CN105899680A - Nucleic acid probe and method of detecting genomic fragments - Google Patents

Nucleic acid probe and method of detecting genomic fragments Download PDF

Info

Publication number
CN105899680A
CN105899680A CN201480072154.XA CN201480072154A CN105899680A CN 105899680 A CN105899680 A CN 105899680A CN 201480072154 A CN201480072154 A CN 201480072154A CN 105899680 A CN105899680 A CN 105899680A
Authority
CN
China
Prior art keywords
sequence
target
probe
fragment
nucleic acid
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Granted
Application number
CN201480072154.XA
Other languages
Chinese (zh)
Other versions
CN105899680B (en
Inventor
C·O·F·达尔
J·O·埃瑞克森
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Suzhou Sym Bio Lifescience Co Ltd
Original Assignee
Vanadis Diagnostics AB
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Vanadis Diagnostics AB filed Critical Vanadis Diagnostics AB
Priority to CN201810535249.0A priority Critical patent/CN108707652B/en
Publication of CN105899680A publication Critical patent/CN105899680A/en
Application granted granted Critical
Publication of CN105899680B publication Critical patent/CN105899680B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6813—Hybridisation assays
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6813—Hybridisation assays
    • C12Q1/6816—Hybridisation assays characterised by the detection means
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6813—Hybridisation assays
    • C12Q1/6816—Hybridisation assays characterised by the detection means
    • C12Q1/682—Signal amplification
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6813—Hybridisation assays
    • C12Q1/6832—Enhancement of hybridisation reaction
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6813—Hybridisation assays
    • C12Q1/6834—Enzymatic or biochemical coupling of nucleic acids to a solid phase
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6844—Nucleic acid amplification reactions
    • C12Q1/6853—Nucleic acid amplification reactions using modified primers or templates
    • C12Q1/6855—Ligating adaptors
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2521/00—Reaction characterised by the enzymatic activity
    • C12Q2521/50—Other enzymatic activities
    • C12Q2521/501—Ligase
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2525/00—Reactions involving modified oligonucleotides, nucleic acids, or nucleotides
    • C12Q2525/10—Modifications characterised by
    • C12Q2525/161—Modifications characterised by incorporating target specific and non-target specific sites
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2525/00—Reactions involving modified oligonucleotides, nucleic acids, or nucleotides
    • C12Q2525/10—Modifications characterised by
    • C12Q2525/191—Modifications characterised by incorporating an adaptor
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2525/00—Reactions involving modified oligonucleotides, nucleic acids, or nucleotides
    • C12Q2525/30—Oligonucleotides characterised by their secondary structure
    • C12Q2525/301—Hairpin oligonucleotides
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2525/00—Reactions involving modified oligonucleotides, nucleic acids, or nucleotides
    • C12Q2525/30—Oligonucleotides characterised by their secondary structure
    • C12Q2525/307—Circular oligonucleotides
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2531/00—Reactions of nucleic acids characterised by
    • C12Q2531/10—Reactions of nucleic acids characterised by the purpose being amplify/increase the copy number of target nucleic acid
    • C12Q2531/125—Rolling circle
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2537/00—Reactions characterised by the reaction format or use of a specific feature
    • C12Q2537/10—Reactions characterised by the reaction format or use of a specific feature the purpose or use of
    • C12Q2537/143—Multiplexing, i.e. use of multiple primers or probes in a single reaction, usually for simultaneously analyse of multiple analysis

Abstract

Provided herein, among other things, is a method of processing a nucleic acid sample. In some embodiments, the method comprises a) hybridizing a sample comprising a target fragment to a nucleic acid probe comprising: i. a head sequence and a tail sequence, wherein the head and tail sequences are at the ends of a first oligonucleotide molecule; and ii. a splint sequence comprising, in order: an upstream flanking sequence that is complementary to the head sequence; a target complementary sequence that is complementary to the target fragment; and a downstream flanking sequence that is complementary to the tail sequence; thereby producing a hybridization product in which the ends of the target fragment are ligatably adjacent to the ends of the head and tail sequences in the first oligonucleotide molecule;; and b) ligating the ends of the target fragment to the ends of the head and tail sequences of the first oligonucleotide molecule, thereby producing a cyclic product that comprises the target fragment and the head and tail sequences. Probes and kits for performing the method are also provided.

