CN114540547A - Amplification-free nucleic acid detection method and application thereof - Google Patents
Amplification-free nucleic acid detection method and application thereof Download PDFInfo
- Publication number
- CN114540547A CN114540547A CN202210180046.0A CN202210180046A CN114540547A CN 114540547 A CN114540547 A CN 114540547A CN 202210180046 A CN202210180046 A CN 202210180046A CN 114540547 A CN114540547 A CN 114540547A
- Authority
- CN
- China
- Prior art keywords
- nucleic acid
- reaction
- detection method
- crispr
- detected
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/70—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving virus or bacteriophage
- C12Q1/701—Specific hybridization probes
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6813—Hybridisation assays
- C12Q1/6834—Enzymatic or biochemical coupling of nucleic acids to a solid phase
- C12Q1/6837—Enzymatic or biochemical coupling of nucleic acids to a solid phase using probe arrays or probe chips
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
- Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
- Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change
Abstract
The invention belongs to the field of nucleic acid detection, and discloses an amplification-free nucleic acid detection method and application thereof. The nucleic acid detection method of the present invention comprises: capturing the nucleic acid to be detected by using a capture probe to form a capture probe-nucleic acid to be detected compound; mixing the capture probe-nucleic acid compound to be detected with a CRISPR reaction system to form a reaction solution, and introducing the reaction solution into micropores of a microfluidic chip for reaction; the resulting fluorescence was observed microscopically to confirm the nucleic acid detection results. The nucleic acid detection method developed by combining the CRISPR technology and the microfluidic technology can realize single molecule detection of nucleic acid without nucleic acid amplification, is simple, convenient and quick, cannot cause aerosol pollution caused by nucleic acid amplification, has high sensitivity, can detect nucleic acid molecules at an attomole level, and greatly expands the application range.
Description
Technical Field
The invention belongs to the field of nucleic acid detection, and particularly relates to an amplification-free nucleic acid detection method and application thereof.
Background
The novel coronavirus pneumonia is a respiratory infectious disease mainly caused by infection of the novel coronavirus. The early diagnosis and early isolation of patients with the novel coronavirus pneumonia are the key points for preventing and controlling the diseases at present, wherein the nucleic acid detection is the gold standard for the novel coronavirus detection. The current methods for detecting RNA virus nucleic acid comprise reverse transcription PCR (RT-PCR), reverse transcription-loop mediated isothermal amplification (RT-LAMP), reverse transcription-recombinase polymerase amplification (RT-RPA) and the like, but the technologies have certain defects, such as reverse transcription and nucleic acid amplification, complex detection process, long time and aerosol pollution caused by nucleic acid amplification. Recombinase polymerase amplification-CRISPR (RPA-CRISPR) is a technology that has attracted much attention in recent years, and is first used for gene editing and then used for nucleic acid detection, and the detection principle is that a target is complementary to CRISPR RNA (crRNA), so that cis-cleavage and non-specific trans-cleavage of Cas protein are initiated, and probe nucleic acid can be cleaved to generate a fluorescent signal. Many reports combine CRISPR/Cas technology with nucleic acid amplification to achieve ultrasensitive detection of nucleic acid molecules, however, these CRISPR-based detections rely mostly on nucleic acid amplification to further amplify the detected signal and improve the detection sensitivity.
In recent years, researchers have developed some amplification-free nucleic acid detection techniques, but the sensitivity is usually only 1 to 100 femtomoles (fM), which is far from the requirement of clinical early diagnosis (1 to 10 attomoles (aM)). Researchers directly use the Cas13a nuclease to detect the novel coronavirus, and find that the sensitivity reaches 100 copies/microliter (approximately equal to 200aM), and is improved by nearly 100 times compared with other amplification-free nucleic acid detection technologies, so that the super-strong signal amplification capacity of the CRISPR/Cas13a system is mainly benefited, and the CRISPR/Cas system has amplification-free nucleic acid detection potential. However, the detection system still reacts in a conventional test tube, that is, the whole reaction system is placed in a test tube, and the fluorescence signal in the reaction system is severely diluted, so that the concentration of the cut fluorescence molecules is reduced, and the fluorescence signals can be detected only when a large amount of fluorescence products exist. And researchers detect RNA and DNA by using the micro-droplet digital CRISPR, but the sample loading amount is very small based on the droplet method, the possibility of omission exists, and meanwhile, the size of the droplet is larger, about 20 micrometers, and the fluorescence signal of a single droplet can be detected only after a long reaction time. Therefore, it is very important to provide a method for detecting nucleic acid which can improve the detection sensitivity without amplification.
