CN103975075A - Probe for detecting method of integration of virus in test sample and preparation method and use thereof - Google Patents
Probe for detecting method of integration of virus in test sample and preparation method and use thereof Download PDFInfo
- Publication number
- CN103975075A CN103975075A CN201180074786.6A CN201180074786A CN103975075A CN 103975075 A CN103975075 A CN 103975075A CN 201180074786 A CN201180074786 A CN 201180074786A CN 103975075 A CN103975075 A CN 103975075A
- Authority
- CN
- China
- Prior art keywords
- probe
- sample
- nucleic acid
- dntp
- virus
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/70—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving virus or bacteriophage
- C12Q1/701—Specific hybridization probes
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/70—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving virus or bacteriophage
- C12Q1/701—Specific hybridization probes
- C12Q1/702—Specific hybridization probes for retroviruses
- C12Q1/703—Viruses associated with AIDS
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/70—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving virus or bacteriophage
- C12Q1/701—Specific hybridization probes
- C12Q1/706—Specific hybridization probes for hepatitis
- C12Q1/707—Specific hybridization probes for hepatitis non-A, non-B Hepatitis, excluding hepatitis D
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/16—Primer sets for multiplex assays
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Zoology (AREA)
- Immunology (AREA)
- Wood Science & Technology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Virology (AREA)
- Microbiology (AREA)
- Biochemistry (AREA)
- Biophysics (AREA)
- Molecular Biology (AREA)
- Analytical Chemistry (AREA)
- Physics & Mathematics (AREA)
- Genetics & Genomics (AREA)
- Biotechnology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Communicable Diseases (AREA)
- AIDS & HIV (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
Disclosed are a probe for detecting the method of integration of a virus in a test sample and a preparation method and the use thereof. In particular, the probe has at least one of the following characteristics: (1) there is one or more biotin-labelled dNTP on each probe; (2) the abundance of the biotin-labelled dNTP in the probe set is 1 : 6 to 1 : 2; and (3) all the nucleic acid sequences of the probe set cover 70%-100% of the corresponding sequences of the virus genome.
Description
A kind of detection virus probe of Integration Mode and its preparation method and application technical field in sample to be tested
The invention belongs to biological technical field, in particular it relates to a kind of detection virus probe of Integration Mode and its preparation method and application in sample to be tested.Background technology
Hepatitis type B virus（Hepatitis B vims, HBV) it is a kind of global chronic viral infection disease.The hepatitis B virus infection rate about 60%-70% of China；And hepatitis B surface antigen carrying rate accounts for the 7.18% of total population, calculated with this, the whole nation there are about 93,000,000 people's Hepatitis B carriers, wherein hepatitis B patient about 30,000,000.In the whole world, about 45% crowd lives in the district occurred frequently of chronic HBV infection, and 43% crowd lives in the Zhong Faqu of chronic HBV infection, and the crowd for separately having 12% lives in chronic HBV infection Di Fa areas.In the district occurred frequently of chronic HBV infection, the danger of HBV infection>60%, most HBV infections are by vertical transmission；Area is sent out in chronic HBV infection, the danger of HBV infection is 20% -60%；In the Di Fa areas of chronic HBV infection, the danger of HBV infection<20%.
During chronic HBV infection, a certain proportion of HBV infection develops into hepatic sclerosis and hepatocellular carcinoma, some deterioration due to liver pathological changes and occur hepatic failure.Therefore, in the natural process of chronic HBV infection, many patients can cause death because of hepatic sclerosis, hepatocellular carcinoma, and liver failure, and huge economic loss is brought to society and family.
Hepatitis B virus-DNA, which is one, the single-stranded circular double stranded DNA molecule in part, and two single chain lengths differences, HBV viruses have Multi-genotype, and Common genes type has eight kinds, respectively A-H.A types are distributed in Northern Europe and West Europe；B, c-type is distributed in Southeast Asia；D types are distributed in southern Europe, Indian；E types are distributed in West Africa and South Africa；F, H type are distributed Sino-U.S., South America；G types distribution France, the U.S..
Now on liver cancer and HBV gene group reorganizing research, it is found that HBV-DNA is integrated into liver cancer cells genome.Find that HBV gene is integrated into around human genome site using monocloning method, occur to reset, lack.HBV carrier is changed into liver cancer, and research discovery has three below approach：
(1) HBV be integrated into genome cause chromosome instability determine, cause many site deletions；
(2) HBV fragments insertion specific site causes gene insertion and deletion, activates proto-oncogene, for example carefully
Born of the same parents' Proliferation, Differentiation gene, with telomere pol gene；
(3) the virus protein controllable hepatoma cell proliferation of expression.
HBV virus genomic integrations enter human genome destruction Genome stability and cause improper transposition, and DNA is reset, and is deleted, and heterozygosis is lost, and activation suppresses related gene, so that inducing hepatocyte cancer（HCC generation).Know in No. 14, No. 15, No. 18, No. 19 and Y chromosome, there are some genes related to cancer near HBV DNA integration site, as BCL2L2 genes are related to Apoptosis, SMOCl, Calmodulin-1 gene are related to calcium channel, FBLN5 genes are related to angiogenic growth, and NOTCH3 is related to cellular signal transduction pathways.There may be multiple integration sites in HCC tissues, HBV can also occur to integrate again on the basis of integration.The transposition that No. 17 and No. 18 chromosome occurs for HBV DNA integration sites two ends can be detected sometimes such as in the hepatic tissue of liver cancer patient, while No. 18 chromosomes have at least 1.3 kb base deletion at integration site.Found by the research of the hepatic tissue HBV integration to liver cancer patient：Human genome sequence respectively has 5bp and 19bp missing in some cases；Although the human chromosome that HBV integration fragments both sides are detected in 3 cases is same chromosome, but in the opposite direction, is reset.
The research method that HBV gene group is integrated into host genome is mainly Southern Blot, probe isotope marks, monoclonal sequencing, ALU-PCR, oligonucleotide probe etc. at present.Be present many problems in these current methods, be mainly reflected in：1. the supplier that typical probe is customized for high-flux sequence is mainly Agilent and imblegene, customization price is higher, generally hundreds of dollars/reaction；2. not yet did the trial in terms of integration.
Current this area is also integrated into the research method of host genome without a kind of simple and quick HBV gene group of economy.Therefore this area is integrated into the detection method of host genome in the urgent need to developing new HBV gene group, is that research HBV and liver related disease provide and facilitate cheap research method and means.The content of the invention
It is an object of the invention to provide a kind of probe for being used to detect virus Integration Mode in sample to be tested.
It is a further object of the present invention to provide the preparation method and application of the probe.