Description

Nucleic acid probe and the method for detection genomic fragment
Cross reference
This application claims the power of the GB App. Nos 1321191.7 submitted on December 2nd, 2013 Benefit, described application is hereby incorporated herein by.
Invention field
It relates to for the probe detecting the specific nucleic acid sequence in biological specimen, especially The probe used in the multiple applications at the multiple particular sequence of parallel detection, and relate to it In this kind of probe for detecting the method for fragment of nucleic acid.Specifically, it relates to targeting From the DNA fragmentation of specific chromosome for downstream analysis.
Background
Human haploid genome comprises 3,000,000,000 base-pairs being packaged in 23 chromosomes, and And diploid gene group has 6,000,000,000 base-pairs in 23 pairs of chromosome.Modern order-checking skill The rapidity of art and convenience make many diagnosis problems can use the whole genome of individuality Or the high-flux sequence of the total amount of the DNA in sample studies.But, for many DNA For diagnostic application, it is only necessary to research genome subgroup, thus concentrate on known with studied The relevant one or more regions of particular condition.
Have been described for many technology of complexity for reducing genome before analysis.Only Need analyze genome single short district in the case of, this can use Direct PCR use appoint The primer amplification sequence of the known region on side is carried out.But, when wishing amplification gene group Many regions of sample are for when analyzing, and amplification illusion can be as in same reactant mixture one Act the result appearance performing multiple different amplification.
WO2003/044216 (Parallele Bioscience, Inc.) and US20090004701A1 (Malek Faham) describes a kind of method of multiplex amplification target nucleic acid, the most common few nucleosides Acid primer is connected to the site of single-chain nucleic acid fragment internal.Common priming site is affixed to many Each to allow its stoichiometry to expand in individual different target sequence.
WO2005/111236 (Olink AB) also illustrates a kind of by amplification particular target sequence mirror The method of the sequence in others' genome.Described method relates to genome sample fragment chemical conversion tool There is the fragment of at least one end sequence determined.Make selection all comprising primer to motif Construct (selector construct) contacts with described fragment.After connection, use to The primer selecting son total has specific primer to the target selected by parallel amplification to motif Sequence.The sub-construct of selection described in WO2005/111236 has and short oligonucleotide The long oligonucleotide of hybridization, the sub-construct of each selection has and the limit of the fragment containing target sequence Determine one or two protruding terminus that end sequence is complementary.Described selection is made to contact with target fragment Cause the hybridization between one or more protruding terminuses selecting son of the described target fragment.Have In the case of single selection of two protruding terminuses, this hybridization produces cyclisation construct.? In the case of each having a pair selection of a jag, this forms linear construct.Contain The connection selecting sub-construct and the order-checking that have target fragment allow to measure target sequence.Because selecting son Construct only hybridize with the end section of the fragment containing target sequence (or with an end section and One interior section hybridization), the most described method allows selection different in non-hybridization portion Target sequence, so that the sub-molecule of each selection can be from multiple different target sequence hybridization.Then The identity of accurate target is determined by construct being expanded and checking order. WO2005/111236 is proposed in the method analyzing hereditary variability to use and selects son or use Son is selected to measure for DNA copy number.
GB2492042 describes a kind of version selecting submethod, wherein makes fragment and bag Contact containing the partially double stranded probe selecting sub-oligonucleotides and at least one carrier oligonucleotides. Select sub-oligonucleotides to comprise target fragment and there are specific two non-adjacent districts and comprise The non-target specific regions of at least two binding site of carrier oligonucleotides.Carrier widow's nucleosides Acid not with target complement sequence, and comprise with to select the carrier binding site on sub-oligonucleotides mutual The nucleotide sequence mended.Carrier oligonucleotides also comprises the element for detecting/being enriched with.Institute State in method, the complementary portion of probe oligonucleotides is hybridized with target fragment, connects carrier subsequently Oligonucleotides and target, to produce probe-target fragment heterozygote, then detect described heterozygote.
The exploitation selecting sub-technology is entered in WO2011/009941 (Olink Genomics AB) Having gone description, it describes and the one end because of the fragment of group DNA through digestion base is connected to probe. With two regions relating to being bound to target fragment and sequence the most to be separated generally by known The sub-probe that previously selects that two regions of sequence combine is compared, the spy in WO2011/009941 Pin is described in the case of only existing a known region of sequence using. Some embodiments of probe in WO2011/009941 comprise the unit for being fixed to solid phase Part.Target nucleic acid fragment causes the stable capture of target fragment with the connection of probe and allows to use height Spend strict washing step to remove and be not connected with fragment, thus produce high specific.
It is also known that padlock probe (padlock probe).Padlock probe is to have in end Target complementary series and the linear oligonucleotide of non-target complementary series between end.When with just Really during target DNA sequence hybridization, two ends of described probe and can pass through the most together DNA ligase connects.Connect by the mispairing suppression connecting junction point, therefore padlock probe Be successfully connected the high degree of specificity hybridization depended on target sequence, thus allow described probe region Divide the most similar target sequence and optionally pin its accurate target.Due to double-stranded DNA Helical nature, described circularizing probes strand is connected to target dna strand.
The padlock probe of known use rolling-circle replication amplification link, also referred to as rolling circle amplification.Rolling ring It is replicated in US 5,854,033 (Lizardi) and is described.Rolling-circle replication is to use strand displacement Archaeal dna polymerase amplification circular nucleic acid molecules, thus produce the tandem sequence repeats containing extension increasing sequence The big DNA molecular of sequence.Archaeal dna polymerase is catalyzed the lasting rolling ring carried out in the case of required Primer in polymerisation extends and strand displacement.It produce higher than single PCR replication cycle and The amplification of the circularizing probes sequence of the multiple order of magnitude of other amplification techniques, the most each circulation is limited to The copy number purpose of target sequence doubles.The cascade that can use strand replacement reaction obtains additionally expansion Increase.
Fredriksson et al. (Nucleic Acids Res.35 (7): e47 2007) describes " gene receipts Storage (Gene-Collector) ", a kind of for using the homology contained with required PCR primer to draw The method of the collector probe multiple amplification of nucleic acid of the flanking sequence that thing end sequence is complementary, so that To be formed together with obtaining the end that collector probe makes PCR primer with the combination of PCR primer DNA circle.Then rolling circle amplification is used to carry out universal amplification to produce the concatermer of target sequence End product.The method allows the correct amplicon optionally detecting in multi-PRC reaction, Because the end sequence of correct amplicon be homologous primer to and by collector circularizing probes, And combine from a pair primer with from draw another to PCR illusion be not cyclized.
Summary of the invention
The disclosure provides the improvement of the genomic DNA for analyzing nucleic acid fragment such as fragmentation Method and probe.Some embodiments of the present invention relate to probe and it is for target strand core Purposes in the method for the existence test sample of acid fragment.Some embodiments of the present invention relate to Probe, described probe comprises
Target oligonucleotide, its containing promising target fragment complementary series target-complementary sequence and with The flanking sequence that described target-complementary sequence is adjacent, and
There are free 5 ' or the 3 ' oligonucleotide sequences held,
Hybridization between wherein said fragment and described probe makes target fragment template for even It is connected to free 5 ' or the 3 ' ends of oligonucleotide sequence.
Some embodiments of the present invention further relate to hybridize along the length of single-chain nucleic acid fragment and connect It is connected to the probe of each end of described fragment.Described probe comprises and has the free 5 ' oligonucleotides held Sequence and have the free 3 ' oligonucleotide sequences held, for being connected to each of described target fragment End.Then detection connects product, thus allows the high degree of specificity target of described restriction nucleic acid fragment To and detection.
The method of some embodiments according to the present invention can include DNA is digested to have limit The fragment of fixed sequence, making gained DNA fragmentation sex change is single-chain fragment (target) and by described Target mixes with probe as described herein.Described target is used for the hybridization generation of described probe The template connected is to be connected to corresponding probe to produce ring-type or line by described target specificity Property connect product.Then described connection product can such as be come by exonuclease or solid state chemistry Enrichment, and expand optionally by rolling circle amplification, PCR or other DNA cloning methods.
The key advantage of some embodiments of the present invention is parallel parsing a large amount of DNA sheet Section.A large amount of DNA fragmentations can be used for downstream analysis by specifically targeting and selection.This is special The noninvasive antenatal exaination (NIPT) of the acellular foetal DNA be applicable to parent blood flow, wherein Thousands of chromosome specific DNA fragmentations are carried out counting generation point-device quantitatively.
On the one hand, it is provided that a kind of method of existence test sample for target nucleic acid.Described method It is usually directed to produce and limits target nucleic acid fragment, make described sample miscellaneous with the length along described target fragment Hand over and provide the probe at attachable abutment to contact in 3 ' and 5 ' ends of described fragment, Described target fragment is connected at described 3 ' and 5 ' ends described probe, and then detection is logical Cross the new nucleic acid molecules that dual connection event is formed.
On the one hand a kind of method providing existence test sample for target nucleic acid, described method bag Include:
I () provides the sample of fragmented nucleic acids
(ii) providing Denaturing, under described Denaturing, described target fragment is strand
(iii) making described sample contact with nucleic acid probe, described nucleic acid probe comprises
Target oligonucleotide, described target oligonucleotide than described target sheet segment length and comprises inside Target-complementary sequence, so that the hybridization shape between described target oligonucleotide and described target fragment Become between the upstream flanking sequence and downstream flanking sequence of described target oligonucleotide is double Chain-ordering, and
It is respectively provided with 5 ' free end and the 3 ' header sequence held and tail sequence, wherein said Header sequence and tail sequence are complementary with described upstream flanking sequence and downstream flanking sequence respectively,
(iv) annealing conditions, the most described header sequence and tail sequence and institute are provided State flanking sequence hybridization, and described target fragment (if present) is miscellaneous with described target-complementary sequence Hand over, thus the end of described target fragment is positioned to and the 5 ' of described header sequence end and described tails 3 ' end juxtapositions of portion's sequence
V () provides the condition for connecting, so that if there is target fragment, then by described target 3 ' ends of fragment are connected to 5 ' ends of described header sequence and connect abutment to form first, and And 5 ' ends of described target fragment are connected to 3 ' ends of described tail sequence to form the second connection Abutment, thus produce the product of dual connection, described product comprises the continuous chain of nucleic acid, institute State nucleic acid and comprise described header sequence and tail sequence and described target fragment, and
(vi) detect whether to exist the product of described dual connection,
Wherein detect that the product of described dual connection indicates target fragment described in described sample Exist.
Select with other DNA of great majority and compared with detection method, the inventive method is at whole core Acid fragment is to limit in advance or predetermined i.e. the most known in the sequence of described target fragment Time be useful especially.In some embodiments of the inventive method, described target fragment is core Acid specific fragment product rather than such as by physics mode as shear or ultrasonic place The product of the random fragmentation that reason produces.The specific fragmentization of nucleic acid can use restriction enzyme, PCR or other sequences orientation fragment ends limit and realize.
Wish that target oligonucleotide contacts whole target fragment to guarantee the specific of accurate target sequence In conjunction with.This is contrasted with earlier processes, in described earlier processes, probe be designed to One of described fragment end or the hybridization of multiple end and/or with interior zone hybridization and not along target fragment Length combine.Really, having a mind to during the limited combination with target fragment is many probes in early days Design feature, because it allows the targeting and detect described when only part is known for the sequence of fragment Section.By the fragment of specifically targeting known array be limited by by colony the most equal The possibility of the slight sequence variability that position gene produces, the present invention under applicable circumstances The probe of method and method can allow accurately combine with low-down false positive results risk and examine Survey required target fragment.
The dual connection of described target fragment can further help in the high specific of described method.Institute State probe to become to be connected to target sequence at each end, be i.e. connected to nucleic acid single-chain fragment 5 ' end and 3 ' ends.Therefore, the end of the target specifically produced by fragmentation can by with header sequence Connect with the sequence-specific of tail sequence and specifically detect.The sequence specific of described connection Property character by target fragment with and header sequence and tail sequence and target oligonucleotide The sensitivity of the requirement of hybridization and the DNA ligase by being suppressed by base-pair mismatch realizes. Target fragment and the hybridization of target oligonucleotide contribute to combine specific, but with relative at target 3 ' ends of fragment provide the highest selective coupled reaction to compare with the mispairing at 5 ' ends, described Hybridization is farthest stabilization removal by the inside mispairing in the core of target.
Described target oligonucleotide is for target fragment described in templating and described header sequence and tail The connection of portion's sequence.Described header sequence and tail sequence hybridize with described flanking sequence, thus Room is limited between the 5 ' ends and 3 ' ends of described tail sequence of described header sequence.Described Target fragment and target-complementary sequence hybridize in described room, thus by the end of described target fragment It is positioned to 3 ' the end juxtapositions with the 5 ' of described header sequence ends and described tail sequence.Preferably, Described target fragment and described header sequence and tail sequence produce two completely with probe anneals The attachable abutment of coupling.The product of described dual connection followed by comprises described head sequence The continuous chain of the nucleic acid of row and tail sequence and described target fragment.
Contain the multiple possible design of described probe.Such as, for being connected to the 5 ' of target fragment End and 3 ' ends can be provided by the header sequence in two independent backbone oligonucleotides and tail sequence, Or by formed ring-type with target fragment is positioned at 5 ' end with 3 ' hold between single main chain widow's core Header sequence and tail sequence at the associated end of thuja acid provide.
In the first situation (two single backbone oligonucleotides), described target fragment is with described The connection of two backbone oligonucleotides produces and is included between described header sequence and tail sequence The linear chain of nucleic acid of target fragment.
In the second situation (single cyclic backbones oligonucleotides), the connection of described target fragment is produced The ring of the nucleic acid of the raw target sequence being included between described header sequence and tail sequence.
In other patterns, one or two in header sequence and tail sequence may be provided on Described target oligonucleotide itself so that described target oligonucleotide shape under annealing conditions Structure circlewise.Depending on design, the product of the most described dual connection can be Linear or circular nucleic acid molecules.
The detection of described product depends on described target fragment and described header sequence and tail sequence Be successfully connected to be formed the continuous chain of nucleic acid.Two kinds of connection events are needed it is said that in general, use All occur to produce the method for signal to detect the product of described dual connection.Such as, detection Can include across two connect abutments amplification (such as, by PCR or, for the cyclisation of probe Embodiment, rolling-circle replication) or capture continuous nucleic acid chains at one end and detect its other end. Described target fragment is with described probe by the covalently bound formation strong bond being connected, and the strictest washes Washing and can be used for removing the nucleic acid being not connected with, wherein said header sequence and the non-covalency of tail sequence are even Connecing, the phase mutual cross of described sequence and target oligonucleotide is destroyed by washing.
These features of described method and described probe realize the high specific of target fragment and select.When When described method is applied to parallel Multiple detection multiple target fragment, target nucleic acid point-device Detection and be quantitatively possible.Due to its high specific, the method for the present invention can be particularly suitable for Diagnostic uses in small sample and/or for detecting the least of the different target nucleic acids of relative quantity Difference, such as diagnosing the aneuploidy of the fetal chromosomal of the sample from maternal blood, Or for detection from the trace Tumour DNA in the sample of the normal structure of patient existence or Detect the nucleic acid fragment from infectious agent.
There is high specific target fragment identification allow to use relatively high concentration and probe concentration not produce Raw false positive signal, thus improve productivity and reaction efficiency.This can have height in diagnostic application Degree importance, in described diagnostic application, low variability is important, and in such as NIPT By analyze acellular DNA, detect acellular circulation cancer DNA and detection from The DNA of infectious agent, target may exist with low number.Some embodiment party of the inventive method Case realizes the high specific analysis of short dna fragment, and it analyzes blood or formalin being used for In the application of the fixing fragmentation acellular DNA of DNA sample in paraffin-embedded DNA There is importance.
With reference to Fig. 3 and Fig. 4, the most especially provide a kind of method processing sample of nucleic acid.One In a little embodiments, described method comprises the steps that sample a) making to comprise target fragment (" DNA target mark ") This (such as, with restriction enzymic digestion sample) with comprise following nucleic acid probe hybridization: i. head Portion's sequence and tail sequence, wherein said header sequence and tail sequence divide at the first oligonucleotides The end of son；And ii. clamping plate sequence (wherein term " clamping plate sequence " refers to oligonucleotides In when with two or more other multi-nucleotide hybrids, serve as " clamping plate " with by described multinuclear Thuja acid is positioned to adjacent one another are so that they sequences that can be joined together, as at Fig. 3 and Shown in 4).As shown in figs. 3 and 4, the clamping plate sequence that uses in this method ( Under certain situation, it is referred to as " target oligonucleotide ") comprise the upstream side complementary with header sequence Wing sequence；Target-complementary sequence with target fragment complementation；And the downstream complementary with tail sequence Flanking sequence.This hybridization step produces hybrid product, and the end of its fragment that hits is the most adjacent Header sequence in nearly first oligonucleotide molecules and the end of tail sequence, wherein term " can Connect neighbouring " mean two kinds of widows under the background of two sequences the most located adjacent one another There is not insertion nucleotides between nucleotides and they can use ligase to be connected to each other.Institute The next step stating method includes the end of described target fragment b) is connected to the described first few core The header sequence of thuja acid molecule and the end of tail sequence, thus produce comprise described target fragment with And described header sequence and the cyclic products of tail sequence.Described Connection Step figure 1 illustrates (as shown in figures 3 and 4, although described method can be implemented in a number of different manners, and And so in the first step of described method, the nucleic acid probe of use can be few by one or both Nucleotides forms).
Cyclisation product provides the remarkable advantage for detection, because they can pass through rolling circle amplification (RCA) expand.RCA produces copying of hundreds of or thousands of cyclisation product in individual molecule Shellfish, thus effectively amplification cyclisation product and make its use such as with the motif in described product The oligonucleotides of the mark of hybridization is relatively easy to detect.
As shown in FIG. 1, described method may also include the sequence (example used with nucleic acid probe As, header sequence, tail sequence or the sequence between it) primer that hybridizes passes through rolling circle amplification Expand described cyclic products.In these embodiments, described method may also include quantitative institute The number of the rolling circle amplification product produced, thus the amount of the described target fragment in described sample is provided Estimation.In these embodiments, described product can use and the sequence in somewhere in cyclic products The complementary primer of row carries out expanding to produce multiple RCA product by rolling circle amplification, such as, Corresponding to single, the product of " clone's " fragment.The number of rolling circle amplification product can be by such as In the following manner is estimated: is distributed on the surface of support (slide) by RCA product, makes With oligonucleotides (such as, fluorescently-labeled oligonucleotides) the hybridization RCA product of mark and so Afterwards by microscope (such as fluorescence microscope) to the discrete signal in the region of described support Number count.Mark can before described product has been distributed on described support or Carry out afterwards, and comprise the several thousand copies of identical sequence, institute because of every kind of RCA product So that the thousands of binding sites of the oligonucleotides of mark should be there are, thus increase signal.Many RCA product corresponding to two coloured differently bodies (such as, is wherein counted by weight embodiment Number) in, the RCA product corresponding to item chromosome can be with a kind of fluorogen mark and right With different fluorogen marks, thus list should can be allowed in the RCA product of another item chromosome Solely different RCA products is counted.
The most meaningful from the signal of independent RCA product, because applying (example in many As, by analyzing the noninvasive pre-natal diagnosis that acellular DNA is carried out) in, corresponding to specific dye The number of the fragment of colour solid (such as, chromosome 21) needs extremely accurate and unbiased ground measures. Typical assay use PCR, PCR are the program of very bias as is well known, Expand with higher efficiency than other sequences in some sequences.This makes the strategy of PCR-based It is unpractiaca for many diagnostic works.
In an alternate embodiment and as shown in fig. 1, target fragment can be expanded by PCR and Quantitatively.As will be apparent from, the flanking sequence being added into target fragment and/or PCR primer can With the reversible terminator method of such as Illumina, the pyrosequencing method (454) of Roche, Life Technologies by connect order-checking (SOLiD platform) or Life Technologies Ion Torrent platform in use compatible.The example of this kind of method is described in below with reference to document In: Margulies et al. (Nature 2005 437:376 80)；Ronaghi et al. (Analytical Biochemistry 1996 242:84–9)；Shendure(Science 2005 309:1728)； Imelfort et al. (Brief Bioinform.2009 10:609-18)；Fox et al. (Methods Mol Biol.2009；553:79-108)；Appleby et al. (Methods Mol Biol. 2009；513:19-39) and Morozova (Genomics.2008 92:255-64), described reference Document is herein incorporated by reference for described method and the concrete steps of described method, including The general description of each all initial product, reagent and the end product in described step. In these embodiments, cyclic products can be expanded and check order, and the sheet in sample The abundance of section can count by the sequence corresponding to described fragment is read the number of section (read) Estimate.
In certain embodiments and as shown in Figure 3, clamping plate sequence can with header sequence and In the molecule that tail sequence is different, i.e. " second " oligonucleotide molecules.So, in described method The nucleic acid probe started with can by two kinds of oligonucleotides (" main chain " and " targeting " oligonucleotides, Composition as shown in Figure 3).
In other embodiments and as shown in Figure 4, clamping plate sequence can with header sequence and In the molecule that tail sequence is identical, i.e. in " first " oligonucleotide molecules.So, described The nucleic acid probe that method starts with can be made up of single oligonucleotides.
Target-complementary sequence can have any length, and this depends on the target-complementary in nucleic acid probe The length of sequence.In some embodiments, the length of target-complementary sequence is 10 to 100 Individual nucleotides, such as, 10 to 50 or 10 to 30 nucleotides.As indicated below, target Mark complementary series comprises the one or more mispairing (such as, 1,2,3,4,5 with target fragment Or 6 or more, reach 10 or more), and in some cases, target-complementary The reverse complementary sequence of sequence can be with described target fragment at least 80%, at least 90% or at least 95% Identical.
Depending on design, flanking sequence can have any length.In some embodiments, side The length of wing sequence is 10 and 40 nucleotides, such as, and 10 and 30 nucleotides.
In some embodiments, described sample can comprise genomic DNA, such as, from The fragment of the genomic DNA of the most any organism, described organism includes but not limited to Plant, animal (such as, reptile, mammal, insect, worm, fish etc.), group Knit sample, bacterium, fungi (such as, yeast), bacteriophage, virus, cadaveric tissue, archaeology / ancient sample etc..In certain embodiments, the genomic DNA in described method can Being derived from mammal, the most described mammal is people.Exemplary In embodiment, genome sample can comprise the genomic DNA from mammalian cell, Described mammal such as people, mouse, rat or MC.Described sample can be by the cell cultivated Or the cell of clinical sample makes, the such as biopsy of legal medical expert's sample, scraping or lavation or thin Born of the same parents' (that is, cell of the sample collected in scene of a crime).In a particular embodiment, nucleic acid sample Originally can obtain from biological specimen such as cell, tissue, body fluid and ight soil.Target body fluid include but not It is limited to, blood, serum, blood plasma, saliva, mucus, phlegm, celiolymph, liquor pleurae, tear Liquid, latex dust liquid, lymph liquid, sputum, celiolymph, synovial fluid, urine, amniotic fluid and essence Liquid.In a particular embodiment, sample can be from experimenter, and such as people obtains.Implement at some In scheme, the sample analyzed can be from blood, such as, obtain from the blood of pregnant female The sample of Cell-free DNA.In certain embodiments, genomic DNA can be at fragmentation Whole genome amplification method is the most such as used to expand.
In clamping plate sequence in the embodiment of the second oligonucleotide molecules (as shown in Fig. 3), Described second oligonucleotides can additionally comprise the capture portion that can be used for being enriched with cyclic products.At this In a little embodiments, described method comprises the steps that c) by combining described capture portion by ring-type product Thing is fixed to solid phase；And d) wash described solid phase to remove the nucleic acid being not connected with and other reactions Component；Thus it is enriched with described cyclic products.Such as, the second oligonucleotides can comprise biotin portion Point, such as biotin or biotin analog such as desthiobiotin, oxybiotin, 2 '-Asia Aminobiotin, diaminobiotin, biotinylsulfoxide, biocytin etc., with or without joint, Such as ,-LC-biotin ,-LC-LC-biotin ,-SLC-biotin or-PEGn-are biological Element, wherein n is 3-12, and cyclic products can use the matrix being coupled to Streptavidin Enrichment.The affinity of the mould Avidin of biotin-binds is at least 10-8M。
For in noninvasive antenatal exaination embodiment, target fragment may be from human chromosome 21,13 Or 18.
In some embodiments, (such as, described method includes making sample and one group at least 50 At least 100, at least 200, at least 500, at least 1,000, at least 2,000 or at least 5,000) Individual described probe hybridizes, and wherein said probe targeting is at same chromosome (such as, human chromosome 21,13 or 18) different fragments on, and wherein said method produce comprise target fragment Multiple cyclic products.The quantity of produced cyclic products can expand by such as using RCA They and the quantity of RCA product carried out counting carry out quantitatively, as mentioned above.