Disclosure of Invention
The present invention is directed to solving at least one of the problems of the prior art described above. Therefore, the invention provides an amplification-free nucleic acid detection method, which realizes digital CRISPR detection by using a micron-scale microarray chip, does not need nucleic acid amplification before CRISPR detection, is simple, convenient and quick, has high sensitivity, can detect nucleic acid molecules as low as 1aM, and can meet the requirement of clinical early diagnosis.
The invention also provides application of the detection method.
According to one aspect of the present invention, an amplification-free nucleic acid detection method is provided, which comprises the following steps:
s1: capturing the nucleic acid to be detected by using a capture probe to form a capture probe-nucleic acid to be detected compound;
s2: mixing the capture probe-nucleic acid compound to be detected with a CRISPR reaction system to form a reaction solution, and introducing the reaction solution into micropores of a microfluidic chip for reaction;
the CRISPR reaction system comprises a Cas protein, CRISPR RNA and a report probe;
the volume of the micropore of the microfluidic chip is 30-100 fL;
s3: the fluorescence generated by the reporter probe in step S2 is observed microscopically to determine the result of nucleic acid detection.
According to a preferred embodiment of the present invention, at least the following advantages are provided:
1. the micro-pore volume of the micro-array chip is very small, only 1% of the micro-liquid drop volume, the reaction volume of each micro-pore is in the femtoliter level, and is 10 hundred million times smaller than the traditional reaction volume, so that although only one molecule exists in the micro-pore, a large amount of fluorescence recognized and cut by the CRISPR reaction system is limited in one micro-pore, the sensitivity is effectively improved, and simultaneously, the background noise can be exponentially reduced, and the diffusion and dilution of fluorescence signals can be exponentially reduced by 10 hundred million times.
2. The nucleic acid detection method developed by combining the CRISPR technology and the digital microfluidic technology can realize single-molecule detection of nucleic acid without nucleic acid amplification, is simple, convenient and quick, cannot cause aerosol pollution caused by nucleic acid amplification, and greatly expands the application range; in addition, in the prior art, after the nucleic acid to be detected and the CRISPR reaction solution are mixed, the reaction solution is directly placed on a glass slide or in a 96-well plate for microscopic observation, the specificity of the method is extremely poor, and the micro-fluidic chip is combined with the micro-fluidic chip, so that each micro-pore of the chip can be ensured to only contain one molecule, namely, the specificity is strong, and the single molecule detection result is more accurate.
In some embodiments of the present invention, the capture probe in step S1 is bound to a magnetic bead, and the diameter of the magnetic bead is 2.6-3.5 μm.
In some embodiments of the present invention, the capture probe is modified with biotin, the magnetic bead is modified with streptavidin, and the binding of the biotin and the streptavidin modifies the capture probe on the magnetic bead by co-incubation.
In some embodiments of the invention, the Cas protein comprises at least one of Cas13a or Cas13 b.
In some preferred embodiments of the invention, the Cas protein comprises at least one of LwaCas13a (purified from Leptotrichia wadei bacteria), LbuCas13a (purified from Leptotrichia buccallis bacteria), CcaCas13b (purified from Capnocytophaga canimosus Cc5 bacteria), LbaCas13a (purified from Lachnospiraceae bacteria), PsmCas13b (purified from Prevotella sp.ma2016 bacteria), or PsmCas13a (purified from Prevotella sp.ma2016 bacteria).