It is a further object of the present invention to provide a kind of method for detecting virus Integration Mode in sample to be tested.In the first aspect of the present invention there is provided a kind of nucleic acid probe collection, including multiple probes, the probe collection has following characteristics：
(1) there is the dNTP of one or more biotin labelings on each probe;And/or
(2) dNTP of biotin labeling is 1 in the abundance that probe is concentrated:6-1 :2;And/or
(3) 70%-100% of whole nucleotide sequences covering correspondence virus genome sequence of the probe collection.
In another preference, the probe collection has 1-20000 nucleic acid probe；It is preferred that the probe collection has 1000-5000 nucleic acid probe；More preferably, the probe collection has 2500 nucleic acid probes.
In another preference, the dNTP of the biotin labeling is 1 in the abundance that the probe is concentrated:4.Have in another preference, between the probe and partly overlap.
In another preference, the probe length is 100-500bp;It is preferred that the probe length is 200-300bp;More preferably, the probe length is 250bp.
In another preference, the probe is that, using viral genome as template, the amplification of PCR methods is obtained, it is preferred that the amplification template is hepatitis type B virus（HBV) genome, HCV（HCV) genome, AIDS virus（HIV) genome, papillomavirus（HPV) genome, or its combination；More preferably described sample is Type B HBV gene group and/or c-type HBV gene group.
In the second aspect of the present invention, there is provided the nucleic acid chip that a kind of surface is fixed with probe collection described in second aspect of the present invention.
In the third aspect of the present invention there is provided the purposes of nucleic acid chip described in nucleic acid probe collection described in the first aspect of the present invention and the second aspect of the present invention, for detecting Integration Mode of the virus in sample is treated；It is preferred that described Integration Mode is selected from the group：Rearrangement, dystopy, insertion, replacement, or its combination.
In the fourth aspect of the present invention, there is provided a kind of method for preparing nucleic acid probe described in the first aspect of the present invention, including step：
A. probe source sample is obtained；
B. to step（A) sample obtained enters performing PCR amplification, and the dNTP of PCR amplification system is the dNTP of biotin labeling, obtains the pcr amplification product with biotin labeling；
C is to step（B) pcr amplification product of the biotin labeling obtained enters Break Row, obtains the pcr amplification product of the biotin labeling of fragmentation, as probe；
In another preference, step（A) sample has following characteristics：
Sample is the Virus Sample containing nucleic acid；And/or
The sample is virion, serum, blood, tissue samples, cast-off cells, epithelial cell, or its combination；And/or
The sample is selected from the group：Hepatitis type B virus（HBV), HCV（HCV), AIDS virus（HIV), papillomavirus（HPV), or its combination；And/or
The sample is Type B HBV and/or c-type HBV.
In another preference, step（B) there are following characteristics：
Step（B) amplification described in is that viral DNA total length in sample is expanded；And/or
Step（B) dNTP of the mark is biotin-dNTP, and the dNTP of the mark can be combined with the affine magnetic bead of streptomysin；And/or
Step（B) dNTP of the mark and non-marked dNTP ratio are 1: 2-8；It is preferably in a proportion of 1: 3-6；More preferably ratio is 1: 4.
In another preference, step（C) described interrupt is interrupted for ultrasonic method.
In another preference, in addition to step（d) ：To step（C) probe obtained is purified and/or quantified.
In another preference, the length of the probe is 100-500bp;It is preferred that the length of the probe is 200-300bp, more preferably, the length of the probe is 250bp.
In the fifth aspect of the present invention, there is provided a kind of method for detecting virus gene integration mode in sample to be tested, including step：
(i) sample to be tested is obtained；
(ii) to step（I) sample obtained carries out library construction；
(iii) by the probe and step described in first aspect present invention（Ii) library obtained is hybridized, and captures the nucleotide sequence relevant with viral gene integration；
(iv) to step（Iii) nucleotide sequence of capture is expanded, and obtains the amplified production relevant with viral integrase；
(V) to step（Iv) amplified production obtained is sequenced, and obtains nucleic acid relevant with viral integrase mode
I from,
In another preference, step（I) there are following characteristics：
The sample to be tested is tissue, blood, cast-off cells, epithelial cell；And/or
The sample to be tested derives from people or non-human mammal, preferably from people；And/or
The sample to be tested derives from HBV infection person or liver cancer patient.
In another preference, step（Iii) there are following characteristics：
The probe is the single stranded DNA of denaturation;And/or
Tab closure molecule and label closing molecule are added in hybridization solution；And/or
The sequence of the tab closure molecule such as SEQ ID NO:Shown in 7；And/or
The label closes the sequence such as SEQ ID NO of molecule:8 and SEQ ID NO:Shown in 9.
In another preference, in step（V in), sequencing probe fixed on described amplified production and solid phase carrier is hybridized, solid phase bridge-type PCR amplifications are carried out, sequencing cluster is formed；Then to it is described sequencing cluster with " while synthesis-while be sequenced " method is sequenced, so as to obtain information nucleic acid relevant with viral integrase mode.
In another preference, in step（Ii in), described library construction is：End reparation is carried out to the genomic DNA interrupted, joint is added, the fragment with joint is expanded, the amplification mixture with joint of acquisition is sample library.
In another preference, described joint has such as SEQ ID Ν Ο:1 and SEQ ID NO:Sequence shown in 2；And/or, constructed library has such as SEQ ID:3 and SEQ ID:Sequence label shown in 4.
In the 6th face of the present invention there is provided a kind of kit available for fourth aspect present invention methods described, the kit includes：
(1) first container and positioned at the nucleic acid chip described in second aspect of the present invention in container, or the probe described in first aspect present invention；
(2) second container and being used in container build the joint in sample library；
(3) the 3rd containers and the tab closure molecule in container；
(4) the 4th containers and the label closing molecule in container；
(5) specification is detected；
In another preference, the kit also includes the reagent being selected from the group：
For enter performing PCR amplification needed for reagent,
For carry out reagent needed for capping,
For carry out reagent needed for hybridization reaction,
For carry out reagent needed for sequencing reaction,
Or its combination.It should be understood that within the scope of the present invention, can be combined with each other between above-mentioned each technical characteristic of the invention and each technical characteristic specifically described in below (eg embodiment), so as to constitute new or preferred technical side
Case.As space is limited, no longer tire out one by one herein and state.Brief description of the drawings
Drawings below is used to illustrate specific embodiments of the present invention, rather than limits the scope of the invention being defined by the claims.
Fig. 1 shows the electrophoresis detection result after being expanded to HBV full-length genomes PCR, and full-length genome is about 32 Κ.
Fig. 2 is shown interrupts rear electrophoresis testing result to HBV full length products, and the clip size interrupted is concentrated between 250bp-300bp.
Fig. 3, which is shown, builds storehouse hybridization latter two library segment size detection result, respectively 271bp and 876bp.Fig. 4 shows flows of the present invention detection HBV in sample to be tested gene integration mode.