In some embodiments, described method includes making described sample and described group of nucleic acid probe In first group and second group hybridization, described in the targeting respectively of wherein said first and second groups of probes The first chromosome in sample and the second chromosome in described sample (that is, with fragment hybridization and Connect to produce cyclic products, as mentioned above)；Described ring is expanded by rolling circle amplification (RCA) Shape product and compare the quantity of the RCA product corresponding to described the first chromosome with corresponding to institute State the quantity of the RCA product of the first chromosome, thus provide from the dyeing in described sample The estimation of the relative quantity of the DNA of body.
In some embodiments, described method includes making described sample and described group of nucleic acid probe In first group and second group hybridization, described in the targeting respectively of wherein said first and second groups of probes Firstth district of the chromosome in sample and the secondth district (that is, hybridize with fragment and are connected to produce ring Shape product, as mentioned above)；Expand described cyclic products by rolling circle amplification (RCA) and compare Quantity corresponding to the RCA product in described the first chromosome district dyes with corresponding to described second The quantity of the RCA product in body district, thus provide from the chromosomal region in described sample The estimation of the relative quantity of DNA.Such as, this embodiment can be used for differentiating such as to lack or multiple System.
Composition is also provided herein, and described composition comprises nucleic acid probe, described nucleic acid probe bag Containing: i. header sequence and tail sequence, wherein said header sequence and tail sequence are first At the opposite end of oligonucleotide molecules；And ii. clamping plate sequence, described clamping plate sequence comprises successively: The upstream flanking sequence complementary with described header sequence, with the target fragment complementation in human genome Target-complementary sequence and the downstream flanking sequence complementary with described tail sequence；Wherein said spy Pin is designed such that when described first oligonucleotides, described clamping plate sequence and described target fragment When hybridizing each other, the end of described target fragment is joinably adjacent to described first oligonucleotide molecules In header sequence and the end of tail sequence.In certain embodiments, described composition can Comprise first group at least 50 (such as, at least 100, at least 200, at least 500, at least 1,000, At least 2,000 or at least 5,000) individual nucleic acid probe, the target-complementary sequence of wherein said probe Different target fragment complementations with the first chromosome (such as, chromosome is 21,13 or 18).
In certain embodiments, (such as, extremely described composition can comprise second group at least 50 Few 100, at least 200, at least 500, at least 1,000, at least 2,000 or at least 5,000) Individual described nucleic acid probe, the target-complementary sequence of probe described in wherein said second group of probe with The different target fragment complementations of the second human chromosome.In some embodiments, the first chromosome Can be chromosome 21 and the second human chromosome can be chromosome 13 or 18.At some In the case of, the second human chromosome is not chromosome 21,13 or 18.
Accompanying drawing is sketched
Skilled artisan will appreciate that, figures described below is for illustration purposes only.These accompanying drawings It is not intended to limit by any way the scope of this teaching.
Fig. 1 schematically shows an embodiment of subject methods, wherein forms cyclic DNA Molecule and by RCA or PCR expand described ring-shaped DNA molecule.
Fig. 2 schematically shows an embodiment of subject methods, wherein forms linearly connected Product and with solid-phase reagent be enriched with described linearly connected product.
Fig. 3 illustrates the probe comprising the cyclized backbone oligonucleotides being bound to its target fragment.Described Probe is with two kinds of patterns, A and B illustrates.
Fig. 4 illustrates the single oligonucleotide probe of cyclisation of the target fragment with combination.
Fig. 5 illustrates had combination by what target oligonucleotide and cyclic backbones oligonucleotides formed The cyclisation dicyclo probe of target fragment.
Fig. 6 illustrates had combination by what target oligonucleotide and linear backbone oligonucleotides formed The linear cycling probe of target fragment.
Fig. 7 illustrates the linear spy of the target fragment with combination comprising two kinds of backbone oligonucleotides Pin.
Fig. 8 is the image of the specific gel illustrating method described herein.
Fig. 9 is the figure of the accuracy illustrating method described herein.
Figure 10 figure A illustrates the image of the RCA product of the mark on the surface of slide；Figure B Illustrate that the ratio of the fragment from coloured differently body can be by counting independent RCA product The mode measured exactly.
Describe in detail
Target nucleic acid fragment
The target fragment combined by probe is the single-chain fragment of nucleic acid.In some embodiments, originally The method binding sequence of invention is the target fragment limited in advance.Comprise the sequence of the whole fragment of end Row can be known.Limit in advance sequence known fragment can by nucleic acid specifically and not It is that random fragmentation produces.Specific fragment method includes with limiting enzymic digestion, PCR (example Such as, multiplex PCR) and other sequences orientation fragment ends limit method, including other enzymes, Ribozyme or the combination of this kind of technology.
A kind of method of fragmentation is with restriction endonuclease or two or more restrictions Property endonuclease combination digestion.Therefore, the sample of fragmented nucleic acids can be to limit enzyme to disappear Change product and target fragment can be restricted fragment.
Multiple specific nucleic acid lyases is that known and any suitable enzyme can be used for this In bright, the enzyme of the position limited the in advance cracking being included in specific nucleic acid sequence, or spy The endonucleolytic cracked after or before determining nucleic acid recognizing sequence and nickase.Catalytic nucleic acid As ribozyme can also be used for DNA fragmentation.Described enzyme cleavable double-strandednucleic acid is to produce flat end Or cohesive end, or the strand of cleavable nucleic acid.Various types of restriction enzymes are known, bag Include I type, II type, type III, IV type and V-type.Suitably the combination of enzyme or enzyme can basis Need to be selected in described method.Such as, the nucleic acid in sample (DNA of such as 10ng) Can be with limiting enzyme (such as, 1U) digestion in the restriction enzyme buffer liquid that correspondence is compatible.Described reaction (such as, 37 DEG C continue 1 hour) can be hatched under suitable conditions, then carry out enzyme inactivation (example As continued 20 minutes at 80 DEG C).
There is provided the another kind of method easily of fragmented nucleic acids be use primer for amplification from The specific linear sequence of described nucleic acid.Multiplex PCR can be used, with multiple specific primers pair Process nucleic acid to expand multiple specific fragments.In this case, the end of target fragment is corresponding In the described sequence to primer.
For many diagnosis and other application, sample is (such as, the people's dyeing of fragmentation chromosome Body or microbial chromosomal) sample.Target fragment can be of the genome to organism The genomic fragment that chromosome is special.In other words, target fragment can be only in a dyeing of genome Body finds, and does not finds in other chromosomes of described genome.Generally, described method To be used for the analysis of human genome, in said case, target fragment can be to people's dyeing The fragment that body is special, i.e. in this chromosome find and in other people chromosome find sheet Section.Such as, described fragment can be special to chromosome 21.
Target fragment can be special to chromosome a locus.Therefore, it can be in described dye Colour solid locus finds, and not in other locus of same chromosome or same gene group Other chromosomes find.Such as, described fragment can be special to human chromosome a locus Different.
In sample, the nucleic acid of given kind can be contained some changeabilities, such as sample and can comprise difference Individual chromosome, such as obtain from the maternal blood containing mother body D NA and foetal DNA Nucleic acid.Can be specific chromosome in this targeted species, but it is expedient to detect described chromosome All copies, either fetus or maternal source.Therefore, targeted species can be one Bar chromosome or chromogene seat, and target sequence is at described chromosome or chromogene seat Parent and fetus copy both in described chromosome or locus find.
The sample of nucleic acid can provide in any suitable manner, such as the biology from patient Tissue or the sample of fluid.Sample can be blood sample, whole blood, blood plasma or serum, tissue The paraffin-embedded tissue samples that sample, such as formalin are fixing, or can be from blood Or the sample of the nucleic acid extracted in tissue.
Sample can be any sample comprising nucleic acid.Comprising nucleic acid in the sample can be DNA and/or RNA.Described sample can be complicated, such as complete genome DNA or next From full organism, tissue or cell colony or the cDNA of its fraction.In this regard, it is permissible It is direct product or the direct product of cell dissolving program of such as separate nucleic acid program, or it Can classification isolated or purified the most in some way, such as it can comprise the most partially or completely with The nucleic acid (such as RNA) that certain mode separates or processes by any way is to produce cDNA.Sample Originally may be from any eucaryon or protokaryon or viral source, such as, can be microorganism (such as bacterium Or fungi), plant or animal.Preferably, sample is behaved and is originated, such as, and human gene group DNA. Described sample can be from tissue or the blood sample of animal, and nucleic acid the most to be detected is micro- Biological, such as bacterium, virus or fungi.For relevant to noninvasive pre-natal diagnosis Method, sample is derived from the blood of pregnant woman and comprises foetal DNA.In other instances, treat Detection or quantitative nucleic acid are the DNA that tumour is relevant.
Generally, sample can be carried out by described method in vitro.Therefore, described method is not wrapped Include the people to the diagnosis carried out in human or animal's health body or carried out or dynamic by operation or therapy The methods for the treatment of of thing health.While it is true, the result can still be used for of in-vitro diagnosis method informs trouble The successive treatment of person.
Make target nucleic acid sex change
Probe is by the hybridization between single-chain fragment and the target-complementary sequence of target oligonucleotide Identify and combine the target nucleic acid in single stranded form.Therefore, if the target fragment in sample is no longer Strand, then should provide Denaturing so that strand target fragment is complementary to nucleic acid chains and separates.
Described Denaturing can be sufficiently high temperature to make described target fragment be complementary to Sequence separates.Denaturing can be hatched the suitable time at 95 DEG C, such as 10 minutes.Or Person can carry out chemical modification.
Complementary
A kind of method for the existence test sample of target fragment can include making described sample and core Acid probe contacts, and wherein said probe comprises
Target oligonucleotide, its containing promising target fragment complementary series target-complementary sequence and with The flanking sequence that described target-complementary sequence is adjacent, and
There is the oligonucleotide sequence that free 5 ' or 3 ' are held, wherein said oligonucleotide sequence Complementary with described flanking sequence.
The suitable concn of probe can concentration based on the one or more target fragments in sample (or pre- Phase concentration) measure.As illustrated by an embodiment, probe can be with the concentration of 10pM/ probe Add to sample.In the case of making sample contact with multiple probes (such as one group probe), Individually the concentration of probe can be 10pM.Preferably, probe is to be detected or quantitative to exceed The expection concentration of target nucleic acid species uses.Use excess probe it is ensured that identify and be present in sample In all copies of target sequence.This makes the sensitivity of detection maximize.Additionally, relate in method And in the case of quantitatively, it should be ensured that connect product or the detection of the accumulating signal from one group of probe Proportional to the amount of the target sequence in sample.
Under annealing conditions, target fragment (if present) and the target-complementary sequence hybridization of targeting chain And oligonucleotide sequence hybridizes with flanking sequence, so that free the 5 ' of oligonucleotide sequence Or 3 ' end respectively with 3 ' or the 5 ' of target fragment end juxtapositions.Therefore, target oligonucleotide makes target sheet Section templating is for being connected to oligonucleotide sequence.In dual connection event, target fragment 3 ' ends can be connected to 5 ' ends of header sequence, and 5 ' ends of target fragment can be connected to afterbody 3 ' ends of sequence.
According in the probe of the present invention, if target-complementary sequence is the exact complementarity of target fragment Sequence, so that there is perfection hybridization between which, then realizes the maximum to target fragment special Property.But, this is not the most required, and acceptable lesser degree of mispairing, Such as detect fragment in hope, in the case of the accurate allele being present in sample To allow detected representation to go out the fragment of allelic variation.Or, multiple probes can be designed to use In variant sequence thereof.This is capable of not iso-allele or the detection of sudden change and differentiation.According to this The probe of invention is most advantageously used in multiple applications, and the most different probes is included in instead Ying Zhong.In the plurality of probe, it is contemplated that most of probes will have perfection for its target fragment Complementarity, but some probes mispairing can combine target on a small quantity.
Preferably, target-complementary sequence and target fragment have less than 5 base-pair mismatch.At target May be optionally present one, two, three or four bases between fragment and target-complementary sequence To mispairing.Mispairing can be corresponding base from the point of a sequence deletion so that complementary series At described mispairing point formed ring, or can in non-complementary nucleotide is present in a sequence and Do not occur with in the case of the base pairing in the corresponding position of another sequence.Exist In the case of incorrect base pairing (i.e. the pairing of A or T and C or G), hydrogen bonding is not Can occur between the base of two chains, but hybridization will be at target fragment and target oligonucleotide Target-complementary sequence between occur, this be due to the nucleotides adjacent with mispairing between base Pairing.Mispairing can be wobble bases (wobble base).Wobble bases generally would correspond to target The position matched with the position of the known hereditary variation in target fragment in mark complementary series.Described spy Pin can be by adding one or several two during the specific synthesis circulation of wobble bases position Deoxynucleotide synthesizes.Conventional Oliaonucleotides synthesis is typically this situation.Or, can produce Raw multiple single probes, each probe is used for each genetic variation.If used based on micro-battle array The synthesis of row carrys out synthesising probing needle, the most this situation.Wobble bases may correspond to codon Between single nucleotide difference, the most different codon encodes same monoamino-acid.
It is said that in general, compared to shorter target-complementary sequence, for hybridizing longer target fragment The longer target-complementary further amounts of mispairing of sequence tolerable.Target-complementary sequence can such as with target sheet Section has at most 1/8,1/9 or 1/10 base-pair mismatch.Any this kind of mispairing should be restricted to Target-complementary sequence and the interior zone of target fragment, so that they will not suppress by such as limiting Connection that enzymic digestion processed is carried out or sequence-specific target fragmentation.It is therefore preferred that at target sheet At target in 6 to 8 nucleotides of end of each end of section, preferably 10 nucleotides of end Exist perfect complementary between fragment and target-complementary sequence.
It is said that in general, target fragment and target-complementary sequence have equal length.The total length of target fragment Therefore combined by target-complementary sequence.Target fragment represents two kinds of cores with the hybridization of target oligonucleotide Single binding events between acid molecule, thus with the two ends of binding target molecule or combine target The probe in two non-conterminous regions is contrasted.
Target-complementary sequence can have at least 10 nucleotides, for example, at least 15 nucleotides Length.It up to 20,25,30,35 or 40 nucleotides long.Preferably scope includes 10 20 nucleotides, 10 30 nucleotides and 10 40 nucleotides.This kind of relatively Short target-complementary sequence is suitable for combining correspondence relatively short-movie section.Described short sequence contributes to double Reconnect the specific of reaction, because DNA ligase is sensitive to base-pair mismatch, and And will preferentially connect the sequence mated completely.It is present in mispairing and is bound to double-stranded sequence In the case of in the footprint of DNA ligase, described sequence may be not connected with, and this provides additionally Check and correction step, so that it is guaranteed that detection target fragment in terms of have precedence over difference but the sheet of similar sequence The high specific of section.DNA ligase generally has 6 to 8 bases on every side of otch Footprint.Therefore, if fragment is 20 bases, 12 to 16 in the most described base Connected enzyme spcificity is covered.
Described probe hybridizes the mispairing in the core of the sequence especially distinguishing hybridization, and connects Connect and will distinguish the mispairing in the end of target fragment.This produces the detection of high specific fragment together.
Target oligonucleotide is than target sheet segment length, because it includes flanking sequence and target-complementary sequence Arrange, and it also can comprise one or more custom sequence.Custom sequence not with other of probe Region or target fragment complementation in other words under annealing conditions it not with other regions of probe (outside custom sequence) or target fragment hybridize.Upstream flanking region is the target in target oligonucleotide The upstream or 5 ' of mark complementary series.Downstream flanking region is the target-complementary in target oligonucleotide The downstream of sequence or 3 '.Therefore, target-complementary sequence is not inside target oligonucleotide, and not Comprise the end of target oligonucleotide, because it is by upstream and downstream flanking sequence side joint.
The double-stranded sequence produced by the hybridization of target fragment with target-complementary sequence can be considered heterozygosis Double-stranded sequence, because it is the heterozygote of target and probe.Generally, double-stranded sequence uses dual Helical conformation, its fragment that hits be a chain and target oligonucleotide be double-helical another Chain.Heteroduplex sequence is by the upstream and downstream flanking sequence side joint of target oligonucleotide, and it enters And hybridize with header sequence and tail sequence to produce double-stranded sequence.Again, these generally use The normal duplex conformation of double-strandednucleic acid.
Upstream and downstream flanking sequence is the most different from each other, the most preferably has different sequence. Preferably header sequence is complementary with upstream flanking sequence, but not complementary with downstream flanking sequence, and Tail sequence is complementary with downstream flanking sequence, but not complementary with upstream flanking sequence.This guarantees head Portion's sequence and tail sequence hybridize with upstream and downstream flanking sequence the most respectively.
Header sequence will be generally and upstream flanking sequence equal length.Tail sequence will be generally With downstream flanking sequence equal length.
The normal length of flanking sequence between 10 and 40 nucleotides, such as 10 20 or 10 30 nucleotides.Flanking sequence can be and mutually the same length.One or two side Wing sequence can be and target-complementary sequence equal length.Upstream and/or downstream flanking sequence because of This can have at least 10 nucleotides, for example, at least length of 15 nucleotides.It up to 20,25,30,35 or 40 nucleotides are long.
Preferably, header sequence is the complementary series of upstream sequence.Preferably, tail sequence is The complementary series of downstream sequence.The Optimum Matching of sequence is to close for the best combination of probe Need, so that header sequence and tail sequence are properly oriented for being connected to target sheet Section.Optionally, however, between header sequence and upstream flanking sequence and/or in afterbody sequence One, two, three or four base-pair mismatch can be there are between row and downstream flanking sequence. Preferably, there are less than 5 base-pair mismatch.
Being different from target-complementary sequence, described probe generally should not be with target fragment or may be present in sample Other complementary nucleic acid in Ben.This will be avoided the undesired of probe and the nucleic acid in addition to target Hybridization.Therefore, if probe is the fragment for combining human gene group DNA, the most described spy Pin can be designed such that the sequence in addition to target-complementary sequence is not mutual with human gene group DNA Mend, so that described probe only hybridizes and not miscellaneous with other nucleic acid in sample with target fragment Hand over.
Annealing and connection
Target fragment connects in high specific reacts at two ends.Because target fragment is typically nucleic acid The product of specific fragment, so these ends generally will have specific predetermined sequence Row.In Connection Step, these ends are respectively by the sequence with header sequence and tail sequence Dependence connection specifically detects.Preferably, target fragment produces two with the combination of probe The attachable abutment mated completely, 3 ' ends in target fragment and the 5 ' of header sequence Between end, and between 5 ' ends in target fragment and 3 ' ends of tail sequence.
5 ' ends of nucleic acid are connected to 3 ' ends of nucleic acid can be at the adjacent nucleosides at two ends Yu complementary series Occur during acid base pairing.Associated end nucleotides is formed at the base pairing of adjacent nucleotide The nucleic acid chains of otch is contained between two ends.The connection at two ends can be catalyzed by DNA ligase. The condition for connecting is provided therefore to be typically included offer DNA ligase and reaction condition, DNA ligase connection two ends are to form continuous nucleic acid chains under the cited reaction conditions, thus close Close otch.Multiple ligase is commercially available, such as Ampligase (Epicentre), for it The condition being suitable for is to add 1U enzyme and to hatch 1 at 55 DEG C in ligase buffer solution little Time.
Target oligonucleotide make target fragment template for being connected to header sequence and tail sequence, This be due to flanking sequence between target-complementary sequence position caused by.Under annealing conditions In the presence of target fragment, described header sequence and tail sequence hybridize with described flanking sequence, thus Room is limited between the 5 ' ends and 3 ' ends of described tail sequence of described header sequence.Target sheet Section and target-complementary sequence hybridize in described room.Therefore, header sequence and tail sequence with And 3 ' ends of target fragment are positioned to and header sequence by target fragment with target oligonucleotide hybridization 5 ' end juxtapositions, and 5 ' ends of target fragment are positioned to 3 ' the end juxtapositions with tail sequence.
Two ends are positioned to juxtaposition provides the substrate being used for DNA ligase with by described end even It is connected together.Preferably 5 ' ends of header sequence and the 3 ' of target fragment are held and target oligonucleotide Adjacent nucleosides acid hybridization, and the 3 ' of tail sequence are held and 5 ' end and targeting widow's cores of target fragment The adjacent nucleosides acid hybridization of thuja acid.Therefore, upstream flanking sequence can be close to target-complementary sequence, Not there is insertion nucleotides.Similarly, downstream flanking sequence can be close to target-complementary sequence, no There is insertion nucleotides.3 ' adjacent ends and 5 ' ends can be directly connected to by DNA ligase, Thus seal the otch between them to form continuous nucleic acid chains.
The product of dual connection, header sequence and tail sequence will be connected to the product of target fragment It it is the continuous chain of nucleic acid.In the sense that it does not comprise otch or room, it is continuous print, therefore All nucleotides in described chain are covalently bound.
Described probe can be designed such that and comprises header sequence and tail sequence and target fragment The continuous chain of nucleic acid is the ring of nucleic acid.Term ring refer at this not have free-end for Guan Bi ring The topological structure of chain.
Under annealing conditions in the presence of target fragment, described header sequence and tail sequence are with described Flanking sequence hybridizes, thus holds at 5 ' ends of described header sequence and the 3 ' of described tail sequence Between limit room.Described target fragment and target-complementary sequence hybridize in described room, thus The end of described target fragment is positioned to and the 5 ' of described header sequence end and described tail sequence 3 ' end juxtapositions, and the nucleic acid completing to comprise target fragment and header sequence and tail sequence Ring.
The end juxtaposition of the looped nucleic acid molecules of shape.The connection of described end produces and comprises at least institute State the continuous annular chain of the nucleic acid of header sequence and tail sequence and described target fragment.
The probe of the ring forming nucleic acid comprises wherein header sequence and tail sequence and is provided at list Probe on individual nucleic acid molecules.Such as, in addition to target oligonucleotide, described probe can wrap Containing at its 5 ' end, 3 ' ends, there is the backbone oligonucleotides of header sequence and tail sequence respectively, its Described in the header sequence of backbone oligonucleotides and tail sequence trans combination under annealing conditions Flanking sequence to target oligonucleotide.Described backbone oligonucleotides can be included in header sequence with Custom sequence between tail sequence.Fig. 3 illustrates the embodiment of this kind of probe.Or, institute Header sequence and the tail sequence of stating backbone oligonucleotides can be adjacent, the most not There is custom sequence.
In another example, described header sequence and tail sequence can be at target oligonucleotides End and cis under annealing conditions be bound to flanking sequence.Described target oligonucleotide can It is included in the custom sequence between target oligonucleotide and head and/or tail sequence.Fig. 4 shows Go out the embodiment of this probe.
The probe of the ring forming nucleic acid also includes that wherein header sequence and tail sequence are provided at Probe on different IPs acid molecule.In such cases, the nucleic acid formed under annealing conditions Ring will comprise at least three nucleic acid target molecule fragment, header sequence and tail sequence.Described The end of nucleic acid molecules is by whole juxtapositions, as previously pointed out.Need in such cases to be more than Two kinds of coupled reactions form the continuous annular chain of nucleic acid.One example is that wherein tail sequence is 3 ' ends of target oligonucleotide, and described probe comprises and has in its 5 ' header sequence held Backbone oligonucleotides.Under annealing conditions, tail sequence is cis is bound to target oligonucleotide Downstream flanking sequence, and the header sequence of backbone oligonucleotides is trans is bound to targeting widow's core The upstream flanking sequence of thuja acid.Cis combination means to combine and occurs on same nucleic acid molecules, i.e. The strand of nucleic acid forms three-dimensional structure, and wherein zones of different is taken to together and hybridizes.Trans knot Desirable finger is combined between different IPs acid molecule generation.Optionally, backbone oligonucleotides comprises one To inverted repeats, described inverted repeats forms hairpin structure under annealing conditions, from And 3 ' ends of backbone oligonucleotides are positioned to 5 ' the end juxtapositions with target oligonucleotide.Two Otch is there is between end.Such probe figure 5 illustrates.When providing for connection During condition, 5 ' ends of target oligonucleotide are connected to 3 ' ends of backbone oligonucleotides.Dual The product connected is to comprise target oligonucleotide, target fragment and the nucleic acid of backbone oligonucleotides Ring.Or, exist between the 5 ' ends and 3 ' ends of backbone oligonucleotides of target oligonucleotide In the case of room, the probe shown in Fig. 5 will not be cyclized by connection but comprise head The continuous chain of the nucleic acid of portion's sequence and tail sequence and target fragment is the linear chain of nucleic acid.
Described probe or can arrange with opposed orientation, so that header sequence is at targeting widow's nucleosides 5 ' ends of acid, and described probe comprises and has the main chain widow's core at its 3 ' tail sequence held Thuja acid.In this case, under annealing conditions, header sequence is cis is bound to targeting widow's core The upstream flanking sequence of thuja acid, and the tail sequence of backbone oligonucleotides is trans is bound to targeting The downstream flanking sequence of oligonucleotides.Again, backbone oligonucleotides can comprise a pair inverted repeat Sequence, described inverted repeats forms hairpin structure under annealing conditions, with by main chain widow's core 5 ' ends of thuja acid are positioned to 3 ' the end juxtapositions with target oligonucleotide.Described target oligonucleotide 3 ' ends be then attached to 5 ' ends of described backbone oligonucleotides, so that the product of dual connection Thing is the ring of the nucleic acid comprising target oligonucleotide, target fragment and backbone oligonucleotides.Or, As it has been described above, 5 ' ends of backbone oligonucleotides can be positioned at target oligonucleotide by described annealing Near 3 ' ends, but separated by the room of one or more nucleotides.Then the product connected will It it is the continuously linear of the nucleic acid comprising described header sequence and tail sequence and described target fragment Chain.
Described backbone oligonucleotides can be included in the custom sequence between inverted repeats, so that Hairpin loop must be formed, as shown in Figure 5 in backbone oligonucleotides under annealing conditions.
