification can also be used in hot start amplification. In some embodiments, reagents or components suitable for use in hot start amplification can be used in place of one or more components, if desired. For example, polymerases or other reagents that exhibit the desired activity at specific temperatures or other reaction conditions can be used. In some embodiments, reagents designed or optimized for use in hot start amplification may be used, for example, the polymerase can be activated after rearrangement or after reaching a particular temperature. Such polymerases can be antibody-based or aptamer-based. The polymerases described herein are known in the art. Examples of such reagents may include, but are not limited to, hot start polymerases, hot start dNTPs, and optical cage dNTPs. Such reagents are known and available in the art. One of ordinary skill in the art will be able to determine the optimum temperature suitable for the individual reagent. Amplification of nucleic acids can be carried out using a particular thermodynamic mechanism or device and can be carried out in a single reaction or in large quantities, so that any desired number of reactions can be carried out simultaneously. In some cases, amplification can be performed within the droplet or prior to droplet formation. In some embodiments, amplification can be performed using a microfluidic device or robotic device, or by manually changing the temperature to achieve the desired amplification. In some embodiments, optimization may be performed to obtain optimal reaction conditions for a particular application or material. One of ordinary skill in the art will be able to understand and optimize the reaction conditions to obtain sufficient amplification.

In some cases, nucleic acid amplification reagents include recombinantase polymerase amplification (RPA) reagents, nucleic acid sequence-based amplification (NASBA) reagents, loop-mediated isothermal amplification (LAMP) reagents, chain substitution amplification (SDA) reagents, and helicase-dependent amplification (HDA). ) Reagent, Nicking Enzyme Amplification Reaction (NEAR) Reagent, RT-PCR Reagent, Multiple Substitution Amplification (MDA) Reagent, Rolling Circle Amplification (RCA) Reagent, Rigase Chain Reaction (LCR) Reagent, Branch Amplification (RAM) Reagent, Transposase Includes a base amplification reagent, or a programmable CRISPR Nicking Amplification (PCNA) reagent. In certain embodiments, detection of DNA by the methods or systems of the invention requires transcription of the (amplified) DNA into RNA prior to detection.

It will be clear that the detection methods of the present invention may include nucleic acid amplification and detection procedures in various combinations. The nucleic acid detected can be any naturally occurring or synthetic nucleic acid, including but not limited to DNA and RNA, which can be amplified by any suitable method to provide a detectable intermediate product. Detection of intermediates can be carried out by any suitable method including, but not limited to, binding and activation of Cas proteins that produce detectable signaling moieties by direct or incidental activity.

Amplification and / or Enhancement of Detectable Positive Signals In certain exemplary embodiments, further modifications can be introduced that further amplify the detectable positive signal. For example, concomitant activation of the activated CRISPR effector protein can be used to generate secondary targets and / or additional guide sequences. In one embodiment, the reaction solution comprises a high concentration of spiked secondary targets. The secondary target can be different from the primary target (ie, the target designed to be detected by the assay) and in some cases can be common across all reaction volumes. The secondary guide sequence for the secondary target may be protected by secondary structural features such as, for example, a hairpin with an RNA loop, making it incapable of binding to the secondary target or CRISPR effector protein. Cleavage of the protecting group by the activated CRISPR effector protein (ie, after activation by forming a complex with the primary target (s) in solution) and forming a complex with the free CRISPR effector protein in solution and Activation from spiked secondary targets. In certain other exemplary embodiments, a similar concept is used with a second guide sequence for the secondary target sequence. The secondary target sequence can be protected by structural features or protecting groups on the secondary target. Cleavage of the protecting group from the secondary target forms an additional CRISPR effector protein / second guide sequence / secondary target complex. In yet another exemplary embodiment, activation of the CRISPR effector protein by the primary target (s) can be used to cleave the protected or cyclized primer, which is then released. The isothermal amplification reaction as disclosed herein is then performed on a template encoding a secondary guide sequence, a secondary target sequence, or both. Subsequent transcription of this amplified template produces more secondary guide sequences and / or secondary target sequences, followed by concomitant activation of additional CRISPR effector proteins.

Methods In one aspect, the embodiments disclosed herein are directed to a method of detecting a target nucleic acid in a sample using the system described herein. The method disclosed herein is, in some embodiments, a step of producing a first set of droplets, where each droplet in the first set of droplets is at least one target molecule. And in the step of generating a second set of droplets, including an optical bar code, each droplet of the second set of droplets binds to the RNA target effector protein and the corresponding target molecule. The steps can include one or more guide RNAs designed for, a masking construct, and optionally a detection CRISPR system including an optical bar code. The first and second sets of droplets are typically combined into a pool of droplets by mixing or stirring the first and second sets of droplets. A pool of droplets can then be flushed onto a microfluidic device that includes an array of microwells and at least one flow channel beneath the microwells, which captures at least two droplets. Set to size, it detects the optical bar code of the droplets captured in each microwell and merges the droplets captured in each microwell into a merged droplet formed in each microwell, the merged liquid. At least a subset of the droplets comprises the detection CRISPR system and the target sequence, the detection reaction is initiated and the detectable signal of each merged droplet is measured at one or more time intervals.

Droplet Generation With respect to the generation of the first set of droplets, in one aspect of generating the first set of droplets, each first droplet comprises a detection CRISPR system, the detection CRISPR system is an RNA target effector. Includes a protein, one or more guide RNAs designed to bind to the corresponding target molecule, RNA-based masking constructs, and optional optical barcodes as described herein. In certain embodiments, in the step of producing a second set of droplets, each droplet in the second set has at least one target molecule and an optional optical barcode provided herein. include.

Following the generation of the first set of droplets and the second set of droplets, the first set of droplets and the second set of droplets are combined into a pool of droplets. The combination can be done by any means of combining the first and second sets. In one exemplary embodiment, the set of droplets is mixed and combined into a pool of droplets.

Once the droplet pool is created, the step of flushing the droplet pool is performed. The flow of a pool of droplets is carried out by loading the droplets into a microfluidic device containing multiple microwells. Microwells are sized to capture at least two droplets. Optionally, the surfactant is washed away following loading.

Once the droplets are loaded into the microwell array, a step is performed to detect the optical barcode of the droplets captured in each microwell. In some cases, if the optical bar code is a fluorescent bar code, the detection of the optical bar code is performed by a low magnification fluorescent scan. Regardless of the type of optical barcode, the barcode of each droplet is unique, so that the contents of each droplet can be identified. The detection method is selected according to the type of optical barcode used. The droplets contained in each microwell are then merged. The merge can be performed by applying an electric field. At least a subset of the merged droplets contain the detection CRISPR system and the target sequence.

After merging the droplets, the detection reaction begins. In some embodiments, initiating the detection reaction involves incubating the merged droplet. Following the detection reaction, the merged droplets are subjected to an optical assay. This is, in some cases, a low magnification fluorescent scan to generate an assay score.

In some embodiments, the method can include the step of amplifying the target molecule. Amplification of the target molecule can be performed before or after the formation of the first set of droplets.

In yet another embodiment, the embodiments disclosed herein are directed to methods for detecting polypeptides. The method for detecting a polypeptide is the same as the method for detecting a target nucleic acid described above. However, peptide detection aptamers are also included. Peptide detection aptamers function as described above and, upon binding to the target polypeptide, promote the production of trigger oligonucleotides. Guide RNAs are designed to recognize trigger oligonucleotides and thereby activate CRISPR effector proteins. Deactivation of masking constructs with activated CRISPR effector proteins results in unmasking, release, or production of detectable positive signals.

Multiple detection diagnostics using reporter constructs (such as fluorescent proteins) can rapidly detect target sequences, diagnose drug-resistant SNPs, and distinguish between strains and subtypes of microbial species. For example, when evaluating a sample for the presence of one or more strains of a microbial species, a series of target molecules from the sample are evaluated using a series of CRISPR systems contained in a second set of droplets, each The CRISPR system contains various guide RNAs. After combining the first set of droplets and the second set of droplets, the combination is quickly and repeatedly tested. Each target molecule to be tested is placed in a microplate well. Aqueous and oil input channels can be used to form monodisperse droplets containing the target molecule to be screened. Droplets of the target molecule are then loaded onto the microfluidic device. Each target molecule is labeled with a barcode. When two or more droplets are merged, the combined optical barcode identifies the target molecule and / or the CRISPR system present in the merged droplet. Barcodes are optically detectable barcodes visualized with a light or fluorescence microscope, or oligonucleotide barcodes detected off-chip.

As described herein, a sample containing a target molecule targeted by a guide RNA is loaded into a set of droplets and merged with the droplet (s) containing the guide RNA and CRISPR system. To. The reporter system incorporated into the CRISPR system droplet expresses an optically detectable marker (such as fluorescent protein) in the masking construct. The set of droplets comprises a CRISPR system that includes an effector protein, one or more guide RNAs designed to bind to the corresponding target molecule, and an RNA-based masking construct. After the droplets have been merged, the identity of the molecular species within each well can be determined by optically scanning each microwell and reading the optical barcode. Optical measurements of the reporter system can be performed at the same time as the optical scan of the barcode. Therefore, this combinatorial screening system can be used to collect experimental data and identify molecular species at the same time.

In some cases, the microfluidic device is incubated for a period of time prior to imaging and imaged at multiple time points to track changes in reporter measurements over time. In addition, in some experiments, the merged droplets are eluted from the microfluidic device for off-chip evaluation (eg, which is incorporated herein by reference in its entirety for all purposes). See WO2016 / 149661; elution is specifically discussed in [0056]-[0059]). With the disclosed processing strategies, parallel processing of millions of droplets reaches the scale required for combinatorial screening. In addition, the nanoliter volume of the droplets reduces the consumption of compounds required for screening. The present disclosure incorporates parallel manipulation of droplets in optical barcodes and large fixed position space arrays to correlate droplet identity with assay results. A unique advantage of this system is that it minimizes the use of compounds screened for 2nL assay volumes. The platform herein takes advantage of the high throughput potential of droplet microfluidic systems and performs the deterministic liquid processing operations required to build combinations of compound pairs in a microwell device. Replace with parallel merging of random pairs. The unique advantages of this method are high throughput and manual manipulation, and the miniaturization of the assay in microwells allows the use of small samples. Combined with SHEROCK technology, this method provides a powerful detection technology that can be multiplexed on a large scale utilizing smaller sample sizes.

The techniques herein provide a processing platform for testing all pair combinations of a set of input compounds in three steps. First, the target molecule is combined with a color barcode (a unique proportion of 2, 3, 4, or more fluorescent dyes). The target molecule can be barcoded by the proportion of the fluorescent dye (eg, red, green, blue, etc.). Following sample processing, the target molecule is preferably emulsified in water in oil droplets sized to about 1 nanoliter. In some embodiments, surfactants can be included to stabilize the droplets. Droplets can be combined into a pool using standard multi-channel micropipette technology. A second set of droplets containing a CRISPR system, an optional optical barcode using a fluorescent dye ratio, and an RNA masking compound is prepared. The first and second sets of droplets are mixed into one large pool, after which the droplets are loaded into the microwell array so that each microwell randomly captures the two droplets. In some embodiments, the loaded microwell array is sealed on a glass substrate to limit cross-contamination and evaporation of the microwells. In some cases, the microwell array is secured to the assembly by mechanical clamps. The content of each droplet is a fluorescent barcode resulting from a unique proportion of 2, 3, 4, or more fluorescent dyes premixed with the identified first and second sets of droplets. Encoded by. A low magnification (2-4x) epifluorescence microscope can be used to identify the contents of each droplet and / or well. Next, the two droplets in each well are merged and a high voltage AC electric field is applied to induce the droplet merge. Following the merge, the SHERLOCK reaction is initiated and in some embodiments the sample is incubated at 37 ° C. The array is then imaged to determine the optical phenotype (eg, positive fluorescence) and map this measurement to the previously identified pair of compounds in each well. A microwell array design that limits compound exchange after loading is particularly preferred, and one exemplary method is to mechanically seal the microwell array after loading the droplets.

In one aspect, the embodiments described herein are directed to a method of multiple screening of nucleic acid sequence variations in one or more nucleic acid-containing specimens. Nucleic acid sequence variability can include natural sequence variability, gene expression variability, engineered genetic perturbations, or combinations thereof. Nucleic acid-containing specimens can be cellular or non-cellular. Specimens containing nucleic acids are prepared as droplets containing optical barcodes. A second set of droplets containing the CRISPR detection system and optical barcodes is prepared. In some cases, the barcode can be an optically detectable barcode that can be visualized with a light or fluorescence microscope. In certain exemplary embodiments, the optical barcode comprises a subset of fluorophores or quantum dots of color distinguishable from a set of defined colors. In some cases, the optically coded particles may be randomly delivered to individual volumes resulting in a random combination of optically coded particles within each well, or optically coded. A unique combination of optics may be specifically assigned to each individual volume. Random distribution of optically coded particles can be achieved by pumping, mixing, locking, or stirring the assay platform for sufficient time to allow distribution to all individual volumes. can. One of skill in the art can select an appropriate mechanism for randomly distributing optically coded particles across individual volumes, based on the assay platform used.

An observable combination of optically coded particles can then be used to identify each individual volume. Optical evaluations such as phenotypes can be created and recorded for each individual volume, for example with a fluorescence microscope or other imaging device. As shown in FIG. 13, three fluorescent dyes, such as various levels of Alexa Fluor 555, 594, 647, can be used to generate 105 barcodes. A fourth dye can be added and used and expanded to the scale of hundreds of unique barcodes. Similarly, the five colors can increase the number of unique barcodes that can be achieved by varying the color ratio.

For example, nucleic acid functionalized particles are synthesized on a solid support and subsequently labeled with different proportions of dyes at various levels, such as FAM, Cy3 and Cy5, or three fluorescent dyes, such as Alexa Fluor 555, 594, 647. , 105 barcodes can be generated.