In some embodiments of the invention, the Cas protein and the CRISPR RNA are combined to form a complex.
In some preferred embodiments of the present invention, the reporter probe is a fluorescent reporter probe, and both ends of the reporter probe are labeled with a fluorescent group and a quenching group.
The Cas protein has the cleavage activity of nuclease, when the CRISPR RNA recognizes the capture probe-nucleic acid to be detected complex, the CRISPR RNA and the nucleic acid to be detected are combined through base complementary pairing, cis-type cleavage and non-specific trans-type cleavage of the Cas protein are triggered at this time, the Cas protein performs non-specific trans-type cleavage on the report probe, and the fluorescent group on the report probe is cleaved into a free state, so that fluorescence is generated.
In some embodiments of the invention, the microfluidic chip in step S2 comprises 5 × 104～5×106And a micropore.
In some embodiments of the present invention, the microfluidic chip in step S2 includes 10-500 matrixes.
In some preferred embodiments of the present invention, the microfluidic chip comprises 100 matrices.
In some embodiments of the invention, each of the matrices comprises 5000 to 10000 microwells.
In some preferred embodiments of the invention, each of the matrices comprises 10000 microwells.
In some embodiments of the present invention, each of the micropores has a diameter of 3.5 to 5 μm and a height of 3.5 to 5 μm.
In some preferred embodiments of the present invention, each of the micropores has a diameter of 4.4 μm and a height of 3.5. mu.m.
In some embodiments of the invention, the reaction performed in step S2 is a CRISPR reaction, i.e. the Cas protein performs non-specific cleavage of the reporter probe, causing the fluorophore of the reporter probe to be cleaved into a free state, the free fluorophore generating the fluorescence.
In some embodiments of the present invention, in the CRISPR reaction, the reaction temperature is 32-39 ℃ and the reaction time is 14-16 min.
In some preferred embodiments of the invention, the reaction time of the CRISPR reaction is 15 min.
The reaction time is optimized in the test process, the fluorescence brightness is gradually enhanced along with the increase of the reaction time, the number of the positive micropores is increased, but the fluorescence intensity basically reaches saturation when the reaction is carried out for 15min, so that 15min is selected as the detection time which is identical with the result in a PCR tube, and the reaction reaches the plateau stage when the detection is carried out for about 15 min.
In some embodiments of the present invention, the method for introducing the reaction solution into the microfluidic chip in step S2 includes: and injecting the reaction liquid into the micropores of the microfluidic chip by using a micro-injection pump, and carrying out oil sealing on the microfluidic chip.
In some embodiments of the invention, the oil seal is selected from fluoro oil.
In some embodiments of the invention, the fluoro oil comprises at least one of HFE-7500 or FC-40.
In some embodiments of the invention, the method of microscopic observation described in step S3 includes: observing the fluorescence generated by the CRISPR reaction with a microscope.
In some embodiments of the invention, the microscope comprises at least one of an inverted fluorescence microscope, a confocal laser microscope.
According to a further aspect of the invention, the use of the nucleic acid detection method for rapid detection of nucleic acids for non-diagnostic purposes is proposed.
In some embodiments of the invention, the nucleic acid rapid test comprises a viral nucleic acid test in the food field or a viral nucleic acid test in the environment.
At present, the novel coronavirus is spread everywhere, and the novel coronavirus exists in food and environment, so that the virus nucleic acid can be detected by using the detection method disclosed by the invention before the food enters the market, or the virus nucleic acid in the environment can be detected on the inner wall of a container of a goods outer package and a transport vehicle, so that the safety of the food and the environment is ensured, and the food and the environment are put into the market.