As noted, probe can be designed such that and comprises header sequence and tail sequence and target The continuous chain of the nucleic acid of fragment is the linear chain of nucleic acid.Exist in target fragment under annealing conditions Under, described header sequence and tail sequence hybridize with described flanking sequence, thus at described head Room is limited between 5 ' ends and the 3 ' ends of described tail sequence of sequence.Described target fragment and target Mark complementary series hybridizes in described room, thus is positioned to and institute by the end of described target fragment State 5 ' ends of header sequence and 3 ' end juxtapositions of described tail sequence, and complete to comprise target sheet The chain of the nucleic acid of section and header sequence and tail sequence.Form the end of the nucleic acid molecules of described chain End juxtaposition.Term juxtaposition is discussed elsewhere.Deposit between two ends to be connected At otch.The connection of described end produce comprise the most described header sequence and tail sequence and The continuous chain of the nucleic acid of described target fragment.
Described probe can comprise have its 3 ' tail sequence held target oligonucleotide and There is the linear backbone oligonucleotides in its 5 ' header sequence held.Under annealing conditions, afterbody The cis downstream flanking sequence being bound to target oligonucleotide of sequence, and backbone oligonucleotides The trans upstream flanking sequence being bound to target oligonucleotide of header sequence.Target oligonucleotide can The custom sequence being included between downstream flanking sequence and tail sequence, so that at annealing conditions Under described target oligonucleotide formed hairpin loop.The linear chain of the nucleic acid formed under annealing conditions Comprise backbone oligonucleotides, target fragment and target oligonucleotide.Fig. 6 illustrates this layout.
Described probe can equally be arranged with inverted orientation, and wherein header sequence is at targeting widow's nucleosides 5 ' ends of acid, and described probe comprises and has the main chain widow's core at its 3 ' tail sequence held Thuja acid.In this case, the cis upstream flank being bound to target oligonucleotide of header sequence Sequence, and the trans downstream being bound to target oligonucleotide of tail sequence of backbone oligonucleotides Flanking sequence.
Formation is to comprise as the another kind of form of the probe of the linear nucleic acid chain of the product connected Header sequence in independent backbone oligonucleotides and the probe of tail sequence.This probe can wrap Containing containing the backbone oligonucleotides with the free 5 ' header sequence held；And it is free containing having The backbone oligonucleotides of the 3 ' tail sequence held, wherein under annealing conditions described header sequence and The trans flanking sequence being bound to target oligonucleotide of tail sequence.One or both main chains widow's core Thuja acid also can comprise custom sequence.Fig. 7 illustrates such probe.
Preferably, the oligonucleotides in its not connected form of described probe is linear.Therefore, Preferably, described target oligonucleotide is linear nucleic acid molecule.Main for comprising one or more The probe of chain oligonucleotides, these are the most linear.This allow connect probe with not Convenient differentiation between the probe connected, wherein the ring of DNA is only used as the cyclisation of described probe The result being successfully connected of embodiment is formed.Linear nucleic acid molecule is not expanded by rolling-circle replication Increase.
Detection
Thering is provided after its lower target fragment (if present) is connected to the condition of probe, examining Survey step to determine whether this combination has occurred and that.Whether this instruction target fragment is present in sample In.Therefore, the detection of product depends on described target fragment and described header sequence and tail sequence Be successfully connected to be formed the continuous chain of nucleic acid.Therefore detecting step is usually directed to detect needs two The signal of the existence at individual connection abutment.Such as, detection can include that connecting abutment across two expands Increase (such as, by PCR or, for the cyclisation embodiment of probe, rolling-circle replication) or capture Continuous nucleic acid chains at one end and detect its other end.
Optionally, the product of dual connection it is enriched with before method may be included in detection.Product can lead to Cross amplification and/or be enriched with by solid state chemistry.Circular nucleic acid product can be by with exonuclease (such as, λ exonuclease) processes sample and is optionally enriched with digestion linear nucleic acid product. In general, exonuclease degradation can be used for being protected from exonuclease at connection product During degraded, enrichment connects product.Exonuclease then should be at any subsequent step relating to polymerization Before, such as before rolling circle amplification, (such as passing through heat) is inactivated.Such as institute in embodiment 1 Show, 1U exonuclease can be added to remove unreacted probe and fragment.The condition being suitable for It is to hatch at 37 DEG C 1 hour, then at 80 DEG C in corresponding exonuclease buffer solution Enzyme inactivates 20 minutes.In the case of using capture/detection method, connect product and can pass through warp It is enriched with by the product in capture portion capture solid phase.As shown in example 2, containing wired Property connect product solution can with 10ml M-280 Streptavidin coating magnetic bead (Invitrogen) the Tris HCl in 200ml final volume (pH 7.5), 3.5mM EDTA Mix with in 0.07%Tween-20, and at room temperature hatch 15 minutes.After incubation, Use annular magnet to collect bead, and remove supernatant.Enrichment connects other modes of product Select to connect product including specifically size.
It is to provide the condition for amplification for detecting the convenient mode of the product of dual connection And the existence for amplified production tests.Several amplification methods are possible, as NASPA, LAMP, T7 amplification, PCR or rolling-circle replication in the case of continuous chain is ring. The step of the product detecting dual connection can include providing for first of the continuous chain across nucleic acid Connect, with second, the condition that abutment expands, and detect whether to there is amplified production.Connect and produce Thing can be expanded by clonal expansion.The amplification technique being suitable for includes that rolling circle amplification (sees down Literary composition), bridge-type PCR (Adessi C et al., Nucleic Acids Res.2000 October 15 Day；28 (20): E87), (digital pcr in emulsion is by Dressman et al., Proc for emulsion-based PCR Natl Acad Sci U S A.2003 on July 22, in；100 (15): 8817-22.Epub 2003 years July 11 described) and digital pcr (Vogelstein&Kinzler, Proc Natl Acad Sci U S A.1999 on August 3, in；96(16):9236-41).Clone's local expansion in gel by Mitra&Church, Nucleic Acids Res.1999 December 15；27 (24): e34 retouch State.
In the case of the product of dual connection is the ring of nucleic acid, for detecting the convenient of product Mode is to provide for the condition of rolling-circle replication and detects whether to exist the product of rolling-circle replication. The product of rolling-circle replication depends on dual connection to provide the ring of the nucleic acid for amplification.Rolling ring is multiple System is described in US 5,854,033 (Lizardi) and Fire&Xu, Proc Natl Acad Sci U S A. 1995May 9；In 92 (10): 4641-5.Rolling-circle replication is to use strand displacement archaeal dna polymerase to expand Increase circular nucleic acid molecules, thus produce the big DNA of the tandem repetitive sequence containing extension increasing sequence Molecule.In the lasting rolling cyclopolymerization reaction that archaeal dna polymerase catalysis is carried out in the case of required Primer extends and strand displacement.It produces higher than single PCR replication cycle and other amplification techniques The amplification of the circularizing probes sequence of multiple orders of magnitude, the most each circulation is limited to the copy of target sequence Doubling of number.The cascade that can use strand replacement reaction obtains additionally amplification.Rolling-circle replication can To be hyperbranched rolling-circle replication.Hyperbranched RCA is by Lizardi et al., Nat Genet.1998 July in year；19 (3): 225-32 describe.Condition for rolling-circle replication illustrates in an embodiment, example As hatch with the phi29 polymerase of 1U (New England Biolabs) can be added on corresponding Phi29 buffer solution and nucleotides (dNTPs) continue 1 hour at 37 DEG C.
After rolling-circle replication, the probe sequence of amplification can use any conventional inspection for nucleic acid Examining system such as detects fluorescence labeling, enzyme joint inspection examining system, the detection of antibody-mediated mark and radiation Property mark detection detect and quantitatively.Preferably, rolling circle amplification product is by the detection of mark Motif in oligonucleotides and RCA product, such as the motif in the custom sequence of probe miscellaneous Hand over and detect.Because the amount of target sequence is directly proportional present in amplified production and sample, thus fixed Measurement reliably represents the amount of target sequence in sample.The major advantage of this method is, connects Step can be manipulated to obtain allele difference, and described DNA replication dna step is constant temperature, And signal is the most quantitative, because amplified reaction is linear and is urged by further processing enzyme Change.In multiple assay, the primer tasteless nucleotide for DNA polymerase reaction can be right Identical in all probes.
The probe on independent nucleic acid molecular probe for wherein header sequence and tail sequence, can It is conveniently used capture/detection method.The product of dual connection is included in single core acid molecule Header sequence and tail sequence (continuous chain), and the probe being not connected with does not has.Therefore, dual The product connected can come specifically to detect in the following manner: the capture core containing header sequence Acid molecule, washs the probe nucleic acid being not connected with removing, then detects afterbody in the fraction of capture The existence of sequence.Or, the product of dual connection can come specifically to detect in the following manner: The capture nucleic acid molecules containing tail sequence, washs the probe nucleic acid being not connected with removing, then The existence of header sequence in the fraction of detection capture.Detect the probe to connecting and have specifically, Because the header sequence of the probe being not connected with and tail sequence are only by the hybridization between nucleic acid even Connect, and by washing and separate, and the probe connected contain in continuous nucleic acid chains (i.e., Covalently bound) header sequence and tail sequence.
Probe may be trimmed to carry capture portion.Capture portion can allow to be attached to solid-based Matter such as bead.Suitably capture portion is biotin, and it matches with strepto-new isotope, thus permits Permitted to stay in the probe nucleic acid separating modification on the solid matrix with Streptavidin coating.Wherein visit Pin comprises the backbone oligonucleotides containing head or tail sequence, and contains afterbody or head respectively The independent nucleic acid (target oligonucleotide or the second backbone oligonucleotides) in portion, in these nucleic acid molecules Any one carried capture portion, such as can biotinylation.May be it is expedient to visit in combination The probe with capture portion is provided before pin and sample.Or, capture portion can connect step Introduce after rapid.
In the case of a kind of nucleic acid molecules within the probe carries capture portion, another kind of nucleic acid divides Son can carry mark.It is possibly used nucleotide sequence conduct mark itself, such as with specifically Detection header sequence (wherein afterbody is captured) or the existence of tail sequence (wherein head is captured) Or it is detected as the custom sequence that nucleic acid molecules to be detected is exclusive.Complementary oligonucleotide can be used for examining Survey.Or, nucleic acid can carry foreign marker such as fluorogen.Foreign marker is not nucleic acid itself A part.Other marks spendable include the enzyme level of quantum dot, bioluminescence, generation signal Join as junket acid amides signal amplifies and radioactive segment.Then described method can include detection mark Existence, such as, detect respectively fluorescence, detection quantum dot, detection bioluminescence, detection by The signal of enzyme generation or detection of radioactive.
As an example, detect whether to exist the step of the product of dual connection can include via The backbone oligonucleotides of probe is captured in matrix by capture portion, washs described matrix to remove The probe being not connected with and reservation comprise the capture of the backbone oligonucleotides of described matrix and capture Part and the existence for the product of connection dual in captured fraction are tested.Wherein, The product of dual connection carries mark, and this can include entering for the existence of mark in captured fraction Row test.Described capture portion can be to have the biotin of affinity to Streptavidin matrix Molecule.Other affinity tag being suitable for include poly-group to fixing metal ion with affinity His tag, as can be used for the purifying containing histidine sequences (such as, backbone oligonucleotides) cobalt, Nickel, copper.Therefore capture portion can be a part for sequence to be captured, such as His label Sequence, or it can be the heterologous moiety of a part of nucleic acid itself.
Suitably solid matrix is that bead (such as magnetic bead) is to contribute to using magnet enrichment to be caught The product obtained.Described matrix such as can use biotin with the binding members coating of capture portion The magnetic bead of the Streptavidin coating that the probe changed is used together.
The advantage of some embodiments of the inventive method is, it does not relies on nucleic acid sequencing, Also not dependent on PCR, this will cause bias result, because some sequences are than other sequences more Effectively expand.But optionally, detection can include being connected by product is carried out sequence verification The step of identity of fragment.One of advantages of the present invention is, by the product in dual connection In be incorporated to actual target fragment, product can check order to confirm described probe and correct target Reaction.This is compared to its other party based on dual connection such as US20130172212 (Ariosa) The advantage of method.
Multiple reaction
Multiple different target nucleic acid fragments can use multiple probe parallel detection.Such as, fragmentation The sample of chromosome can contact with one group of probe of the multiple fragments for combining chromosome, its Described in each probe in group for combining the different target fragments special to described chromosome.Institute Stating probe and can have common custom sequence, it is special to differentiate that described custom sequence can be used as bar code Combine to property the probe of described chromosome.Multiple reaction can include multiple target oligonucleotide and Individual common backbone oligonucleotides, but also include several groups of target oligonucleotides, the most each subgroup with Individually backbone oligonucleotides hybridization.
Multiple probes can be used for providing detectable signal, the wherein amplitude of signal and its target of identification The number of the probe of fragment is proportional.Independent signal from the plurality of probe is converted into list Individual accumulation detectable signal, thus expand independent signal by multiple-stage detection.Ten or more Probe produces ten times or more signal amplifies.Produced signal depends on when target identification The probe correctly reacted, so that producing dual connection with sequence specific hybridization and connection Specific product, obtain signal from described product.
Identify that each probe of its target fragment produces and connect product, and produced by the hybridization of each probe Raw connection product can be the most detectable, so that individually signal can obtain from each. But, the excellent characteristic of the present invention is that these independent signals need not be detected separately, but quilt It is merged into accumulating signal and detects described accumulating signal.Accumulating signal is the group of independent signal Close, and therefore can be used for detection and/or quantitative continuous is practiced midwifery thing, thus represent studied core The existence of acid kind or amount.Compared to the method relating to order-checking and microarray, the inventive method Some embodiments allow the early stage of probe signals to merge, and wherein independent signal is across a region pin Multiple probes are produced, and the most described signal closes to represent a region in analysis.Institute State signal can merge before testing, so that individually signal the most individually maps or inquires about.This is real Existing simpler reading form.
The dual connection that individually signal can be formed from the result hybridized as probe each target fragment Every kind of product obtain.It is therefoie, for example, comprise the object identified in sample at one group of probe In the case of 10 different probes of 10 the target fragments planted, existence is comprised connection abutment 10 kinds of connection products, and accumulating signal can be detected, described accumulating signal is from 10 kinds Connect the combination of the independent signal of product.Certainly, in this example, molecular probe, target fragment 10 can be higher than with the actual number connecting product, because each target that there typically will be in sample Multiple copies with each probe are contacted by multiple copies and the described sample of fragment.
The method amplified by multiple reaction signal can be used for detecting the target nucleic acid kind in sample Class, such as secondary the or trace components during one of them nucleic acid species is complex nucleic acid sample.Logical Cross multiple reaction amplification and realize reliable detection.This can be used for such as detecting sample for diagnostic purpose Microbial nucleic acids in (such as clinical samples).Sample can be with the microbial nucleic acids tool to multiple kind Those detecting to detect and differentiating are carried out with the presence of specific probe.This is applicable to detection and passes The medium of infectious diseases, such as bacterium, virus and fungi.Specific nucleic acid transcript can be detected. Quantitative nucleic acid species is can also be used for by multiple reaction amplification.By detecting two or more kinds The one or more targeted species of nucleic acid and one or more reference nucleic acid kind institute The method of stating realizes the quantitative of the relative quantity of the two kinds of types in sample.When being applied to chromosome or dye The detection or quantitative of colour solid locus, such as when chromosomal copy number detects, described method is Useful especially.A kind of application of particular value is to use described method for identifying that chromosome lacks Fall into, including for diagnosing cancer and congenital aneuploid.It is specifically described for noninvasive antenatal The purposes of diagnosis (NIPT).
The kind of the nucleic acid in sample can be by making sample and one group of probe phase according to the present invention Contact detects, and the most each probe specificity ground identifies the difference in nucleic acid species to be detected Target sequence.Target sequence is corresponding to the target fragment of described nucleic acid species.Every by each probe identification Individual target sequence produces the product of dual connection as described herein.Then accumulation letter can be detected Number, this is the combination of the signal from described product.The detection of signal indicates institute in described sample State the existence of nucleic acid species.Described nucleic acid species can be by quantitative accumulating signal to measure signal water Putting down and carry out quantitatively, wherein said signal level becomes ratio with the amount of described sample amplifying nucleic acid kind Example, and thus measure the amount of nucleic acid species in described sample.Can be by making sample and first Group probe and second group of probe contact relative to second or reference nucleic acid kind quantitative first Nucleic acid species, wherein said first group of probe the most specifically identifies described first nucleic acid species In different target sequences, and wherein said second group of probe the most specifically identify described the Two or reference nucleic acid kind in different target sequences.Detect the first and second accumulating signals, described First accumulating signal freely to identify the list of the product of first group of probe generation of its target sequence The solely combination of signal, and the second accumulating signal freely identifies second group of spy of its target sequence The combination of the independent signal of the product that pin produces.Described first and second signals are carried out quantitatively with Measure the first and second signal levels respectively, these and the first and second nucleic acid in described sample The amount of kind is proportional.Therefore the relative quantity of the first and second nucleic acid species in described sample may be used Determine by comparing the first and second signal levels.
Such as, accumulating signal can be clonal expansion and/or the mark of the probe identifying its target sequence The summary of product (product of such as rolling circle amplification) of note is enumerated, or from all products send glimmering Optical signal, wherein every kind of product launches fluorescence signal.Relative for quantitative multiple nucleic acid species Amount, different signals can be launched compared to separately for each kind, the such as product of one group of probe Wavelength of fluorescence that the product of one group of probe is different or spectrum.
Nucleic acid species in sample can detect in one approach, and described method includes
Making described sample and one group of probe contact, the most each probe specificity ground identifies described Different target sequences in nucleic acid species to be detected,
Thering is provided Denaturing, the target sequence in the most described nucleic acid species is strand,
Thering is provided for annealing and the condition of connection, the most described probe is hybridized to its target Sequence and produce connection product, and
Detection accumulating signal, described accumulating signal is the independent signal from all connection products Combination,
The detection of wherein said signal indicates the existence of nucleic acid species described in described sample.
Described sample, target nucleic acid, method step (such as, sex change, anneal, connect) and visit The details of pin is described elsewhere herein.Described method comprises the steps that
I () provides sample, wherein said nucleic acid species is melted into target fragment by fragment,
(ii) providing Denaturing, under described Denaturing, described target fragment is strand
(iii) making described sample and one group of probe contact, the most each probe specificity ground identifies Different target sequences in described nucleic acid species to be detected, wherein said target sequence is described target sheet The sequence of section, and the most each probe comprises
Target oligonucleotide, described target oligonucleotide than described target sheet segment length and comprises inside Target-complementary sequence, so that the hybridization shape between described target oligonucleotide and described target fragment Become between the upstream flanking sequence and downstream flanking sequence of described target oligonucleotide is double Chain-ordering, and
It is respectively provided with 5 ' free ends and the header sequence of 3 ' ends and tail sequence, wherein Described header sequence and tail sequence respectively with described upstream flanking sequence and downstream flanking sequence Complementation,
(iv) annealing conditions, the most described header sequence and tail sequence and institute are provided State flanking sequence hybridization, and the target-complementary sequence of target fragment (if present) and described probe Hybridization, is thus positioned to the end of described target fragment hold and described with the 5 ' of described header sequence 3 ' end juxtapositions of tail sequence
V () provides the condition for connecting, so that if there is target fragment, then by described target 3 ' ends of fragment are connected to 5 ' ends of described header sequence and connect abutment to form first, and And 5 ' ends of described target fragment are connected to 3 ' ends of described tail sequence to form the second connection Abutment, thus produce the product of dual connection, described product comprises the continuous chain of nucleic acid, institute State nucleic acid and comprise described header sequence and tail sequence and described target fragment, and
(vi) detection accumulating signal, described accumulating signal is the independent signal from all products Combination,
The detection of wherein said signal indicates the existence of nucleic acid species described in described sample.
Described nucleic acid species can be come quantitatively by a kind of method, and described method includes
I () provides sample, wherein said nucleic acid species is melted into target fragment by fragment
(ii) providing Denaturing, under described Denaturing, described target fragment is strand
(iii) making described sample and one group of probe contact, the most each probe specificity ground identifies The described different target fragments treated in quantitative nucleic acid species, the most each probe comprises
Target oligonucleotide, described target oligonucleotide than described target sheet segment length and comprises inside Target-complementary sequence, so that the hybridization shape between described target oligonucleotide and described target fragment Become between the upstream flanking sequence and downstream flanking sequence of described target oligonucleotide is double Chain-ordering, and
It is respectively provided with 5 ' free ends and the header sequence of 3 ' ends and tail sequence, wherein Described header sequence and tail sequence respectively with described upstream flanking sequence and downstream flanking sequence Complementation,
(iv) annealing conditions, the most described header sequence and tail sequence and institute are provided State flanking sequence hybridization, and the target-complementary sequence of target fragment (if present) and described probe Hybridization, is thus positioned to the end of described target fragment hold and described with the 5 ' of described header sequence 3 ' end juxtapositions of tail sequence
V () provides the condition for connecting, so that if there is target fragment, then by described target 3 ' ends of fragment are connected to 5 ' ends of described header sequence and connect abutment to form first, and And 5 ' ends of described target fragment are connected to 3 ' ends of described tail sequence to form the second connection Abutment, thus produce the product of dual connection, described product comprises the continuous chain of nucleic acid, institute State nucleic acid and comprise described header sequence and tail sequence and described target fragment,
(vi) detection accumulating signal, described accumulating signal is the independent letter from all connection products Number combination, and
(vii) quantitative described accumulating signal is to measure signal level, wherein said signal level with The amount of the described nucleic acid species in described sample is proportional, and
Thus measure the amount of described nucleic acid species in described sample.
Described method can be used for first nucleic acid kind quantitative relative to the second nucleic acid species in sample Class.Described method comprises the steps that
I () provides sample, wherein said first and second nucleic acid species are melted into target fragment by fragment
(ii) providing Denaturing, under described Denaturing, described target fragment is strand
(iii) described sample and first group of probe and second group of probe is made to contact, wherein said One group of probe specificity ground identifies the different target fragments of described first nucleic acid species, and wherein institute Identify the different target fragments of described second nucleic acid species with stating second group of probe specificity, the most often Individual probe comprises
Target oligonucleotide, described target oligonucleotide than described target sheet segment length and comprises inside Target-complementary sequence, so that the hybridization shape between described target oligonucleotide and described target fragment Become between the upstream flanking sequence and downstream flanking sequence of described target oligonucleotide is double Chain-ordering, and
It is respectively provided with 5 ' free ends and the header sequence of 3 ' ends and tail sequence, wherein Described header sequence and tail sequence respectively with described upstream flanking sequence and downstream flanking sequence Complementation,
(iv) annealing conditions, the most described header sequence and tail sequence and institute are provided State flanking sequence hybridization, and the target-complementary sequence of target fragment (if present) and described probe Hybridization, is thus positioned to the end of described target fragment hold and described with the 5 ' of described header sequence 3 ' end juxtapositions of tail sequence
V () provides the condition for connecting, so that if there is target fragment, then by described target 3 ' ends of fragment are connected to 5 ' ends of described header sequence and connect abutment to form first, and And 5 ' ends of described target fragment are connected to 3 ' ends of described tail sequence to form the second connection Abutment, thus produce the product of dual connection, described product comprises the continuous chain of nucleic acid, institute State nucleic acid and comprise described header sequence and tail sequence and described target fragment,
(vi) detecting the first accumulating signal, described first accumulating signal comes freely described first group The combination of the independent signal connecting product that probe produces；And the most described first accumulating signal To measure the first signal level, described the in wherein said first signal level and described sample The amount of one nucleic acid species is proportional,
(vii) detecting the second accumulating signal, described second accumulating signal comes free described second The combination of the independent signal connecting product that group probe produces；And the most described second accumulation letter Number to measure secondary signal level, described with described sample of wherein said secondary signal level The amount of the second nucleic acid species is proportional, and
(viii) relatively described first and second signal levels, thus measure the in described sample One and second relative quantity of nucleic acid species.
In general, the number of probe will be for be detected or quantitative each nucleic acid species extremely Few ten.Number course refers to the number of different probe rather than the absolute number of the molecule of probe. Therefore, described nucleic acid will comprise at least ten kinds of different specific target sequence, and described accumulation Signal is the combination of the independent signal of at least ten unique probes, and described accumulating signal represents a kind of Nucleic acid species.High-caliber multiple can be used for correspondingly obtains high-caliber amplification of signal.Such as, At least 100, at least 1,000, at least 10,000 or the most greater number of probes can be used for treating Detection or every kind of quantitative nucleic acid species.