Fig. 5 shows information analysis flows of the present invention detection HBV in sample to be tested gene integration mode.Embodiment
The present inventor by in-depth study extensively, construct first it is a kind of be used to detect the viral probe of Integration Mode and its application in sample to be tested, specifically, the probe collection has following characteristics：
(1) there is the dNTP of one or more biotin labelings on each probe;And/or
(2) dNTP of biotin labeling is 1 in the abundance that probe is concentrated:6-1 :2;And/or
(3) 70%-100% of whole nucleotide sequences covering correspondence virus genome sequence of the probe collection.
In the preference of the present invention, the probe collection has 1-20000 nucleic acid probe；It is preferred that the probe collection has 1000-5000 nucleic acid probe；More preferably, the probe collection has 2500 nucleic acid probes.
In another preference, the probe collection also has following characteristics：
(i) dNTP of the biotin labeling is 1 in the abundance that the probe is concentrated:4;And/or
(ii) have between the probe and partly overlap；And/or
(iii) probe length is 100-500bp;It is preferred that the probe length is 200-300bp;More preferably, the probe length is 250bp;And/or
(iv) probe is that, using viral genome as template, the amplification of PCR methods is obtained, it is preferred that the amplification template is hepatitis type B virus（HBV) genome, HCV（HCV) genome, AIDS
Virus（HIV) genome, papillomavirus（HPV) genome, or its combination；More preferably described sample is Type B HB V genomes and/or c-type HB V genomes.
Present invention also offers the preparation method and applications of the probe.The present invention is completed on this basis.Term
As used herein, term " containing " include " have (comprise) ", " substantially by ... constitutes " with " by ... constitute ".
As used herein, term " above " includes this number with " following ", and such as " more than 80% " refers to >=80%, and " less than 2% " refers to≤2%.
Abundance
As used herein, the dNTP quantity for the biotin labeling that term " abundance " refers to concentrates shared ratio in whole probe.In the preference of the present invention, the dNTP of biotin labeling is 1 in the abundance that probe is concentrated:6-1 :2；More, the dNTP of biotin labeling is 1 in the abundance that the probe is concentrated:4.
Primer
As used herein, term " primer " refers to that the general name of the oligonucleotide of the DNA complementary with template can be synthesized in the effect of archaeal dna polymerase with template complementary pairing.Primer can be natural RNA, DNA or any type of natural nucleotide, and primer can even is that non-natural nucleotides such as LNA or ZNA etc..
Primer " generally " (or " substantially ") and a special sequence complementation on a chain in template.Primer must could start with an abundant complementation of chain in template extension, but primer sequence need not be with template sequence complete complementary.Such as, the preceding paragraph and the not complementary sequence of template are added at the 5' ends at a 3' end and the complementary primer of template, such primer is still generally complementary with template.As long as there is sufficiently long primer sufficiently to be combined with template, non-fully complementary primer can also form primer-template complex with template, so as to be expanded.
Probe and preparation method thereof
As used herein, " probe " one word is the simple DNA or RNA molecule for referring to detect complementary nucleic acid sequences.Probe must be pure, and not influenceed by other different sequencing nucleic acids.Typical probe is the DNA sequence dna of clone or expands the DNA obtained, artificial synthesized oligonucleotides or the RNA obtained after in-vitro transcription cloned dna sequence by PCR, can also be used as probe.Probe length can be from 20-500mer, preferably 50-300mer, more preferably 250mer.Probe is designed and synthetic method is ripe for those skilled in the art
Artificial chemical synthesis synthesising probing needle can be used or use commercially available probe by knowing.
The invention provides a kind of probe for being used to detect virus Integration Mode in sample to be tested, the probe collection has following characteristics：
(1) there is the dNTP of one or more biotin labelings on each probe;And/or
(2) dNTP of biotin labeling is 1 in the abundance that probe is concentrated:6-1 :2;And/or
(3) 70%-100% of whole nucleotide sequences covering correspondence virus genome sequence of the probe collection.
In the preference of the present invention, the probe collection has 1-20000 nucleic acid probe；It is preferred that the probe collection has 1000-5000 nucleic acid probe；More preferably, the probe collection has 2500 nucleic acid probes.
In another preference, the probe collection also has following characteristics：
(i) dNTP of the biotin labeling is 1 in the abundance that the probe is concentrated:4;And/or
(ii) have between the probe and partly overlap；And/or
(iii) probe length is 100-500bp;It is preferred that the probe length is 200-300bp;More preferably, the probe length is 250bp;And/or
(iv) probe is that, using viral genome as template, the amplification of PCR methods is obtained, it is preferred that the amplification template is hepatitis type B virus（HBV) genome, HCV（HCV) genome, AIDS virus（HIV) genome, papillomavirus（HPV) genome, or its combination；More preferably described sample is Type B HB V genomes and/or c-type HB V genomes.
Present invention also offers a kind of preparation method of the probe, in a preference, methods described includes step：
A. Virus Sample is obtained；
B. obtain sample to be expanded, the dNTP of mark is introduced in amplification, the pcr amplification product of mark is obtained, the dNTP of mark is preferably biotin-dNTP, and the dNTP of mark can be combined with the affine magnetic bead of streptomysin；
C carries out fragmentation, as probe to the pcr amplification product of mark；
d:The probe of acquisition is purified and/or quantified.
The length of probe of the present invention is 100-500bp, it is preferred that the length of the probe is 200-300bp, the length of more preferably described probe is 250bp.
Chip
As used herein, " chip " one word refers to using micro-processing technology on the base material of chip to add
Work goes out various fine structures, applies necessary biochemical and is surface-treated, by various probe molecules and surface immobilized, the obtained material containing a large amount of probes.
Those skilled in the art can use general method to obtain chip.DNA chip preparation method generally has 4 kinds.1st kind is light guiding in-situ synthesis, is combined in micro-processing technology with photoetching process with photochemical syntheses method.2nd kind of method is chemical gunite, and synthetic oligonucleotide probe fixed point is ejected on chip and is subject to immobilization to make DNA chip.3rd kind of method is contact point coating, allows pipetting head to be contacted with glass-chip by the accurate movement of high speed and precision manipulator and DNA probe is coated on chip.4th kind of method is to be respectively provided with A, T, G using 4, and the piezo jets of C nucleosides synthesize DNA probes parallel on chip.
The chip for detecting viral gene Integration Mode is fixed with the invention provides a kind of surface.In a preference, the virus is HBV, it is preferred that being Type B HBV and c-type HBV.The chip of the present invention is used to detect gene integration mode of the virus in host to be measured.
DNA library and its preparation
As used herein, " DNA library preparation " word refers to enter the purpose fragment of genome Break Row, and obtaining one group has a certain size DNA fragmentation mixture.
The preparation method in sample library is well known to those skilled in the art, including but not limited to step：Genomic DNA Ends reparation to interrupting, with flat end；Joint is added, the fragment with joint is expanded, the mixture with joint of acquisition is library.