In one embodiment, an assigned or random subset (s) of fluorophores received in each droplet or individual volume are observable of individual optically coded particles in each individual volume. The pattern is determined, thereby allowing each individual volume to be identified independently. Each individual volume is imaged with appropriate imaging techniques to detect optically coded particles. For example, if the optically coded particles are fluorescently labeled, each individual volume is imaged using a fluorescence microscope. In another example, if the optically coded particles are colorimetrically labeled, each individual volume has one or more filters that match the wavelength or absorption spectrum or emission spectrum unique to each color label. Is imaged using a microscope equipped with. Other detection methods suitable for the optical system used, such as those known in the art for detecting quantum dots, dyes, etc., are intended. The pattern of the individual optically coded particles observed for each individual volume can be recorded for later use.

In addition, droplet merging and incubation of the CRISPR detection system with the target molecule can be followed by an optical evaluation. When the target molecule is detected by the guide molecule, the CRISPR effector protein is activated, eg, by cleaving the masking construct so that a detectable positive signal is unmasked, released, or generated, thereby disabling the masking construct. Activate. It is possible to detect and measure the detectable signal of each droplet merged in one or more time cycles, eg, the presence of a positive detectable signal, indicating the presence of the target molecule.

Further embodiments of the present invention are described in the following numbered items.
1. 1. A method for detecting target molecules
To generate a first set of droplets, one or more guides designed to bind each droplet in the first set of droplets to a Cas protein, a corresponding target molecule. Generating, including detection CRISPR systems including RNA, masking constructs, and optical barcodes.
To generate a second set of droplets, wherein each droplet in the second set contains at least one target molecule and an optional optical barcode.
The first set and the second set of droplets are mixed to form a pool of droplets, the pool of droplets being a microfluidic containing an array of microwells and at least one flow channel beneath the microwells. The liquid as a pool of droplets by mixing the first set and the second set of droplets, which is to be flushed onto the device and is sized for the microwells to capture at least two droplets. Drop pools are flushed onto a microfluidic device that includes an array of microwells and at least one flow channel beneath said microwells.
To detect the optical barcode of the droplet captured in each microwell,
By merging the droplets captured in each microwell to form a merged droplet in each microwell, at least a subset of the merged droplets comprises the detection CRISPR system and the target sequence. By merging the droplets captured by the microwells to form a merged droplet at each microwell,
Starting the detection reaction and
Measuring the detectable signal of each merged droplet continuously, optionally, at one or more time intervals.
The method described above.
2. 2. The method of item 1, further comprising the step of amplifying the target molecule.
3. 3. The amplification includes nucleic acid sequence-based amplification (NASBA), recombinase polymerase amplification (RPA), loop-mediated isothermal amplification (LAMP), chain substitution amplification (SDA), helicase-dependent amplification (HDA), and nicking enzyme amplification reaction (NEAR). ), PCR, Multiple Substitution Amplification (MDA), Rolling Circle Amplification (RCA), Ligase Chain Reaction (LCR), or Branch Amplification Method (RAM).
4. The method of item 2, wherein the amplification is performed by RPA or PCR.
5. The method according to item 1, wherein the target molecule is contained in a biological sample or an environmental sample.
6. 5. The method of item 5, wherein the sample is of human origin.
7. The biological sample is blood, plasma, serum, urine, stool, sputum, mucus, lymph, synovial fluid, bile, ascites, pleural effusion, serous tumor, saliva, cerebrospinal fluid, tufted or vitreous fluid, or any body fluid. 5. The method of item 5, wherein the fluid is a secretion, serum, exudate, or fluid obtained from a joint, or a swab on the surface of the skin or mucous membrane.
8. The method of item 1, wherein the one or more guides are RNA designed to bind to a corresponding target molecule, including a (synthetic) mismatch.
9. 8. The method of item 8, wherein the mismatch is upstream or downstream of an SNP or other single nucleotide mutation in the target molecule.
10. The method of item 1, wherein the one or more guide RNAs are designed to detect single nucleotide polymorphisms in the target RNA or DNA, or splicing variants of RNA transcripts.
11. 10. The method of item 10, wherein the one or more guide RNAs are designed to detect drug resistant SNPs in viral infections.
12. The method of item 1, wherein the one or more guide RNAs are designed to bind to one or more target molecules characteristic of the disease state.
13. 12. The method of item 12, wherein the disease state is characterized by the presence or absence of a drug resistance or susceptibility gene or transcript or polypeptide.
14. The method of item 1, wherein the one or more guide RNAs are designed to distinguish one or more microbial strains.
15. The method according to item 12, wherein the disease state is an infectious disease.
16. 15. The method of item 15, wherein the infection is caused by a virus, bacterium, fungus, protozoan, or parasite.
17. 15. The method of item 15, wherein the one or more guide RNAs comprise at least 90 guide RNAs.
18. The method according to item 1, wherein the Cas protein is an RNA target protein, a DNA target protein, or a combination thereof.
19. 18. The method of item 18, wherein the RNA target protein comprises one or more HEPN domains.
20. 19. The method of item 19, wherein the one or more HEPN domains comprises an RxxxxxxH motif sequence.
21. 20. The method of item 20, wherein the RxxxH motif comprises an R {N / H / K] X ₁ X ₂ X ₃ H sequence.
22. X ₁ is R, S, D, E, Q, N, G, or Y, X ₂ is independent, I, S, T, V, or L, and X ₃ is independent. 21. The method of item 21, wherein L, F, N, Y, V, I, S, D, E, or A.
23. The method of item 1, wherein the CRISPR RNA target protein is C2c2.
24. 18. The method of item 18, wherein the Cas protein is a DNA target protein.
25. 24. The method of item 24, wherein the Cas protein comprises a RuvC-like domain.
26. 24. The method of item 24, wherein the DNA target protein is a V-type protein.
27. 24. The method of item 24, wherein the DNA target protein is Cas12.
28. 25. The method of item 25, wherein Cas12 is Cpf1, C2c3, C2c1, or a combination thereof.
29. The method of item 1, wherein the masking construct is RNA-based and suppresses the generation of detectable positive signals.
30. 29. The method of item 29, wherein the RNA-based masking construct suppresses the generation of the detectable positive signal by masking the detectable positive signal or instead producing a detectable negative signal. ..
31. 29. The method of item 29, wherein the RNA-based masking construct comprises silencing RNA that suppresses the production of the gene product encoded by the reporting construct, wherein the gene product produces a detectable positive signal upon expression.
32. 29. The RNA-based masking construct is a ribozyme that produces the negative detectable signal, wherein the positive detectable signal is produced when the ribozyme is inactivated. Method.
33. 32. The method of item 32, wherein the ribozyme converts the substrate to a first color and the substrate is converted to a second color when the ribozyme is inactivated.
34. 29. The method of item 29, wherein the RNA-based masking agent is an RNA aptamer and / or comprises an RNA mooring inhibitor.
35. 34. The method of item 34, wherein the aptamer or RNA mooring inhibitor sequesters the enzyme and the enzyme acts on the substrate to generate a detectable signal when released from the aptamer or RNA mooring inhibitor.
36. The aptamer is an inhibitory aptamer that inhibits the enzyme and prevents the enzyme from catalyzing the generation of a detectable signal from the substrate, or the RNA mooring inhibitor inhibits the enzyme and the enzyme is from the substrate. 34. The method of item 34, which prevents catalyzing the production of a detectable signal.
37. 36. The method of item 36, wherein the enzyme is thrombin, protein C, neutrophil elastase, subtilisin, horseradish peroxidase, beta-galactosidase, or calf alkaline phosphatase.
38. 37. The method of item 37, wherein the enzyme is thrombin, the substrate being paranitroanilide covalently bound to the peptide substrate of thrombin, or 7-amino-4-methylcoumarin covalently bound to the peptide substrate of thrombin.
39. 34. The method of item 34, wherein the aptamer sequesters a pair of agents that bind when released from the aptamer to produce a detectable signal.
40. 29. The method of item 29, wherein the RNA-based masking construct comprises an RNA oligonucleotide to which a detectable ligand and masking component are attached.
41. The solution is colored when the RNA-based masking construct contains nanoparticles aggregated and retained by cross-linking molecules, at least a portion of the cross-linking molecules contains RNA, and the nanoparticles are dispensed into the solution. 29. The method of item 29, which receives a shift.
42. 41. The method of item 41, wherein the nanoparticles are colloidal metals.
43. 42. The method of item 42, wherein the colloidal metal is colloidal gold.
44. 22. The method of item 22, wherein the RNA-based masking construct comprises quantum dots linked to one or more quencher molecules by a linking molecule, wherein at least a portion of the linking molecule comprises RNA.
45. 22. The method of item 22, wherein the RNA-based masking construct comprises RNA compounded with an insert, wherein the insert changes the absorbance upon cleavage of the RNA.
46. 45. The method of item 45, wherein the insert is pyronin-Y or methylene blue.
47. 22. The method of item 22, wherein the detectable ligand is a fluorophore and the masking component is a quencher molecule.
48. The method of item 1, wherein detecting the optical barcode comprises performing an optical evaluation of the droplet in each microwell.
49. 48. The method of item 48, wherein performing the optical evaluation comprises capturing an image of each microwell.
50. The method of item 1, wherein the optical barcode comprises particles of a particular size, shape, index of refraction, color, or a combination thereof.
51. 50. The method of item 50, wherein the particles include colloidal metal particles, nanoshells, nanotubes, nanorods, quantum dots, hydrogel particles, liposomes, dendrimers, or metal-liposomal particles.
52. 48. The method of item 48, wherein the optical barcode is detected using light microscopy, fluorescence microscopy, Raman spectroscopy, or a combination thereof.
53. The method of item 1, wherein each optical barcode comprises one or more fluorescent dyes.
54. 53. The method of item 53, wherein each optical barcode comprises a different proportion of fluorescent dye.
55. The method of item 1, wherein the detectable signal is a level of fluorescence.
56. The method of item 1, further comprising the step of applying the set cover resolution process.
57. The method of item 1, wherein the microfluidic device comprises an array of at least 40,000 microwells.
58. 57. The method of item 57, wherein the microfluidic device comprises an array of at least 190,000 microwells.
59. It is a multiple detection system
A detection CRISPR system that includes RNA target proteins, one or more guide RNAs designed to bind to the corresponding target molecule, RNA-based masking constructs, and optical barcodes.
Optical barcodes of one or more target molecules of choice,
A microfluidic device comprising an array of microwells and at least one flow channel beneath the microwells, the size of which the microwells are sized to capture at least two droplets.
The multiple detection system including.
60. A kit comprising the multiplex detection system according to item 59.
61. The method of any of items 1-58, wherein the second set of droplets comprises an optical barcode.
62. 59. The multiplex detection system of item 59, comprising an optical barcode of one or more target molecules.

The invention is further described in the following examples, which does not limit the scope of the invention described in the claims.

Illustrative Method In the exemplary method, the compounds can be mixed in a unique ratio of fluorescent dyes. Each mixture of target molecule and dye mixture can be emulsified into droplets. Similarly, each detection CRISPR system with optical barcodes was emulsified into droplets. In some embodiments, each droplet is about 1 nL. The droplets can then be combined and applied to a microwell chip. Droplets can be combined with a simple mix. In one exemplary embodiment, the microwell tip is suspended on a platform such as a hydrophobic glass slide with removable spacers that can be clamped from above and below by a clamp such as a neodymium magnet. It is possible to load oil into the gap between the chip and the glass created by the spacer, inject a pool of droplets into the chip, and then inject more oil to expel excess droplets to keep the droplets flowing. can. Once loading is complete, the chips can be cleaned with oil to purge the free surfactant. The spacer can be removed to seal the microwell against the glass slide and close the clamp. The chips are then imaged with an epifluorescence microscope, then the droplets are merged and the compounds in each microwell are mixed, for example by applying an AC electric field supplied by a corona processing device. Microwell incubation at 37 ° C. and fluorescence measurement using an epifluorescence microscope.

For primer design, the following exemplary methods for viral sequences can be utilized using the "diagnostic guide design" method implemented in software tools. In the case of viral sequences, the input of viral sequence alignment is utilized and the purpose is to allow some mismatch (usually 1) between the guide and the target some desired fraction of the input sequence (eg, 1). , 95%) is to find a set of guide sequences within some specific amplicon length. Important for subtyping (or any differential identification) is to design a collection of different guides that ensure that each collection is unique to one subtype. Based on this, the goal is to simultaneously design amplicon primers and guide sequences for species identification using diagnostic guide design (“dgd”) and other tools.

Assemble the required viral genome, align at the species level using maft, and cluster the data to identify closely related species. Treat segmented viruses specially. Treat each segment individually. Finally, select the best segment (or two) to continue.

The diagnostic guide design is used to identify the putative primer binding site (25 mer). Look for a single primer sequence with 95% coverage and no more than two mismatches.

If there is no way to achieve this coverage at position / window, move to the next position and do this first across the genome before calling Primer 3.

Identify primer pairs of amplicon with a length of 80-120 nucleotides. The primer 3 is used to narrow down 25 mer to obtain a target melting temperature of 58-60C.

SEQUENCE_PRIMER_PAIR_OK_REGION_LIST is used to specify the fwd / reverse primer position of the putative amplicon. This allows you to enter the region containing the primer using the [fwd_start, fwd_length, rev_start, rev_length] format.

Preferably, PCR can be performed at a lower temperature, eg 50-55C.

If the secondary structure of the primer is bad, discard it (PRIMER_MAX_SELF_ANY_TH, PRIMER_PAIR_MAX_COMPL_ANY_TH are set to 40C). This is lower than the default setting of 47C, but stringency is required to obtain good primers here.

Use clustering data to confirm the cross-reactivity of the amplicon. This can be done with primer 3 which allows for a "mispriming library" that the primer should avoid. Here you can enter a sequence listing from another species (but within the same cluster). Although the amplicon may contain primers specific to it, there may still be duplication at the crRNA level needed to ensure that the assay is very specific.

Pass those amplicons to d-g-d and try to find crRNA.

As before, allow one mismatch.