Drawings
The invention is further described with reference to the following figures and examples, in which:
FIG. 1 is a schematic view of a reticle used in an embodiment of the invention;
FIG. 2 is a microimaging of a base plate of a microfluidic chip according to an embodiment of the present invention, where a scale is 200 μm, a scale is 100 μm, and a scale is 50 μm;
FIG. 3 is a schematic view of an upper cover of a microfluidic chip according to an embodiment of the present invention;
FIG. 4 is a flowchart of nucleic acid detection in an example of the present invention;
FIG. 5 is a fluorescent micrographs of influenza virus M gene of examples and comparative examples of the present invention (from the first to the last, examples 8, 7, 6, 5, 4, 3, 1, 2, 1, respectively);
FIG. 6 is a diagram showing the statistical analysis of the results of nucleic acid detection of 20 positive samples and 15 negative samples by the detection method and RT-PCR method according to the embodiment of the present invention.
Detailed Description
The following detailed description of embodiments of the invention is intended to be illustrative, but not limiting, of the invention.
In the description of the present invention, unless otherwise specifically limited, terms such as heating, incubation and the like should be broadly construed, and those skilled in the art can reasonably determine the specific meanings of the above terms in the present invention in consideration of the detailed contents of the technical solutions.
In the description of the present invention, reference to the description of "one embodiment," "some embodiments," or the like, means that a particular structure, material, or method described in connection with the embodiment is included in at least one embodiment of the invention. In this specification, the schematic representations of the terms used above do not necessarily refer to the same embodiment. Furthermore, the particular structures, materials, or methods described may be combined in any suitable manner in any one or more embodiments.
The test methods used in the examples are all conventional methods unless otherwise specified; the materials, reagents and the like used are commercially available reagents and materials unless otherwise specified.
Example 1
In this example, the influenza virus M gene at a concentration of 1aM was detected, and the specific process was:
(1) preparing a micro-fluidic chip: a. growing a layer of silicon nitride on the surface of a 4-inch silicon wafer by using a vapor deposition method, spin-coating photoresist SU8-2005 on the silicon nitride by using a spin coater, wherein the first-stage rotating speed is 500r/min, the acceleration is 100(r/min)/s, and the spin-coating is performed for 5-15 s; in the second stage, the rotating speed is 4000r/min, the acceleration is 500(r/min)/s, spin coating is carried out for 20-50 s, and the silicon wafer coated with the photoresist in a spin coating mode is placed on a hot plate at 95 ℃ and baked for 3 min;
b. loading a mask (as shown in figure 1, the mask is designed to comprise 100 matrixes, each matrix comprises 10000 small circles, the diameter of each small circle is 4.4 mu m, the circle center distance of each small circle is 10 mu m) and a silicon wafer with the temperature reduced to room temperature after baking by using a SUSS MA6 photoetching machine, carrying out ultraviolet exposure for 10-20 s, and placing the exposed silicon wafer on a hot plate with the temperature of 95 ℃ for baking for 2-5 min; soaking the silicon wafer which is baked and cooled to normal temperature in SU-8 developing solution for developing for 10-40 s, then washing with isopropanol, blow-drying with an air gun, and baking the blow-dried silicon wafer on a hot plate at 150 ℃ for 20-40 min;
c. evaporating a platinum layer as a catalyst, and processing a micropore structure with the depth of 3.5 mu m at the position of each small circle on the silicon wafer by an anisotropic metal-assisted chemical etching method; removing the catalyst, etching with an etching solution, and taking out and cleaning the silicon wafer after 8-12 min;
d. coating a Polydimethylsiloxane (PDMS) layer on the surface of a silicon chip, removing bubbles in a vacuum drying box, heating and curing, peeling the PDMS layer from the silicon chip after curing to obtain a microfluidic chip bottom plate, putting the microfluidic chip bottom plate and an upper cover prepared by the same operation into a plasma cleaning machine plasma for treatment, then attaching the upper cover and the bottom plate, and baking for 5min to obtain the microfluidic chip.
The microimaging diagram of the microfluidic chip substrate is shown in fig. 2, the chip substrate comprises 100 matrixes, each matrix comprises 10000 micropores, the diameter of each micropore is 4.4 micrometers, the height of each micropore is 3.5 micrometers, the circle center distance of each micropore is 10 micrometers, wherein A is a part of the chip substrate and comprises 2 matrixes, B is an enlarged view of 1 matrix in A and comprises 10000 micropores, C is a partial enlarged view of B, and the diameter of each micropore is 4.4 micrometers.