Described method can include making the sample of the chromosome of fragmentation with for combining two or more Many groups probe of multiple fragments of a plurality of chromosome contacts, comprising:
For combining first group of probe of the multiple target fragments special to the first chromosome, and
For combining second group of probe of the multiple target fragments special to the second chromosome, Yi Jiren Selection of land
For combining a group of the multiple target fragments special to one or more other chromosome Or organize other probe more.
Probe in one group can have custom sequence, described custom sequence be described group common also And the custom sequence of the probe being different from other groups, thus allow to differentiate easily from each group Probe.Often group probe can comprise for combining the multiple target fragments special to described chromosome At least 500,600,700,800,900 or at least 1,000 different probes.Such as, A kind of method can use chromosome 21,13 with 1,000 of every kind in 18 kinds different respectively Target oligonucleotide, and three kinds of different backbone oligonucleotides, every kind is used for each chromosome Subgroup.
Possibly through detecting the product for the dual connection often organizing probe and detecting described The relative quantity of the custom sequence in product measures two or more chromosomes in sample Relative quantity.
Use wherein target oligonucleotide and the looped probe of upstream and downstream oligonucleotides shape, Coding specific alleles and or locus motif can height multiple in be incorporated to custom sequence.
Numeral chromosome karyotype analysis and noninvasive pre-natal diagnosis
Some embodiments of the inventive method can provide wherein seeks the most fixed of target DNA Specific advantages in the field of amount.This includes multiple diagnostic techniques based on nucleic acid.Such a Field is to analyze the analysis from cancer DNA in the biological specimen (such as blood) of patient. Another this field is the noninvasive pre-natal diagnosis (NIPT) by analyzing Cell-free DNA.
One challenge of NIPT be a large amount of specific gene pack sections must be counted so that Realize the statistics confidence needed for diagnosis abnormal chromosome aneuploid (chromosomal copy number difference). Owing to foetal DNA mixes with mother body D NA, constitute inhereditary material in pregnant woman's blood flow 4%-30%, observing the chromosomal aneuploidy in foetal DNA needs point-device measurement.
Probe as herein described can be used for the free cyclisation fetus analyzing in maternal blood sample DNA.By using multiple probes of the different fragments for item chromosome and for second Multiple probes of the different fragments of chromosome, described probe realizes measuring described sample with high confidence level The imbalance of the relative populations of two chromosomes in Ben.This allows even for mother body D NA High background diagnose chromosomal aneuploidy from foetal DNA, such as trisomy.
Probe described herein can be used for testing the maternal blood sample from pregnant woman and detects Fetal nucleic acid is for diagnosis chromosome abnormality such as three body, thus suffers from for Tumour DNA test Person's sample is for the existence of tumour in diagnosis or monitoring patient.Other purposes include for micro-life The sample of the existence test material of thing nucleic acid, wherein detects that described microbial nucleic acids indicates material Being infected by microorganism, described microorganism can be infectious agent such as bacterium, virus or fungi.Described Sample can be from tissue or the blood sample of patient.
More generally, by using hundreds of or thousands of different probe, the method for the present invention can Realize pinpoint accuracy by detecting hundreds of or thousands of nucleic acid specific fragment, thus one be Row diagnostic application provides advantage.Detection is from the chromosome relevant to specified disease or chromosome A large amount of DNA fragmentations of locus realize measuring described dye relative to comparison chromosome or locus Colour solid or the amount of locus, enable to the even Light Difference detecting in sample assuredly.
By analyzing short target fragment, most height in maternal blood can be analyzed with high efficiency The Cell-free DNA of fragmentation.This is important, because very small amount of Cell-free DNA can Maternal blood obtains.
A kind of relative to the second chromosome in the sample of nucleic acid obtained from individuality or chromosome base Because the method for the quantitative the first chromosome of seat or chromogene seat can include
I () provides sample, wherein said first and second chromosomes or chromogene seat are by sheet Duan Huacheng target fragment
(ii) providing Denaturing, under described Denaturing, described target fragment is strand
(iii) described sample and first group of probe and second group of probe is made to contact, wherein said One group of probe specificity ground identifies the different target fragments of described the first chromosome, and wherein said Second group of probe specificity ground identifies the different target fragments of described second chromosome, the most each spy Pin comprises
Target oligonucleotide, described target oligonucleotide than described target sheet segment length and comprises inside Target-complementary sequence, so that the hybridization shape between described target oligonucleotide and described target fragment Become between the upstream flanking sequence and downstream flanking sequence of described target oligonucleotide is double Chain-ordering, and
It is respectively provided with 5 ' free ends and the header sequence of 3 ' ends and tail sequence, wherein Described header sequence and tail sequence respectively with described upstream flanking sequence and downstream flanking sequence Complementation,
(iv) annealing conditions, the most described header sequence and tail sequence and institute are provided State flanking sequence hybridization, and the target-complementary sequence of target fragment (if present) and described probe Hybridization, is thus positioned to the end of described target fragment hold and described with the 5 ' of described header sequence 3 ' end juxtapositions of tail sequence
V () provides the condition for connecting, so that if there is target fragment, then by described target 3 ' ends of fragment are connected to 5 ' ends of described header sequence and connect abutment to form first, and And 5 ' ends of described target fragment are connected to 3 ' ends of described tail sequence to form the second connection Abutment, thus produce the product of dual connection, described product comprises the continuous chain of nucleic acid, institute State nucleic acid and comprise described header sequence and tail sequence and described target fragment,
(vi) detecting the first accumulating signal, described first accumulating signal comes freely described first group The combination of the independent signal connecting product that probe produces；And the most described first accumulating signal To measure the first signal level, described the in wherein said first signal level and described sample The amount of one chromosome or chromogene seat is proportional,
(vii) detecting the second accumulating signal, described second accumulating signal comes free described second The combination of the independent signal connecting product that group probe produces；And the most described second accumulation letter Number to measure secondary signal level, described with described sample of wherein said secondary signal level The amount of the second chromosome or chromogene seat is proportional, and
(viii) relatively described first and second signal levels, thus measure the in described sample One and second chromosome or the relative quantity of chromogene seat.
Described method can be used for the aneuploidy (such as trisomy) in diagnosing fetal, wherein said Sample of nucleic acid is the sample obtained from maternal blood and comprises the nothing mixed with mother body D NA carefully Born of the same parents' foetal DNA, and the inequality proportion instruction of wherein said first and second signal levels is non- Ortholoidy (such as trisomy).
Probe
Other aspects include the probe being suitable for using in the methods of the invention.Probe and feature thereof Example be described in the above.It is described herein some other characteristic and examples.
Probe nucleic acid is preferably DNA.But, it can be another kind of nucleic acid, natural deposits Or non-naturally-occurring.The standard base of DNA is A, T, C and G, but probe nuclei Acid optionally comprises non-standard nucleotide.
It is said that in general, according to the probe of the present invention comprise target oligonucleotide and header sequence and Tail sequence.Described header sequence and tail sequence can be parts for target oligonucleotide, Or the one or both in them can be on different nucleic acid molecules.Optionally, described probe Comprise target oligonucleotide, the backbone oligonucleotides comprising header sequence and comprise tail sequence Backbone oligonucleotides.Therefore, probe can comprise in its disconnected form, two or Three nucleic acid molecules.
Described target oligonucleotide is than described target sheet segment length and comprises internal target-complementary sequence, So that the hybridization between described target oligonucleotide and described target fragment is formed and is positioned at described target Double-stranded sequence between the upstream flanking sequence and downstream flanking sequence of oligonucleotides.Described head Portion's sequence and tail sequence are respectively provided with free 5 ' ends and 3 ' ends, and respectively with described on Trip flanking sequence and downstream flanking sequence are complementary.Under annealing conditions in the presence of target fragment, institute State header sequence and tail sequence to hybridize with described flanking sequence, thus in described header sequence Limiting room between 5 ' ends and 3 ' ends of described tail sequence, wherein said target fragment is mutual with target Complementary series hybridizes in described room, is thus positioned to and described head by the end of described target fragment 5 ' ends of portion's sequence and 3 ' end juxtapositions of described tail sequence.
Described probe may be designed such that the hybridization of the target fragment in described room completes core The ring of acid, described ring comprises target fragment and header sequence and tail sequence.
The header sequence of described probe and/or tail sequence be preferably coupled to not with its of probe His region or custom sequence with target fragment complementation.
In some embodiments of described probe, single core acid molecule comprises header sequence and tail Portion's sequence.
Described header sequence and tail sequence can be spaced from them anti-with target oligonucleotide Formula is bound to flanking sequence.Such as, described header sequence and tail sequence can be few at main chain respectively 5 ' ends of nucleotides and 3 ' ends.Custom sequence may be included in the header sequence of backbone oligonucleotides And between tail sequence.The example of this probe is shown in Fig. 1 and Fig. 3.Or, described The header sequence of backbone oligonucleotides and tail sequence can be adjacent, do not have insertion nucleosides Acid sequence.In this case, the flanking sequence of target oligonucleotide is along backbone oligonucleotides Total length hybridization and it can be made to be cyclized.
Described probe may be designed such that header sequence be target oligonucleotide 5 ' end and/or Tail sequence is 3 ' ends of target oligonucleotide, so that the hybridization of the target fragment in described room Completing the chain of nucleic acid, it is mutual that described nucleic acid comprises target fragment, header sequence and tail sequence, target Complementary series and flanking sequence.Described header sequence and tail sequence can be at target oligonucleotides End and cis be bound to flanking sequence.The example of this probe figure 4 illustrates.? In this pattern of probe, header sequence and tail sequence and target-complementary sequence all become It is cyclized with target fragment.Custom sequence can be positioned in the ring of oligonucleotides.Probe nucleic acid is relative Longer, but have oligonucleotide structure is connected into a pre-assembled molecule and be not required to otherwise Advantage with the hybridization of probe nucleic acid molecule.
Probe also is designed to have backbone oligonucleotides, described backbone oligonucleotides be from The independent molecule of the nucleic acid of target oligonucleotide.Tail sequence can be the 3 ' of target oligonucleotide Hold, and header sequence can be 5 ' ends of backbone oligonucleotides.Or, header sequence is permissible It is 5 ' ends of target oligonucleotide, and tail sequence can be 3 ' ends of backbone oligonucleotides. Custom sequence can be introduced in target oligonucleotide, such as with described head or tail sequence with Ring is provided between flanking sequence.The advantage using this detecting probe method is that detection sequence can quilt Introducing in described ring and associate with target-complementary sequence, this can be for multiple applications Favourable, the highest multiple especially with high re-detection scheme.Backbone oligonucleotides also can be wrapped Containing custom sequence.By providing probe, described probe nucleic acid molecule ratio in two kinds of oligonucleotides Single oligonucleotides pattern is short, but maintains identical function.
The another kind of design of probe provides head and tail of sequence in two kinds of backbone oligonucleotides Sequence.Therefore, described probe comprises
Target oligonucleotide, described target oligonucleotide than described target sheet segment length and comprises inside Target-complementary sequence, so that the hybridization shape between described target oligonucleotide and described target fragment Become between the upstream flanking sequence and downstream flanking sequence of described target oligonucleotide is double Chain-ordering,
Comprise the backbone oligonucleotides with the free 5 ' header sequence held, and
Comprise the backbone oligonucleotides with the free 3 ' tail sequence held,
Wherein said head and afterbody oligonucleotide sequence respectively with upstream and downstream flanking sequence Complementary.
A kind of backbone oligonucleotides can carry capture portion, in this case another main chain widow's core Thuja acid is for detection and can carry foreign marker.One or both backbone oligonucleotides also can be wrapped Containing custom sequence.Alternatively or additionally, target oligonucleotide can comprise custom sequence.
Under annealing conditions in the presence of target fragment, described header sequence and tail sequence are with described Flanking sequence hybridizes, thus holds at 5 ' ends of described header sequence and the 3 ' of described tail sequence Between limit room, wherein said target fragment and target-complementary sequence hybridize in described room, Thus the end of described target fragment is positioned to and the 5 ' of described header sequence end and described afterbodys 3 ' end juxtapositions of sequence.The hybridization of the target fragment in described room complete to comprise described target fragment with And the chain of the nucleic acid of described head and tail sequence.Described chain carries described capture portion and described Mark, thus allow to use the capture/detection method described in elsewhere herein to detect.
Kit and probe groups
Another aspect of the present disclosure is the probe groups for combining strand target nucleic acid fragment, described spy Pin group include multiple probe, described probe have for combine multiple different target fragment multiple not Same target-complementary sequence.
Described probe groups can be used for combining multiple fragments of human chromosome, every in wherein said group Individual probe is for combining the different target fragments special to described chromosome.Described probe can all wrap Containing common custom sequence as a part for target oligonucleotide or as backbone oligonucleotides A part.
Many group probes are provided to combine the different fragments of two or more human chromosomes, Comprising:
For combining first group of probe of the multiple target fragments special to the first chromosome, and
For combining second group of probe of the multiple target fragments special to the second chromosome, Yi Jiren Selection of land
For combining a group of the multiple target fragments special to one or more other chromosome Or organize other probe more.Probe in one group can have custom sequence, and described custom sequence is The custom sequence of described group of probe that is common and that be different from other groups.
May also provide kit, described kit is included in the solution in one or more container Many groups probe.
Purposes
Probe as herein described, probe groups and kit are useful for the existence of target nucleic acid fragment Test sample.They can be used for the restriction target fragment differentiating in the sample of fragmented nucleic acids in vitro Existence.
On the one hand include using probe for the existence test sample for target single-chain nucleic acid fragment,
Wherein said probe comprises target oligonucleotide, and described target oligonucleotide contains promising target sheet The sequence of the exact complementary sequence of section；And head and afterbody oligonucleotide sequence, described head Hybridize with afterbody oligonucleotide sequence target fragment on described target oligonucleotide,
Hybridization between wherein said target fragment and described probe makes target fragment template for even It is connected to header sequence and tail sequence.
The example of this kind of probe and the purposes in the method for test sample thereof is on other ground herein Side is more fully described.Purposes includes that the test maternal blood sample from pregnant woman is to detect fetus Nucleic acid is for diagnosis chromosome abnormality such as trisomy, and tests patient for Tumour DNA Sample is for the existence of tumour in diagnosis or monitoring patient.Other purposes include for microorganism The sample of the existence test material of nucleic acid, the detection instruction material quilt of wherein said microbial nucleic acids Microorganism infects, and described microorganism can be infectious agent such as bacterium, virus or fungi.Described sample Originally can be from tissue or the blood sample of patient.
Embodiment
There is provided following example to show and further illustrating certain embodiments of the present invention With aspect and be not necessarily to be construed as limiting its scope.
Embodiment 1
The scheme being suitable for carrying out the method shown in Fig. 1 is as follows:
1) by the DNA of 10ng in corresponding compatible restriction enzyme buffer liquid by the limit of 1 unit Enzymic digestion processed.Reaction being hatched at 37 DEG C 1 hour, then at 80 DEG C, enzyme inactivates 20 points Clock.2) DNA fragmentation is continued at 95 DEG C sex change in 10 minutes be single-chain fragment and with spy Pin and ligase mix to form ring.Probe set is added together with 1U with the independent concentration of 10pM Ampligase (Epicentre) and hatch in ligase buffer solution 1 hour at 55 DEG C. 3) 1U exonuclease is added to remove unreacted probe and fragment.By circumscribed for the λ of I U Nuclease (Epicentre) continues within 1 hour, to be added on corresponding exonuclease enzyme buffer at 37 DEG C In liquid, then at 80 DEG C, enzyme inactivates 20 minutes.4) remaining ring is expanded by RCA. Continue the phi29 polymerase (New England Biolabs) of 1U at 37 DEG C to add for 1 hour It is added in corresponding phi29 buffer solution and nucleotides (dNTP).
Embodiment 2
The scheme being suitable for carrying out the method shown in Fig. 2 is as follows:
1) by the DNA of 10ng in corresponding compatible restriction enzyme buffer liquid by the limit of 1 unit Enzymic digestion processed.Reaction being hatched in 37 DEG C 1 hour, then at 80 DEG C, enzyme inactivates 20 points Clock.2) DNA fragmentation is continued at 95 DEG C sex change in 10 minutes be single-chain fragment and with spy Pin and ligase mix to form linearly connected product.Probe collection is added with the independent concentration of 10pM Close together with the Ampligase (Epicentre) of 1U and at 55 DEG C in ligase buffer solution Hatch 1 hour.3) product will be connected to capture on magnetic Streptavidin bead.In order to remove Unreacted probe and fragment, by the magnetic bead of solution with the coating of 10ml M-280 Streptavidin (Invitrogen) the Tris HCl in 200ml final volume (pH 7.5), 3.5mM EDTA Mix with in 0.07%Tween-20, and at room temperature hatch 15 minutes.After incubation, Use annular magnet to collect bead, and remove supernatant.
Embodiment 3
Material and method
Sample prepares: by the 10ml blood collection from each experimenter to Cell-free DNA In pipe (Streck, Omaha, NE).By dual centrifugation protocol (1600g continue 10 minutes, Then after first rotates, after pipe transfer, 16 000g continue 10 minutes) from blood separation blood Slurry.Scheme according to manufacturer by Qiagen ccf nucleic acid reagent box (Qiagen, Hilden, Germany) cfDNA is separated.By gained DNA at buffer solution (the Qiagen kit of 50ul A part) in wash-out.
Probe and main chain design: multiple probe technology as herein described realizes thousands of chromosome Specifically and simultaneously expanding of fragment.It is designed to probe capture from chromosome 21,18 and 2500-5000 the fragment (target) of every kind in 13.Target is selected as in genome tool Having unique sequences, uniform AT/GC forms, and does not comprise known polymorphism in target sequence The most do not comprise the size between CNV, and 18-35bp.By targeting from every chromosome The probe of 2500 fragments of 13 and 18 and targeting from chromosome 21 fragment 5000 Individual probe pools together to produce single oligonucleotide probe set.
The exemplary sequence of probe, " N " represents target-complementary sequence: ATGTGACCCTTCCGTCTGTTGAGTTAGGCCNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNTCGTGCCTTGTCATTCGGGAGCACTA ACTGCTG(SEQ ID NO:1)
The main chain of the header sequence and tail sequence with the termini-complementary with probe is designed to Comprise the sequence motifs for order-checking and digital counting.Two main chains are used in result part In the experiment of general introduction；A main chain with the probes complementary of targeting staining body 13 and 18: (/ 5P hos/CGCACACGATTAAGGTCCAGTCACAGGCAGAGATCGGAAG AGCGTCGTGTAGGGAAAGAGTGTNNNNNNNNNNGTGTAGATCT CGGTGGTCGCCGTATCATTTCATGCTGCTAACGGTCGAGTCGGA CAGGTGGCTCCACTAAATAGACGCA)；SEQ ID NO:2, and targeting One main chain of chromosome 21: (/ 5Phos/GGCCTAACTCAACAGACGGAAGG GTCACATAGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTNNN NNNNNNNGTGTAGATCTCGGTGGTCGCCGTATCATTTCATGCTG CTAACGGTCGAGCAGTTAGTGCTCCCGAATGACAAGGCACGA； SEQ ID NO:3)。
Biochemical probes scheme: by the purifying cfDNA of 50ul with in 55ul cumulative volume 5U MseI (New in 1x NEB4 buffer solution (New England Biolabs) and 1x BSA England Biolabs) digest 30 minutes at 37 DEG C, then heat inactivation 20 points at 65 DEG C Clock.Then the DNA of digestion is mixed together together with probe and main chain with being connected mixture.Will The DNA of the digestion of 55ul is connected slow with probe (1pM/ probe), main chain (respective 60nM), 1x Rush liquid (Epicentre), the Ampligase (Epicentre) of 100U, 1mM NAD and 5mM Mg2+Mix the cumulative volume to 70ul.By digestion fragment first at 95 DEG C in 5 minutes First sex change is single stranded DNA, then 55 DEG C of hybridization and connection in 16 hours.Then will Connect mixture exonuclease ferment treatment to remove any remaining linear DNA molecule.Will The ExoIII (NEB) of the ExoI (NEB) and 5U of the 20U of coupled reaction and 75ul cumulative volume And 1x BSA tot mixes lasting 60 minutes at 37 DEG C, then heat inactivation at 65 DEG C 10 minutes.
Analyze: for sequencing analysis, the ring of exonuclease ferment treatment is surveyed with Illumina The sequencing primer of sequence instrument complementation expands and is supported on Illumina according to manufacturer's scheme subsequently On Miseq instrument.
For numerical analysis, the reaction of exonuclease ferment treatment is made to stand rolling circle amplification reaction (RCA) to produce the discrete dna object that the concatermer of described ring copies.By 37,5ul's The ring of exonuclease ferment treatment is polymerized with the phi29 of 4mM DTT, 3U in 50ul cumulative volume Enzyme (NEB), 0,1uM primer, 1mM dNTP mixture (NEB) and 1x BSA mixing, And hatch at 37 DEG C 1 hour, then heat inactivation 10 minutes at 65 DEG C.Then will The RCA reaction fluorescently-labeled oligonucleotide marker with backbone sequence complementation.By 50ul's The widow that RCA product marks with 0,1%Tween 20 (Sigma), the 5nM in 100ul cumulative volume Nucleotides and 2x SSC (Sigma) mixing.The RCA product of mark is eventually deposited at painting It is covered with on the microslide of polylysine (Sigma) and counts in fluorescence microscope.
Result
Illumina order-checking and digital counting system prove detecting probe method as herein described.For Prove the performance of detecting probe method, will have DNA sample and the variable concentrations of three bodies 21 The DNA mixing extracted from normal plasma sample (3-5ml blood plasma).Then sample is made to carry out probe Method, and be evaluated by order-checking.
For result shown in fig. 8, the cell line dna of 100ng is made to stand above-mentioned side Case.Mix 10,000 probes in set to be specifically cyclized from chromosome 13, 10,000 homologue fragments of 18 and 21.Then 10,000 gained rings are used Illumina-correspondence PCR primer carries out expanding and being analyzed on gel before order-checking.Swimming Road 1 is corresponding to DNA ladder degree, swimming lane 2 DNA sample after digestion, and swimming lane 3 There is the PCR primer of the fragment of 10,000 amplifications.
For Fig. 9, the result shown in 12, by carrying of normal plasma sample and variable concentrations There is the Sample-Parallel analysis of the DNA of three bodies 21.Extract DNA and pass through 10K-plex Probe designs processes, and last order-checking on Illumina sequenator.Offer 99% is provided Specific confidential interval, based on estimated normal distribution with 90% sensitivity technique positive sample This.
In order to prove to change into targeting fragment the principle of the DNA object of mark, will have The DNA of the 10% of three bodies 21 adds to 20ng normal cell system DNA and carries out probe Method.The RCA product of obtained mark is randomly deposited on microslide and Counting.Targeting is derived from a kind of color mark of probe of chromosome 21 and targeting is derived from The fragment reference color of chromosome 13 and 18 marks.These results figure 10 illustrates. The figure (A) of Figure 10 illustrates from microscopical image, it is shown that the RCA with detection of mark produces Thing.By with a kind of fluorogen mark from all fragments of chromosome 13 and glimmering with second Light blob mark carrys out the fragment of self-reference chromosome, can realize ratio measure.Figure (B): by 20ng The DNA RCA-that carries out processing and change into mark by 10K-plex probe designs produce Thing.Sample-Parallel analysis by RCA-product with 10% interpolation carrying three body 21DNA. By 12 kinds of normal DNA samples (sample #1-12) and three kinds of positive sample (sample #13-15) and Row is analyzed.
Further describe
Following clause is a part for specification.
1., for the method for existence test sample for target nucleic acid fragment, described method includes:
I () provides the sample of fragmented nucleic acids
(ii) providing Denaturing, under described Denaturing, described target fragment is strand
(iii) making described sample contact with nucleic acid probe, described nucleic acid probe comprises
Target oligonucleotide, described target oligonucleotide than described target sheet segment length and comprises inside Target-complementary sequence, so that the hybridization shape between described target oligonucleotide and described target fragment Become between the upstream flanking sequence and downstream flanking sequence of described target oligonucleotide is double Chain-ordering, and
It is respectively provided with 5 ' free end and the 3 ' header sequence held and tail sequence, wherein said Header sequence and described tail sequence respectively with described upstream flanking sequence and described downstream flank Complementary,
(iv) annealing conditions, the most described header sequence and described tail sequence are provided Hybridize with described flanking sequence, and described target fragment (if present) and described target-complementary sequence Row hybridization, thus the described end of described target fragment is positioned to described in described header sequence 5 ' ends and described 3 ' the end juxtapositions of described tail sequence
V () provides the condition for connecting, so that if there is described target fragment, then by institute Described 3 ' the ends stating target fragment are connected to the described 5 ' ends of described header sequence to form first even Connect abutment, and the described 5 ' ends of described target fragment are connected to the described of described tail sequence 3 ' ends are to form the second connection abutment, thus produce the product of dual connection, described product bag Continuous chain containing nucleic acid, described nucleic acid comprises described header sequence and described tail sequence and institute State target fragment, and
(vi) detect whether to exist the product of described dual connection,
Wherein detect that the product of described dual connection indicates target fragment described in described sample Exist.
2., according to the method described in clause 1, the sample of wherein said fragmented nucleic acids is to limit Enzymic digestion product and described target fragment are restricted fragments.
3. according to the method described in clause 1 or clause 2, described the 5 ' of wherein said header sequence Described 3 ' the ends of end and described target fragment and the adjacent nucleosides acid hybridization of described target oligonucleotide, And the described 3 ' ends of described tail sequence and described 5 ' end and the described targetings of described target fragment The adjacent nucleosides acid hybridization of oligonucleotides.
4., according to the method according to any one of aforementioned clause, wherein said detection is described dual The step of the product connected includes providing and connects for described first of the continuous chain across described nucleic acid Connect abutment and described second and connect the condition of abutment amplification, and detect whether to there is amplification Product.
5., according to the method according to any one of aforementioned clause, wherein comprise described header sequence It is the ring of nucleic acid with the continuous chain of described tail sequence and the described nucleic acid of described target fragment.
6. according to the method described in clause 5, the product of the described dual connection of wherein said detection Step include providing for the condition of rolling-circle replication and detecting whether to there is rolling-circle replication Product.
7., according to the method described in clause 6, wherein said rolling-circle replication is that hyperbranched rolling ring is multiple System.
8., according to the method according to any one of clause 5 to 7, wherein said probe is included in Described header sequence on one nucleic acid molecules and described tail sequence.