The window size is the entire amplicon (no overlap with the primer sequence)

Make a differential design using clustering data (probably just looking at the amplicons vs. other amplicons because of the lack of unamplified material). Requires at least 4 mismatches (GU pairs not included).

Create a table of specific amplicon with low crRNA and high coverage.

At this point, we can prepare a single "best" design, but we need to modify the code to allow, for example, to create a whitelist that offers several options for testing each virus. The sensitivity curve of the same Zika sample analyzed by SHERLOCK for Zika virus in a plate using a 20 uL reaction is the same as the SHERLOCK assay for Zika virus in droplets using a 2 nL reaction and is the same as the SHERLOCK assay for droplet SHERLOCK (dSHERLOCK). ) Indicates that the detection limit is comparable to the plate. (Fig. 3). Similarly, dSHERLOCK equally distinguishes single nucleotide polymorphisms (SNPs) when compared to assay on plates.

The methods and systems disclosed herein can be utilized for multiple detection of influenza subtypes (Fig. 5). In particular, the experimental effort required to generate all combinations of detection mixes and targets in the chip is the same as the effort required to build only the diagonal response in the well plate, system and method. Allows application to analysis in many combinations. Since the chip automatically builds all off-diagonal combinations in addition to diagonal, rapid determination of the selectivity of each detection mix for the desired product is achievable. Guide RNAs can be designed to target specific unique segments of the virus based on the deposited sequence. In some cases, the design can be weighted to include newer array data, or more general arrays. As shown in FIG. 6 for influenza H subtypes, a set of guide RNAs can be designed for various viral subtypes, with guide RNA alignments for multiple consensus sequences of each subtype with a 0 or 1 mismatch. You will get the successful results you provide.

Other exemplary applications of current systems and methods include multiple detection of mutations, including detection of drug resistance mutations in TB (FIG. 11) and HIV reverse transcriptase. Guide RNAs can be designed to target ancestral alleles and derived alleles, and can be tested to show the possibility of using both derived and target allele tests together. (Fig. 10). dSHERLOCK can be performed with fluorescence detected within 30 minutes. (Fig. 11).

By combining SHERLOCK with the methods disclosed herein using microwell array chips and droplet detection, the number and chip size of barcodes can be expanded to allow large-scale multiplexing. The highest throughput can be provided through multiple detection. (Figs. 12-14).

Example 1
In this example, the development of a combinatorial sequence reaction (CARMEN) for multiple evaluation of nucleic acids and the implementation of CARMEN (CARMEN-cas13) using cass13 will be described. As shown herein, CARMEN-cas13 specifically, selectively, and simultaneously tested dozens of samples for all human-related viruses with 10 or more sequenced genomes. In addition, CARMEN-cas13 leverages the sensitivity and specificity of cas13 detection to identify all strains of diverse viral species in parallel and detect panels of single nucleotide variants such as drug resistance mutations. In summary, CARMEN-cas13 is a highly multiplexed CRISPR-based nucleic acid detection platform that enables epidemiological monitoring on an unprecedented scale.

CARMEN transforms traditional CRISPR-based nucleic acid detection into a multiplexing assay by enclosing each sample and detection mix in an emulsified droplet and constructing a pair of sample and detection mix in a microwell array (FIG. 15B, FIG. 20). The amplified sample and detection mix are prepared on a conventional microtiter plate. Each amplified sample or detection mix is combined with a different fluorescent color code that acts as a unique optical identifier, and the color coded solution is emulsified with fluorus oil to yield 1 nL droplets. Once emulsified, droplets from all samples and detection mixes are pooled in a single tube and loaded into a microwell array integrated into a polydimethylsiloxane (PDMS) chip in a single pipetting step (FIG. 15B). And FIGS. 20-21). Each microwell in the array randomly contains two droplets from the pool, thereby spontaneously forming a combination of all pairs of dropleted inputs, and the array is physically relative to the glass substrate. Each microwell is physically isolated. The content of each well is determined by evaluating the color code of the droplet using a fluorescence microscope. Upon exposure to an electric field, the droplet pairs confined in each microwell are merged and all detection reactions are initiated simultaneously. Each detection reaction is monitored over time using a fluorescence microscope (FIGS. 15B and 20).

CARMEN-cas13 is as sensitive as the specific sensitive enzymatic reporter unLOCKing (SHERLOCK) used to rapidly detect various viral and bacterial pathogens in complex samples, and is a microwell array. The large number of data points collected for each can be used to adjust statistical power and throughput for each experiment. CARMEN-cas13 detects deca sequences with atomor sensitivities consistent with the sensitivities of standard SHERLOCK and PCR-based assays (FIGS. 15C and 22). In addition, running CARMEN on the applicant's standard chip retrieves data from approximately 10,000 microwells after quality filtering, offering the possibility of hundreds of technical iterations per test (FIG. 15C). Bootstrap analysis shows that CARMEN-Cas13 is very consistent and requires only 3 technical iterations per test (FIG. 20). Performing up to 1,000 tests per chip ensures that> X% of pairs have 3 or more technical repeat droplet pairs per test. The shape of the combinatorial space (eg, 100 sample x 10 detection mix, or 10 sample x 100 detection mix) is flexible. One use of CARMEN's flexibility is to extend the dynamic range of nucleic acid detection by evaluating multiple parallel detection reactions involving orthogonal RNA polymerases. To demonstrate this principle, amplification primers are barcoded using the orthogonal RNA polymerase promoters T3 and T7, and a detection reaction involving either T3 or T7 RNA polymerase is used to create a standard curve of 6 digits or more. (Fig. 23).

CARMEN goes beyond quantification and enables the detection of multiple nucleic acids on an unprecedented scale. To demonstrate this scale, the next focus is to specify dozens of samples of all 169 human-related viruses with more than 10 published genomes to inform the design of the Cas13 detection assay. It was to design an assay that could be selectively and simultaneously tested (FIGS. 16A, 26). Only 39 of these species have FDA-approved diagnostics, primarily due to the labor-intensive process of developing and validating such trials. Applicants have embarked on the development of a CARMEN assay to simultaneously identify each of these 169 viral species.

Experimental efforts to develop and test assays across human-related byloms (169 samples x 169 detection mix = 28,561 trials, controls and pre-replication) have included previous standard chips and color code sets as well as other existing multiplexings. It demanded higher throughput than what the system can provide. To distinguish droplets from hundreds of inputs, Applicants have existing for highly multiplexed and accurate spectral coding systems ^24-26 without the need for previously reported custom particle synthesis. A set of 1,050 solution-based color codes was developed using the ratio of four commercially available low molecular weight fluorophores, largely based on the 64 color code sets ⁸ . The 1,050 color code works the same as the original set, with a correct droplet classification of 97.8% across all droplets and a correct classification after permissible filtering holding 94% droplets of 99. It was 5% (FIGS. 24, 16B, 38A-38G). With just five iterations, the chances of a misclassified droplet leading to a misjudgment are 1 in 100,000. Applicants have designed a larger capacity chip (mChip) to match the throughput enabled by the expanded color code set (FIGS. 25A-25G). It has four times the surface area of previous standard chips and can simultaneously perform over 4,000 robust and statistically repeated tests. mChip reduces reagent costs per test by more than 300 times compared to standard well plate SHERLOCK tests. (Table 11).

Applicants then selectively and simultaneously test dozens of samples for all 169 human-related viruses (HAVs) with more than 10 available published genomes and display the viral genomes on the HAV panel. CATCH-dx (Metsky et al. In preparation) was applied to the virus, and a CARMEN- ^Cas13 assay was designed to select an amplicon of the PCR primer pool using the primer 327 for optimizing the primer sequence. CATCH-dx accepts a collection of sequences arranged in groups (eg, all known sequences within a species). For each group, CATCH-dx searches for the optimal set of crRNAs that are sensitive to sequences within the group (ie, detect the desired fraction of the sequence) and are unlikely to detect sequences within the other groups. (Fig. 39A). Using CATCHdx, along with virus species alignment as input, each set is highly selective (> 90%) within the target species with high selectivity for other species, taking into account the genomic diversity of NCBI GenBank. A small set of various crRNA sequences was designed to provide sequence detection) (FIGS. 16C, 26, 39A-39G). This design was tested using synthetic targets based on various consensus sequences, and the optimal crRNA from the various set in the design was computer-selected for testing (FIG. 16B).

Utilizing the large-scale multiplexing function of CARMEN-cas13, the applicant has extensively tested the HAV panel and demonstrated high performance. Each crRNA (total 169) was evaluated against all amplified targets using the corresponding primer pool (total 184 PCR products including controls; Figure 16B), total 30,912 times at 8 mChip. Tests were performed (see Table 1). In the initial design set, 148 crRNAs (87.6%) are already highly selective for the target and are over-threshold signals, and 13 (7.7%) are over-threshold cross-reactivity. 8 (4.7%) showed no reactivity above the threshold. To address the degraded crRNA, 11 crRNA sequences were redesigned, 3 primer sequences were redesigned, and new stocks of crRNA and targets were prepared. In a second round of study incorporating the redesigned sequence, 157 (94%) of the 167 crRNAs evaluated were highly selective for the target, the signal exceeded the threshold, and 6 (3. 6%) showed cross-reactivity above the threshold, and 4 (2.4%) did not exceed the threshold (FIG. 16C). The results for Rounds 1 and 2 were very consistent: 97.2% of the sequences that were not redesigned or rediluted were equally performed between the two rounds, altering the performance of the rest of the assay. It was demonstrated that the individual crRNA could be improved without any (FIGS. 40A-40E). In addition, the performance of the individual crRNAs is strong (median AUCs for rounds 1 and 2 are 0.999 and 0.997, respectively) (FIGS. 40A-40E). In fact, no broad cross-reactivity is observed even when the synthetic target is amplified in all primer pools (FIGS. 41A-41F).

To rigorously test the performance of CARMEN in more difficult and complex situations, Applicants evaluated HAV panels on plasma or serum samples from 16 confirmed infected patients. Each clinical sample was treated as unknown and amplified using all 15 primer pools. To improve test throughput, PCR products were then pooled into 3 sets (5 end products per patient sample) and tested with crRNA from the HAV panel. As a comparative reading, a second round of PCR was performed using species-specific PCR primers. CARMEN and PCR amplification were 100% consistent with dengue, deer, and HIV samples. For HCV, a highly diverse virus, HCV-specific crRNA in the HAV panel identified two of the four PCR-positive samples. Particularly diverse virus detection sensitivities can be addressed by increasing crRNA multiplexing to cover a heterogeneous target set, as demonstrated by the influenza A subtyping of FIG. 3 below. Furthermore, the specificity of CARMEN is high and the cross-reactivity is not wide. Only 3 (1.8%) of the 169 crRNAs showed unexpected reactions in 3 diverse negative controls (plasma, serum, or urine pooled from healthy humans), with 89.6% PCR. The result was consistent with amplification. These three crRNAs were excluded from the analysis without affecting the performance of the rest of the HAV panel.

In addition to identifying the individual causes of symptomatic infections, the HAV panel can be used in parallel to monitor many viruses. Here, the HAV panel identified strains of torqueteno-like minivirus (TLMV) and human papillomavirus (HPV) in a subset of patients (TLMV: 11/16 patients, HPV: 4/16 patients). These results were confirmed with 100% concordance by PCR in the second round. These viruses are generally known to infect humans, are often asymptomatic, and are often undiagnosed, so secondary infections or asymptomatic using a multiplexed CARMEN panel. It has been demonstrated that the infection can be identified. In a clinical environment, integrating the results of the HAV panel with the patient's symptoms is important for interpretation, and the results may only be needed from a subset of the HAV panel. Therefore, the HAV panel can be viewed as a modular master set of nucleic acid detection assays that end users can customize for a variety of applications.

Taking advantage of the specificity of Cas13 detection, Applicants used CARMEN-Cas13 to distinguish all epidemiologically relevant serotypes of various viral species in parallel and to parallel various viral strains. Distinguished. Diversity within a virus species poses a major challenge for detection. The assay must maintain selectivity for that group while correctly identifying many different sequences within a group of strains. Influenza A virus (IAV) hemagglutinin (H) and neuraminidase (N) subtypes H1-H16 and N1-N9 were selected as case studies. These serologically defined subtypes consist of strains capable of infecting a wide variety of host species, some of which are associated with a pandemic potential. H and N amplicons were identified that were well conserved for amplification with the parallel primer set. To identify subtypes, CATCH dx was used to design a specific set of crRNAs covering> 90% of the sequences within each subtype (FIG. 17A, FIG. 30, see Method for details). ). Optimal crRNAs were tested from each set using synthetic consensus sequences from H1-16 and N1-9, and these subtypes were readily identified (FIGS. 17B-17C, FIG. 31). N-subtyping assays were further tested using 35 synthetic sequences representing> 90% of sequence diversity within each N-subtype, 32 of 35 (91.4%) of these sequences. Was identified (FIG. 32). Subtyping assays were validated using seed stocks from H1N1 and H3N2 strains, IAV subtypes commonly circulating in humans, and synthetic sequences from avian IAV subtypes (FIG. 17D, table). 1). Based on these results, the assay was able to potentially identify any of the possible combinations of 144 of the H1-16 and N1-9 subtypes.

Due to the exquisite specificity of Cas13, CARMEN-cas13 can identify multiple clinically relevant viral mutations, such as those that confer drug resistance. As a proof of concept, a primer pair was designed by tying a set of crRNAs with an HIV reverse transcriptase (RT) coding sequence, and six common drug resistance mutations (DRM, FIG. 18A, Table 2) were identified. .. These DRMs are prevalent in African, Latin American, and Asian antiviral naive patient populations with a frequency of 5-15%. The design was tested using synthetic targets and all 6 mutations could be identified in parallel (FIG. 18B, FIG. 33). Applicants were able to further analyze the performance of the RT assay to detect DRM with low allele frequency, detect K103N at a frequency of 1%, and detect other DRM at a frequency of 10% (FIG. 34). ..