The schematic diagram of the upper cover of the microfluidic chip is shown in fig. 3, the upper cover is provided with 2 ports for liquid to enter and exit, one of the ports is a liquid inlet, and the other port is a liquid outlet; the middle part of the upper cover is a space with the height of 100 mu m for liquid to flow through, namely, the liquid enters the microfluidic chip from the inlet of the upper cover, flows through the middle part for reaction, and then the waste liquid is discharged from the outlet of the upper cover.
(2) The specific flow of detecting M gene of influenza virus is shown in FIG. 4. a. Firstly, incubating magnetic beads MB modified by streptavidin and capture probes modified by biotin (the capture probes are shown as SEQ ID NO:1, and the specific sequence is atcctaaaattcccttagtcag) for 30min, modifying the capture probes on the magnetic beads MB, washing for 3 times by Phosphate Buffer Solution (PBS), resuspending by 20 mu L of PBS, adding into 500 mu L of cracked influenza virus sample (wherein the concentration of influenza virus M gene is 1aM), capturing the influenza virus M gene by using the capture probes for 30min, capturing the magnetic beads MB by using magnet adsorption, washing for 3 times by PBS, and resuspending by 20 mu L of PBS, wherein the suspension comprises magnetic bead MB-capture probes-influenza virus M gene compound;
b. CRISPR reaction system (reaction Buffer (50mM NaCl, 10mM Tris-HCl, 10mM MgCl)2100 μ g/mL BSA, pH 7.9), LwaCas13a protein (purified from Leptotrichia wadei bacteria), CRISPR RNA (shown in SEQ ID NO:2, specific sequence: gaccaccccaaaaaugaaggggacuaaaaccuugucuuuagccauuccaugag) and a fluorescent reporter probe, wherein two ends of the fluorescent reporter probe are marked with a fluorescent group F and a quenching group Q, the sequence of the fluorescent reporter probe is FAM-tttatt-BHQ1, wherein FAM is the fluorescent group F and emits green fluorescence, and BHQ1 is the quenching group Q;
c. adding the magnetic bead MB-capture probe-influenza virus M gene compound prepared in the step a into a CRISPR reaction system in the step b, uniformly mixing to form a reaction liquid, injecting 20 mu L of the reaction liquid into micropores of a microfluidic chip through a micro-injection pump at the flow rate of 10 mu L/min, then injecting fluorine oil FC-40 into the micropores of the microfluidic chip to carry out oil sealing, so that the reaction in each micropore is divided into separate reactions, heating the microfluidic chip from the bottom to 32-39 ℃, and carrying out CRISPR reaction;
since the number of targets is much less than 100 ten thousand, and theoretically there is only one nucleic acid to be detected in each microwell, the initial assay (without magnetic beads) found that many microwells generated fluorescence, but the number was much less than the number of nucleic acids to be detected added, since 100 ten thousand microwells were usedThe total pore volume was only 50nL (i.e., 50fL X10 in FIG. 4)6) In addition, 20 mu L of reaction liquid is introduced during the experiment, most of nucleic acid to be detected is washed away by FC-40, and although the monodisperse detection is realized, the sample with low content of nucleic acid to be detected can cause false negative result, thereby causing the omission of detection. Therefore, when the magnetic beads are further introduced into the system, the magnetic beads sink into the micropores due to the high density of the magnetic beads, and the redundant magnetic beads are pushed into the micropores by FC-40, it is found through multiple trials that when the number of the magnetic beads is 2 times that of the micropores, more than 50% of the micropores contain one magnetic bead per micropore, so 200 ten thousand magnetic beads are added into each reaction system.