In a preference, described joint has such as SEQ ID Ν Ο:1 and SEQ ID NO:Sequence shown in 2.In a preference, constructed library has such as SEQ ID NO:3 and SEQ ID NO:Sequence label shown in 4.
In a preference, the stopping pregnancy thing that can also fight each other, end are repaired product, joint product and enriched product and purified.Purification condition and parameter are well known to those skilled in the art, and certain change is carried out to the condition of reaction or is optimized also within those skilled in the art's limit of power.
High-flux sequence
New-generation sequencing technology (NGS) changes analytical model in the past to DNA/RNA samples, almost as research tool essential in all research fields.Parallel sequencing while new-generation sequencing technology is by up to a million DNA short-movie sections so that can just complete the sequencing of each base in a short time, and cost is greatly lowered.NGS technologies are applied at many aspects, such as genomics, transcription group, apparent
Genomics, clinical diagnosis etc..
Those skilled in the art generally can carry out high-flux sequence using a variety of second generation microarray datasets：The including but not limited to Hiseq2000 of illumina companies, 454 FLX (oche companies）, Solexa Genome Analyzer and Applied Biosystems companies SOLID etc..The characteristics of these platforms are common is high sequencing throughput, relative to 96 road capillary sequencings of tradition sequencing, high-flux sequence, which is once tested, can read 40 ten thousand to 400 ten thousand sequences, according to the difference of platform, length is read from 25bp to 450bp, therefore different microarray datasets can read the base number that 1G to 14G is not waited in once testing.Wherein, Solexa high-flux sequences include the formation of DNA clusters and two steps are sequenced in upper machine：Fixed sequencing probe is hybridized on the mixture and solid phase carrier of pcr amplification product, and carries out solid phase bridge-type PCR amplifications, forms sequencing cluster；To it is described sequencing cluster with " while synthesis-while PCR sequencing PCR " be sequenced.
The formation of DNA clusters is the sequence testing chip (flow cell) that one layer of single-stranded primer (primer) is connected with using surface, the DNA fragmentation of single-chain state is fixed on the surface of chip by the primer of joint sequence and chip surface by the principle of base pair complementarity, pass through amplified reaction, fixed single stranded DNA is changed into double-stranded DNA, double-strand is denatured as single-stranded again, its one end is anchored on sequence testing chip, another random and neighbouring Primers complementary of the other end is formed " bridge " so as to be anchored；There are up to ten million DNA unimolecules to occur the reaction of the above simultaneously on sequence testing chip；The single-stranded bridge formed, using the primer of surrounding as amplimer, is expanded again on the surface of amplification chip, forms double-strand, and double-strand is single-stranded through being denatured into, again as bridge, and the template of referred to as next round amplification continues to expand；It has been repeated after 30 wheel amplifications, each unimolecule obtains 1000 times of amplifications, referred to as the DNA clusters of monoclonal.
DNA clusters carry out being sequenced in synthesis on Solexa sequenators; in sequencing reaction; four kinds of bases mark different fluorescence respectively, and each base end is closed by protection base, and single reaction can only add a base; it is scanned through; read after the color of the secondary response, the protection group is removed, and next reaction can proceed; so repeatedly, that is, the precise sequence of base is obtained.During the multiple sequencings (Multiplexed Sequencing) of Solexa INDEX (label or BARCODE) can be used to distinguish sample, and after the completion of routinely sequencing, for the extra sequencing for carrying out 7 circulations in INDEX parts, by INDEX identification, it can be at most sequenced at 1 in path and distinguish 12 kinds of different samples.
Detection method
Present invention also offers a kind of method for detecting virus gene integration mode in host cell, by taking HBV viruses as an example, in the preference of the present invention, methods described is mainly included the following steps that：
1. HBV probe manufacturings
Enter during performing PCR, wherein PCR to introduce the dNTP of mark to HBV full-length genomes;
In a preference, the mark dNTP is 1 for biotin-dNTP, biotin-dNTP and common dNTP ratio:4, total concentration is 2.5mM;
2. a pair HBV full length products are purified
In a preference, using 1.5 times of volume AMPURE magnetic beads for purifying, the rear 250MinElute PCR Purification Kit using QIAGEN are purified；
3. pair HBV full length products carry out fragmentation
DNA is transferred in buffer solution, ultrasonic fragmentation is carried out；
4. probe hybridizes with sample
Sample source can be HBV patient or the blood plasma or tissue of liver cancer patient, according to Illumina companies Paired-End Sample Preparation Guide (operating processes）Carry out library construction；Probe is mixed with library, specific sample nucleic acid fragment is captured.
5. elution
The nucleic acid fragment captured is eluted；
6. the above-mentioned DNA eluted is entered into performing PCR amplification and purifying, quantified；
7. on machine sequencing system and information analysis
Above-mentioned PCR primer after purification is used into the HISEQ2000 of ILLUMINA Inc. through carrying out high-flux sequence, microarray dataset, PEI101 is not limited to for sequencing length, can also use PEI91.The reads that lower machine data are polluted except deduplication and by joint, the essential information of the lower machine data of statistics（For example：Library length；Reads length；Reads bar numbers；Base number；Repetitive rate etc.）；The 50bp bases before interception PE two reads, form a pair of a length of new reads of 50bp respectively, and new PE50 reads are compared software by B PE50readsc with soap（The reference sequences of-the V of-r 1 2) respectively with people（Hgl9) it is compared with the various reference sequences of HBV, a read is picked out from comparison result than the reference sequences to people and another a pair of the reads compared to HBV reference sequences;The very possible sites inserted across HBV of such reads；This part reads comparison informations are counted, are found in the insertion hot spot region of human genome.Fig. 5 shows information analysis flows of the present invention detection HBV in sample to be tested gene integration mode.
Kit
Present invention also offers a kind of kit for being used to detect virus Integration Mode in host, it is main include with
Lower component：
(1) first container and detection chip or probe collection in container；
(2) second container and being used in container build the joint in sample library；
(3) the 3rd containers and the tab closure molecule in container；
(4) the 4th containers and the label closing molecule in container；
(5) specification is detected.
In another preference, the kit also includes the reagent being selected from the group：
For entering the reagent needed for performing PCR amplification, for carrying out reagent needed for capping, for carrying out reagent needed for hybridization reaction, for carrying out the reagent needed for sequencing reaction or its combination.
Main advantages of the present invention include：
1. the price needed for preparing probe using the present invention is only the 1%-5% that prior art prepares price；
2. present invention flexible form during probe is made, can be needed design by itself, ratio adds HBV species and quantity；
3. it is simple to make probe process, by PCR and interrupts purifying and can obtain probe, without synthesis；
4. the probe of the present invention is double-chain probe, information errors and loss caused by PCR reasons can be reduced；
Play a part of being enriched with HBV fragments 5. the detection method of the present invention can be used in combination with database technology；With wide applicability.With reference to specific embodiment, the present invention is expanded on further.It should be understood that these embodiments are only illustrative of the invention and is not intended to limit the scope of the invention.The experimental method of unreceipted actual conditions in the following example, generally according to normal condition such as Sambrook et al., molecular cloning：Laboratory manual (New York:Cold Spring Harbor Laboratory Press, 1989) described in condition, or according to the condition proposed by manufacturer.