Further validation of the RT DRM assay was performed on clinical plasma samples from 4 HIV patients (FIG. 18D) and showed 100% agreement with the gold standard approach Sanger sequencing assay (out of 4 patients). DRM was absent in 3 patients; 1 patient had the K103N mutation). In particular, the CARMEN HIV SNP assay was more sensitive to HIV detection than the HAV panel or associated PCR because of the high likelihood of high primer and crRNA multiplexing. To demonstrate the generalizability of the approach, Applicants expanded the panel to include a comprehensive set of DRMs for HIV integrase, the front-line HIV treatment targets in high-income countries. Amplification primers and crRNA were designed to target all 21 integrase DRMs designated clinically relevant by the American International Antiviral Society in 2017. Applicants have successfully identified all of these mutations by testing a set of nine complex synthetic targets (FIG. 18E, Table 2). Notably, four of these complex targets contained multiple DRMs, confirming the ability of CARMEN-Cas13 to detect multiple DRM combinations simultaneously.

Discussion The widespread use of CARMEN-Cas13 (distinguishing viral sequences at the species, strain, and SNP level) and the ability to rapidly develop and validate highly multiplexed detection panels have been demonstrated. More generally, CARMEN-Cas13 enhances CRISPR-based nucleic acid detection techniques by improving throughput, reducing reagent and sample consumption per test, and enabling detection over a larger dynamic range. (FIGS. 42A-42C). The flexibility and high throughput of CARMEN accommodates the addition and rapid optimization of new primers or crRNAs to existing CARMEN assays, facilitating the detection of most known pathogen sequences. In addition, in the broader context of pathogen detection, detection and evolution, CARMEN and next-generation sequencing complement each other: CARMEN can rapidly sequence infected samples to further track viral evolution. The newly identified sequences can inform the design of improved CRISPR-based diagnostics. Due to the exponential growth of sequencing data, it may ultimately be possible to create a CARMEN assay with near complete sensitivity to high-risk pathogens. In the future, Applicants will deploy region-specific detection panels to sample thousands of selected populations, including animal mediators, animal reservoirs, or symptomatic patients. It is supposed to be tested. Routine adoption of such panels requires careful interpretation in order to use the data wisely and clinically when testing human samples. CARMEN unleashes CRISPR-based diagnostics on a large scale. This is an important step towards routine comprehensive disease monitoring to improve patient care and public health.

Materials and Methods Human samples from HIV patients were obtained commercially from Boca Biolitics, and all protocols were approved by the Massachusetts Institute of Technology (MIT) and the in-facility review board of the Broad Institute of MIT and Harvard.

General Experimental Procedure Preparation of Targets, Samples, and CrRNA Synthetic Targets: Synthetic DNA targets were ordered from Integrated DNA Technologies (IDT) and resuspended in nuclease-free water. The resuspended DNA was serially diluted to 104 copies ^per microliter and used as input to the PCR reaction.

Sample Preparation: For influenza A virus seed stock and HIV clinical samples, RNA was extracted from 140 μl of input material using QIAamp Viral RNA Mini Kit (QIAGEN) and carrier RNA according to the manufacturer's instructions. The sample was eluted with 60 μl of nuclease-free water and stored at −80 ° C. until use. 5 μl of the extracted RNA was converted to single-stranded cDNA by a reaction of 20 μl. First, random hexamer primers were annealed to sample RNA at 70 ° C. for 7 minutes, followed by reverse transcription at 55 ° C. for 20 minutes using SuperScript IV with random hexamer primers without RNase H treatment. The cDNA was stored at −20 ° C. until use.
crRNA preparation: For virus detection (FIGS. 15-18), crRNA was synthesized by Synthego and resuspended in nuclease-free water. For SNP detection (FIG. 18), the crRNA DNA template was annealed to the T7 promoter oligonucleotide at a final concentration of 10 μM in 1 × Taq reaction buffer (New England Biolabs). In this procedure, the first denaturation at 95 ° C. for 5 minutes was followed by annealing at 5 ° C. per minute to 4 ° C. SNP-detected crRNAs were transcribed in vitro from annealed DNA templates using the HiScribe T7 High Yield RNA Synthesis Kit (New England Biolabs). Transcription was performed in a volume of 30 μl according to the manufacturer's instructions for short RNA transcripts. The reaction was incubated at 37 ° C. for 18 hours or overnight. The transcript is purified by using RNAClean XP beads (Beckman Coulter), doubling the ratio of the beads to the reaction volume, adding 1.8 times more isopropanol, and resuspending in nuclease-free water. did. RNA products transcribed in vitro were then quantified using NanoDrop One (Thermo Scientific) or on Take3 plates whose absorbance was measured by Equation 5 (Biotech Instruments). Cas13a was recombinantly expressed as described in Genscript, purified and stored in storage buffer (600 mM NaCl, 50 mM Tris-HCl pH 7.5, 5% glycerol, 2 mM DTT).

Nucleic Acid Amplification Unless otherwise stated, amplification was performed by PCR using a Q5 hot start polymerase (New England Biolabs) in a 20 μl reaction using a primer pool (containing 150 nM of each primer). The amplified sample was stored at −20 ° C. until use. See Methods for more information on thermal cycle conditions.

Cas13 detection reaction Cas13 detection reaction: The detection assay is a nuclease assay buffer containing 45 nM purified 1 mM ATP, 1 mM GTP, 1 mM UTP, 1 mM CTP, and 0.6 μl T7 polymerase mix (Lucien) (40 mM Tris-HCl, LwaCas13a in 60 mM NaCl, pH 7.3), 22.5 nM crRNA, 500 nM quenched fluorescent RNA reporter (RNAse Assay v2, Thermo Scientific), 2 μl mouse RNase inhibitor (New England Biolabs). The input of amplified nucleic acid was altered by the assay detailed herein. The detection mix was prepared as a 2.2x master mix so that each droplet contained a 2x master mix after color coding and a 1x master mix after merging the droplets.

Color coding, emulsification, and droplet pooling Color coding: Unless otherwise stated, amplified samples are diluted 1:10 with water containing 13.2 mM MgCl ₂ nuclease-free and then color coded. The final concentration after merging the droplets was 6 mM. The detection mix was not diluted. Color code stock (2 μL) was placed on a 96 W plate (see method below for more information on building color codes). Each amplified sample or detection mix (18 μL) was added to different color codes and mixed by pipetting.

Emulsification: 2% 008-fluorosurfactant (RAN Biotechnologies) in color coded reagent (20 μL) and fluorus oil (3M 7500, 70 μL) is added to the droplet generator cartridge (BioRad) and droplets are added. The reagent was emulsified into droplets using a generator (QX200, BioRad).

Droplet pooling: A total drop pool capacity of 150 μL droplets was used to load each standard chip. A total of 800 μL droplets were used to load each mChip. To maximize the probability of forming productive droplet pairing (amplified sample droplet + detection reagent droplet), half of the total volume of the droplet pool will be the target droplet and half will be the detection reagent solution. Assigned to the drop. Individual droplet mixtures were lined up on 96W plates for pooling. A multi-channel pipette was used to transfer the required amount of each drop type into a row of eight drop pools, which were then combined to create a single drop pool. The final droplet pool was gently pipetted up and down to completely randomize the placement of the droplets in the pool.

Microwell array loading, imaging, and merging Microwell array loading (standard chip): Standard chip loading was performed as described above. Briefly, each chip was placed in an acrylic chip loader and hung about 300-500 μm above the surface of the hydrophobic glass to create a flow space between the chip and the glass. The flow space was filled with fluorous oil (3M, 7500) until loaded. Immediately before loading, fluorous oil was drained from the flow space. In one pipetting step, a droplet pool was added to the flow space (FIG. 20, step 3). The loader was tilted to move the droplet pool within the flow space until the microwells were filled with droplets. Clean the flow space with fresh detergent-free Fluorus oil (3M 7500) (3 x 1 mL), fill the flow space with oil, and seal the chip against the glass by twisting and closing the loader. (Fig. 20, step 4). Additional oil (1 mL) was added to the loading slot and the slot was sealed with clear tape (Scotch) to prevent evaporation.

Microwell array loading (mChips): The back of the mChip was pressed against the lid of the mChip loader to adhere the chips to the lid and leave the microwell array facing out (FIG. 25C, center view). The lid was placed on the loader base, and magnets on the opposite side of the lid and base held the lid and chip suspended above the base (FIG. 25C, right figure, and 25D). Using the wing nut of the screw, the lid was pushed toward the base until the flow space between the surface of the tip and the base was about 300-500 μm (Fig. 25C, right figure). The flow space was filled with fluorous oil (3M, 7500) until loaded. Immediately before loading, fluorous oil was drained from the flow space. A droplet pool was added to the flow space by pipetting along the edge of the chip in a single pipetting step (FIG. 25D, step 3). The loader was tilted to move the droplet pool within the flow space until the microwells were filled with droplets. The flow space was washed (3 x 1 mL) with fresh fluorous oil (3M 7500) without surfactant. Two pieces of PCR film (MicroAmp, Applied Biosystems) were joined by placing one piece of adhesive surface a few millimeters above the other end. A sheet of PCR film was wetted with Fluorous oil and set aside. Return to loader: The wing nut was removed so that the loader lid (with the mChip attached) could be removed from the base. The mChip was sealed with a single smooth motion against a sheet of moist PCR film (FIG. 25D, step 4). The excess PCR film hanging on the edge of the chip was cut off with a razor blade.

Imaging, merging, and subsequent imaging of microwell arrays: After loading the chips, the color code of each droplet was identified with a fluorescence microscope (FIG. 20, step 4). After imaging, the droplet pairs in each microwell were merged by passing the tip of a corona processor onto glass or PCR film (FIG. 20, step 5). The merged droplets are immediately imaged by a fluorescence microscope (FIG. 20, step 6) and placed in an incubator (37 ° C.) until the point of subsequent imaging. All imaging was performed with a Nikon TI2 microscope equipped with an automatic stage (Ludl Electronics, Bio Precision 3 LM), LED light source (Sola), and camera (Hamamatsu). The standard chip was imaged using a 2x objective lens, but the mChip was imaged using a 1x objective lens to shorten the imaging time. During imaging, the microscope capacitor was tilted backwards to reduce background fluorescence on channel 488. In addition, during experiments involving UV channel imaging, the microscope was covered with a black cloth to reduce background fluorescence from light scattered from the ceiling.

Data analysis Data analysis: The imaged data was analyzed using a custom Python script. The analysis consisted of three parts. (1) Image analysis before merging to determine the identity of the contents of each droplet based on the color code of the droplet, (2) Determine the fluorescence output of each droplet pair and microwell their fluorescence values. Image analysis after merging that maps to the contents of (3) Statistical analysis of the data obtained in parts 1 and 2.

Image analysis before merging: The content of each droplet was determined from the images taken prior to the droplet merging. The background image was subtracted from each droplet image and the fluorescence channel intensity was scaled so that the intensity range of each channel was approximately the same. The droplets were identified using the Hough transform and the fluorescence intensity of each channel at each droplet location was determined from the local convolution image. Cross-channel optical bleed correction was applied and all fluorescence intensities were normalized to the sum of the 647 nm, 594 nm, and 555 nm channels. For 4-channel datasets, analysis of the 3-color space was performed directly with normalized intensity. For a 5-channel dataset, the droplets were split into UV intensity bins for downstream analysis (FIG. 24). The three color spaces of each UV bin were analyzed individually. A three-color intensity vector for each droplet was projected onto the unit simplex, and a marker was assigned to each color-coded cluster using density-based spatial clustering (DBSCAN) for noisy applications. Manual adjustments to clustering were made as needed. For a 5-channel dataset, the UV intensity bins were recombined after allocation to create a complete dataset (FIG. 24).

Post-merging image analysis: Background subtraction, intensity scaling, correction, and normalization were performed as in the pre-merging analysis. Following image registration of the images before and after merging, the fluorescence intensity of the reporter channel at the location of each drop pair was determined from the locally convoluted image. The physical mapping of the fluorescent reporter channel to the previously determined position of each color code helped to assign the fluorescent signal of the reporter channel to the contents of each well. Quality filtering was applied for the appropriate post-merged droplet size (excluding unmerged droplet pairs) and the proximity of the droplet color code to its specified cluster (see Figure 24). sea bream).

Statistical analysis: Heatmaps were generated from the median fluorescence of each crRNA target pair. The performance of each guide was evaluated by calculating the receiver operating characteristic (ROC) curves of the fluorescence distribution from all on-target and off-target droplets to determine the area under the curve (AUC).

Experiment-specific protocol deer detection (Fig. 15C)
Nucleic Acid Amplification: Recombinase polymerase amplification (RPA) was used for Zika virus detection (FIG. 15C, FIG. 22). The RPA reaction was performed using the Twist-Dx RT-RPA kit according to the manufacturer's instructions. The primer concentration was 480 nM and the MgAc concentration was 17 mM. In the RNA-containing amplification reaction, a mouse RNase inhibitor (New England Biolabs M3014L) was used at a final concentration of 2 units / microliter. All RPA reactions were incubated at 41 ° C. for 20 minutes unless otherwise stated. The RPA primer sequences are listed. The RPA reaction was diluted 1:10 with nuclease-free water prior to color coding.

Cas13 detection reaction: For the deer detection experiment (FIG. 15C), the detection mix was supplemented with MgCl ₂ at a final concentration of 6 mM prior to droplet merging. For comparison of CARMEN and SHERLOCK (FIG. 22), a Biotek Cytation 5 plate reader was used to measure the fluorescence of the detection reaction. Fluorescence kinetics was monitored by reading every 5 minutes for up to 3 hours using a monochromator that was excited at 485 nm and emitted at 520 nm.