9. according to the method described in clause 8, wherein said probe comprise respectively its 5 ' end, 3 ' End has described header sequence and the backbone oligonucleotides of described tail sequence, wherein said main chain The described header sequence of oligonucleotides and described tail sequence trans knot under described annealing conditions It is bonded to the described flanking sequence of described target oligonucleotide.
10., according to the method described in clause 9, wherein said backbone oligonucleotides is included in described Custom sequence between header sequence and described tail sequence, wherein said custom sequence not with institute State probe other regions or with described target fragment complementation.
11. according to the method described in clause 9, the described head of wherein said backbone oligonucleotides Sequence and described tail sequence are adjacent.
12. according to the method according to any one of clause 5 to 8, wherein said header sequence and Described tail sequence is in the end of described target oligonucleotide and under described annealing conditions Cis it is bound to described flanking sequence.
13. are included in institute according to the method described in clause 12, wherein said target oligonucleotide State the custom sequence between target oligonucleotide and described head and/or tail sequence, Qi Zhongsuo State custom sequence not with other regions of described probe or with described target fragment complementation.
14. exist according to the method according to any one of clause 1 to 7, wherein said tail sequence Described 3 ' the ends of described target oligonucleotide, and described probe comprises to have and 5 ' holds at it The backbone oligonucleotides of described header sequence,
Wherein under described annealing conditions, described tail sequence is cis is bound to described targeting widow's core The described downstream flanking sequence of thuja acid, and the described header sequence of described backbone oligonucleotides is anti- Formula is bound to the described upstream flanking sequence of described target oligonucleotide.
15. comprise a pair according to the method described in clause 14, wherein said backbone oligonucleotides Inverted repeats, wherein
Under described annealing conditions, described inverted repeats forms hairpin structure, thus by institute Described 3 ' the ends stating backbone oligonucleotides are positioned to the described 5 ' ends with described target oligonucleotide Juxtaposition, and wherein
Described under conditions of connecting, the described 5 ' ends of described target oligonucleotide are connected To the described 3 ' ends of described backbone oligonucleotides, so that the product of described dual connection is to comprise The ring of the nucleic acid of described target oligonucleotide, described target fragment and described backbone oligonucleotides.
16. exist according to the method according to any one of clause 1 to 7, wherein said header sequence Described 5 ' the ends of described target oligonucleotide, and described probe comprises to have and 3 ' holds at it The backbone oligonucleotides of described tail sequence,
Wherein under described annealing conditions, described header sequence is cis is bound to described targeting widow's core The described upstream flanking sequence of thuja acid, and the described tail sequence of described backbone oligonucleotides is anti- Formula is bound to the described downstream flanking sequence of described target oligonucleotide.
17. comprise a pair according to the method described in clause 16, wherein said backbone oligonucleotides Inverted repeats, wherein
Under described annealing conditions, described inverted repeats forms hairpin structure, thus by institute Described 5 ' the ends stating backbone oligonucleotides are positioned to the described 3 ' ends with described target oligonucleotide Juxtaposition, and wherein
Described under conditions of connecting, the described 3 ' ends of described target oligonucleotide are connected To the described 5 ' ends of described backbone oligonucleotides, so that the product of described dual connection is to comprise The ring of the nucleic acid of described target oligonucleotide, described target fragment and described backbone oligonucleotides.
18. according to the method according to any one of clause 14 to 17, wherein said main chain widow's core Thuja acid is included in the custom sequence between described inverted repeats, so that at described annealing bar Under part, described backbone oligonucleotides forms hairpin loop.
19. according to the method according to any one of clause 1 to 4, wherein comprises described head sequence The continuous chain of the described nucleic acid of row and described tail sequence and described target fragment is the line of nucleic acid Property chain.
20. according to the method described in clause 19, and wherein said tail sequence is few in described targeting Described 3 ' the ends of nucleotides, and described probe comprises and has in its 5 ' described head sequence held The backbone oligonucleotides of row,
Wherein under described annealing conditions, described tail sequence is cis is bound to described targeting widow's core The described downstream flanking sequence of thuja acid, and the described header sequence of described backbone oligonucleotides is anti- Formula is bound to the described upstream flanking sequence of described target oligonucleotide.
21. according to the method according to any one of clause 14,15 or 20, wherein said targeting Oligonucleotides is included in the custom sequence between described downstream flanking sequence and described tail sequence, So that described target oligonucleotide forms hairpin loop under described annealing conditions.
22. according to the method described in clause 19, and wherein said header sequence is few in described targeting Described 5 ' the ends of nucleotides, and described probe comprises and has in its 3 ' described afterbody sequence held The backbone oligonucleotides of row,
Wherein under described annealing conditions, described header sequence is cis is bound to described targeting widow's core The described upstream flanking sequence of thuja acid, and the described tail sequence of described backbone oligonucleotides is anti- Formula is bound to the described downstream flanking sequence of described target oligonucleotide.
23. according to the method according to any one of clause 16,17 or 22, wherein said targeting Oligonucleotides is included in the custom sequence between described header sequence and described upstream flanking sequence, So that described target oligonucleotide forms hairpin loop under described annealing conditions.
24. according to the method according to any one of clause 14 to 18 or 20 to 23, Qi Zhongsuo State backbone oligonucleotides and carry capture portion.
25. comprise containing having free 5 ' according to the method described in clause 19, wherein said probe The backbone oligonucleotides of the header sequence of end；And containing having the free 3 ' tail sequence held Backbone oligonucleotides, wherein described header sequence and described tail sequence under described annealing conditions The trans described flanking sequence being bound to described target oligonucleotide.
26. according to the method described in clause 25, and wherein one or two backbone oligonucleotides is also Comprise custom sequence, wherein said custom sequence not with other regions of described probe or with described Target fragment complementation.
27. according to the method described in clause 25 or clause 26, wherein said backbone oligonucleotides In one carry capture portion.
28. carry according to the method described in clause 27, another backbone oligonucleotides wherein said Foreign marker.
29. is fluorogen according to the method described in clause 28, wherein said mark.
30. according to the method according to any one of clause 24 or clause 27 to 29, Qi Zhongsuo State the step detecting whether to exist the product of described dual connection to include via described capture portion Described backbone oligonucleotides is captured in matrix, washs the spy that described matrix is not connected with removing Pin and reservation comprise the capture fraction of the backbone oligonucleotides of described matrix and capture, Yi Jizhen Existence to the product of dual connection described in described capture fraction is tested.
31. according to the method described in clause 28 or clause 29, and wherein said detecting whether exists The step of the product of described dual connection includes described main chain widow's core via described capture portion Thuja acid captures in matrix, washs described matrix and comprises to remove the probe being not connected with and reservation The capture fraction of the backbone oligonucleotides of described matrix and capture, and for described capture fraction Described in mark existence test.
32. according to the method according to any one of clause 24 or clause 27 to 31, Qi Zhongsuo Stating capture portion is biotin.
33. according to the method according to any one of aforementioned clause, wherein said target-complementary sequence There is the length of 10 to 30 nucleotides.
34. according to the method according to any one of aforementioned clause, wherein said target-complementary sequence Have less than 5 base-pair mismatch with described target fragment.
35. is described target according to the method described in clause 34, wherein said target-complementary sequence The exact complementary sequence of fragment.
36. according to the method according to any one of aforementioned clause, and wherein said flanking sequence is each There is the length of 10 to 30 nucleotides.
37. according to the method according to any one of aforementioned clause, wherein said upstream flanking sequence Different from each other with described downstream flanking sequence.
38. according to the method according to any one of aforementioned clause, wherein said header sequence and institute State upstream flanking sequence to have less than 5 base-pair mismatch, and described tail sequence is with described Downstream flanking sequence has less than 5 base-pair mismatch.
39. according to the method described in clause 38, and wherein said header sequence is described upstream side The exact complementary sequence of wing sequence, and described tail sequence is the essence of described downstream flanking sequence Really complementary series.
40. according to the method according to any one of aforementioned clause, wherein said target oligonucleotide It is linear.
41. is fragmentation according to the method according to any one of aforementioned clause, wherein said sample The sample of human chromosome, and described target fragment is the human genome special to item chromosome Fragment.
42. according to the method described in clause 41, and wherein said target fragment is to described human genome A locus special.
43. according to the method according to any one of aforementioned clause, wherein said probe nucleic acid are DNA。
44. according to the method according to any one of aforementioned clause, and wherein said method includes using Multiple multiple different target nucleic acid fragments of the parallel multiple testing of described probe.
45. according to the method described in clause 44, and wherein said method includes making fragmentation dye The sample of body contacts with one group of probe of the multiple fragments for combining chromosome, wherein said Each probe in group is for combining the different target fragments special to described chromosome.
46. have common custom sequence according to the method described in clause 45, wherein said probe.
47. according to the method described in clause 44, and wherein said method includes making fragmentation dye The sample of body connects with many groups probe of the multiple fragments for combining two or more bar chromosome Touching, wherein said probe groups comprises:
For combining first group of probe of the multiple target fragments special to the first chromosome, and
For combining second group of probe of the multiple target fragments special to the second chromosome, Yi Jiren Selection of land
For combining a group of the multiple target fragments special to one or more other chromosome Or organize other probe more.
48. according to the method described in clause 47, and respectively group probe comprises for combining institute State at least 500 different probes of the special multiple target fragments of chromosome.
49. according to the method described in clause 47 or clause 48, the described probe in one of which Total custom sequence, described custom sequence is that described subgroup is common and be different from other groups The described custom sequence of probe.
50. according to the method described in clause 49, and it includes by detection for often organizing probe The product of described dual connection and detect the relative quantity of described custom sequence in described product Measure the relative quantity of two or more chromosomes described in described sample.
51. according to the method according to any one of clause 45 to 50, wherein said one or many Bar chromosome is people.
52. 1 kinds for combining the nucleic acid probe of strand target nucleic acid fragment, wherein said probe bag Contain
Target oligonucleotide, described target oligonucleotide than described target sheet segment length and comprises inside Target-complementary sequence, so that the hybridization shape between described target oligonucleotide and described target fragment Become between the upstream flanking sequence and downstream flanking sequence of described target oligonucleotide is double Chain-ordering, and
It is respectively provided with 5 ' free end and the 3 ' header sequence held and tail sequence, wherein said Header sequence and described tail sequence respectively with described upstream flanking sequence and described downstream flank Complementary
So that under annealing conditions in the presence of described target fragment, described header sequence and described Tail sequence hybridizes with described flanking sequence, thus in described 5 ' end and the institutes of described header sequence Stating and limit room between the described 3 ' ends of tail sequence, wherein said target fragment is mutual with described target Complementary series hybridizes in described room, is thus positioned to and institute by the described end of described target fragment State described the 5 ' of header sequence to hold and described 3 ' the end juxtapositions of described tail sequence, and wherein
The hybridization of the described target fragment in described room completes the ring of nucleic acid, and described ring comprises described Target fragment and described header sequence and described tail sequence.
53. according to the nucleic acid probe described in clause 52, wherein said head and/or tail sequence Be connected to custom sequence, wherein said custom sequence not with other regions of described probe or with Described target fragment complementation.
54. according to the nucleic acid probe described in clause 52 or clause 53, wherein single core acid molecule Comprise described header sequence and described tail sequence.
55. according to the probe described in clause 52 or clause 53, wherein said header sequence and institute State tail sequence to separate with described target oligonucleotide, and trans be bound to described flank sequence Row.
56. according to the probe described in clause 55, wherein said header sequence and described afterbody sequence Row are respectively at 5 ' ends and the 3 ' ends of backbone oligonucleotides.
57. are included in institute according to the probe described in clause 56, wherein said backbone oligonucleotides State the custom sequence between header sequence and described tail sequence, wherein said custom sequence not with Other regions of described probe or with described target fragment complementation.
58. according to the probe described in clause 56, the described head of wherein said backbone oligonucleotides Portion's sequence and described tail sequence are adjacent.
59. 1 kinds for combining the nucleic acid probe of strand target nucleic acid fragment, wherein said probe bag Contain
Target oligonucleotide, described target oligonucleotide than described target sheet segment length and comprises inside Target-complementary sequence, so that the hybridization shape between described target oligonucleotide and described target fragment Become between the upstream flanking sequence and downstream flanking sequence of described target oligonucleotide is double Chain-ordering, and
It is respectively provided with 5 ' free end and the 3 ' header sequence held and tail sequence, wherein said Head oligonucleotide sequence and described afterbody oligonucleotide sequence respectively with described upstream flank sequence Row and described downstream flanking sequence are complementary,
So that under annealing conditions in the presence of described target fragment, described header sequence and described Tail sequence hybridizes with described flanking sequence, thus in described 5 ' end and the institutes of described header sequence Stating and limit room between the described 3 ' ends of tail sequence, wherein said target fragment is mutual with described target Complementary series hybridizes in described room, is thus positioned to and institute by the described end of described target fragment State described the 5 ' of header sequence to hold and described 3 ' the end juxtapositions of described tail sequence, and wherein
Described header sequence is that the 5 ' of described target oligonucleotide is held and/or described tail sequence is 3 ' ends of described target oligonucleotide, so that the hybridization of the described target fragment in described room is complete Becoming the chain of nucleic acid, described nucleic acid comprises described target fragment, described header sequence and described afterbody sequence Row, described target-complementary sequence and described flanking sequence.
60. according to the probe described in clause 52 or clause 59, wherein said header sequence and institute State the tail sequence end at described target oligonucleotide, and trans be bound to described flank Sequence.
61. is institute according to the probe described in clause 52 or clause 59, wherein said tail sequence State target oligonucleotide 3 ' end, and described header sequence be with described target oligonucleotide every 5 ' ends of the backbone oligonucleotides opened.
62. is institute according to the probe described in clause 52 or clause 59, wherein said header sequence State target oligonucleotide 5 ' end, and described tail sequence be with described target oligonucleotide every 3 ' ends of the backbone oligonucleotides opened.
63. according to the probe described in clause 61 or clause 62, wherein said backbone oligonucleotides Also comprise custom sequence, wherein said custom sequence not with other regions of described probe or with institute State target fragment complementation.
64. 1 kinds for combining the nucleic acid probe of strand target nucleic acid fragment, wherein said probe bag Contain
Target oligonucleotide, described target oligonucleotide than described target sheet segment length and comprises inside Target-complementary sequence, so that the hybridization shape between described target oligonucleotide and described target fragment Become between the upstream flanking sequence and downstream flanking sequence of described target oligonucleotide is double Chain-ordering,
Comprise the backbone oligonucleotides with the free 5 ' header sequence held, and
Comprise the backbone oligonucleotides with the free 3 ' tail sequence held,
Wherein said head oligonucleotide sequence and described afterbody oligonucleotide sequence respectively with institute State upstream flanking sequence and described downstream flanking sequence is complementary, and wherein
A kind of backbone oligonucleotides carries capture portion and another backbone oligonucleotides is carried different Source marking,
So that under annealing conditions in the presence of described target fragment, described header sequence and described Tail sequence hybridizes with described flanking sequence, thus in described 5 ' end and the institutes of described header sequence Stating and limit room between the described 3 ' ends of tail sequence, wherein said target fragment is mutual with described target Complementary series hybridizes in described room, is thus positioned to and institute by the described end of described target fragment State described the 5 ' of header sequence to hold and described 3 ' the end juxtapositions of described tail sequence, and wherein
The hybridization of the described target fragment in described room completes to comprise described target fragment and described The chain of the nucleic acid of header sequence and described tail sequence, wherein said chain carries described capture portion With described mark.
65. is biotin according to the probe described in clause 64, wherein said capture portion.
66. according to the probe described in clause 64 or clause 65, and wherein said mark is fluorogen.
67. according to the probe according to any one of clause 64 to 66, and wherein one or two is main Chain oligonucleotides also comprises custom sequence, wherein said custom sequence not with other of described probe Region or with described target fragment complementation.
68. according to the probe according to any one of clause 52 to 67, wherein said targeting widow's core Thuja acid also comprises custom sequence, described custom sequence not with other regions of described probe or with institute State target fragment complementation.
69. according to the probe according to any one of aforementioned clause, wherein said target-complementary sequence There is the length of 10 to 30 nucleotides.
70. according to the probe according to any one of aforementioned clause, wherein said target-complementary sequence Have less than 5 base-pair mismatch with described target fragment.
71. is described target according to the probe described in clause 70, wherein said target-complementary sequence The exact complementary sequence of fragment.
72. according to the probe according to any one of clause 52 to 71, wherein said flanking sequence Each there is the length of 10 to 30 nucleotides.
73. according to the probe according to any one of clause 52 to 72, wherein said targeting widow's core Described upstream flanking sequence and the described downstream flanking sequence of thuja acid are different from each other.
74. according to the probe according to any one of clause 52 to 73, wherein said header sequence Have less than 5 base-pair mismatch with described upstream flanking sequence, and described tail sequence with Described downstream flanking sequence has less than 5 base-pair mismatch.
75. according to the probe described in clause 74, wherein said header sequence and described afterbody sequence Row are the definite complementary series of described flanking sequence.
76. according to the probe according to any one of clause 52 to 75, wherein said targeting widow's core Thuja acid is linear.
77. according to the probe according to any one of clause 52 to 76, wherein said target fragment are Restriction endonuclease fragment.
78. according to the probe according to any one of clause 52 to 77, wherein said target fragment are Human genome fragment.
79. according to the probe described in clause 78, and wherein said target fragment is to item chromosome Special human genome fragment.
80. according to the probe described in clause 79, and wherein said target fragment is to described human genome A locus special.
81. according to the probe according to any one of clause 52 to 80, wherein said probe nucleic acid It is DNA.
82. 1 groups of probes being used for combining strand target nucleic acid fragment, it includes according to clause 52 To the multiple probes according to any one of 81, described probe has for combining multiple different target The multiple different target-complementary sequence of fragment.
83. according to one group of probe described in clause 82, and it is for combining the multiple of human chromosome Fragment, each probe in wherein said group is for combining the different targets special to described chromosome Fragment.
84. according to one group of probe described in clause 83, the total common customization of wherein said probe Sequence.
85. for combining many groups probe of the different fragments of two or more human chromosomes, its Including:
For combining first group of probe of the multiple target fragments special to the first chromosome, and
For combining second group of probe of the multiple target fragments special to the second chromosome, Yi Jiren Selection of land
For combining a group of the multiple target fragments special to one or more other chromosome Or organize other probe more.
86. have according to the many groups probe described in clause 85, the described probe in one of which Custom sequence, described custom sequence be described group common and be different from the probe in other groups Described custom sequence.
87. 1 kinds of kits, its be included in the solution in one or more container according to bar One or more groups probe according to any one of money 82 to 86.
88. according to the probe according to any one of clause 52 to 81, according to clause 82 to 86 According to any one of one group of probe or according to the purposes of the kit described in clause 87, it is used In the existence test sample for target nucleic acid fragment.
89. 1 kinds of probes are used for the purposes of the existence test sample for target single-chain nucleic acid fragment,
Wherein said probe comprises target oligonucleotide, and described target oligonucleotide is containing promising described The sequence of the definite complementary series of target fragment；And head oligonucleotide sequence and afterbody widow's nucleosides Acid sequence, described head oligonucleotide sequence and described afterbody oligonucleotide sequence are adjacent to described target Described target fragment hybridization on oligonucleotides,
Hybridization between wherein said target fragment and described probe makes described target fragment templateization use In being connected to described header sequence and described tail sequence.
90. is such as clause 52 to 81 according to the purposes described in clause 89, wherein said probe Defined in any one of.
One embodiment provides a kind of method processing sample of nucleic acid, and described method includes: a) Making to comprise sample and the nucleic acid probe hybridization of target fragment, described nucleic acid probe comprises: i. head sequence Row and tail sequence, wherein said header sequence and described tail sequence are at the first oligonucleotides The end of molecule；And ii. clamping plate sequence, described clamping plate sequence comprises successively: with described head The upstream flanking sequence of portion's complementary, with the target-complementary sequence of described target fragment complementation and The downstream flanking sequence complementary with described tail sequence；Thus produce hybrid product, wherein said The end of the target fragment header sequence in described first oligonucleotide molecules joinably and The end of tail sequence；And b) end of described target fragment is connected to the described first few nucleosides The header sequence of acid molecule and the end of tail sequence, thus produce comprise described target fragment and Described header sequence and the cyclic products of tail sequence.
In any embodiment, described method may also include use and described first oligonucleotides The primer of molecule or described clamping plate sequence hybridization expands described cyclic products by rolling circle amplification. In these embodiments, described method may also include the most produced rolling circle amplification product Number, thus the estimation of the amount of the described target fragment in described sample is provided.
In some embodiments, described clamping plate sequence can be in described first oligonucleotide molecules In.
In some embodiments, described clamping plate sequence can be in the second oligonucleotide molecules.
In any embodiment, the length of described target-complementary sequence can be 10 to 30 Nucleotides.
In any embodiment, described target-complementary sequence can comprise and the one of described target fragment Individual or multiple mispairing.
In any embodiment, the length of described flanking sequence can be 10 and 40 nucleosides Acid.
In any embodiment, described sample can be with limiting enzymic digestion.
In any embodiment, described sample can comprise genomic DNA, such as people's gene Group DNA.In these embodiments, described sample can comprise from blood separate acellular DNA.Such as, in any embodiment, the blood flow that described sample can comprise from pregnant woman divides From Cell-free DNA.
In some embodiments, described clamping plate sequence can comprise capture portion such as biotin In second oligonucleotide molecules of part.In these embodiments, described method comprises the steps that C) described cyclic products is fixed to solid phase by combining described capture portion；And
D) nucleic acid and other reactive components that described solid phase is not connected with are washed with removing, thus rich Collect described cyclic products.
In any embodiment, described target fragment may be from chromosome 21,13 or 18.
In some embodiments, described method can include described sample and one group at least 50 Individual described probe hybridizes, the different fragments on the wherein said same chromosome of probe targeting, and Wherein said method produces the multiple cyclic products comprising described target fragment.
In these embodiments, described method can include in described sample and described probe groups First group and second group hybridization, wherein said first group and the other targeting of second component first are dyeed Body and the second chromosome；Described cyclic products and comparison pair is expanded by rolling circle amplification (RCA) The number of the RCA product of the first chromosome described in Ying Yu with corresponding to described the first chromosome The number of RCA product.
In these embodiments, described method can include in described sample and described probe groups First group and second group hybridization, on wherein said first group and the other targeting staining body of second component First area and second area；By rolling circle amplification (RCA) expand described cyclic products and Compare the number of the RCA product corresponding to described first area and corresponding to described second area The number of RCA product.
A kind of composition that comprise nucleic acid probe is also provided herein, as mentioned above.Implement at some In scheme, described nucleic acid probe can comprise: i. header sequence and tail sequence, wherein said head Portion's sequence and tail sequence are at the opposite end of the first oligonucleotide molecules；And ii. clamping plate sequence Row, described clamping plate sequence comprises successively: the upstream flanking sequence complementary with described header sequence, With the target-complementary sequence of the target fragment complementation in human genome and mutual with described tail sequence The downstream flanking sequence mended；Wherein said probe is designed such that when the described first few nucleosides When clamping plate sequence sour, described and described target fragment hybridize each other, the end of described target fragment can Connect the header sequence in neighbouring described first oligonucleotide molecules in ground and the end of tail sequence.
In any composition embodiment, described composition can comprise first group at least 50 Nucleic acid probe, the target-complementary sequence target sheet different from the first chromosome of wherein said probe Section is complementary, and such as human chromosome is 21,13 or 18.In these embodiments, described group Compound optionally comprises second group of at least 50 described nucleic acid probe, wherein said second group The target-complementary sequence target fragment complementation different from the second human chromosome of probe, such as dye Body 13 or 18 (if the first chromosome is chromosome 21).

Claims (73)

1., for the method for existence test sample for target nucleic acid fragment, described method includes
I () provides the sample of fragmented nucleic acids
(ii) providing Denaturing, under described Denaturing, described target fragment is strand
(iii) making described sample contact with nucleic acid probe, described nucleic acid probe comprises
Target oligonucleotide, described target oligonucleotide than described target sheet segment length and comprises inside Target-complementary sequence, so that the hybridization shape between described target oligonucleotide and described target fragment Become between the upstream flanking sequence and downstream flanking sequence of described target oligonucleotide is double Chain-ordering, and
It is respectively provided with 5 ' free end and the 3 ' header sequence held and tail sequence, wherein said Header sequence and described tail sequence respectively with described upstream flanking sequence and described downstream flank Complementary,
(iv) annealing conditions, the most described header sequence and described tail sequence are provided Hybridize with described flanking sequence, and described target fragment (if present) and described target-complementary sequence Row hybridization, thus the described end of described target fragment is positioned to described in described header sequence 5 ' ends and described 3 ' the end juxtapositions of described tail sequence
V () provides the condition for connecting, so that if there is described target fragment, then by institute Described 3 ' the ends stating target fragment are connected to the described 5 ' ends of described header sequence to form first even Connect abutment, and the described 5 ' ends of described target fragment are connected to the described of described tail sequence 3 ' ends are to form the second connection abutment, thus produce the product of dual connection, described product bag Continuous chain containing nucleic acid, described nucleic acid comprises described header sequence and described tail sequence and institute Stating target fragment, wherein said continuous chain is the ring of nucleic acid, and
(vi) detect whether to exist the product of described dual connection,
Wherein detect that the product of described dual connection indicates target fragment described in described sample Exist.
Method the most according to claim 1, the sample of wherein said fragmented nucleic acids is Limit enzymic digestion product and described target fragment is restricted fragment.
3. according to the method described in claim 1 or claim 2, wherein said head sequence Described 5 ' the ends of row and the described 3 ' ends of described target fragment are adjacent with described target oligonucleotide Nucleotide hybridization, and the described 3 ' ends and described the 5 ' of described target fragment of described tail sequence End and the adjacent nucleosides acid hybridization of described target oligonucleotide.
4. according to method in any one of the preceding claims wherein, described in wherein said detection The step of the product of dual connection includes providing described for the described continuous chain across nucleic acid One connects abutment and described second connects the condition of abutment amplification, and detects whether to exist Amplified production.
Method the most according to claim 4, the described dual connection of wherein said detection The step of product includes that offer for the condition of rolling-circle replication and detects whether to there is rolling ring again The product of system.
Method the most according to claim 5, wherein said rolling-circle replication is hyperbranched rolling Circle replication.
Method the most according to claim 1, it also includes by capture in solid phase It is enriched with described dual connection product.
8. according to the method according to any one of claim 5 to 7, wherein said probe bag It is contained in the described header sequence on a nucleic acid molecules and described tail sequence.
Method the most according to claim 8, wherein said probe comprise respectively its 5 ' End, 3 ' ends have described header sequence and the backbone oligonucleotides of described tail sequence, Qi Zhongsuo State the described header sequence of backbone oligonucleotides and described tail sequence under described annealing conditions The trans described flanking sequence being bound to described target oligonucleotide.
Method the most according to claim 9, wherein said backbone oligonucleotides is included in Custom sequence between described header sequence and described tail sequence, wherein said custom sequence is not With other regions of described probe or with described target fragment complementation.
11. methods according to claim 9, wherein said backbone oligonucleotides described Header sequence and described tail sequence are adjacent.
12. according to the method according to any one of claim 5 to 8, wherein said head sequence Row and described tail sequence are in the end of described target oligonucleotide and at described annealing bar Cis under part it is bound to described flanking sequence.
13. methods according to claim 12, wherein said target oligonucleotide comprises Custom sequence between described target oligonucleotide and described head and/or tail sequence, its Described in custom sequence not with other regions of described probe or with described target fragment complementation.
14. methods according to any one of claim 1 to 7, wherein said afterbody sequence Be listed in described target oligonucleotide described 3 ' end, and described probe comprise have its 5 ' The backbone oligonucleotides of the described header sequence of end,
Wherein under described annealing conditions, described tail sequence is cis is bound to described targeting widow's core The described downstream flanking sequence of thuja acid, and the described header sequence of described backbone oligonucleotides is anti- Formula is bound to the described upstream flanking sequence of described target oligonucleotide.
15. methods according to claim 14, wherein said backbone oligonucleotides comprises A pair inverted repeats, wherein
Under described annealing conditions, described inverted repeats forms hairpin structure, thus by institute Described 3 ' the ends stating backbone oligonucleotides are positioned to the described 5 ' ends with described target oligonucleotide Juxtaposition, and wherein
Described under conditions of connecting, the described 5 ' ends of described target oligonucleotide are connected To the described 3 ' ends of described backbone oligonucleotides, so that the product of described dual connection is to comprise The ring of the nucleic acid of described target oligonucleotide, described target fragment and described backbone oligonucleotides.
16. methods according to any one of claim 1 to 7, wherein said head sequence Be listed in described target oligonucleotide described 5 ' end, and described probe comprise have its 3 ' The backbone oligonucleotides of the described tail sequence of end,
Wherein under described annealing conditions, described header sequence is cis is bound to described targeting widow's core The described upstream flanking sequence of thuja acid, and the described tail sequence of described backbone oligonucleotides is anti- Formula is bound to the described downstream flanking sequence of described target oligonucleotide.
17. methods according to claim 16, wherein said backbone oligonucleotides comprises A pair inverted repeats, wherein
Under described annealing conditions, described inverted repeats forms hairpin structure, thus by institute Described 5 ' the ends stating backbone oligonucleotides are positioned to the described 3 ' ends with described target oligonucleotide Juxtaposition, and wherein
Described under conditions of connecting, the described 3 ' ends of described target oligonucleotide are connected To the described 5 ' ends of described backbone oligonucleotides, so that the product of described dual connection is to comprise The ring of the nucleic acid of described target oligonucleotide, described target fragment and described backbone oligonucleotides.
18. according to the method according to any one of claim 14 to 17, wherein said main chain Oligonucleotides is included in the custom sequence between described inverted repeats, so that moving back described Under the conditions of fire, described backbone oligonucleotides forms hairpin loop.
19. according to the method according to any one of claims 14 or 15, wherein said targeting Oligonucleotides is included in the custom sequence between described downstream flanking sequence and described tail sequence, So that described target oligonucleotide forms hairpin loop under described annealing conditions.
20. according to the method according to any one of claim 16 or 17, wherein said targeting Oligonucleotides is included in the custom sequence between described header sequence and described upstream flanking sequence, So that described target oligonucleotide forms hairpin loop under described annealing conditions.
21. according to the method according to any one of claim 14 to 20, wherein said main chain Oligonucleotides carries capture portion.
22. methods according to claim 21, wherein said detect whether to exist described The step of the product of dual connection includes described backbone oligonucleotides via described capture portion Capture, in matrix, is washed described matrix and is comprised described to remove the probe being not connected with and reservation The capture fraction of the backbone oligonucleotides of matrix and capture, and for institute in described capture fraction The existence of the product stating dual connection is tested.
23. according to the method described in claim 21 or claim 22, wherein said capture Part is biotin.
24. according to method in any one of the preceding claims wherein, wherein said target-complementary Sequence has the length of 10 to 30 nucleotides.
25. according to method in any one of the preceding claims wherein, wherein said target-complementary Sequence and described target fragment have less than 5 base-pair mismatch.
26. methods according to claim 25, wherein said target-complementary sequence is institute State the exact complementary sequence of target fragment.
27. according to method in any one of the preceding claims wherein, wherein said flanking sequence Each there is the length of 10 to 30 nucleotides.
28. according to method in any one of the preceding claims wherein, wherein said upstream flank Sequence and described downstream flanking sequence are different from each other.
29. according to method in any one of the preceding claims wherein, wherein said header sequence Have less than 5 base-pair mismatch with described upstream flanking sequence, and described tail sequence with Described downstream flanking sequence has less than 5 base-pair mismatch.
30. methods according to claim 29, wherein said header sequence is on described Swim the exact complementary sequence of flanking sequence, and described tail sequence is described downstream flanking sequence Exact complementary sequence.
31. according to method in any one of the preceding claims wherein, wherein said targeting widow's core Thuja acid is linear.
32. is sheet according to method in any one of the preceding claims wherein, wherein said sample The sample of the human chromosome of sectionization, and described target fragment is the people base special to item chromosome Because of pack section.
33. methods according to claim 32, wherein said target fragment is to described people's base Because a locus of group is special.
34. according to method in any one of the preceding claims wherein, wherein said probe nucleic acid It is DNA.
35. include according to method in any one of the preceding claims wherein, wherein said method Use multiple multiple different target nucleic acid fragment of the parallel multiple testing of described probe.
36. methods according to claim 35, wherein said method includes making fragmentation The sample of chromosome contacts, wherein with one group of probe of the multiple fragments for combining chromosome Each probe in described group is for combining the different target fragments special to described chromosome.
37. methods according to claim 36, the total common customization of wherein said probe Sequence.
38. methods according to claim 35, wherein said method includes making fragmentation The sample of chromosome and the many groups of spies of multiple fragments for combining two or more chromosomes Pin contacts, and wherein said probe groups comprises:
For combining first group of probe of the multiple target fragments special to the first chromosome, and
For combining second group of probe of the multiple target fragments special to the second chromosome, Yi Jiren Selection of land
For combining a group of the multiple target fragments special to one or more other chromosome Or organize other probe more.
39. according to the method described in claim 38, and respectively group probe comprises for combining At least 500 different probes of the multiple target fragments special to described chromosome.
40. according to the method described in claim 38 or claim 39, in one of which Described probe has custom sequence, and described custom sequence is that described subgroup is common and be different from The described custom sequence of the probe in other groups.
41. methods according to claim 40, it includes by detection for often organizing spy The product of the described dual connection of pin and detect the phase of described custom sequence in described product The relative quantity of two or more chromosomes described in amount is measured in described sample.
42. according to the method according to any one of claim 36 to 41, wherein said one Or a plurality of chromosome is people.
43. 1 kinds for combining the nucleic acid probe of strand target nucleic acid fragment, wherein said probe bag Contain
Target oligonucleotide, described target oligonucleotide than described target sheet segment length and comprises inside Target-complementary sequence, so that the hybridization shape between described target oligonucleotide and described target fragment Become between the upstream flanking sequence and downstream flanking sequence of described target oligonucleotide is double Chain-ordering, and
It is respectively provided with 5 ' free end and the 3 ' header sequence held and tail sequence, wherein said Header sequence and described tail sequence respectively with described upstream flanking sequence and described downstream flank Complementary,
So that under annealing conditions in the presence of described target fragment, described header sequence and described Tail sequence hybridizes with described flanking sequence, thus in described 5 ' end and the institutes of described header sequence Stating and limit room between the described 3 ' ends of tail sequence, wherein said target fragment is mutual with described target Complementary series hybridizes in described room, is thus positioned to and institute by the described end of described target fragment State described the 5 ' of header sequence to hold and described 3 ' the end juxtapositions of described tail sequence, and wherein
The hybridization of the described target fragment in described room completes the ring of nucleic acid, and described ring comprises described Target fragment and described header sequence and described tail sequence.
44. nucleic acid probes according to claim 43, wherein said head and/or afterbody Sequence is connected to custom sequence, wherein said custom sequence not with other regions of described probe Or with described target fragment complementation.
45. according to the nucleic acid probe described in claim 43 or claim 44, the most single Nucleic acid molecules comprises described header sequence and described tail sequence.
46. according to the probe described in claim 43 or claim 44, wherein said head Sequence and described tail sequence separate with described target oligonucleotide, and trans be bound to described Flanking sequence.
47. probes according to claim 46, wherein said header sequence and described tail Portion's sequence is respectively at 5' end and the 3' end of backbone oligonucleotides.
48. probes according to claim 47, wherein said backbone oligonucleotides comprises Custom sequence between described header sequence and described tail sequence, wherein said custom sequence Not with other regions of described probe or with described target fragment complementation.
49. probes according to claim 47, the institute of wherein said backbone oligonucleotides State header sequence and described tail sequence is adjacent.
50. 1 kinds for combining the nucleic acid probe of strand target nucleic acid fragment, wherein said probe bag Contain
Target oligonucleotide, described target oligonucleotide than described target sheet segment length and comprises inside Target-complementary sequence, so that the hybridization shape between described target oligonucleotide and described target fragment Become between the upstream flanking sequence and downstream flanking sequence of described target oligonucleotide is double Chain-ordering, and
It is respectively provided with 5 ' free end and the 3 ' header sequence held and tail sequence, wherein said Head oligonucleotide sequence and described afterbody oligonucleotide sequence respectively with described upstream flank sequence Row and described downstream flanking sequence are complementary,
So that under annealing conditions in the presence of described target fragment, described header sequence and described Tail sequence hybridizes with described flanking sequence, thus in described 5 ' end and the institutes of described header sequence Stating and limit room between the described 3 ' ends of tail sequence, wherein said target fragment is mutual with described target Complementary series hybridizes in described room, is thus positioned to and institute by the described end of described target fragment State described the 5 ' of header sequence to hold and described 3 ' the end juxtapositions of described tail sequence, and wherein
Described header sequence is that the 5 ' of described target oligonucleotide is held and/or described tail sequence is 3 ' ends of described target oligonucleotide, so that the hybridization of the described target fragment in described room is complete Becoming the chain of nucleic acid, described nucleic acid comprises described target fragment, described header sequence and described afterbody sequence Row, described target-complementary sequence and described flanking sequence, wherein said chain is the ring of nucleic acid.
51. according to the probe described in claim 43 or claim 50, wherein said head Sequence and described tail sequence are in the end of described target oligonucleotide, and trans are bound to Described flanking sequence.
52. according to probe in any one of the preceding claims wherein, wherein said target-complementary Sequence has the length of 10 to 30 nucleotides.
53. according to probe in any one of the preceding claims wherein, wherein said target-complementary Sequence and described target fragment have less than 5 base-pair mismatch.
54. probes according to claim 53, wherein said target-complementary sequence is institute State the exact complementary sequence of target fragment.
55. according to the probe according to any one of claim 43 to 54, wherein said flank Sequence each has the length of 10 to 30 nucleotides.
56. according to the probe according to any one of claim 43 to 55, wherein said targeting Described upstream flanking sequence and the described downstream flanking sequence of oligonucleotides are different from each other.
57. according to the probe according to any one of claim 43 to 56, wherein said head Sequence and described upstream flanking sequence have less than 5 base-pair mismatch, and described afterbody sequence Row and described downstream flanking sequence have less than 5 base-pair mismatch.
58. probes according to claim 57, wherein said header sequence and described tail Portion's sequence is the definite complementary series of described flanking sequence.
59. according to the probe according to any one of claim 43 to 58, wherein said targeting Oligonucleotides is linear.
60. according to the probe according to any one of claim 43 to 59, wherein said target sheet Section is restriction endonuclease fragment.
61. according to the probe according to any one of claim 43 to 60, wherein said target sheet Section is human genome fragment.
62. probes according to claim 61, wherein said target fragment is to a dye The human genome fragment that colour solid is special.
63. probes according to claim 62, wherein said target fragment is to described people's base Because a locus of group is special.
64. according to the probe according to any one of claim 43 to 63, wherein said probe Nucleic acid is DNA.
65. for combining the probe groups of strand target nucleic acid fragment, and it includes according to claim 52 To the multiple probes according to any one of 81, described probe has for combining multiple different target The multiple different target-complementary sequence of fragment.
66. probe groups according to claim 65, they are many for combining human chromosome Individual fragment, each probe in wherein said group is for combining the difference special to described chromosome Target fragment.
67. probe groups according to claim 66, wherein said probe is total common fixed Sequence processed.
68. 1 kinds of compositions, it comprises the difference for combining two or more human chromosomes Many groups probe of fragment, described many group probes comprise:
For combining first group of probe of the multiple target fragments special to the first chromosome, and
For combining second group of probe of the multiple target fragments special to the second chromosome, Yi Jiren Selection of land
For combining a group of the multiple target fragments special to one or more other chromosome Or organize other probe more.
69. compositions according to claim 68, wherein the described probe in subgroup is altogether Have custom sequence, described custom sequence be described group common and be different from the spy in other groups The described custom sequence of pin.
70. 1 kinds of kits, its be included in the solution in one or more container according to power Profit requires one or more groups probe according to any one of 65 to 69.
71. according to the probe according to any one of claim 43 to 64, according to claim One group of probe according to any one of 65 to 69 or kit according to claim 70 Purposes, it is for for the existence test sample of target nucleic acid fragment.
72. 1 kinds of probes are used for the purposes of the existence test sample for target single-chain nucleic acid fragment,
Wherein said probe comprises target oligonucleotide, and described target oligonucleotide is containing promising described The sequence of the definite complementary series of target fragment；And head oligonucleotide sequence and afterbody widow's nucleosides Acid sequence, described head oligonucleotide sequence and described afterbody oligonucleotide sequence are adjacent to described target Described target fragment hybridization on oligonucleotides,
Hybridization between wherein said target fragment and described probe makes described target fragment templateization use In being connected to described header sequence and described tail sequence.
73. is such as claim according to the purposes described in claim 72, wherein said probe Required by any one of 43 to 64.
CN201480072154.XA 2013-12-02 2014-11-26 The method of nucleic acid probe and detection genomic fragment Active CN105899680B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN201810535249.0A CN108707652B (en) 2013-12-02 2014-11-26 Nucleic acid probes and methods for detecting genomic fragments

Applications Claiming Priority (3)

Application Number Priority Date Filing Date Title
GB1321191.7A GB2520763A (en) 2013-12-02 2013-12-02 Nucleic acid probe and method of detecting genomic fragments
GB1321191.7 2013-12-02
PCT/IB2014/003061 WO2015083001A2 (en) 2013-12-02 2014-11-26 Nucleic acid probe and method of detecting genomic fragments

Related Child Applications (1)

Application Number Title Priority Date Filing Date
CN201810535249.0A Division CN108707652B (en) 2013-12-02 2014-11-26 Nucleic acid probes and methods for detecting genomic fragments

Publications (2)

Publication Number Publication Date
CN105899680A true CN105899680A (en) 2016-08-24
CN105899680B CN105899680B (en) 2018-06-15

Family

ID=49979619

Family Applications (2)

Application Number Title Priority Date Filing Date
CN201480072154.XA Active CN105899680B (en) 2013-12-02 2014-11-26 The method of nucleic acid probe and detection genomic fragment
CN201810535249.0A Active CN108707652B (en) 2013-12-02 2014-11-26 Nucleic acid probes and methods for detecting genomic fragments

Family Applications After (1)

Application Number Title Priority Date Filing Date
CN201810535249.0A Active CN108707652B (en) 2013-12-02 2014-11-26 Nucleic acid probes and methods for detecting genomic fragments

Country Status (13)

Country Link
US (3) US10240198B2 (en)
EP (2) EP3770273B1 (en)
JP (3) JP6542771B2 (en)
KR (1) KR102390285B1 (en)
CN (2) CN105899680B (en)
AU (2) AU2014358861B2 (en)
BR (1) BR112016012264B1 (en)
CA (1) CA2931013C (en)
ES (2) ES2899693T3 (en)
GB (1) GB2520763A (en)
HK (1) HK1258148A1 (en)
RU (1) RU2733888C2 (en)
WO (1) WO2015083001A2 (en)

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN110023505A (en) * 2016-10-27 2019-07-16 瓦纳迪斯诊断公司 Method for handling rolling circle amplification product
CN110225979A (en) * 2017-05-23 2019-09-10 深圳华大基因股份有限公司 Genome target region enrichment method and its application based on rolling circle amplification

Families Citing this family (15)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
GB2520763A (en) 2013-12-02 2015-06-03 Vanadis Diagnostics Ab Nucleic acid probe and method of detecting genomic fragments
GB2520765A (en) 2013-12-02 2015-06-03 Vanadis Diagnostics Ab Multiplex detection of nucleic acids
US10174383B2 (en) 2014-08-13 2019-01-08 Vanadis Diagnostics Method of estimating the amount of a methylated locus in a sample
GB201507376D0 (en) 2015-04-30 2015-06-17 Vanadis Diagnostics Ab Use of a porous transparent capillary membrane for counting rolling circle amplification products
AU2016325100B2 (en) * 2015-09-18 2022-01-20 Vanadis Diagnostics Probe set for analyzing a DNA sample and method for using the same
JPWO2017135383A1 (en) * 2016-02-03 2018-12-06 国立大学法人豊橋技術科学大学 Pseudocyclic double-stranded polynucleotide and gene expression inhibitor using the same
US11117128B2 (en) 2017-08-25 2021-09-14 Vanadis Diagnostics Ab Filtration device
WO2019195346A1 (en) 2018-04-02 2019-10-10 Progenity, Inc. Methods, systems, and compositions for counting nucleic acid molecules
AU2018452059B2 (en) * 2018-12-05 2023-03-09 Egi Tech (Shen Zhen) Co., Limited Rolling circle amplification method, method for preparing sequencing library, and DNA nanosphere prepared therefrom
CN109652506A (en) * 2018-12-20 2019-04-19 派德洛格(天津)生物科技有限公司 Fluorescent in situ detects the method and kit of 21 exon p.L858R of Human epidermal growth factor receptor gene mutation
US20230242971A1 (en) * 2020-05-08 2023-08-03 Roche Sequencing Solutions, Inc. Removal of excess oligonucleotides from a reation mixture
AU2022264021A1 (en) * 2021-04-29 2023-11-09 Illumina Cambridge Limited Amplification techniques for nucleic acid characterization
WO2023282164A1 (en) * 2021-07-08 2023-01-12 国立大学法人九州大学 Probe, probe set, and nucleic acid detection kit for mammals
CA3230692A1 (en) * 2021-09-03 2023-03-09 Eddie Adams Methods of identifying cancer-associated microbial biomarkers
GB202213930D0 (en) * 2022-09-23 2022-11-09 Xu Bo Padlock blocking oligonucleotide

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2001094625A2 (en) * 2000-06-06 2001-12-13 Tm Bioscience Corporation Capture moieties for nucleic acids and uses thereof
CN102899417A (en) * 2012-10-24 2013-01-30 武汉大学 Micro RNAs (ribonucleic acids) fluorescence detection probe

Family Cites Families (30)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5854033A (en) 1995-11-21 1998-12-29 Yale University Rolling circle replication reporter systems
US6573051B2 (en) 2001-03-09 2003-06-03 Molecular Staging, Inc. Open circle probes with intramolecular stem structures
US7208295B2 (en) 2001-11-19 2007-04-24 Affymetrix, Inc. Multiplex oligonucleotide addition and target amplification
US20040171047A1 (en) * 2002-05-22 2004-09-02 Dahl Gary A. Target-dependent transcription
US20050164205A1 (en) 2002-11-19 2005-07-28 Singulex, Inc. Charge and mass tags for detection and analysis
CA2510381C (en) 2002-12-18 2014-07-08 Third Wave Technologies, Inc. Detection of small nucleic acids
EP1680517B1 (en) * 2003-11-04 2010-03-31 Applied Biosystems, LLC Concatameric ligation products: compositions, methods and kits for same
SE0401270D0 (en) 2004-05-18 2004-05-18 Fredrik Dahl Method for amplifying specific nucleic acids in parallel
JP2008527979A (en) * 2005-01-12 2008-07-31 アプレラ コーポレイション Compositions, methods and kits for selective amplification of nucleic acids
ES2398233T3 (en) 2005-03-18 2013-03-14 The Chinese University Of Hong Kong A method for the detection of chromosomal aneuploidies
WO2007004057A2 (en) 2005-07-04 2007-01-11 Erasmus University Medical Center Chromosome conformation capture-on-chip (4c) assay
US20070087355A1 (en) 2005-10-14 2007-04-19 Barrett Michael T Comparative genomic hybridization assays and compositions for practicing the same
JP4989493B2 (en) 2006-01-20 2012-08-01 オリンパス株式会社 Method for detecting nucleic acid sequence by intramolecular probe
US8038595B2 (en) 2006-01-25 2011-10-18 Beth Israel Deaconess Medical Center Devices and methods for tissue transplant and regeneration
US7901884B2 (en) * 2006-05-03 2011-03-08 The Chinese University Of Hong Kong Markers for prenatal diagnosis and monitoring
US20090061424A1 (en) * 2007-08-30 2009-03-05 Sigma-Aldrich Company Universal ligation array for analyzing gene expression or genomic variations
US9388457B2 (en) * 2007-09-14 2016-07-12 Affymetrix, Inc. Locus specific amplification using array probes
GB0912909D0 (en) * 2009-07-23 2009-08-26 Olink Genomics Ab Probes for specific analysis of nucleic acids
CA2777322A1 (en) * 2009-08-12 2011-02-17 President And Fellows Of Harvard College Biodetection methods and compositions
US8916349B2 (en) * 2009-11-23 2014-12-23 Becton, Dickinson And Company Assay method for target nucleic acid by signal amplification using probe hybridization and restriction
GB0921264D0 (en) * 2009-12-03 2010-01-20 Olink Genomics Ab Method for amplification of target nucleic acid
WO2011142836A2 (en) 2010-05-14 2011-11-17 Fluidigm Corporation Assays for the detection of genotype, mutations, and/or aneuploidy
US20120034603A1 (en) 2010-08-06 2012-02-09 Tandem Diagnostics, Inc. Ligation-based detection of genetic variants
GB2492042B (en) 2011-05-11 2020-04-15 Agilent Technologies Inc Selector probes for nucleic acid analysis comprising at each end a non-adjacent target specific region
US10373705B2 (en) 2011-06-07 2019-08-06 Koninklijke Philips N.V. Providing nucleotide sequence data
US20140336058A1 (en) * 2011-12-02 2014-11-13 Qiagen Gmbh Method and kit for characterizing rna in a composition
US9193994B2 (en) * 2012-04-20 2015-11-24 Samsung Electronics Co., Ltd. Polynucleotide and use thereof
CN105074007A (en) 2013-03-12 2015-11-18 考希尔股份有限公司 Systems and methods for prenatal genetic analysis
GB2520763A (en) 2013-12-02 2015-06-03 Vanadis Diagnostics Ab Nucleic acid probe and method of detecting genomic fragments
GB2520765A (en) 2013-12-02 2015-06-03 Vanadis Diagnostics Ab Multiplex detection of nucleic acids

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2001094625A2 (en) * 2000-06-06 2001-12-13 Tm Bioscience Corporation Capture moieties for nucleic acids and uses thereof
CN102899417A (en) * 2012-10-24 2013-01-30 武汉大学 Micro RNAs (ribonucleic acids) fluorescence detection probe

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
PAUL M. LIZARDI等: "Mutation detection and single molecule counting using isothermal rolling-circle amplification", 《NATURE GENETICS》 *

Cited By (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN110023505A (en) * 2016-10-27 2019-07-16 瓦纳迪斯诊断公司 Method for handling rolling circle amplification product
CN110023505B (en) * 2016-10-27 2023-04-04 瓦纳迪斯诊断公司 Method for processing rolling circle amplification products
CN110225979A (en) * 2017-05-23 2019-09-10 深圳华大基因股份有限公司 Genome target region enrichment method and its application based on rolling circle amplification

Also Published As

Publication number Publication date
AU2021200461B2 (en) 2022-10-06
GB201321191D0 (en) 2014-01-15
GB2520763A (en) 2015-06-03
ES2899693T3 (en) 2022-03-14
KR102390285B1 (en) 2022-04-25
JP2019176867A (en) 2019-10-17
WO2015083001A3 (en) 2015-11-26
US10240198B2 (en) 2019-03-26
KR20160096633A (en) 2016-08-16
JP6571895B1 (en) 2019-09-04
EP3770273B1 (en) 2021-09-29
CN108707652B (en) 2022-04-15
EP3770273A1 (en) 2021-01-27
US10731214B2 (en) 2020-08-04
US20190194748A1 (en) 2019-06-27
CA2931013C (en) 2023-06-06
ES2818920T3 (en) 2021-04-14
RU2733888C2 (en) 2020-10-07
AU2014358861A1 (en) 2016-06-09
CN105899680B (en) 2018-06-15
US20170016065A1 (en) 2017-01-19
HK1258148A1 (en) 2019-11-08
BR112016012264A2 (en) 2017-09-26
AU2014358861B2 (en) 2020-12-10
US20200318186A1 (en) 2020-10-08
AU2021200461A1 (en) 2021-02-25
WO2015083001A2 (en) 2015-06-11
JP2016537990A (en) 2016-12-08
EP3077540B1 (en) 2020-09-02
EP3077540A2 (en) 2016-10-12
CA2931013A1 (en) 2015-06-11
JP6766236B2 (en) 2020-10-07
CN108707652A (en) 2018-10-26
JP6542771B2 (en) 2019-07-10
BR112016012264B1 (en) 2023-04-25
JP2019216734A (en) 2019-12-26

Similar Documents

Publication Publication Date Title
CN105899680A (en) Nucleic acid probe and method of detecting genomic fragments
JP7091400B2 (en) Multiple detection of nucleic acids
CN104254617B (en) Method of dna detection and quantification by single-molecule hybridization and manipulation
CN100588953C (en) Method for detecting mononucleotide polymorphism with biochip
WO2011142836A9 (en) Assays for the detection of genotype, mutations, and/or aneuploidy
CN106536735A (en) Probe set for analyzing a dna sample and method for using the same
CN109844137A (en) For identifying the bar coded cyclic annular library construction of chimeric product
US20030124544A1 (en) Method for testing nucleic acid sequence
CN104093854A (en) Method and kit for characterizing rna in a composition
AU2006226873B2 (en) Nucleic acid detection
CN108456716A (en) Method, composition and kit for detecting the variation of mutant target gene body

Legal Events

Date Code Title Description
C06 Publication
PB01 Publication
C10 Entry into substantive examination
SE01 Entry into force of request for substantive examination
C41 Transfer of patent application or patent right or utility model
TA01 Transfer of patent application right

Effective date of registration: 20161031

Address after: 115 No. 215400 Taiping North Road, Taicang Economic Development Zone, Jiangsu Province, China

Applicant after: Suzhou Sym-Bio Lifescience Co., Ltd.

Address before: Sweden Sollentuna

Applicant before: VANADIS DIAGNOSTICS

GR01 Patent grant
GR01 Patent grant