d. After reacting for 15min, placing the microfluidic chip under an inverted fluorescence microscope for observation, taking a picture, and counting and analyzing by using ImageJ software;
when CRISPR reaction is carried out in the micropores, if influenza virus M genes to be detected are in the micropores, CRISPR RNA is combined with the influenza virus M genes through base complementary pairing, cis-type cutting and non-specific trans-type cutting of Cas13a protein can be triggered at the moment, the Cas13a protein carries out non-specific trans-type cutting on the fluorescence report probe, fluorescent group FAM on the fluorescence report probe is cut into a free state, green fluorescence is further generated, a large number of fluorescent groups are gathered in the micropores, and the green fluorescence can be observed under a microscope;
if no influenza virus M gene to be detected exists in the micropores, only the capture probe connected with the magnetic beads MB is used, and no target is identified by CRISPR RNA at this time, the cleavage behavior of the Cas13a protein is not triggered, the fluorescent group of the fluorescent reporter probe is not cleaved, no free fluorescent group is generated in the corresponding micropores, and no fluorescence is observed under a microscope.
Example 2
In this example, the M gene of influenza virus was detected at a concentration of 0.1aM, and the specific procedure was the same as in example 1.
Example 3
In this example, the M gene of influenza virus at a concentration of 10aM was detected by the same procedure as in example 1.
Example 4
In this example, the M gene of influenza virus at a concentration of 100aM was detected by the same procedure as in example 1.
Example 5
In this example, the M gene of influenza virus at a concentration of 1fM was detected by the same procedure as in example 1.
Example 6
In this example, the M gene of influenza virus at a concentration of 10fM was detected in the same manner as in example 1.
Example 7
In this example, the M gene of influenza virus at a concentration of 100fM was detected by the same procedure as in example 1.
Example 8
In this example, the M gene of influenza virus was detected at a concentration of 1pM, and the procedure was the same as in example 1.
Comparative example 1
This comparative example was also subjected to nucleic acid testing, and differs from example 1 in that no influenza virus specimen was added in this comparative example, i.e., the concentration of influenza virus M gene was 0, and the rest of the procedure was the same as in example 1.
Test examples
In the experimental example, the detection results of the influenza virus M genes with different concentrations in examples 1 to 8 and comparative example 1 are subjected to microscopic observation, and the detection sensitivity is analyzed. Wherein:
the results of detection of influenza virus M gene in examples 1 to 8 and comparative example 1 are shown in FIG. 5. In FIG. 5, green fluorescence was not observed in the microwells of comparative example 1 (no influenza virus sample added) and example 2 (concentration of influenza virus M gene is 0.1 aM); in example 1 (concentration of influenza virus M gene is 1aM), green fluorescence was observed in the microwell, the number of microwells exhibiting green fluorescence was small, and 1 microwell exhibiting green fluorescence was observed in the visual field; in example 3 (concentration of influenza M gene 10aM), 3 microwells were observed in the field to exhibit green fluorescence; increase in microwell showing green fluorescence in the visual field of example 4 (concentration of influenza virus M gene 100 aM); in example 5 (concentration of influenza virus M gene is 1fM), example 6 (concentration of influenza virus M gene is 10fM), example 7 (concentration of influenza virus M gene is 100fM) and example 8 (concentration of influenza virus M gene is 1pM), the number of microwells exhibiting green fluorescence gradually increases as the concentration of influenza virus M gene increases.
From the above results, it can be seen that nucleic acid molecules to be detected as low as 1aM can be detected by the nucleic acid detection method of the present invention, which improves the sensitivity by more than 100 times compared with the conventional amplification-free method.
In addition, the inventor uses the influenza virus true samples collected from hospitals, wherein 20 positive samples and 15 negative samples are detected by using the nucleic acid detection method of the invention, the RT-PCR method is used as a control method, the statistical analysis result of the detection is shown in FIG. 6, and the detection results of 20 positive samples and 15 negative samples by using the detection method of the invention and the RT-PCR method are consistent, which indicates that the nucleic acid detection method of the invention can be used for detecting actual samples.
The embodiments of the present invention have been described in detail, but the present invention is not limited to the embodiments, and various changes can be made without departing from the gist of the present invention within the knowledge of those skilled in the art. Furthermore, the embodiments of the present invention and the features of the embodiments may be combined with each other without conflict.