Human-related virus panel (Fig. 16)
Nucleic Acid Amplification: For human-related virus panels, amplification was performed in a 20 μl reaction using a primer pool (containing 150 nM of each primer) and a Q5 hot start polymerase (New England Biolabs). The following thermal cycle conditions were used. (I) Initial denaturation at 98 ° C. for 2 minutes, (ii) 45 cycles at 98 ° C. for 15 seconds, 50 ° C. for 30 seconds, 72 ° C. for 30 seconds, (iii) Final elongation at 72 ° C. for 2 minutes.

Influenza A (Fig. 17)
Species Stock Information: This study used a seed stock of viruses derived from three influenza A virus strains. A / Puerto Rico / 8/1934 (HlNl), A / Hong Kong / l-l-MA-12 / 1968 (H3N2), and A / Hong Kong / 1 / 1968-2 mouse-adapted 21-2 (H3N2) ..

Nucleic Acid Amplification: For influenza subtyping panels, amplification was performed in a 20 μl reaction using a primer pool (containing 150 nM of each primer) using a Q5 hot start polymerase (New England Biolabs). The following thermal cycle conditions were used. (I) Initial denaturation at 98 ° C. for 2 minutes, (ii) 40 cycles at 98 ° C. for 15 seconds, 52 ° C. for 30 seconds, 72 ° C. for 30 seconds, (iii) Final elongation at 72 ° C. for 2 minutes. In the experiment shown in FIG. 3D, the H and N amplification reactants were diluted together. Prior to color coding, the H reactant was diluted 1:10 and N was diluted 1: 5 with nuclease-free water supplemented with 13.2 mM MgCl ₂ .

HIV DRM (Fig. 18)
Nucleic Acid Amplification: For the HIV DRM panel, amplification was performed in a 20 μl reaction using a primer pool (including 150 nM of each primer) using a Q5 hot start polymerase (New England Biolabs). The following thermal cycle conditions were used. (I) Initial denaturation at 98 ° C. for 2 minutes, (ii) 40 cycles of 98 ° C. for 15 seconds, 52 ° C. for 30 seconds, 72 ° C. for 30 seconds, (iii) Final elongation at 72 ° C. for 2 minutes. In the experiment shown in FIG. 4, even and odd reactants were diluted 1:10 together in nuclease-free water supplemented with 13.2 mM MgCl ₂ prior to color coding.

Software and Nucleic Acid Sequence Design Human-Related Virus Panel Design Overview: An overview of the human-related virus panel sequence design strategy is shown in FIG. Briefly, the design pipeline consisted of viral genome segment alignment, PCR amplicon selection, followed by crRNA selection with confirmation of cross-reactivity. Finally, PCR primers were phylogenetically pooled.

Viral Genome Segment Alignment: Viral Genome Neighbors were downloaded from NCBI. Each segment of each virus species was aligned with the following parameters using mafft v7.31. －－Retree 1 －－preservecase. Alignments were selected to remove sequences assigned to the wrong species, decomplemented sequences, or sequences derived from the wrong genomic segment. Links to aligned genomic segments can be found at:

PCR amplicon selection: Potential PCR binding sites were identified using CATCH-dx with a window size and length of 20 nucleotides and a coverage requirement of 90% of the sequences in the alignment. (1) Automated continuous crRNA design that comprehensively targets diverse sequences. Manuscript is being prepared. 2) Capture of metagenomic sequence diversity by comprehensive and scalable probe design. Nature Biotechnology (2019). )

Potential pairs of primer binding sites within a distance of 70 and 200 nucleotides were selected. These sets of potential primer pairs were populated in Primer 3 v2.4.0 to see if suitable PCR primers could be designed for amplification. Primer3 was run using the following parameters: PRIMER_TASK = generic, PRIMER_EXPLAIN_FLAG = 1, PRIMER_MIN_SIZE = 15, PRIMER_OPT_SIZE = 18, PRIMER_MAX_SIDE = 20, PRIMER_MIN_GC = 30.0, PRIMER_MIN_GC = 30.0, PRIMER_MAX_GC = 70.0, PRIMER_MAX_GC = 70.0 56.0, PRIMER_MAX_DIFF_TM = 1.5, PRIMER_MAX_HAIRPIN_TH = 40.0, PRIMER_MAX_SELF_END_TH = 40.0, PRIMER_MAX_SELF_ANY_TH = 40.0, PRIMER_PRODUCT_SIDE_RANGE- A list of potential amplicon analyzes the Primer 3 output file and the maximum difference in melting temperature between any pair of forward and reverse primers is less than 4 ° C (all primers in the pool have similar PCR). Generated by filtering to make sure it has efficiency). This list of potential amplicon was scored based on the average pairwise penalty between all pairs of forward and reverse primers of the design, as measured by Primer 3. For the crRNA design, the highest-scoring amplicon was selected from various types.

crRNA design: A software package called CATCH-dx is used to determine the minimum number of crRNA required to bind 90% of the sequences in a 40 nt window of each amplicon alignment and up to one in the window. It allowed mismatches and enabled GU pairing. These crRNA sets were tested for cross-reactivity at the family level, requiring 3 or more mismatches in> 99% of sequences of other species within the same family, allowing GU pairing. This strict threshold was chosen to ensure the high specificity of the human-related viral assay. For closely related viral genera (enterovirus and poxvirus), regions with different consensus sequences of various types were selected and crRNA was considered only in windows with sufficient sequence diversity at multiple consensus levels.

Primer pooling: Primers were designed for a set of 169 species with at least one segment with> = 10 sequences in the database. Hereinafter referred to as human-related virus panel 10 version 1 or hav10-v1. Due to the limitations of multiplex PCR, 210 primer pairs designed for 169 hav10 species in version 1 design are divided into 15 primer pools, which are described in more detail below.

Conserved Primer Pools: For 14 species, conserved species were selected as pilot experiments to test primer design algorithms and pooling strategies. These seeds were bound to a single "conserved" primer pool at a final concentration of 150 nM.

Diversity Primer pool: 164 of the 169 hav10 species have designs containing 3 or less primer pairs (require a total of 187 primer sequences to cover them: 145 have one primer pair). , 15 has two primer pairs and 4 has three primer pairs). There were four species that required more than three primer pairs. Lymphocytic choriomyelitis virus (LCMV, 7 primer pairs), Norovirus (4 primer pairs), Beta papillomavirus 2 (6 primer pairs), and Candiru Frevovirus (6 primer pairs). These four species were bound to a single "various" primer pool at a final concentration of 150 nM.

Reduced Primer Pool For 167 of the 169 hav10 species, CATCH-dx / Primer 3 can be used to design primer sets that cover more than 90% of the genome in the database with less than 10 primer pairs. rice field. However, for the two species (simian immunodeficiency virus and sapovirus), computer design strategies could not be used to identify well-conserved pairs of primer binding sites. Instead, primers were designed using several degenerate bases to capture widespread sequence diversity and the amplicon was manually identified. These primers were used in a "degenerate" primer pool with a final concentration of 600 nM.

Remaining Primer Pools: For the remaining 149 hav10 species, Applicants phylogenetically pooled the primers so that each pool contained species from 1-3 viral genera (see Table 4 for details). I want to be). One primer of pool 4 (Torque teno Leptonychotes weddellili virus-1) contained several degenerate bases and was designed manually. These primers were used at a final concentration of 150 nM.

Version 2 redesign: After testing the hav10-v1 design, three amplicons were redesigned. Orthohepesvirus A, rhinovirus A, and rhinovirus B. The newly designed primers were pooled again to create pools 8v2 and 12v2, and new crRNA sequences were designed to target these amplicon. Based on the results of the hav10-v1 test, Applicants redesigned the crRNA within 14 existing v1 amplicons (see Table 5b).

One replication of an equivalent experiment performed on 96 W plates requires approximately 300 plates and more than 1 L of detection mix.

Influenza A design Primer design: N primers were based on multiple consensus sequences for each subtype (9 primer pairs) in a single pool. CATCH-dx was used to design H primers that covered at least 95% of the sequences within each subtype. In total, one pool contained 45 primers (15 forward primers, 30 reverse primers).

crRNA design: A set of a small number of crRNA sequences was designed to selectively target individual H or N subtypes using CATCH-dx. The design approach has been improved throughout the process by incorporating new features into each round of design (Figure 32). In the first round of design, the applicant designed only H crRNA and required that all crRNA hybridize 90% of all sequences and allow up to one mismatch. The crRNA in the set can be placed anywhere in the amplicon. In the second round of design, the applicant designs both H and N crRNAs and, based on sequence alignment, positions the crRNAs in the set (in the 91 nt window for H, 35 nt window for N). (Inside) restricted. At some locations within the amplicon, it was more conserved among the subtypes than others. In addition, design coverage was weighted towards more recent years by introducing exponential decay parameters for arrays older than 2017. In the third round, a differential design approach was implemented in which all crRNAs require at least three mismatches when hybridizing to at least 99% of the sequences within any other subtype. In the fourth round, the hybridization model was modified to explain GU pairing, the threshold was raised to 95% of the sequences of each subtype, and up to one mismatch was allowed. Each round of design was experimentally tested and high performance crRNA between designs was used in combination. H needed a four-round design, while N needed only two rounds (rounds 2 and 3).

HIV DRM Panel Design Primer Design: Applicants have developed a primer pooling strategy that divides primer pairs into overlapping "odd" and "even" primer pools based on the location of the DRM within the reverse transcriptase and integrase genes. used. This allowed all mutations to be included in at least one amplicon and no problems occurred during amplification. The primer sequence was designed with the following parameters using primer3 v2.4.0. PRIMER_PRODUCT_OPT_SIZE = 150, PRIMER_MAX_GC = 70, PRIMER_MIN_GC = 30, PRIMER_OPT_GC_PERCENT = 50, PRIMER_MIN_TM = 55, PRIMER_MAX_TM = 60, PRIMER_MAX_TM = 60, PRIMER_DNA_CONC = 150, PRIMER_DNA_ Amplicon lengths ranged from 150 to 250 nucleotides. All primer sequences are shown in Table 9.

crRNA design: crRNA pairs were designed for HIV DRM identification using three different strategies: mutation at position 3 and synthetic mismatch at position 5 and DRM codon at positions 3-5 and synthesis mismatch at position 6. , And a synthetic mismatch at position 3 with the DRM codon at positions 4-6. The sequence was designed using the most commonly used codons for each amino acid, based on the HIV subtype B consensus sequence. All designs were experimentally tested and the highest performance design was selected for the final panel.

Hardware Development and Construction Microwell Array Chip Design and Manufacture Microwell Array Design: The dimensions of the microwell are the loading speed of the droplets (the larger the wells, the faster) and the proximity of the droplets within the microwells. Optimized by empirical testing to balance (smaller wells are easier to merge). For droplets made from PCR amplification reactions or Cas13 detection mixes, optimal well shape was achieved by joining two circles with a diameter of 158 μm and an overlap of 10% (FIG. 21A). A minimum distance of 37 μm between each well facilitated consistent chip production without tearing the PDMS (see μ Well Chip Production below). The total microwell array of standard chips is 6.0 x 5.5 cm (51,496 microwells). Loading slots partially obscured the microwell array, reducing the functional array size to 6.0 x about 4.5 cm (about 42,400 microwells) (FIG. 21B). The mChip comprises a 12 x 9.1 cm microwell array with 177,840 microwells (FIG. 25A). The mChip microwell array is surrounded by a 0.1-0.3 cm border of PDMS to facilitate robust sealing around the edge of the chip. The total dimensions of the mChip are designed to maximize the number of wells that can be imaged in the area of a standard microscope stage (16 x 11 cm opening, Bio Precision LM Motorized Stage, Lud. Electronics), while the tip is It is to be manufactured using a standard silicon wafer (15 cm) (FIG. 25B).

Microwell Chip Manufacturing: Polydimethylsiloxane (PDMS) chips were manufactured according to standard hard and soft lithography practices using acrylic molds to achieve consistent chip dimensions. The manufacture of standard size chips has been previously described (PNAS # 1). In the case of mChips, a 150 mm wafer (WaferNet, Inc., # S64801) was washed with a spin coater (Model WS-650MZ-23NPP, Laurell Technologies) at 2500 rpm, once with acetone and once with isopropanol. The photoresist (SU-8 2050, MicroChem) was spin-coated onto each wafer in a two-step process. (1) 30 seconds, 500 rpm, acceleration 30; (2) 59 seconds, 1285 rpm, acceleration 50. Wafers were baked at 65 ° C. for 5 minutes and then at 95 ° C. for 18 minutes. After cooling for 1 minute, the coated wafer was placed under a suitable photomask and irradiated (5 x 3 seconds, 350 W, model 200, OAI). Wafers were baked again at 65 ° C. for 3 minutes and at 95 ° C. for 9 minutes. After cooling for 1 minute, the wafer was incubated with SU-8 developer for 5 minutes. The developer was removed by rotating at 2500 rpm and the acetone and isopropanol cleaning solution was applied directly to the rotating wafer to remove excess developer and photoresist. Each wafer was characterized by measuring feature dimensions by visual inspection and shape measurement under a light microscope (Contour GT, Bruker). The wafer was placed in an acrylic mold and fixed with a magnet (Fig. 25B). To make chips from the mold, PDMS was mixed and poured into the mold and the entire mold was placed under vacuum for 3-5 minutes. The mold was closed with an acrylic lid so that the thickness of the chips was uniform, and the chips were baked for at least 2 hours. After removing the chip from the mold, the surface and sides of the chip holding the microwell array (but not the back of the chip on the opposite side of the microwell array) are 1.5 μm parilen C (Paratronix / MicroChem, Westborough, MA). ) Was coated. The chips were stored in a plastic bag at room temperature until use.

Acrylic device manufacturing (molds and loaders): Molds (PNAS # 1) and loaders (PNAS # 2) for standard chip production and handling were constructed as described above. A mold and loader for mChip were constructed using a similar method (Fig. 25B). Briefly, a 12 "x 12" cast acrylic sheet (1/4 "or 1/8", transparent or black) was purchased from Amazon (Small Parts, # B004N1JLI4). The mold and loader design was made in AutoCAD (AutoDesk) and the parts were cut using an Epilog Fusion M2 laser cutter (60W). The acrylic moieties were fused by wetting with dichloromethane (Sigma Aldrich). N42 neodymium disk magnets (Applied Magnets, Inc., Plano, TX) were added to devices containing Loctite, Metal / Concrete. Cap screws (M4 x 25), nuts (M4), and washers (M4) were purchased from Thorlabs.

Color Code Design, Construction, and Characteristic Evaluation Color Code Design: The color code serves as an optically unique solution identifier for each reagent emulsified in droplets (eg, detection mix or amplified sample). The original 64 color code sets were created from the proportions of the three fluorescent dyes, the total concentration of the three dyes ([Dye 1] + [Dye 2] + [Dye 3]) was constant, the entire field of view or the chip. Served as an internal control to normalize lighting changes at the various locations above (PNAS # 1). As mentioned above, the total working concentration of the dyes in the 64 color code sets was 1-5 μM (PNAS # 1). The 1050 color codes (1) increase the total working concentration of the three fluorescent dyes to 20 μM so that the 210 color codes are faithfully identified in the three color spaces (FIGS. 24A and 24B), and (FIG. 24A and 24B). 2) Designed by adding a fourth fluorescent dye at one of five concentrations (0, 3, 7, 12, or 20 μM) to multiply the 210 code by a factor of 5 (FIG. 24A). In this design, each of the four dye intensities is normalized to the sum of the first three fluorescent dyes.

Color Code Construction: A standard 64 color code set (50 μM stock solution concentration; 1-5 μM working concentration) was constructed as described above (PNAS # 1). The 210 color code (400 μM stock solution concentration; 20 μM working concentration) was constructed using a similar method as follows. Alexa Fluor 647 (AF647), Alexa Fluor 594 (AF594), Alexa Fluor 555 (AF555), and Alexa Fluor 405 NHS Ester (AF405-NHS) (Thermo Fisher) were diluted 25 mM in DMSO (Sigma). Since the molar masses of these dyes are unique, the following approximate masses provided by the manufacturer were used in the calculations. AF647: 1135 g / mol; AF594: 1026 g / mol; AF555: 1135 g / mol; AF405-NHS: 1028 g / mol. The dye stock in DMSO was further diluted to 400 μm with DNase / RNase-free water (Life Technologies). The Alexa Fluor 405 NHS ester was incubated for 1 hour at room temperature to allow hydrolysis of the NHS ester to produce Alexa Fluor 405 (AF405). A custom MATLAB script was used to calculate the amount of dye to combine to evenly distribute the 210 color codes across the three color spaces (Table 10b). A combination of three color dyes (made from AF647, AF594, and AF555) was constructed in a 96-well plate (Eppendall) using a Janus Mini liquid handler (PerkinElmer). To construct the 1050 color code, AF405 was manually diluted to 5 concentrations (0, 60, 140, 240, and 400 μm) and each concentration was aligned across the 96-well plate. Each of the 210 color codes (10 μL) and AF405 (10 μL) were combined and mixed in a new 96-well plate using Bravo (supplier). The total final stock solution concentration of AF647, AF594 and AF555 was 200 μM. The final concentrations of AF405 were 0, 30, 70, 120, and 200 μM. The stock was used diluted 1:10 into an amplified sample or detection mix.

Characteristic evaluation of 1050 color code sets: Each color code is diluted 1:10 with LB broth (a medium that produces droplets of similar size to droplets made from PCR products and detection reagents) of the three dyes. The final total concentration was 20 μM. Section II. D. Each solution was emulsified into droplets as described in. The fidelity of the color code strategy was measured as previously described [PNAS # 1].

Tables 10a to 10b In Tables 10a and 10b, each line represents a color code. Each column shows one volume (μm) of the three dyes. The total capacity of each cord is 50 μL.

Characteristic in 3 color spaces: The fidelity of the color code strategy in 3 color spaces was measured as previously described ⁸ . Each color code in the three-color space was assigned to one of the three chips. Allocations were made to maximize the separation between the color codes on any chip, and each chip received 1/3 of the color codes (70 total) (FIGS. 38B and 38C). Droplets from the color code assigned to chip 1 (70 3 color code x 5 UV concentration = 350 droplet emulsion) were pooled and loaded onto a standard chip. Chip 2 and chip 3 were also produced in the same manner. The chips were imaged (note that the merge was not performed in the color code characterization experiment) and each droplet was computer-assigned to the color code cluster. The experimental results of chips 1, 2, and 3 served as a "ground truth" assignment. The data from chips 1, 2, and 3 are then computer-combined to effectively increase the density of the color code clusters in the three color spaces, causing droplets to reappear in the dense color code clusters in the three color spaces. Assigned (FIGS. 38B and 38C). Finally, a slide distance filter was applied to remove droplets at the edges of the clusters or between clusters and reassign the droplets to the color coded clusters (FIGS. 38B and 38F). The slide distance filter points to the radius around the center of gravity of each cluster used to remove droplets falling into the space between the clusters (Fig. 38F). The radius may be larger (because it contains more droplets) or smaller (because the droplets are more strictly filtered). The new assignment was compared to the "ground truth" assignment to measure the percentage of droplets that would be misclassified if the color code was not separated by the three chips (FIGS. 38C and 38D). In the work shown here, the radius of the slide distance filter is set to achieve at least 99.5% correct classification in the test dataset, which corresponds to the removal of 6% of the droplets.

Characterization along the 4th color dimension: 5 concentrations of the 4th fluorescent dye were divided into two chips (chips 1: 0, 7, 20 μM; chips 2: 3, 12 μM) (FIG. 38E). .. Droplets from the dye intensity assigned to chip 1 (3 UV intensity x 210 color code = 620 emulsion) were pooled and loaded onto a standard chip. Chip 2 was prepared in a similar manner, but with a smaller number of pooled emulsions (2 UV intensity x 210 color code = 420 emulsions). The chips were imaged (note that the merge was not performed in the color code characterization experiment) and each droplet was computer-assigned to a UV intensity bin. The experimental results of chips 1 and 2 served as a "ground truth" assignment. The data from Chip 1 and Chip 2 are then combined by a computer to effectively increase the density of the UV intensity bins along the fourth color dimension, causing droplets to appear in the UV intensity bins in this dense space. Reassigned (Fig. 38E). Finally, a slide distance filter was applied to remove the droplets at the ends of the intensity bins or between the intensity bins and reassign the droplets to the UV intensity bins (FIG. 38E). The new assignment was compared to the "ground truth" assignment and the percentage of droplets misclassified when the UV intensity was not separated by the three chips was measured (FIG. 38E). Filtering in the 4th color dimension was not applied to the experimental data because the classification in the 4th color dimension is high enough (> 99.5% accuracy) without filtering.

Microwell Array Statistics: The number of tests that can be performed on a single chip depends on the number of productive drop pairs per chip and the number of iterations per test required to make an accurate call.

First, factors that influence the number of productive droplet pairs per chip are considered: a standard chip microwell array contains approximately 42,000 microwells. Empirical observations show that the loading efficiency is about 70% and an additional about 10% of the microwells are lost by color code filtering (see below). Finally, probabilistic droplet pairing produces a highly productive droplet pair of about 50% (one droplet containing the amplified sample and one droplet containing the detection mix). Overall, about 10,000 to 14,000 droplet pairs produce useful data on a chip-by-chip basis. The mChip microwell array contains about 177,000 microwells, resulting in about 65,000 useful droplet pairs per chip.

Next, factors that influence the number of iterations per test required to make an accurate call chip are considered. The majority of positive detection reactions have high signals above background, little variability between replications, and very good color code classification (after filtering accuracy> 99.5%, FIG. 38A. See ~ 38G). This suggests that the number of iterations required per test may be very low. Bootstrap analysis was performed on CARMEN-Cas13 deer detection data as an experimental measure of the number of iterations required to correctly identify signals above the background (FIGS. 22A-22E and materials and methods). This revealed that> 99.9% of the bootstrap samples correctly call the signal above the background at least 3 iterations.

Note that the number of iterations required to make an accurate call depends on the type of application. For nucleic acid detection, which is a near-binary read, three iterations are sufficient. However, bootstrap analysis suggests that 10-15 iterations are required for SNP identification that depends on distinguishing the relative kinetics of the two crRNAs from a particular target (data not shown). .. In addition, for quantitative applications, many iterations may be required to obtain results within the desired acceptable range of ground truth values (eg, 5%).

Finally, a method of calculating the number of tests that can be performed on one chip will be described using the values determined above. The pairing of droplets in a microwell array is stochastic. Therefore, the distribution of iterations per test is Poisson. The user can set the average number of iterations per test (the average of the Poisson distribution) up or down to control the probability of test dropout due to undersampling. For example, using an average of 12 iterations per test, the probability that any test will be uninterpretable due to a lack of iterations (less than 3) is once in 2,000. For a standard chip (a pair of droplets with a productivity of about 12,000), an average of 12 iterations per test allows 1,000 tests per chip, with a dropout rate well below 1. (1 / 2,000). For an mChip that produces approximately 65,000 droplet pairs, 5,000 tests per chip will result in an average of 14 iterations per test with a 10,000 minute dropout probability. It is reduced to 1 (less than 1 per chip). In situations where it is essential to provide the results of all trials, such as clinical diagnosis, further increase the average repeat level to ensure higher sampling of all trials, and the dropout rate due to undersampling is negligible. It can be made as low as possible.

Control of solute exchange between droplets during pooling: The rate theory of small molecule exchange in the droplet microwell platform has been previously described ⁸ . Small molecules may be split into detergent micelles and exchanged between droplets during a pooling step that lasts less than 10 minutes. The exchange of fluorescent dyes during pooling is negligible and does not ^impair color code classification8. When the droplets are loaded into the microwell array, the parylene-coated wall of the PDMS microwell prevents further replacement ⁸ . Fortunately, the diffusion of larger hydrophilic or charged molecules has not been predicted or observed that the detergent-dependent mechanism by which small molecules emerge from the droplets allows the escape of proteins or nucleic acids. Therefore, it does not matter in this system. In fact, commercially available systems for ultrasensitive nucleic acid detection based on similar oils, detergents, and buffers (such as digital droplet PCR) are well established.

Design of Experiment Flexibility: The number of tests on the chip is the product of the number of samples and the number of detected mixes and can be determined according to the needs of the user (eg, 10 samples x 100 detection mixes or 100 samples x 10 detection mixes). In particular, CARMEN is effective when the test matrix is approximately square, that is, when both the number of samples and the number of detected mixes are high (eg> 10). Traditionally, performing such experiments is complicated and time consuming to handle liquids (either manually or robotically), costly to consume reagents (see cost analysis below), and limit test samples. May be done. CARMEN uses miniaturization and self-organization of droplets to avoid these problems (see text). For uses where only high sample throughput is required (many samples x 1 detection mix), CARMEN can dramatically reduce costs (see below), but the experimental setup is linear (sample x 1). Therefore, the multi-channel pipette is also time efficient. For uses that require only multiple detections (1 sample x multiple detection mixes), users can consider metagenomic sequencing if the application is sufficiently sensitive, but require exquisite sensitivity and extensive multiplex. In some cases CARMEN can be ideal.

Color code analysis: Color code classification is robust (FIGS. 38A-38G). After creating and characterizing a series of color codes, the codes are used outside the refrigerator in each experiment without additional calibration. Normalizing each color code to the sum of the three fluorescent dyes that make up the three color spaces (Alexa Fluor 647, 594, and 555) makes the system robust to fluorescent imaging artifacts and facilitates individual color code clusters. Is displayed in. Each cluster represents a set of droplets with known contents (eg, droplets from detection mix 4). By introducing the maximum distance threshold (ie, distance threshold, see Materials and Methods) that the color code of a droplet can be from the center of its color code cluster, an uncertain point in the color space is created. Excluded. In rare cases where one colorcode cluster begins to overlap with another, only two conflicting clusters are affected (there is a loss of replication, but in most cases it can be resolved) and the rest of the colorcodes are affected. Do not receive. Such conflicting color codes can be excluded from future experiments without adversely affecting the entire set, and the user does not have to recreate the entire color code set.

False Negatives and False Positives Due to Color Code Misclassification: Test results can change if test duplication is sufficiently misclassified. The fluorescence value of the test is the median of all replicas. In order for the median positive test to drop to the background (ie, false negative), the majority of replicas are misclassified droplet pairs (dark droplet pairs) with no signal above the background. ) Must be. Due to the sparse detection matrix, misclassified droplet pairs are more likely to be dark droplet pairs (99% in human-related virus panel tests). This dramatically increases the probability of false negatives compared to false positives. In the case of false negatives, assuming a droplet misclassification rate of 0.005 (see below and FIGS. 38A-38G), the probability of a droplet misclassification is 0.01. The probability that most duplicates will be misclassified in 5 iterations is 0.01 x 0.01 x 0.01 x (5 chooses 3) = 1 in 100,000. Increasing the number of iterations to seven will improve the probability to less than one in two million. Therefore, in situations where it is important to ensure accurate calls, such as in clinical diagnosis, the number of iterations can be increased to dramatically reduce the chance of false calls in the test due to droplet misclassification.

Cost and sample consumption analysis: The main advantage of CARMEN-Cas13 is that the Cas13 detection reaction can be miniaturized to reduce reagent and sample consumption per test. Reagent and consumable costs when testing dozens of samples against hundreds of targets using conventional high volume (tens of microliters) assays such as SHERLOCK, DETECTR, qPCR, ELISA, and LAMP. Is dominant. Therefore, Applicants sought to quantify the cost advantages offered by CARMEN over these methods when testing many samples against many targets.

To analyze the costs associated with CARMEN-Cas13, Applicants first considered the costs of the detection reagents only, and then the additional costs (plastic containing array, droplet formation, and color code). CARMEN-Cas13 typically reduces the detection volume by more than 400 times in a single test (from 92 microliters for 4 repeats of the standard 20 ul detection reaction to an average of 10 repeat droplet pairs. Less than 0.2 microliters when performing the CARMEN-Cas13 test). This resulted in a cost savings of over 300x compared to SHERLOCK due to the applicant's use of a 4x higher concentration fluorescent cleavage reporter in CARMEN-cas13 (see Table 11). Considering the additional fixing cost per chip and the cost of color coding and emulsification of the sample, the cost per test of CARMEN-Cas13 is more than 100 times cheaper than the equivalent SHERLOCK test (see Table 11).

The equipment cost of CARMEN is high, but not dramatically higher than other multiplex methods for nucleic acid detection and may be improved in the future. Like many other methods using fluorescence readout (qPCR, FISH), CARMEN-Cas13 needs to detect fluorescence in 4-5 channels with high sensitivity. CARMEN-Cas13 also requires some automatic imaging capabilities to facilitate data acquisition from the microwell array. The cost of a multimode plate reader or qPCR device is about $ 30,000, while the cost of a microscope suitable for CARMEN is about $ 50,000 (additional cost due to CARMEN imaging requirements). Both of these are much cheaper than the Illumina sequencing machines commonly used for high-throughput metagenomic sequencing (eg, HiSeq, NextSeq, NovaSeq).

CARMEN requires a device for droplet generation in addition to a device for fluorescent reading. A Bio-Rad QX200 ($ 31,000) commercial machine can be used for droplet generation, but the equipment required for droplet generation can be significantly reduced by using a custom made pressure manifold, which is a pressure manifold. It costs about $ 2,000 to manufacture. Therefore, the droplet generation hardware is a minor component of the overall cost of CARMEN technology.

Although it is difficult to quantify labor costs, the labor costs required for CARMEN-cas13 are lower per test than for low-plex assays such as RT-qPCR, ELISA, and LAMP. For example, setting up, imaging, and analyzing individual mChips takes about 8 man-hours, but about 5,000 tests per chip correspond to more than 50 complete 384-well plates (3-4 per test). Technical iterations (the number required to achieve statistical power in a plate-based assay). Therefore, the time required for each complete 384-well plate equal amount is less than 10 servings, and it takes at least 1 hour for the applicant to set up one complete 384-well plate from thawing of the reagent. It begins and ends at the beginning of the assay. In addition, the CARMEN-Cas13 protocol is simpler than new generation sequencing library preparation and requires fewer steps and less time to complete.

It should be noted that it is important to consider the scale of the experiment when comparing the cost of performing CARMEN-Cas13 with other assays. In particular, much of the associated cost is linearly proportional to the number of chips, or the sum of the number of amplified samples and the number of Cas13 detection mixes. Therefore, a less preferred use case for CARMEN-cas13 is to test hundreds of potential viruses in a single sample. Due to the fixed cost, the cost savings are smaller than when the same experiment is performed on a standard microtiter plate. The marginal cost of adding a new sample to a particular chip is only a few dollars, so testing multiple samples at the same time can significantly reduce the cost. The combinatorial nature of CARMEN further reduces the cost of testing many samples for the presence of many targets. Note that with the low reagent cost per test limitation, sample processing is likely to dominate the total cost because sample cost is proportional to the number of samples rather than the number of tests performed. Therefore, in order to enable sample testing with even higher throughput than CARMEN-Cas13, it is necessary to significantly reduce the costs and labor associated with sample collection and processing.

Finally, to perform tens or hundreds of SHERLOCK, DETECTR, qPCR, ELISA, or LAMP assays on a patient's sample, a very large sample (tens of milliliters of blood, saliva, or urine) is needed. Required and this is often not available. For CARMEN, the extracted RNA is used up to 2 microliters per PCR pool, with a total of up to 30 microliters used in 15 PCR pools of the human-related virus panel. This requires a total sample input of hundreds of microliters of body fluid (depending on the type of extraction kit used). That is, despite the significant increase in the number of tests performed on each sample, CARMEN's overall sample input requirements are not significantly different from other methods. Therefore, in addition to reducing reagent costs, CARMEN-Cas13 reduces sample consumption, allowing more tests to be performed and reducing sample acquisition and processing costs.

Choosing the Optimal crRNA for Human-Related Virus Panel Testing: Due to the high cost of synthesizing hundreds of synthetic DNAs and RNA oligonucleotides, Applicants did not experimentally test the entire human-related virus panel design. Since the majority (143) species required a single crRNA to cover 90% of the known sequences (FIGS. 39A-39G), Applicants decided to test a single crRNA for each variety. did. If there were multiple crRNAs in the set, the crRNA with the sequence that most closely matched the majority of the consensus sequences of that species was selected. Based on the results of using the crRNA set for subtyping influenza A (FIGS. 42A-42C), the complete crRNA set can be used to completely cover 90% of the various known sequences as designed. Applicant barcodes and multiplexing schemes can accommodate this, with moderately reduced sample throughput due to the increased number of detection mixes.

Cross-contamination: A real concern when testing large-scale multiplexed virus detection panels is cross-contamination, especially before emulsification. The very high sensitivity of the CARMEN-Cas13 system means that even trace cross-contamination can lead to widespread false positive results. No widespread cross-reactivity was observed in the applicant's study, but there were some examples of cross-reactivity between crRNA and unexpected synthetic targets. All examples of cross-reactivity were investigated by aligning crRNA with synthetic target sequences. Based on this analysis, a small number (4-5) of these examples are likely to be sequence-mediated and have been modified in the version 2 redesign. The remaining examples of cross-reactivity may be due to cross-contamination for the following reasons:
1. 1. Most of the sequence-mediated cross-reactivity occurs between adjacent wells, suggesting that cross-contamination may be the cause during dilution of synthetic targets or during setup of amplification reactions.
2. 2. Cross-reactivity can be due to cross-contamination that occurs during DNA or RNA synthesis. Oligonucleotides from the human-related viral panel were synthesized commercially in parallel on 96-well plates. Co-synthetic oligonucleotides used as bar code adapters for next-generation sequencing have been observed to have ^infrequent cross-contamination37.

Sequence coverage: In addition to cross-reactivity, sequence coverage is an important aspect of design. The human-related virus panel is designed to cover at least 90% of various known sequences, but the actual coverage may be higher or lower for the following reasons:
1. 1. The crRNA and primers are designed to cover at least 90% of the various known sequences in the panel, but may be able to detect 5-10% of known sequences that are not considered to be covered by the design. There is also.
2. 2. Applicants have set a tight threshold of 1 mismatch between crRNA and its targets. Depending on the location of the mismatch, there may still be significant cleavage activity, and the shortened spacers may be very active for nucleic acid detection ⁷ .
3. 3. For some species, there is not enough sequence data to design an accurate diagnosis. Therefore, Applicants limited the panel to species with 10 or more available genomic sequences.

Similar considerations apply to the influenza subtyping panel.

Finally, sequence coverage and analytical sensitivity are different, but are related considerations that contribute to assay sensitivity. A particular crRNA targets a particular sequence in the genome with a particular analytical sensitivity (the ability to detect that sequence across the background). To increase the sensitivity of the assay, users can add additional crRNAs to detect additional fragments of pathogen nucleic acids (increasing sequence coverage) or improve the performance of individual crRNAs. Multiplexing crRNA to increase sequence coverage is particularly effective when the sample may carry only part of a known viral genome (due to degradation, mutation, etc.).

Testing unknown samples: In this study, Applicants used a single primer pool to test 169 known synthetic targets with a consensus sequence for each of the 169 species of human-related virus panels. , Each target amplified (based on design). For unknown samples, all 15 pools are used to amplify each sample and the pools are combined or run individually prior to detection. The following results are possible:
1. 1. It may be pleasing to observe selective identification by a single crRNA.
2. 2. If cross-reactivity is observed, the individual pools in which the cross-reactivity occurred can be rerun. In such cases, co-infection should not be assumed unless there is prior information suggesting the possibility of co-infection.
3. 3. To increase the reliability of the results, the weak reactivity may be explained by using a positive control or retesting the sample.
4. Positive results may not be observed for the following reasons: (1) Pathogen sequences may be in 5-10% of known sequences not covered by design, (2) virus titers may be too low to detect, or (3) samples may be degraded. There is.

The following references relate to Example 2.

1. 1. Bosch, I. et al. Rapid antigen tests for dengue virus serotypes and Zika virus in patient serum. Sci. Transl. Med. 9, (2017).

2. 2. Popowitch, E.I. B. , O'Neill, S.A. S. & Miller, M.M. B. Company of the Biofire
FilmArray RP, Genmark eSensor RVP, Luminex xTAG RVPvl, and Luminex xTAG RVP fast multiplex assay for reflection virus. J. Clin. Microbiol. 51, 1528-1533 (2013).

3. 3. Du, Y. et al. Coupling Sensitive Nucleic Acid Amplification with Commerce Pregnancy Test Strips. Angew. Chem. Int. Ed Engl. 56,992-996 (2017).

4. Wang, D. et al. Microarray-based detection and genotyping of viral pathogens. Proc. Natl. Acad. Sci. U. S. A. 99,15687-15692 (2002).

5. Holdcraft, C.I. J. , Beare, M. et al. A. & Brewer, J.M. Clinical and biological insights from viral genome sequencing. Nat. Rev. Microbiol. 15,183-192 (2017).

6. Palacios, G.M. et al. Panmicrobial oligonucleotide array for diagnostics of
infectious diseases. Emerg. Infect. Dis. 13, 73-81 (2007).

7. Gootenberg, J. Mol. S. et al. Nucleic acid detection with CRISPR-cas13a / C2c2. Science 356,438-442 (2017).

8. Kulesa, A. , Kehe, J.M. , Hurtado, J. et al. E. , Tawde, P.M. & Brainey, P.M. C. Combinatorial drug discovery in nanotiter drops. Proc. Natl. Acad. Sci. U. S. A. 115,6685-6690 (2018).

9. Cherry, D. et al. S. Next-generation diagnostics with CRISPR. Science 360,381-
382 (2018).

10. Kokak, D.I. D. & Gersbach, C.I. A. From CRISPR scissors to virus sensors. Nature 557,168-169 (2018).

11. US Food & Drug Assessment, www. fda. gov. Available at (Access date: November 1, 2018)

12. Brister, J.M. R. , Rodney Brister, J. Mol. , Ako-adjei, D.I. , Bao, Y. & Blinkova, O.D. NCBI Visual Genomes Resource. Nucleic Acids Res. 43, D571-D577 (2014).

13. Briese, T.M. et al. Virome Capture Sequencing Energy Sensitive Visual Diagnosis and Comprehensive Virome Analysis. MBio 6, e01491-15 (2015).

14. Allicock, O.D. M. et al. BacCapSeq: a Platform for Digital Infections and characterization of Bacterial Infections. MBio 9, (2018).

15. Chen, J. et al. S. et al. CRISPR-Cas12a target binding unleashes indisciminate single-stranded DNase activity. Science 360, 436-139 (2018).

16. Gootenberg, J. Mol. S. et al. Multiplexed and portable nucleic acid detection plateform with Cas13, Cas12a, and Csm6. Science 360, 439-444 (2018).

17. Myhrvolve, C.I. et al. Field-deployable viral dynamics using CRISPR-Cas13. Science 360, 444-448 (2018).

18. Macosko, E. et al. Z. et al. Highly Parallel Genome-wide Expression Profiling of
Individual Cells Using Nanoliter Droplets. Cell 161, 1202-1214 (2015).

19. Quake, S.A. Solving the Typitation of Pipetting. arXiv (2018).

20. Ismagilov, R.M. F. , Ng, J. et al. M. , Kenis, P. et al. J. & Whitesides, G.M. M. Microfluidic arrays of fluid-fluid diffusion contact as detection elements and combinatorial tools. Anal. Chem. 73,5207-5213 (2001).

21. Zahn, H. et al. et al. Scalable whole-genome single-cell library prepation without preamplifier. Nat. Methods 14, 167-173 (2017).

22. Hasshibi, A. et al. Multiplexed pathogens, quantification and genotyping of infectious agents using a semiconductor biochip. Nat. Biotechnol. 36,738-745 (2018).

23. Dunbar, S.M. A. Applications of Luminex xMAP technology for rapid, high-throughput multiplexed nucleoplexed detection. Clin. Chim. Acta 363,71-82 (2006).

24. Nguyen, H. et al. Q. et al. Programmable Microfluidic Synthesis of Over One Thousand United Ideal Ideal Codes. Adv Opti Mater 5, (2017).

25. Zhao, Y. et al. Microfluidic generation of multifunctional quantum dot barcode parameters. J. Am. Chem. Soc. 133, 8790-8793 (2011).

26. Dunbar, S.M. A. & Li, D. Integration to Luminex xMAP Technology and Applications for Biological Analysis in China. Asia Pacific Biotechnology News 14, 26-30 (2010).

27. Intergasser, A.I. et al. Primer3-new capabilities and interfaces. Nucleic Acids Res. 40, e! 15-ell5 (2012).

28. Bodaghi, S.A. et al. Cold human papillomaviruses be spread through blood blood? J. Clin. Microbiol. 43,5428-5434 (2005).

29. Moen, E. M. , Huang, L. et al. & Grinde, B. Molecular epidemiology of TTV-like mini virus in Norway. Arch. Vilol. 147,181-185 (2002).

30. Gupta, R.M. K. et al. HIV-1 drug response before regression or re-initiation of first-line antiretrovilal therapy in low-income and middle-income feedback. Lancet Infect. Dis. 18,346-355 (2018).

31. Wensing, A. M. et al. 2017 Update of the Drug Resistance Mutations in HIV-1. Top. Antivirus. Med. 24,132-133 (2017).

32. K. Katoh, D. M. Standard, MAFFT multiple sequence alignment software version 7: improvements in performance and usability. Mol. Biol. Evol. 30,772-780 (2013).

33. H. Li, Aligning sequence leads, clone sequences and assembly contigs with BWA-MEM (2013), (http://arxiv.org/abs/1303.3997).

34. J. Quick et al. , Multiplex PCR method for Minion and Illumina sequencing of Zika and other viruses genomes directy from circular singles. Nat. Protocol. 12,1261-1276 (2017).

35. S. -Y. Rhee et al. , Human immunodeficiency virus reverse transcriptase and
Protease sequence database. Nucleic Acids Res. 31,298-303 (2003).

36. J. Kehe et al. , Massive parallel screening of synchronous microbial communities. PNAS. In Press.

37. M. A. Quail et al. , SASI-Seq: single assurance Spike-Ins, and highly differentialening 384 barcoding for Illumina sequencing. BMC Genomics. 15 (2014), doi: 10.1186 / 1471-2164-15-110.

Example 3: Region-Specific Detection Panel In this project, a diagnostic panel for virus species and strains prevalent in Honduras will be developed. In parallel, Applicants, in collaboration with the National Autonomous University of Honduras (UNAH), have an existing Cas13-based assay for Zika virus detection and dengue serotyping to test patient samples. Expand. Hardware is deployed for multiplexed Cas13-based diagnostics at UNAH and trains collaborators to use this technique. Upon successful completion of these objectives, a multiplexed CRISPR-based detection technique for disease surveillance in countries where many endemic viruses are present will be created and validated. This study is important to the world to improve patient care and contribute to public health efforts by providing a rich data set on the spread of the virus, with all infected individuals admitted to the hospital undergoing molecular diagnostics. It will be the first step.

The first goal is to develop a Cas-13-based virus diagnostic panel for use in Honduras. Utilization of previous Cas13-based virus diagnostics (Myhrwald ^* , Freeje ^* , et al. Science 2018) and utilization of highly multiplexed microwell arrays to miniaturize biochemical assays on nanoliter droplets (Myhrvolve *, Freeje *, et al. Science 2018) Kulesa ^* , Kehe ^* et al. PNAS 2018) provides multiplexed amplification with multiplexed detection using droplets in a microwell array.

Applicants design, implement, and validate a diagnostic panel consisting of multiplexed amplification primers and crRNA that target a set of 20-30 viral pathogens known to be endemic in Honduras. This panel contains some high-risk viral pathogens that have not been previously discovered in Honduras but, if detected, could have a significant impact on public health. Although the cost and time of developing such large-scale assays was exorbitant last year, microwell array technology allows large-scale development and execution of Cas13 detection assays. This panel is believed to be the first comprehensive country-specific virus diagnostic panel. The goal is to develop a multiplexing panel that covers at least 20 viruses of interest, with a detection limit of 100 copies per microliter for each assay, no detectable cross-reactivity, and microliters of virus in patient samples. Myhrwald ^* , Freeje ^* , et al. Can be detected at a low concentration of 1 copy per copy. Achieve sensitivity comparable to the methods described in Science 2018. For a second purpose, Applicants deploy Cas13-based detection techniques in Honduras, including a comprehensive multiplexed virus panel. Early experiments will focus on deploying a standard SHERLOCK assay in Honduras, allowing the underlying Cas13 technology to detect prevalent Zika and dengue viruses with high sensitivity (1-8 months). Eye). For multiplexed panels, the plan is to first test the assays on Broad (1-8 months) and then bring them to Honduras (9-12 months) for the epidemiological season (usually starting in February). Capture the beginning of. The assembly of the hardware setup is performed broadly at 5-8 months to allow the applicant to have a system with the same sensitivity and specificity as existing microscope hardware.

A second objective would benefit from existing efforts to develop Cas13-based viral diagnostics for Honduras' Zika and Dengue fever. Pilot research is underway. Achieving this goal will enable extensive demonstration of conventional and multiplexed CRISPR-based diagnostics in Honduras and lead the use of CRISPR-based diagnostics for virus monitoring worldwide. ..

Potential design challenges include virus-specific sensitivity variations and cross-reactivity between virus species, but with the methods disclosed herein utilizing microwell arrays, only one day or One cycle of assay testing can be performed in two days, allowing rapid optimization of the assay during this project. Analysis of dozens of samples (50-100) is expected to detect under-researched viruses using diagnostic panels. However, the extent to which under-researched viruses are observed remains an unresolved research topic. Advantageously, the approach disclosed herein develops and uses droplets in a microwell array, and a four-color fluorescence microscope with an automatic stage is broadly assembled, tested, and in Honduras. Be expanded. This method allows the use of a No Frills microscope that provides the fluorescence sensitivity and spatial resolution required for imaging droplets in a microwell array, thus maximizing hardware robustness while reducing costs.
^***

Various modifications and variations of the methods, pharmaceutical compositions, and kits described in the present invention will be apparent to those skilled in the art without departing from the scope and gist of the present invention. Although the invention has been described in the context of particular embodiments, it is understood that further modifications are possible and that the claimed invention should not be overly limited to such particular embodiments. Will be. In fact, the various modifications of the described modes for carrying out the invention, which are apparent to those of skill in the art, are intended to be within the scope of the invention. This application is generally within the bounds of known practice in the art to which the invention belongs, in accordance with the principles of the invention, as such from the present disclosure as applicable to the essential features described above. It is intended to embrace any modification, use, or adaptation of the invention, including deviations.

Claims (62)

A method for detecting target molecules
The first set and the second set of droplets are combined into a droplet pool, wherein the first set of droplets is designed to bind to the Cas protein, the corresponding target molecule. The first set and the second set include a detection CRISPR system comprising one or more guide molecules, a masking construct, and an optical bar code, wherein the second set of droplets comprises a sample and optionally an optical bar code. To make a droplet pool by combining the droplets of the set of
The droplet pool is flown onto a microfluidic device comprising an array of microwells and at least one flow channel beneath the microwells, the size of which the microwells capture at least two droplets. , The above-mentioned flow and
To detect the optical barcode of the droplet captured in each microwell,
By merging the droplets captured in each microwell to form a merged droplet in each microwell, at least a subset of the merged droplets comprises the detection CRISPR system and the target sequence. By merging the droplets captured by the microwells to form a merged droplet at each microwell,
To start the detection reaction and
Measuring the detectable signal of each merged droplet continuously, optionally, at one or more time intervals.
The method described above. The method of claim 1, further comprising the step of amplifying the target molecule. The amplification includes nucleic acid sequence-based amplification (NASBA), recombinase polymerase amplification (RPA), loop-mediated isothermal amplification (LAMP), chain substitution amplification (SDA), helicase-dependent amplification (HDA), and nicking enzyme amplification reaction (NEAR). ), PCR, Multiple Substitution Amplification (MDA), Rolling Circle Amplification (RCA), Ligase Chain Reaction (LCR), or Branch Amplification Method (RAM). The method of claim 2, wherein the amplification is performed by RPA or PCR. The method of claim 1, wherein the target molecule is included in a biological sample or an environmental sample. The method of claim 5, wherein the sample is of human origin. The biological sample is blood, plasma, serum, urine, stool, sputum, mucus, lymph, synovial fluid, bile, ascites, pleural effusion, serous tumor, saliva, cerebrospinal fluid, tufted or vitreous fluid, or any body fluid. 5. The method of claim 5, wherein the fluid is a secretion, serum, exudate, or fluid obtained from a joint, or a swab on the surface of the skin or mucous membrane. The method of claim 1, wherein the one or more guides are RNA designed to bind to a corresponding target molecule, including a (synthetic) mismatch. The method of claim 8, wherein the mismatch is upstream or downstream of an SNP or other single nucleotide mutation in the target molecule. The method of claim 1, wherein the one or more guide RNAs are designed to detect single nucleotide polymorphisms in the target RNA or DNA, or splicing variants of RNA transcripts. 10. The method of claim 10, wherein the one or more guide RNAs are designed to detect drug resistant SNPs in viral infections. The method of claim 1, wherein the one or more guide RNAs are designed to bind to one or more target molecules characteristic of the disease state. 12. The method of claim 12, wherein the disease state is characterized by the presence or absence of a drug resistance or susceptibility gene or transcript or polypeptide. The method of claim 1, wherein the one or more guide RNAs are designed to distinguish one or more microbial strains. 12. The method of claim 12, wherein the disease state is an infectious disease. 15. The method of claim 15, wherein the infection is caused by a virus, bacterium, fungus, protozoan, or parasite. 15. The method of claim 15, wherein the one or more guide RNAs comprises at least 90 guide RNAs. The method of claim 1, wherein the CRISPR protein is an RNA target protein, a DNA target protein, or a combination thereof. 18. The method of claim 18, wherein the RNA target protein comprises one or more HEPN domains. 19. The method of claim 19, wherein the one or more HEPN domains comprises an RxxxxxxH motif sequence. 20. The method of claim 20, wherein the RxxxH motif comprises an R {N / H / K] X ₁ X ₂ X ₃ H sequence. X ₁ is R, S, D, E, Q, N, G, or Y, X ₂ is independent, I, S, T, V, or L, and X ₃ is independent. 21. The method of claim 21, wherein L, F, N, Y, V, I, S, D, E, or A. The method of claim 1, wherein the CRISPR RNA target protein is C2c2. 18. The method of claim 18, wherein the CRISPR protein is a DNA target protein. 24. The method of claim 24, wherein the CRISPR protein comprises a RuvC-like domain. 24. The method of claim 24, wherein the DNA target protein is a V-type protein. 24. The method of claim 24, wherein the DNA target protein is Cas12. 25. The method of claim 25, wherein Cas12 is Cpf1, C2c3, C2c1, or a combination thereof. The method of claim 1, wherein the masking construct is RNA-based and suppresses the generation of detectable positive signals. 29. The RNA-based masking construct suppresses the generation of the detectable positive signal by masking the detectable positive signal or instead producing a detectable negative signal. Method. 29. Claim 29, wherein the RNA-based masking construct comprises silencing RNA that suppresses the production of the gene product encoded by the reporting construct, wherein the gene product produces the detectable positive signal upon expression. Method. 29. The RNA-based masking construct is a ribozyme that produces the negative detectable signal, and when the ribozyme is inactivated, the positive detectable signal is produced. the method of. 32. The method of claim 32, wherein the ribozyme converts the substrate to a first color and the substrate is converted to a second color when the ribozyme is inactivated. 29. The method of claim 29, wherein the RNA-based masking agent is an RNA aptamer and / or comprises an RNA mooring inhibitor. 34. The method of claim 34, wherein the aptamer or RNA mooring inhibitor sequesters the enzyme and acts on the substrate to generate a detectable signal when released from the aptamer or RNA mooring inhibitor. The aptamer is an inhibitory aptamer that inhibits the enzyme and prevents the enzyme from catalyzing the generation of a detectable signal from the substrate, or the RNA mooring inhibitor inhibits the enzyme and the enzyme is from the substrate. 34. The method of claim 34, which prevents catalyzing the production of a detectable signal. 36. The method of claim 36, wherein the enzyme is thrombin, protein C, neutrophil elastase, subtilisin, horseradish peroxidase, beta-galactosidase, or calf alkaline phosphatase. 37. The method of claim 37, wherein the enzyme is thrombin, the substrate being paranitroanilide covalently bound to the peptide substrate of thrombin, or 7-amino-4-methylcoumarin covalently bound to the peptide substrate of thrombin. 34. The method of claim 34, wherein the aptamer sequesters a pair of agents that bind when released from the aptamer to produce a detectable signal. 29. The method of claim 29, wherein the RNA-based masking construct comprises an RNA oligonucleotide to which a detectable ligand and masking component are attached. The solution is colored when the RNA-based masking construct contains nanoparticles aggregated and retained by cross-linking molecules, at least a portion of the cross-linking molecules contains RNA, and the nanoparticles are dispensed into the solution. 29. The method of claim 29, which receives a shift. 41. The method of claim 41, wherein the nanoparticles are colloidal metals. 42. The method of claim 42, wherein the colloidal metal is colloidal gold. 22. The method of claim 22, wherein the RNA-based masking construct comprises quantum dots linked to one or more quencher molecules by a linking molecule, wherein at least a portion of the linking molecule comprises RNA. 22. The method of claim 22, wherein the RNA-based masking construct comprises RNA compounded with an insert, wherein the insert changes the absorbance upon cleavage of the RNA. 45. The method of claim 45, wherein the insert is pyronin-Y or methylene blue. 22. The method of claim 22, wherein the detectable ligand is a fluorophore and the masking component is a quencher molecule. The method of claim 1, wherein detecting the optical barcode comprises performing an optical evaluation of the droplet in each microwell. 48. The method of claim 48, wherein performing the optical evaluation comprises capturing an image of each microwell. The method of claim 1, wherein the optical barcode comprises particles of a particular size, shape, index of refraction, color, or a combination thereof. 50. The method of claim 50, wherein the particles include colloidal metal particles, nanoshells, nanotubes, nanorods, quantum dots, hydrogel particles, liposomes, dendrimers, or metal-liposomal particles. 48. The method of claim 48, wherein the optical barcode is detected using light microscopy, fluorescence microscopy, Raman spectroscopy, or a combination thereof. The method of claim 1, wherein each optical barcode comprises one or more fluorescent dyes. 53. The method of claim 53, wherein each optical barcode comprises a different proportion of fluorescent dye. The method of claim 1, wherein the detectable signal is a level of fluorescence. The method of claim 1, further comprising the step of applying a set cover resolution process. The method of claim 1, wherein the microfluidic device comprises an array of at least 40,000 microwells. 57. The method of claim 57, wherein the microfluidic device comprises an array of at least 190,000 microwells. It is a multiple detection system
A detection CRISPR system that includes a Cas protein, one or more guide RNAs designed to bind to the corresponding target molecule, RNA-based masking constructs, and optical barcodes.
Optical barcodes of one or more target molecules of choice,
A microfluidic device comprising an array of microwells and at least one flow channel beneath the microwells, the size of which the microwells are sized to capture at least two droplets.
The multiple detection system including. A kit comprising the multiplex detection system of claim 59. The method of any of claims 1-58, wherein the second set of droplets comprises an optical barcode. 59. The multiplex detection system of claim 59, comprising an optical barcode of one or more target molecules.

Images