Instrument and reagent
The instrument and reagent that present aspect is used are shown in Table 1.
Cycler/9700
Agilent 2100 2100 Bioanalyzer Agilent
The Eppendorf gel imaging system Tanon Shanghai Tian Neng Science and Technology Ltd.s of 1000 Spectrophotometer Thermo Fisher Scientific electrophoresis apparatus DYY-6C Liuyi Instruments Plant, Beijing nucleic acid condensation instrument of NanoDrop 5305
Covaris smashes instrument S-2 Covaris
Thermomixer Thermomixer comfort Eppendorf
Dynabeads M-280
Invitrogen
Strep tavidin magnetic beads
MinElute PC
28004 QIAGEN
Purification Kit
It is prepared by the sample library of embodiment 1
1. samples sources
The source of sample is the liver cancer tissue of same patient, and this patient's liver cancer tissue has genome sequencing information.
2. it is prepared by sample library
Library construction according to Illumina companies standard library preparation flow specification（Paired-End Sample Preparation Guide) built, specific method is as follows：
Genomic DNA, end-filling reparation are interrupted using Covaris s2, end adds A, adds joint, building the joint used in the process of storehouse is：
SEQ ID NO: l 5'-GATCGGAAGAGCACACGTCTGAACTCCAGTCAC-3' ;
SEQ ID NO:25 ,-TACACTCTTTCCCTACACGACGCTCTTCCGATCT-3,.Performing PCR is entered to the fragment for adding joint, sample library is obtained, constructed library carries INDEX sequence labels.INDEX sequences are as follows：
SEQ ID NO: 3
ACGTGTGCTCTTCCGATCT-3,
SEQ ID NO: 4
5'-CAAGCAG
ACGTGTGCTCTTCCGATCT-3' c
Sample is made to two kinds of clip size libraries respectively, clip size inspection is carried out to building library fragments;Master tape is 170bp or so and 800bp or so.Embodiment 2 prepares HBV probes
1. design of primers
In the present embodiment, designed primer is：
PI ( SEQ ID NO:5 ) ： TTTTTCACCTCTGCCTAATCA
P2 ( SEQ ID NO:6 ) ： AAAAAGTTGCATGGTGCTGG
2. PCR reaction systems
PCR reaction systems are shown in Table 2.
Table 2
LA Taq 0.25μ1
10 X LA buffer ( Mg+2.00mM ) 2.5μ1
dNTP (2.5mM) 4μ1
PI ( ΙΟμΜ) 1.5μ1
P2 ( ΙΟμΜ) 1.5μ1
HBV viral genomes（lng/μΐ) 3μ1
H2O 12.25μ1
The μ of cumulative volume 25
(note：Biotin-dNTP and common dNTP ratio are 1 in dNTP:4, total concentration is 2.5mM) 3. PCR reaction conditions
PCR reactions are carried out on AB-9700PCR instrument, and response procedures are shown in Table 3.
Table 3
Temperature-time period
94 °C 3min 1
94 °C 30s 35
56 °C 50s
68 °C 150s
72 °C lOmin
4 °C of holdings
4. PCR is purified and electrophoresis detection
After reaction terminates, PCR primer is detected using 1% agarose gel electrophoresis, and purified with 1.2-1.5 times of volume AMPURE BEADS, is dissolved using 80ul water.Then using 250MinElute PCR Purification Kit purifying, dissolved using the water of 60 μ 1.The 1% agarose gel electrophoresis detection whether purified clean testing result of PCR primer is shown in Fig. 1.
As a result show, expand and be purified into size about 3.2K HBV fragment.
5. PCR primer fragmentation
After the completion of purifying, it is 8 (^l (Nanodrop detects that its total amount is 5 g), Covaris S2 instruments that DNA, which is fully transferred to Covaris to interrupt tubule and add TE buffer solutions to cumulative volume,（Gene Co., Ltd）Interrupt, the condition of interrupting is shown in Table 4.
Table 4
6. fragmentation products electrophoresis detection
2% agarose gel electrophoresis detects the size of fragment, as a result shows, fragment master tape is in 250-300bp (figures
2) .The product of the fragmentation obtained can be used as the probe of hybridization.
7. probe is preserved
Using MinElute PCR Purification Kit purified fragments products, it is dissolved in the buffer solutions of 40 μ 1, with Nanodrop instrument detection probes DNA concentration so that the concentration of probe is 120 ι/μ 1 or so.Obtained probe can be stored in -20 °C or -80 °C.
The HBV probes of embodiment 3 are hybridized with sample library
1. probe is denatured
Probe is denatured 10 minutes using first necessary 95 °C, and cooled on ice is then put in rapidly and forms single-stranded.
2. selecting fixed integration library, library consumption is l g, and probe consumption is that (Nanodrop is quantitative by 600ng）, tab closure molecule is added, the ratio that amount and the library of tab closure molecule are measured is lnmol: 1μ§, label closing molecule is lnmol with the ratio that library is measured: ^g.
Tab closure molecular sequences are：
SEQ ID NO: 7
5'-AATGATA(
GCTCTTCCGATCT-3'
Label closes molecular sequences
SEQ ID NO: 8
S'-AAGCAGA,
CGTGTGCTCTTCCGATCT-3'；
SEQ ID NO: 9
5'-AAGCAGA,
CGTGTGCTCTTCCGATCT-3'。
L g Hybrid Library for the treatment of, lnmol tab closure molecules, lnmol labels closing molecule, 5 g Cot DNA are added in 1.5mL EP pipes.Lid is covered, a hole is stabbed in the EP lids of packing with clean 50ml syringe needles, is subsequently placed in 60 °C of revolving instrument and is evaporated.The lid of puncture is replaced using new centrifuge tube lid, and carries out mark.Two kinds of reagents in EZ crossing systems are separately added into EP pipes：The μ of the 2 X SC Hybridiation Buffer hybridization buffers 7.5 and μ 1 of 1 X SC Hybridiation Component A 3, then 95 °C are denatured 10 minutes, added in above-mentioned hybridization mixture from manufacturing probe 600ng, probe volume totally 5 μ 1.Concussion is placed on centrifuge after mixing and centrifuged at full speed 10 seconds, and sample is transferred completely into the Ρ Ο tubules of 200 μ 1.
The composition contained in hybridization mixture is shown in Table 5.Library is evaporated mixture l g (libraries）+ 5 g (Cot DNA)+2nmol closes molecule
2Χ SC Hybridiation Buffer 7.5μ1
SC Hybridiation Component A 3μ1
Probe 600ng
The μ 1 of cumulative volume 15
The Ρ Ο tubules of 200 μ 1 are positioned in PCR instrument, hybridize 24h under the conditions of 47 °C.Embodiment 4 is eluted after hybridizing
1. prepare Streptavidin MagneSphere (Invitrogen M280)
Streptavidin MagneSphere is taken out from refrigerator in advance；Whirlpool shakes magnetic bead lmin, it is fully mixed；Ι Ο Ο μ Ι magnetic beads are added in 1.5mL EP pipes；Ε Ρ pipes are placed in into magnetic frame up to liquid to clarify, supernatant is carefully removed with pipettor；Keep Ε Ρ pipes on magnetic frame, add 200 μ (2 times of volumes）Combination buffer (be purchased from Agilent companies）；EP pipes are removed from magnetic frame, whirlpool concussion 10s mixes it；EP pipes are placed back in into magnetic frame to liquid to clarify, supernatant is carefully removed with pipettor；Repeated washing is twice；With 100 μ Agilent combination buffer r suspension magnetic beads；In the tubule for being transferred to 0.2 ml；With magnetic frame combination magnetic bead（Tubule is come on magnetic frame）, until liquid clarification, supernatant is carefully removed with pipettor；The DNA that present magnetic bead can capture for combination.
2. the DNA captured is attached on strepavidin magnetic beads
Hybridization mixture is sucked out, is added in the ready magnetic bead of step；10 mixings are blown and beaten with pipettor；Tubule is placed in PCR instrument 47 °C and is incubated 45 min (take out whirlpool every 15 min and shake 3 s to prevent magnetic bead from precipitating)；It is incubated after 45 min, mixture is transferred to from 0.2mL tubule in 1.5 mL EP pipes.
3. washing combines the Streptavidin MagneSphere of capture dna
1) EP pipes are placed in into magnetic frame up to liquid to clarify, supernatant is carefully removed with pipettor；
2) 100 L of power mouthful are preheating to 47 °C of I X cleaning buffer solutions I；
3) whirlpool shakes 10 s, mixes it；
4) EP pipes are placed in into magnetic frame up to liquid to clarify, supernatant is carefully removed with pipettor；
5) EP pipes are removed from magnetic frame, the rigorous cleaning buffer solutions of 1 X that 200 μ 1 are preheating to 47 °C are added, are mixed 10 times with pipettor piping and druming（Step operation rapid should make fluid temperature in pipe be not less than 47 °C to try one's best)；
6) 47 °C of 5 min of incubation;
7) repeat step 5) -7), washed twice with the rigorous cleaning buffer solutions of I X altogether；
8) EP pipes are placed in into magnetic frame up to liquid to clarify, supernatant is carefully removed with pipettor；
9) the I X cleaning buffer solutions I that power P200 L are placed at room temperature (is preheated without 47 °C）, whirlpool shake 2 min, mix it；
10) EP pipes are placed in into magnetic frame up to liquid to clarify, supernatant is carefully removed with pipettor；
The 1 l X Wash Buffer ll that 1) power P200 is placed at room temperature, whirlpool shakes 1 min, mixes it；
12) EP pipes are placed in into magnetic frame up to liquid to clarify, with the removal supernatant of pipettor carefully；
13) the I X Wash Buffer III that power P200 is placed at room temperature, whirlpool shakes 30 s, mixes it；
14) EP pipes are placed in into magnetic frame up to liquid to clarify, supernatant is carefully removed with pipettor；
15) EP pipes are removed from magnetic frame, the ultra-pure waters of 76 μ 1 are added（Without DNA is eluted from magnetic bead, it can directly enter performing PCR, 35 μ 1 of sampling carry out PCR reactions below）.The PCR of embodiment 5 reacts
PFX polymerases are taken out from the kit of -20 °C of preservations in advance and (are purchased from Invirtogen companies）, PFX reaction buffers（10 X), dNTP (10mM) o primer sequences are：
PCR Flowcell-Primer F ( 1 Opm/μΐ)
SEQ ID NO: 10 AATGATACGGCGACCACCGAGATC：.
PCR Flowcell-Primer (lOpm/μΙ)
SEQ ID NO: 11 CAAGCAGAAGACGGCATACGA
On PCR tubules, PCR reaction systems are configured according to form 6 per hole.
Table 6
DNA 35μ1
PFX enzyme Ι μ
The μ 1 of PFX reaction buffers (10*) 5
MgSO4 2μ1
dNTP(lOmM) 2μ1
Flowcell-primer-F 1 (lOpm/μΙ) 2.5μ1
Flowcell-primer- 1 (lOpm/μΙ) 2.5ul
Cumulative volume 50ul
Reaction condition is shown in Table 7.
Table 7
Temperature-time is circulated
94 °C 2min 1
94 °C 15s 14
58 °C 30s
72 °C 30s
72 °C 5min 1
4 °C of holdings
After PCR terminates, each sample Ampme Beads of 1.5 times of volumes are purified, and the PCR primer of recovery is dissolved in the ultra-pure waters of 30 μ 1, and Nanodrop 1000 surveys concentration.Machine is sequenced in the PCR primer of embodiment 6
Above-mentioned PCR primer after purification determines that size and Insert Fragment size are shown in Fig. 3 and Fig. 4 through 2100 Bioanalyzer (Agilent), and purified product size is respectively upper machine sequencing after 271bp and 876bp, QPCR accurate quantifications.In the present embodiment, the c-Bot and the specifications of HISEQ2000Hiseq 2000 that upper machine sequencing is announced according to Illumina/Solexa officials are operated.The information analysis of embodiment 7
The reads that lower machine data are polluted except deduplication and by joint, the essential information of the lower machine data of statistics（Library length；Reads length；Reads bar numbers；Base number；Repetitive rate etc.）；The 50bp bases before interception PE two reads, form a pair of a length of new reads of 50bp respectively, and new PE50 reads are compared software by B PE50reads c with soap（The reference sequences of-the V of-r 1 2) respectively with people（Hgl9) it is compared with the various reference sequences of HBV, a read is picked out from comparison result than the reference sequences to people and another a pair of the reads compared to HBV reference sequences;The very possible sites inserted across HBV of such reads；This part reads comparison informations are counted, are found in the insertion hot spot region of human genome.
Results of hybridization is shown in Table 8.
Table 8
Chrl9:30315005 , Chrl9:30315005 ,
Chrl9:30314586-30315653 sections of point positions 30,315,366 303153661
Chrl4:96085100-96085700 Chrl4:96085140 Chrl4:96085140
The result of table 8 is to obtain result using upper machine data, and sample L-170, L-800, Genome are all from same liver cancer sample, and L- 170 is Insert Fragment 170bp, and L-800 is 800bp libraries, and genome is genome sequencing.As can be drawn from Table 8 from the influence of accuracy of the manufacturing probe for capture genetic fragment, and fragment length.It can be stablized completely by the method for the present invention and reliable site, and required data volume is only 1% of sequencing data of whole genome or so.The reagent preparation box of embodiment 8
A kind of kit that can be used for detecting virus Integration Mode in sample to be tested, including it is following
(1) first container and positioned at container nucleic acid chip；
(2) second container and being used in container build the joint in sample library；
(3) the 3rd containers and the tab closure molecule in container；
(4) the 4th containers and the label closing molecule in container；
(5) the 5th containers and being used in container expand required reagent into performing PCR；
(6) the 6th containers and being used in container carry out the reagent needed for capping；
(7) the 7th containers and being used in container carry out the reagent needed for hybridization reaction；
(8) the 8th containers and being used in container carry out the reagent needed for sequencing reaction.
(9) specification is detected.
All documents referred in the present invention are all incorporated as reference in this application, are individually recited just as each document as with reference to such.In addition, it is to be understood that after the above-mentioned instruction content of the present invention has been read, those skilled in the art can make various changes or modifications to the present invention, and these equivalent form of values equally fall within the application appended claims limited range.
Claims (10)
1. a kind of nucleic acid probe collection, including multiple probes, it is characterised in that the probe collection has following characteristics:
(1) there is the dNTP of one or more biotin labelings on each probe;And/or
(2) dNTP of biotin labeling is 1 in the abundance that probe is concentrated:6-1 :2;And/or
(the 70%-100% of whole nucleotide sequences covering correspondence virus genome sequence of probe collection described in 3；Preferably, the probe collection has 1-20000 nucleic acid probe；It is preferred that the probe collection has 1000-5000 nucleic acid probe；More preferably, the probe collection has 2500 nucleic acid probes；
Preferably, the dNTP of the biotin labeling is 1 in the abundance that the probe is concentrated:4;
Preferably, have between the probe and partly overlap；
Preferably, the probe length is 100-500bp;It is preferred that the probe length is 200-300bp;More preferably, the probe length is 250bp;
Preferably, the probe is that, using viral genome as template, the amplification of PCR methods is obtained, it is preferred that the amplification template is hepatitis type B virus（HBV) genome, HCV（HCV) genome, AIDS virus（HIV) genome, papillomavirus（HPV) genome, or its combination；More preferably described sample is Type B HB V genomes and/or c-type HB V genomes.
2.-kind of surface is fixed with the nucleic acid chip of probe collection described in claim 1.
3. the purposes of nucleic acid chip described in nucleic acid probe collection described in claim 1 or claim 2, it is characterised in that for detecting Integration Mode of the virus in sample is treated；It is preferred that described Integration Mode is selected from the group：Rearrangement, dystopy, insertion, replacement, or its combination.
4. a kind of method for preparing nucleic acid probe described in claim 1, it is characterised in that including step：
(a) probe source sample is obtained；
(b) to step（A) sample obtained enters performing PCR amplification, and the dNTP of PCR amplification system is the dNTP of biotin labeling, obtains the pcr amplification product with biotin labeling；
(c) to step（B) pcr amplification product of the biotin labeling obtained enters Break Row, obtains the pcr amplification product of the biotin labeling of fragmentation, as probe；
It is preferred that step（A) sample has following characteristics：
Sample is the Virus Sample containing nucleic acid；And/or
The sample be virion, serum, blood, tissue samples, cast-off cells, epithelial cell, or its
Combination；And/or
The sample is selected from the group：Hepatitis type B virus（HBV), HCV（HCV), AIDS virus（HIV), papillomavirus（HPV), or its combination；And/or
The sample is Type B HBV and/or c-type HBV;
It is preferred that step（B) there are following characteristics：
Step（B) amplification described in is that viral DNA total length in sample is expanded；And/or
Step（B) dNTP of the mark is biotin-dNTP, and the dNTP of the mark can be combined with the affine magnetic bead of streptomysin；And/or
Step（B) dNTP of the mark and non-marked dNTP ratio are 1: 2-8；It is preferably in a proportion of 1: 3-6；More preferably ratio is 1: 4；
It is preferred that step（C) described interrupt is interrupted for ultrasonic method.
5. the method as described in claim 1, it is characterised in that also including step（d) ：
To step（C) probe obtained is purified and/or quantified.
6. the method as described in claim 1, it is characterised in that the length of the probe is 100-500bp;It is preferred that the length of the probe is 200-300bp, more preferably, the length of the probe is 250bp.
7. a kind of method for detecting virus gene integration mode in sample to be tested, it is characterised in that including step:
(i) sample to be tested is obtained；
(ii) to step（I) sample obtained carries out library construction；
(iii) probe and step included the probe collection described in claim 1（Ii) library obtained is hybridized, and captures the nucleotide sequence relevant with viral gene integration；
(iv) to step（Iii) nucleotide sequence of capture is expanded, and obtains the amplified production relevant with viral integrase；
(V) to step（Iv) amplified production obtained is sequenced, and obtains nucleic acid relevant with viral integrase mode
I oneself,；
It is preferred that step（I) there are following characteristics：
The sample to be tested is tissue, blood, cast-off cells, epithelial cell；And/or
The sample to be tested derives from people or non-human mammal, preferably from people；And/or
The sample to be tested derives from HBV infection person or liver cancer patient；
Preferably, step（Iii) there are following characteristics：
The probe is the single stranded DNA of denaturation;And/or
Tab closure molecule and label closing molecule are added in hybridization solution；And/or
The sequence of the tab closure molecule such as SEQ ID NO:Shown in 7；And/or
The label closes the sequence such as SEQ ID NO of molecule:8 and SEQ ID NO:Shown in 9.
8. method as claimed in claim 7, it is characterised in that in step（V in), sequencing probe fixed on described amplified production and solid phase carrier is hybridized, solid phase bridge-type PCR amplifications are carried out, sequencing cluster is formed；Then to it is described sequencing cluster with " while synthesis-while be sequenced " method is sequenced, so as to obtain information nucleic acid relevant with viral integrase mode.
9. method as claimed in claim 7, it is characterised in that in step（Ii in), described library construction is：End reparation is carried out to the genomic DNA interrupted, joint is added, the fragment with joint is expanded, the amplification mixture with joint of acquisition is sample library；
It is preferred that described joint has such as SEQ ID NO:L and SEQ ID NO:Sequence shown in 2；And/or constructed library has such as SEQ ID:3 and SEQ ID:Sequence label shown in 4.
10. a kind of kit available for any methods describeds of claim 7-9, it is characterised in that the kit includes：
(1) first container and positioned at the nucleic acid chip described in claim 2 in container, or the probe described in claim 1；
(2) second container and being used in container build the joint in sample library；
(3) the 3rd containers and the tab closure molecule in container；
(4) the 4th containers and the label closing molecule in container；
(5) specification is detected；
It is preferred that the kit also includes the reagent being selected from the group：
For enter performing PCR amplification needed for reagent,
For carry out reagent needed for capping,
For carry out reagent needed for hybridization reaction,
For carry out reagent needed for sequencing reaction,
Or its combination.
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| PCT/CN2011/082855 WO2013075313A1 (en) | 2011-11-24 | 2011-11-24 | Probe for detecting method of integration of virus in test sample and preparation method and use thereof |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN103975075A true CN103975075A (en) | 2014-08-06 |
Family
ID=48469012
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201180074786.6A Pending CN103975075A (en) | 2011-11-24 | 2011-11-24 | Probe for detecting method of integration of virus in test sample and preparation method and use thereof |
Country Status (3)
| Country | Link |
|---|---|
| CN (1) | CN103975075A (en) |
| TW (2) | TW201321519A (en) |
| WO (1) | WO2013075313A1 (en) |
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105787294A (en) * | 2014-12-24 | 2016-07-20 | 深圳华大基因研究院 | Method for determining probe set, kit and use thereof |
| CN111961763A (en) * | 2020-09-17 | 2020-11-20 | 生捷科技(杭州)有限公司 | Novel gene chip for detecting coronavirus |
| CN112322783A (en) * | 2020-10-19 | 2021-02-05 | 郑州大学 | Capture probe group for detecting hepatitis B virus gene |
| WO2023115555A1 (en) * | 2021-12-24 | 2023-06-29 | 深圳华大生命科学研究院 | Dna library sequence for increasing number of chip probes and application thereof |
Families Citing this family (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20150119260A1 (en) * | 2013-10-18 | 2015-04-30 | National Taiwan University | Circulating cancer biomarker and its use |
| US11319602B2 (en) * | 2017-02-07 | 2022-05-03 | Tcm Biotech Internationl Corp. | Probe combination for detection of cancer |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102203273A (en) * | 2008-09-09 | 2011-09-28 | 生命技术公司 | Methods of generating gene specific libraries |
Family Cites Families (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101818213B (en) * | 2010-04-20 | 2012-02-08 | 济南艾迪康医学检验中心有限公司 | Gene chip and kit for detecting human papillomavirus (HPV) |
-
2011
- 2011-11-24 WO PCT/CN2011/082855 patent/WO2013075313A1/en active Application Filing
- 2011-11-24 CN CN201180074786.6A patent/CN103975075A/en active Pending
-
2012
- 2012-11-23 TW TW101143949A patent/TW201321519A/en unknown
- 2012-11-23 TW TW101143948A patent/TW201321566A/en unknown
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102203273A (en) * | 2008-09-09 | 2011-09-28 | 生命技术公司 | Methods of generating gene specific libraries |
Non-Patent Citations (1)
| Title |
|---|
| 党双锁 编著: "《医学常用实验技术精编》", 30 June 2004, 世界图书出版西安公司 * |
Cited By (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105787294A (en) * | 2014-12-24 | 2016-07-20 | 深圳华大基因研究院 | Method for determining probe set, kit and use thereof |
| CN105787294B (en) * | 2014-12-24 | 2018-09-14 | 深圳华大生命科学研究院 | Determine method, the kit and application thereof of probe collection |
| CN111961763A (en) * | 2020-09-17 | 2020-11-20 | 生捷科技(杭州)有限公司 | Novel gene chip for detecting coronavirus |
| CN112322783A (en) * | 2020-10-19 | 2021-02-05 | 郑州大学 | Capture probe group for detecting hepatitis B virus gene |
| WO2023115555A1 (en) * | 2021-12-24 | 2023-06-29 | 深圳华大生命科学研究院 | Dna library sequence for increasing number of chip probes and application thereof |
Also Published As
| Publication number | Publication date |
|---|---|
| TW201321566A (en) | 2013-06-01 |
| TW201321519A (en) | 2013-06-01 |
| WO2013075313A1 (en) | 2013-05-30 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN106498040B (en) | A kind of molecular labeling microballon and the unicellular sequencing approach of high throughput based on the molecular labeling microballon | |
| US9862995B2 (en) | Measurement of nucleic acid variants using highly-multiplexed error-suppressed deep sequencing | |
| US20230340590A1 (en) | Method for verifying bioassay samples | |
| JP5249581B2 (en) | Nucleic acid isolation and amplification method | |
| CN115516109A (en) | Method for detecting and sequencing barcode nucleic acid | |
| CN116438316A (en) | Cell-free nucleic acid and single cell combinatorial analysis for oncology diagnostics | |
| JP2003527867A (en) | Microarray-based analysis of polynucleotide sequence alterations | |
| CN105934523A (en) | Multiplex detection of nucleic acids | |
| CN104254617B (en) | Method of dna detection and quantification by single-molecule hybridization and manipulation | |
| TW201321518A (en) | Method of micro-scale nucleic acid library construction and application thereof | |
| CN115896252A (en) | Methods and products for local or spatial detection of nucleic acids in tissue samples | |
| JP2012105679A (en) | Method for providing dna fragment derived from remote sample | |
| JP2018509178A (en) | Highly parallel nucleic acid and accurate measurement method | |
| CN105899680A (en) | Nucleic acid probe and method of detecting genomic fragments | |
| JP7051677B2 (en) | High Molecular Weight DNA Sample Tracking Tag for Next Generation Sequencing | |
| CN103975075A (en) | Probe for detecting method of integration of virus in test sample and preparation method and use thereof | |
| ES2877205T3 (en) | Sample preparation for nucleic acid amplification | |
| US9862988B2 (en) | Methods and kits for breaking emulsions | |
| CN111154754A (en) | Probe set for analyzing DNA sample and method for using the same | |
| KR20220156837A (en) | Spatially resolved single cell RNA sequencing method | |
| CN110914449A (en) | Construction of sequencing libraries | |
| Sun et al. | Recent advances and current issues in single-cell sequencing of tumors | |
| CN114729349A (en) | Method for detecting and sequencing barcode nucleic acid | |
| WO2022115279A1 (en) | Improved measurement of nucleic acids | |
| CN110172530A (en) | A kind of probe and detection method for HPV detection |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C41 | Transfer of patent application or patent right or utility model | ||
| TA01 | Transfer of patent application right |
Effective date of registration: 20150924 Address after: Yantian District of Shenzhen City, Guangdong province 518083 Hongan street No. 21 China Comprehensive Park 7 Building 7 layer -14 layer Applicant after: BGI SHENZHEN CO LTD Address before: North Road No. 146, building 11F-3 Industrial Zone in Yantian District of Shenzhen city of Guangdong Province in 518083 Applicant before: BGI-Shenzhen Co., Ltd. Applicant before: BGI-Shenzhen |
|
| C12 | Rejection of a patent application after its publication | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20140806 |