SEQUENCE LISTING
<110> southern university of science and technology
<120> amplification-free nucleic acid detection method and application thereof
<130> 1
<160> 2
<170> PatentIn version 3.5
<210> 1
<211> 22
<212> DNA
<213> Artificial sequence
<400> 1
atcctaaaat tcccttagtc ag 22
<210> 2
<211> 53
<212> RNA
<213> Artificial sequence
<400> 2
gaccacccca aaaaugaagg ggacuaaaac cuugucuuua gccauuccau gag 53
Claims (10)
1. An amplification-free nucleic acid detection method, comprising the steps of:
s1: capturing the nucleic acid to be detected by using a capture probe to form a capture probe-nucleic acid to be detected compound;
s2: mixing the capture probe-nucleic acid compound to be detected with a CRISPR reaction system to form a reaction solution, and introducing the reaction solution into micropores of a microfluidic chip for reaction;
the CRISPR reaction system comprises a Cas protein, CRISPR RNA and a report probe;
the volume of the micropore of the microfluidic chip is 30-100 fL;
s3: the fluorescence generated by the reporter probe in step S2 is observed microscopically to determine the result of nucleic acid detection.
2. The method according to claim 1, wherein the capture probe of step S1 is bound to a magnetic bead, and the diameter of the magnetic bead is 2.6-3.5 μm.
3. The detection method of claim 1, wherein the Cas protein comprises at least one of Cas13a or Cas13 b.
4. The detection method according to claim 1, wherein both ends of the reporter probe are labeled with a fluorescent group and a quencher group.
5. The method of claim 1, wherein the microfluidic chip of step S2 comprises 5 x 104～5×106And a micropore.
6. The detection method according to claim 4, wherein the reaction performed in step S2 is a CRISPR reaction: the Cas protein performs non-specific cleavage on the reporter probe, so that the fluorescent group of the reporter probe is cleaved into a free state, and the free fluorescent group generates fluorescence.
7. The detection method according to claim 6, wherein in the CRISPR reaction, the reaction temperature is 32-39 ℃ and the reaction time is 14-16 min.
8. The detection method according to claim 1, wherein the microscopic observation method in step S3 includes: the fluorescence generated by the reporter probe was observed with a microscope.
9. Use of the detection method according to any one of claims 1 to 8 for the rapid detection of nucleic acids for non-diagnostic purposes.
10. The use of claim 9, wherein the nucleic acid rapid test comprises viral nucleic acid testing in the food field or viral nucleic acid testing in the environment.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202210180046.0A CN114540547A (en) | 2022-02-25 | 2022-02-25 | Amplification-free nucleic acid detection method and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202210180046.0A CN114540547A (en) | 2022-02-25 | 2022-02-25 | Amplification-free nucleic acid detection method and application thereof |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN114540547A true CN114540547A (en) | 2022-05-27 |
Family
ID=81679323
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202210180046.0A Pending CN114540547A (en) | 2022-02-25 | 2022-02-25 | Amplification-free nucleic acid detection method and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN114540547A (en) |
Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2020102610A1 (en) * | 2018-11-14 | 2020-05-22 | The Broad Institute, Inc. | Crispr system based droplet diagnostic systems and methods |
| WO2020124050A1 (en) * | 2018-12-13 | 2020-06-18 | The Broad Institute, Inc. | Tiled assays using crispr-cas based detection |
| CN111979357A (en) * | 2020-09-01 | 2020-11-24 | 石河子大学 | Detection method of bovine viral diarrhea virus based on CRISPR-Cas13a |
| CN112553307A (en) * | 2020-12-30 | 2021-03-26 | 南方科技大学 | One-pot nucleic acid detection method based on CasRNAse and application |
| CN113791207A (en) * | 2021-08-06 | 2021-12-14 | 南方科技大学 | High-sensitivity immunoassay method and application thereof |
-
2022
- 2022-02-25 CN CN202210180046.0A patent/CN114540547A/en active Pending
Patent Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2020102610A1 (en) * | 2018-11-14 | 2020-05-22 | The Broad Institute, Inc. | Crispr system based droplet diagnostic systems and methods |
| WO2020124050A1 (en) * | 2018-12-13 | 2020-06-18 | The Broad Institute, Inc. | Tiled assays using crispr-cas based detection |
| CN111979357A (en) * | 2020-09-01 | 2020-11-24 | 石河子大学 | Detection method of bovine viral diarrhea virus based on CRISPR-Cas13a |
| CN112553307A (en) * | 2020-12-30 | 2021-03-26 | 南方科技大学 | One-pot nucleic acid detection method based on CasRNAse and application |
| CN113791207A (en) * | 2021-08-06 | 2021-12-14 | 南方科技大学 | High-sensitivity immunoassay method and application thereof |
Non-Patent Citations (3)
| Title |
|---|
| PEIWU QIN ET AL.,: "Rapid and Fully Microfluidic Ebola Virus Detection with CRISPR-Cas13a", ACS PUBLICATIONS, vol. 4, no. 4, pages 1048 - 1054 * |
| 王雪亮等: "CRISPR/Cas系统在分子检测中的应用", 检验医学, no. 2, pages 92 - 96 * |
| 许金和等: "新型冠状病毒核酸检测方法", 国际检验医学杂志, no. 17, pages 96 - 100 * |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US20230183785A1 (en) | Spatially distinguished, multiplex nucleic acid analysis of biological specimens | |
| US9404924B2 (en) | Method of performing one-step, single cell RT-PCR | |
| US8673595B2 (en) | Sample analysis method and assay kit used therein | |
| JP2020534872A (en) | Chemical library encoded by oligonucleotide | |
| US10626446B2 (en) | Analyte enrichment methods and compositions | |
| JP4860869B2 (en) | Method for amplifying and detecting a plurality of polynucleotides on a solid support | |
| US10030240B2 (en) | Two-dimensional cell array device and apparatus for gene quantification and sequence analysis | |
| JP6620160B2 (en) | Methods for rapid and accurate dispensing, visualization and analysis of single cells | |
| US20100047790A1 (en) | Sample analyser | |
| CN108531360A (en) | Micro-current controlled cell capture for high throughput analysis and analytical equipment | |
| CN105018590B (en) | Protein ligands and gene detection kit and application at the same time | |
| Chen et al. | Development of a generic microfluidic device for simultaneous detection of antibodies and nucleic acids in oral fluids | |
| WO2016125251A1 (en) | Flow cell device for single cell analysis, and single cell analysis device | |
| CN103975075A (en) | Probe for detecting method of integration of virus in test sample and preparation method and use thereof | |
| JP2000236876A (en) | Polymerase chain reaction device having integrated microwell | |
| CN114540547A (en) | Amplification-free nucleic acid detection method and application thereof | |
| US20220195543A1 (en) | Paper-based, nucleic acid-detecting kit and method for analysis of pcr amplicon | |
| KR101775984B1 (en) | Molecular beacon for detection of MERS-CoV and uses thereof | |
| Can-Can et al. | Multiplex Nested Solid Phase PCR-Array Chip for Simultaneous Detection of Highly Pathogenic Microorganisms | |
| US20150159224A1 (en) | Ultrasensitive detection and characterization of clustered kras mutations using peptide nucleic acid clamp pcr in drop-based microfluidics | |
| CN113512611A (en) | Gene membrane chip-based method for detecting various respiratory viruses | |
| WO2021114040A1 (en) | Non-amplified nucleic acid molecule detection kit and use method therefor | |
| Adams et al. | Microarray platform for the detection of a range of plant viruses and viroids | |
| RU2270252C2 (en) | Differentive oligonucleotide kit for species identification of genus orthopoxvirus viruses, biological microarray, kit and method for species identification of genus orthopoxvirus viruses | |
| US20060147905A1 (en) | Method for the specific identification of orthopoxvirus with the aid of a miniature biological chip |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination |