JPWO2017135383A1 - Pseudocyclic double-stranded polynucleotide and gene expression inhibitor using the same - Google Patents

Abstract

An object of the present invention is to provide a pseudo-circular double-stranded polynucleotide and a gene expression inhibitor using the same. In order to produce the pseudo-circular double-stranded polynucleotide of the present invention, a first polynucleotide having a first region, a second region, and a third region in this order from 5 ′ direction to 3 ′ direction, For the second polynucleotide having the fourth region, the fifth region, and the sixth region in order from the 3 ′ direction to the 5 ′ direction, the third region and the fourth region are respectively paired. The base sequence forming a double strand, and in order from the 3 ′ direction to the 5 ′ direction, the (3n + 1) th region, the (3n + 2) th region, and the (3n + 3) th region have (n + 1) th region in order. For a polynucleotide (n is an odd number of 1 or more), a first polynucleotide having a base sequence that forms a double strand by pairing the first region and the (3n + 3) region is used. .

Description

  The present invention relates to a pseudo-circular double-stranded polynucleotide and a gene expression inhibitor using the same.

  As a method for suppressing gene expression of a specific target gene, RNA interference (RNAi) has been most frequently used for convenience in recent years.

  In the RNA interference method, typically, a double strand ribonucleotide (siRNA) having a length of 21 to 23 bases having a sequence homologous to a target gene is used. By introducing this siRNA into a cell, the target gene It can suppress gene expression (US Patent Publication US2004 / 0259247).

  Up to now, attempts have been made to make more functional technologies by constructing RNA structures (Nat Mater. 2012 vol.11 (No.4): pp.316-22 .; Nat Nanotechnol.2011). vol.6 (No.2): pp.116-20 .; Nat Chem. 2010 vol.2 (No.9): pp.772-9 .; J Am Chem Soc. 2007 vol.129 (No.49) : pp.15108-9.), but there is no practical application.

  An object of the present invention is to provide a pseudo-circular double-stranded polynucleotide and a gene expression inhibitor using the same.

  One embodiment of the present invention is a first polynucleotide having a first region, a second region, and a third region in this order from the 5 ′ direction to the 3 ′ direction, the 3 ′ direction to the 5 ′ direction. To the second polynucleotide having the fourth region, the fifth region and the sixth region in order, the third region and the fourth region are each paired to form a double strand. A (n + 1) th polynucleotide having a sequence and having a (3n + 1) th region, a (3n + 2) th region, and a (3n + 3) th region in order from the 3 ′ direction to the 5 ′ direction (n is 1 or more) In contrast, the first region and the (3n + 3) region are a first polynucleotide having a base sequence that forms a double strand by pairing with each other. The first polynucleotide, the second polynucleotide, and the (n + 1) th polynucleotide may each consist of 29 to 99 nucleotides. At least one of the second region and the (3n + 2) region may be composed of 0 to 6 nucleotides. The first polynucleotide may be composed of ribodeoxynucleotides or may be composed of ribodeoxynucleotides and deoxynucleotides. In addition, the nucleotide constituting the first polynucleotide may include a modified nucleotide, and the modification may be due to polyethylene glycol, folic acid, or cholesterol.

  Another embodiment of the invention is a polynucleotide pair of a first polynucleotide and a second polynucleotide. It may be a kit containing a polynucleotide pair.

  Further embodiments of the invention include a first polynucleotide having a first region, a second region, and a third region in order from 5 ′ direction to 3 ′ direction, and from 3 ′ direction to 5 ′ direction, A pseudo-circular double-stranded polynucleotide consisting of two polynucleotides of a second polynucleotide having a fourth region, a fifth region, and a sixth region in order, wherein the third region of the first polynucleotide The region and the fourth region of the second polynucleotide each pair to form a duplex, and the first region of the first polynucleotide and the sixth region of the second polynucleotide each pair Pseudo-double-stranded polynucleotide forming a double strand.

  A further embodiment of the present invention is a pseudo-circular double-stranded polynucleotide composed of p polynucleotides (p is an even number of 4 or more), and the first region and the first region in order from the 5 ′ direction to the 3 ′ direction. A third region of the first polynucleotide having a second region and a third region, and a second region having a fourth region, a fifth region, and a sixth region in this order from the 3 ′ direction to the 5 ′ direction. The fourth region of each polynucleotide paired to form a duplex, the sixth region of the second polynucleotide, the 5 ′ direction to the 3 ′ direction, the seventh region and the eighth region in this order. And the seventh region of the third polynucleotide having the ninth region are paired to form a double strand, and the (3m-2) region in order from the 5 ′ direction to the 3 ′ direction. And the (3m-1) region and the 3m region of the mth polynucleotide having the 3m region The (3m + 1) th region of the (m + 1) th polynucleotide having the (3m + 1) th region, the (3m + 2) th region, and the (3m + 3) region in this order from the 3 ′ direction to the 5 ′ direction is a pair. To form a duplex, the (3m + 3) region of the (m + 1) th polynucleotide, the (3m + 4) region and the (3m + 5) region in this order from the 5 ′ direction to the 3 ′ direction, The (3m + 4) th region of the (m + 2) th polynucleotide having the (3m + 6) th region is paired to form a duplex (m is an odd number of 3 or more and (p-1) or less), and The third p region of the p polynucleotide and the first region of the first polynucleotide are paired to form a double-stranded polynucleotide.

  A further embodiment of the present invention is a gene expression inhibitor comprising as an active ingredient the above-mentioned polynucleotide pair or any one of the above-mentioned pseudo-circular double-stranded polynucleotides. In the pseudo-circular double-stranded polynucleotide, each of the first region and the third region may be any of the following.

(1) The sense strand of the first gene to be suppressed and the sense strand of the second gene to be suppressed (2) The sense strand of the first gene to be suppressed and the second gene to be suppressed Antisense strand (3) The antisense strand of the first gene to be suppressed and the sense strand of the second gene to be suppressed (4) The antisense strand of the first gene to be suppressed and the expression suppressed Antisense strand of the second gene

In one embodiment of the present invention, it is a schematic diagram of a pseudo-circular double-stranded polynucleotide when the pseudo-circular double-stranded polynucleotide is formed of two polynucleotides. In one Example of this invention, it is a figure showing the result of the decomposition | disassembly test using RNaseR for confirming the structure of pseudo | simulation circular double stranded RNA. In one Example of this invention, it is a figure showing the result of the decomposition | disassembly test using RNaseS1 for confirming the structure of pseudo | simulation circular double stranded RNA. In one Example of this invention, it is a figure showing the result of the Dicer processing test for showing that pseudo | simulation circular double stranded RNA functions as siRNA. In one Example of this invention, it is a figure showing the result of the stability evaluation experiment for showing that pseudo | simulation circular double-stranded RNA exists stably in a cell extract. In one Example of this invention, it is a result figure of the experiment for showing that pseudo | simulation circular double stranded RNA has a gene expression suppression function. In one Example of this invention, it is a result figure of the experiment for showing that pseudo | simulation circular double stranded RNA has a gene expression suppression function. In one Example of this invention, it is a result figure of the experiment for confirming that pseudo | simulation circular double stranded RNA is formed. In one Example of this invention, it is a figure which shows the result of a control experiment in the experiment for showing that pseudo | simulation circular double stranded RNA has a gene expression suppression function irrespective of the length of a linker. In one Example of this invention, it is a figure which shows the result of pseudo | simulation circular double stranded RNA in the experiment for showing that pseudo | simulation circular double stranded RNA has a gene expression suppression function irrespective of the length of a linker. . In one Example of this invention, it is a result figure of the experiment for showing that pseudo | simulation circular double stranded RNA has a gene expression suppression function over a long period of time. In one Example of this invention, it is a result figure of the experiment which shows that pseudo | simulation circular double stranded RNA does not induce an interferon response.

  Hereinafter, embodiments of the present invention completed based on the above knowledge will be described in detail with reference to examples.

  Unless otherwise stated in the embodiments and examples, MR Green & J. Sambrook (Ed.), Molecular cloning, a laboratory manual (4th edition), Cold Spring Harbor Press, Cold Spring Harbor, New York (2012 ); Described in standard protocol collections such as FM Ausubel, R. Brent, RE Kingston, DD Moore, JG Seidman, JA Smith, K. Struhl (Ed.), Current Protocols in Molecular Biology, John Wiley & Sons Ltd. Or a modified or modified method thereof. In addition, when using commercially available reagent kits and measuring devices, unless otherwise explained, protocols attached to them are used.

  The objects, features, advantages, and ideas of the present invention will be apparent to those skilled in the art from the description of the present specification, and those skilled in the art can easily reproduce the present invention from the description of the present specification. it can. The embodiments and specific examples of the invention described below show preferred embodiments of the present invention, and are shown for illustration or explanation. It is not limited. It will be apparent to those skilled in the art that various modifications and variations can be made based on the description of the present specification within the spirit and scope of the present invention disclosed herein.

  In this specification, the term “duplex” refers to a region composed of two double-stranded polynucleotide chains, and does not include a region composed of a single polynucleotide chain. On the other hand, the double strand may be composed of two polynucleotide chains, and may include a region composed of a single polynucleotide chain such as an overhang.

== Polynucleotide ==
The polynucleotide of the present invention is a first polynucleotide consisting of 29 to 99 nucleotides having a first region, a second region, and a third region in this order from 5 ′ direction to 3 ′ direction. From the 3 ′ direction to the 5 ′ direction, the second region consisting of 29 to 99 nucleotides having the fourth region, the fifth region and the sixth region in this order; The fourth region has a base sequence that forms a double chain by pairing with each other, and the (3n + 1) th region, the (3n + 2) th region, and the (3n + 3) th region from the 3 ′ direction to the 5 ′ direction in that order. For the (n + 1) -th polynucleotide (n is an odd number of 1 or more) consisting of 29 to 99 nucleotides having the region, the first region and the (3n + 3) region are paired respectively. A first poly having a base sequence forming a duplex; Is Kureochido. An overhang (for example, TT dimer) may be bonded to the 3 ′ side of the third region so as not to pair with the fifth region.

  The number of nucleotides in each region of the first region, the second region, and the third region is not particularly limited, but the third region and the first region, the fourth region and the (3n + 3) region are Any length may be used as long as it has a function of suppressing gene expression when paired to form a double chain and cleaved at a double chain alone or at a double chain + overhang site. Accordingly, the number of nucleotides in each of the first and third regions may be, for example, 17 or more, preferably 18 or more, more preferably 19 or more, and 50 or less. It is sufficient that it is 30 or less, more preferably 27 or less. On the other hand, the number of nucleotides in the second region should be a number that functions as a double-stranded linker consisting of the third region and the fourth region and a double-stranded linker consisting of the first region and the (3n + 3) region. For example, it may be 0 or more, preferably 1 or more, more preferably 2 or more, and may be 70 or less, preferably 8 or less. , More preferably 6 or less.

  As long as the nucleotide has a gene expression suppressing function when cleaved by a single strand alone, it may be composed of only ribodeoxynucleotide or both ribodeoxynucleotide and deoxynucleotide. I do not care. In addition, the ribodeoxynucleotide or deoxynucleotide constituting the polynucleotide may be arbitrarily modified with 2′-O-methyl, 2′-fluoro or the like as long as the gene expression suppression function is not lost. Further, it may be modified with an organic molecule such as polyethylene glycol, folic acid, cholesterol, etc. that does not harm RNA interference.

== Pseudocyclic double-stranded polynucleotide ==
When the pseudo-circular double-stranded polynucleotide is formed of two polynucleotides, the third region of the first polynucleotide and the fourth region of the second polynucleotide are respectively paired to form a duplex. The first region of the first polynucleotide and the sixth region of the second polynucleotide each have a sequence that forms a duplex by pairing with each other. Therefore, as shown in FIG. 1, the third region of the first polynucleotide and the fourth region of the second polynucleotide are paired to form a duplex, Since the first region and the sixth region of the second polynucleotide pair with each other to form a duplex, and the second and fifth regions serve as linkers for the duplex, The two polynucleotides are capable of forming a heteropseudocyclic duplex polynucleotide having a duplex. Structurally, each molecule of the first polynucleotide and the second polynucleotide can form a pseudo-circular double-stranded polynucleotide, but the first polynucleotide and the second polynucleotide bind alternately. In addition, multiple molecules of 2 such as 2 molecules, 4 molecules, etc. may form a pseudo-circular double-stranded polynucleotide.

  In general, when the pseudo-circular double-stranded polynucleotide is formed from p polynucleotides (p is an even number of 4 or more), the third region of the first polynucleotide and the fourth region of the second polynucleotide Each have a sequence that forms a double strand by pairing, the sixth region and the third polynucleotide of the second polynucleotide (from the 5 ′ direction to the 3 ′ direction, the seventh region and the Each of the seventh regions of the region 8 and the region 9 has a sequence forming a double strand by pairing with each other, and the m-th polynucleotide (from 5 ′ direction to 3 ′ direction) The (3m-2) region, the (3m-1) region, the 3m region) and the (m + 1) th polynucleotide (from the 3 'direction to the 5' direction) 3m + 1), (3m + 2) th region and (3m + 3) th region The (3m + 1) region of each of which has a sequence forming a double strand by pairing, and the (3m + 3) region and the (m + 2) polynucleotide (5) of the (m + 1) polynucleotide. From the 'direction to the 3' direction, the (3m + 4) region, the (3m + 5) region, and the (3m + 6) region (with 3m + 4) region in order form a double chain by pairing with each other. (M is an odd number greater than or equal to 3 and less than or equal to (p-1)), and the third p region of the pth polynucleotide and the first region of the first polynucleotide are paired to form a double strand. Has an arrangement to form Accordingly, the third region of the first polynucleotide and the fourth region of the second polynucleotide each pair to form a duplex, and the sixth region and the third region of the second polynucleotide The seventh region of the polynucleotide pairs with each other to form a duplex, and the third m region of the mth polynucleotide and the (3m + 1) region of the (m + 1) th polynucleotide pair with each other. A sequence in which the (3m + 3) region of the (m + 1) th polynucleotide and the (3m + 4) region of the (m + 2) polynucleotide pair with each other to form a duplex. And the third p region of the p-th polynucleotide and the first region of the first polynucleotide pair with each other to form a duplex, and the second region, the fifth region, the ( 3m-1) region and (3m + 2) th Since frequency is to be linker to double-stranded polynucleotide of the first to p, it becomes possible to form a false circular double stranded polynucleotide. Here, each polynucleotide has the same configuration (number of nucleotides, type, modification, etc.) as the first polynucleotide described in the section “Polynucleotide”. Note that the p polynucleotides may be all different or partially the same, and the type of the polynucleotide is not limited as long as it adopts the structure described above.

  A hetero-quasi-circular double-stranded polynucleotide composed of the first to p-th polynucleotides is obtained by chemically synthesizing and annealing p polynucleotides. Chemical synthesis of a polynucleotide can be performed by a well-known method. Annealing can be performed by mixing p polynucleotides, heating and then cooling. The heating temperature is not particularly limited and can be easily determined by those skilled in the art in consideration of the nucleotide sequence of the polynucleotide. For example, the heating temperature is 50 ° C to 100 ° C, 60 ° C to 90 ° C, or 70 ° C to 80 ° C. What is necessary is just to heat to ranges, such as degreeC. The cooling may be performed gradually, or may be incubated at a constant temperature for a predetermined time. The temperature is not particularly limited, and it is easy for those skilled in the art to select an appropriate temperature. For example, the incubation is performed in the range of 20 ° C to 60 ° C, 30 ° C to 50 ° C, or 35 ° C to 45 ° C. That's fine. The time is not particularly limited, and for example, the incubation may be performed in a range of 30 seconds to 10 minutes, 1 to 5 minutes, or 2 to 4 minutes. It is not necessary to join the ends of the polynucleotides with an enzyme such as ligase after annealing.

== Gene suppressor ==
When the heteropseudocyclic double-stranded polynucleotide of the present invention is administered to a cell, a linker moiety composed of the second region, the fifth region, the (3m-1) region, and the (3m + 2) region comprises It is degraded and each duplex is separated and functions independently as siRNA. Therefore, by designing each double-stranded sequence as a siRNA sequence, each siRNA can be introduced in an equimolar amount into one cell, and a plurality of genes up to the maximum number of double-stranded strands in one cell. Can be knocked down, and multiple siRNAs of different types can be introduced into one cell at an arbitrary ratio.

  For example, when a pseudo-circular double-stranded polynucleotide is formed of two polynucleotides, each region of each polynucleotide is expressed by designing as shown in (1) to (4) of Table 1 below. It can function as an expression inhibitor of the first gene and the second gene to be suppressed.

In addition, the polynucleotide sequence for gene expression suppression can be easily designed using the rules known to those skilled in the art.

  Thus, by using siRNA as a pseudo-circular double-stranded polynucleotide, the immune response is not activated in the cell, the cytotoxicity is low, and two or more genes are used in the same cell with two polynucleotides. It can be knocked down at the same time, and since the gene repression function is not expressed until the linker is decomposed, the expression of the gene repression function of gene repression is delayed or the half-life is adjusted by adjusting the length of the linker The effect of being able to do is acquired.

  In the present specification, “gene expression suppression” refers to suppression of intracellular protein production by gene expression using a double-stranded polynucleotide, and a typical example is RNA interference.

[Example 1]
[1] Preparation of plasmid DNA for reporter assay
After introducing plasmid DNA (pcDNA3-EGFDP, pCMV DsRed-Express, pRL-TK, pGL3) expressing eGFP, DsRed, Renilla luciferase, and firefly luciferase into E. coli JM109 competent cells, LB containing ampicillin 100 mg / ml Each was inoculated into 200 ml of a medium and cultured with shaking at 37 ° C. for 16 hours. Thereafter, plasmid DNA was recovered using the PureYield ™ Plasmid Midipreps System (Promega).

[2] Preparation of siRNA In the reporter assay, siRNA sequence for eGFP (EGFP1 siRNA) and siRNA sequence for firefly luciferase (Luc428 siRNA) were used in experiments as a positive control and a negative control, respectively. Each RNA was obtained by commissioned organic synthesis (JBios). Each sequence is shown below.

siRNA sequence for eGFP:
Sense: AAGCUGACCCUGAAGUUCAUCUGCACC (SEQ ID NO: 1)
Antisense: GGUGCAGAUGAACUUCAGGGUCAGCUU (SEQ ID NO: 2)
SiRNA sequences for firefly luciferase:
Sense: CCAAUCAUCCAAAAAAUUAUU (SEQ ID NO: 3)
Antisense: UAUUUUUUGGAUGAUUGGGA (SEQ ID NO: 4)

[3] Preparation of pseudo-circular double-stranded RNA LG sense RNA and LG anti RNA obtained by commissioned organic synthesis (JBios) are dissolved in sterilized water to a concentration of 50 μM, 30 μl each of RNA and 5 × annealing buffer 15 μl Were mixed. The mixed solution was heated at 90 ° C. for 1 minute, allowed to stand at 37 ° C. for 60 minutes, and annealed to obtain 20 μM pseudo-circular double-stranded RNA. Further, pseudo-circular double-stranded AA RNA was prepared from different combinations of single-stranded RNA (LG sense RNA and LG anti AA RNA) by the same procedure. These pseudo-circular duplex RNAs target consensus sequences in the transcripts of eGFP and firefly luciferase reporter plasmids.

Each sequence is shown below.

LG sense:
CCAAUCAUCCAAAAAAUUAUUAAAAAGGUGCACAUGAACUUCAGGGUCAGCUU (SEQ ID NO: 5)
LG anti:
UAAUUUUUUGGAUGAUUGGGACCCCCCAAGCUGACCCUGAAGUUCAUCUGCACC (SEQ ID NO: 6)
LG anti AA:
AAUAAUUUUUUGGAUGAUUGGGACCCCCCAAGCUGACCCUGAAGUUCAUCUGCACC (SEQ ID NO: 7)

[4] Decomposition test with RNase In order to confirm that the pseudo-circular double-stranded RNA obtained in [3] formed a pseudo-circular structure as shown in FIG. 1, RNaseR and RNaseS1 were used. A degradation test was performed. In this example, CHR-SAT6 RNA already known to have a circular structure was used as a control.

[4-1] RNaseR degradation test Add 10 μl Buffer 1 μl to the single-stranded RNA, pseudo-circular double-stranded RNA, and CHR-SAT6 RNA (equivalent to 5 pmol each) used for the preparation of pseudo-circular double-stranded RNA. 0.5 μl (10 units) was mixed and adjusted to 10 μl with sterile water. After the resulting RNA solution was reacted at 30 ° C. for 15 minutes, 1 μl of 6 × Loading Dye was added to 5 μl, and the change in the migration position of each RNA before and after RNaseR reaction treatment was confirmed by 12% native PAGE.

  RNaseR is an enzyme that degrades single-stranded RNA from both ends. As shown in FIG. 2, the single-stranded RNA was degraded, but the pseudo-circular double-stranded RNA was composed of 2 polynucleotides and 4 polynucleotides. Both were resistant to RNaseR. That is, it shows that the pseudo-circular double-stranded RNA does not have a single-stranded end. Note that CHR-SAT6 RNA, which is known to be circular, also showed resistance to RNaseR.

[4-2] RNaseS1 degradation test Add 1 μl of 10 × Buffer to the single-stranded RNA, pseudo-circular double-stranded RNA solution, and CHR-SAT6 RNA (equivalent to 5 pmol each) used for the preparation of pseudo-circular double-stranded RNA. RNaseS1 1 μl (6.3 units) was mixed and adjusted to 10 μl with sterilized water. The obtained RNA solution was reacted at 30 ° C. for 15 min, 1 μl of 6 × Loading Dye was added to 5 μl, and the change in the migration position of each RNA before and after RNaseR reaction treatment was confirmed by 12% native PAGE.

  RNaseS1 is an enzyme that nonspecifically degrades single-stranded RNA. As shown in FIG. 3, single-stranded RNA was degraded, while pseudo-circular double-stranded RNA was also degraded, but only the double-stranded RNA remained undegraded. Note that CHR-SAT6 RNA, which is known to be circular, exhibited resistance to RNaseR.

[4-3] Dicer treatment test In order to induce RNA interference in cells, it is necessary that the introduced RNA be processed into siRNA by Dicer. Therefore, Dicer treatment test was performed on the prepared pseudo-circular double-stranded RNA.

According to Recombinant Dicer Enzyme Kit (Genlantis), single-stranded RNA (LG sense RNA), pseudo-circular RNA 3 μl each, 10 mM ATP 4.0 μl, 50 mM MgCl ₂ 2.0 μl, Reaction Buffer 16 μl, Dicer Enzyme (4 units) 8 μl was mixed and adjusted to 40 μl using sterile water. Thereafter, incubation was performed at 37 ° C., 8 μl was sampled at each desired time, mixed with 2 μl of Dicer stop solution, and stored frozen at −20 ° C. After all sampling was completed, the collected sample was gently dissolved on ice, and the degradation behavior of the pseudo-circular RNA was confirmed by 12% native PAGE. (Fig. 4)
As shown in FIG. 4, the LG sense RNA, which is a single-stranded RNA, was confirmed to be degraded by hydrolysis, but the cleavage product by Dicer was not confirmed. On the other hand, the pseudo-circular double-stranded RNA was confirmed to be cleaved by Dicer. Thus, pseudo-circular double-stranded RNA can function as siRNA.

[5] Cell extract treatment test In this experiment, a cell extract extracted from HEK293 cells was used in the experiment.

[5-1] Preparation of cell extract
Using a 10 cm petri dish, HEK293 cells were cultured until they became 80% confluent. After removing the medium and washing the cells with 3 μl of 1 × PBS, HEK293 cells were detached from the petri dish by pipetting using 5 μl of 1 × PBS. The solution containing the detached cells was centrifuged to remove the supernatant, 100 μl of M-PER (registered trademark) Mammalian Protein Extraction Reagent was added, and the pelleted cells were lysed by rapid pipetting. The lysate was centrifuged and the supernatant was collected and stored at -80 ° C.

[5-2] RNA stability evaluation experiment in cell extract Each time of 0 minutes, 10 minutes, 60 minutes, and 90 minutes of the cell extract and RNA prepared in [5-1] at 37 ° C Incubation and RNA stability were assessed by denaturing PAGE or PAGE. (Fig. 5)
As shown in FIG. 5, LG sense RNA, which is a single-stranded RNA, was degraded within 60 minutes, whereas pseudo-circular RNA and circular RNA (CHR-SAT6) were hardly degraded. Thus, pseudo-circular RNA can exist more stably than single-stranded RNA.

[6] Cell introduction
In addition to reporter expression plasmids in HEK293 cells, siRNA for each reporter gene (positive control), siRNA with a random sequence (negative control), single-stranded RNA (LG sense RNA) used to create pseudo-circular double-stranded RNA Alternatively, pseudo-circular double-stranded RNA was introduced using Lipofectamine 3000, and fluorescence of eGFP and DsRed after 24 hours was observed with a phase-contrast fluorescence microscope.

  As shown in FIG. 6, suppression of reporter expression was observed when a reporter-specific positive control or pseudo-circular double-stranded RNA was introduced. Thus, pseudo-circular double-stranded RNA is effective as a gene inhibitor.

  Next, in addition to the reporter expression plasmid, siRNA (positive control) for each reporter gene, solvent alone (referred to as -siRNA in FIG. 7), single-stranded RNA used for the preparation of pseudo-circular double-stranded RNA ( LG sense RNA, LG anti RNA, or LG anti AA RNA), pseudo-circular double-stranded RNA, or pseudo-circular double-stranded AA RNA is introduced using Lipofectamine 3000 to express firefly luciferase gene and Renilla luciferase gene Quantification was performed using Dual-Glo Luciferase Assay Systen (Promega), and the relative knockdown efficiency of the firefly luciferase gene was calculated based on the luminescence intensity of Renilla luciferase. FIG. 7 shows the relative expression level with the average expression level in the case of the solvent alone as 100.

  As a result, suppression of reporter expression was not observed when single-stranded RNA was introduced, and suppression of reporter expression was observed when pseudo-circular duplex was introduced. Thus, pseudo-circular double-stranded RNA is effective as a gene inhibitor.

[Example 2]
In this example, knockdown of eGFP gene expression is used as an assay system, and it is shown that the number of nucleotides in the linker does not affect the effect of the pseudo-circular duplex.
First, using a nucleotide having the following sequence, a total of nine pseudo-circular double-stranded RNAs were prepared in the same manner as in Example 1, including three sense strands and three antisense strands. For example, a pseudo-circular double-stranded RNA composed of LG sense A1 and LG anti AA C1 is referred to as pseudo-circular A1C1, and others are named in the same manner.
LG sense A1:
CCAAUCAUCCAAAAAAUUAUUAGGUGCACAUGAACUUCAGGGUCAGCUU (SEQ ID NO: 8)
LG sense A3:
CCAAUCAUCCAAAAAAUUAUUAAAGGUGCACAUGAACUUCAGGGUCAGCUU (SEQ ID NO: 9)
LG sense A6:
CCAAUCAUCCAAAAAAUUAUUAAAAAAGGUGCACAUGAACUUCAGGGUCAGCUU (SEQ ID NO: 10)
LG anti AA C1:
AAUAAUUUUUUGGAUGAUUGGGACAAGCUGACCCUGAAGUUCAUCUGCACC (SEQ ID NO: 11)
LG anti AA C3:
AAUAAUUUUUUGGAUGAUUGGGACCCAAGCUGACCCUGAAGUUCAUCUGCACC (SEQ ID NO: 12)
LG anti AA C6:
AAUAAUUUUUUGGAUGAUUGGGACCCCCCAAGCUGACCCUGAAGUUCAUCUGCACC (SEQ ID NO: 13)
The preparation was separated by 12% native PAGE to confirm the formation of pseudo-circular double-stranded RNA. The result is shown in FIG.
Next, in the same manner as in Example 1, the effect of these nucleotides and pseudo-circular double-stranded RNA on the expression of the reporter gene was examined by observing the fluorescence by eGFP from the reporter gene. As shown, no expression suppression was observed with nucleotides alone and luc428 (negative control), and expression suppression was observed with pseudocircular double-stranded RNA and EGFP1 (positive control).
Thus, the linker length of the pseudo-circular double-stranded RNA does not affect the gene suppression effect.

[Example 3] Long-term knockdown of luciferase gene expression In this example, knockdown of luciferase gene expression is used as an assay system, and it is shown that the effect of pseudo-circular duplex lasts for a long time.
Using the pseudo-circular double-stranded RNA prepared in Example 2, the reporter gene and the pseudo-circular duplex were introduced into the cells in the same manner as in Example 1, and then the expression of luciferase as the reporter was quantified. In Example 1, expression was measured after 24 hours, but in this example, expression was also measured after 3 days and after 5 days. The result is shown in FIG.
Even when pseudo-circular double-stranded RNA was used, gene expression-inhibiting activity was observed even after 5 days from cell introduction, as in luc428 (positive control).
Thus, the gene expression inhibitory activity of pseudo-circular double-stranded RNA is maintained over a long period of time.

[Example 4] Induction of interferon response In mammalian cells, siRNA is known to induce interferon response and non-specifically suppress gene expression. When an interferon response is induced, the expression of STAT is enhanced and activated by phosphorylation. This example shows that pseudocircular double-stranded RNA does not induce an interferon response.

First, under the same culture conditions as in Example 1, HEK293 cells were seeded in a 24-well plate at 15000 cells per well and cultured overnight. In each plate
(1) No treatment (negative control)
(2) Introducing luc428 with Lipofectamine 3000 (3) Introducing polyIC with Lipofectamine 3000 (positive control)
(4) Pseudocyclic A3C3 introduced with Lipofectamine 3000 (5) Lipofectamine 3000 alone (no RNA) (negative control)
(6) luc428 only (no Lipofectamine 3000) (negative control)
(7) Pseudocyclic A3C3 only (no Lipofectamine 3000) (negative control)
(The nucleotides were 20 pmol each). Then, after 24 hours, the cells were washed with PBS and then collected, and an extract was obtained using M-PER Mammalian Protein Extraction Reagent (PIERCE), followed by Western blotting. As a primary antibody, an anti-STAT1 antibody (Stat1 Rabbit mAb (42H3) (CST Japan)) and an anti-phosphorylated STAT1 antibody (Phospho-Stat1 (Tyr701) Rabbit mAb (D4A7) (CST Japan)) are used as secondary antibodies. When STAT1 expression and STAT1 phosphorylation were detected by chemiluminescence using Anti Mouse IgG, HRP-linked Whole Antibody (GE Healthcare) and Amersham ECL Prime Western Blotting Detection Reagent (GE Healthcare), As shown in FIG. 11, the pseudo-circular double-stranded RNA also had no interferon response-inducing activity, like luc428.
Thus, pseudo-circular double-stranded RNA does not have interferon response inducing activity.

  According to the present invention, it has become possible to provide a pseudo-circular double-stranded polynucleotide and a gene expression inhibitor using the same.

Claims (15)

  A first polynucleotide having a first region, a second region, and a third region in this order from the 5 ′ direction to the 3 ′ direction, and the fourth region in order from the 3 ′ direction to the 5 ′ direction, For the second polynucleotide having the fifth region and the sixth region, the third region and the fourth region each have a base sequence that forms a duplex by pairing with each other, and the 3 ′ direction From the (3n + 1) th region, the (3n + 2) th region, and the (3n + 3) th region in order from the 5 ′ direction to the (n + 1) th polynucleotide (n is an odd number of 1 or more) And the (3n + 3) region each have a base sequence that forms a double strand by pairing.   The polynucleotide according to claim 1, wherein each of the first polynucleotide, the second polynucleotide, and the (n + 1) th polynucleotide consists of 29 to 99 nucleotides.   The polynucleotide according to claim 1 or 2, wherein at least one of the second region and the (3n + 2) region consists of 0 to 6 nucleotides.   The first polynucleotide according to any one of claims 1 to 3, wherein n = 1.   The 1st polynucleotide of any one of Claims 1-4 comprised by the ribodeoxynucleotide.   The first polynucleotide according to any one of claims 1 to 4, which is composed of a ribodeoxynucleotide and a deoxynucleotide.   The first polynucleotide according to any one of claims 1 to 6, wherein the nucleotide constituting the first polynucleotide comprises a modified nucleotide.   8. The first polynucleotide of claim 7, wherein the modification is polyethylene glycol, folic acid, or cholesterol.   A polynucleotide pair of the first polynucleotide and the second polynucleotide according to claim 4.   A kit containing the polynucleotide pair according to claim 9.   The first polynucleotide having the first region, the second region, and the third region in order from the 5 ′ direction to the 3 ′ direction, and the fourth region and the fifth in order from the 3 ′ direction to the 5 ′ direction. A pseudo-circular double-stranded polynucleotide consisting of two polynucleotides of a second polynucleotide having a second region and a sixth region, wherein the third region of the first polynucleotide and the second polynucleotide The fourth regions each pair to form a duplex, and the first region of the first polynucleotide and the sixth region of the second polynucleotide each pair to form a duplex. A pseudo-circular double-stranded polynucleotide.   A pseudo-circular double-stranded polynucleotide composed of p polynucleotides (p is an even number of 4 or more), in order from 5 ′ direction to 3 ′ direction, first region, second region, and third region A third region of the first polynucleotide comprising: a fourth region of the second polynucleotide having a fourth region, a fifth region, and a sixth region in order from the 3 'direction to the 5' direction Are paired to form a double strand, and the sixth region of the second polynucleotide and the seventh region, the eighth region, and the ninth region in this order from the 5 ′ direction to the 3 ′ direction. The seventh region of the third polynucleotide having each pair is paired to form a duplex, and the (3m-2) th region and (3m-1) th region in order from the 5 ′ direction to the 3 ′ direction. A 3m region of the mth polynucleotide having a region and a 3m region, from the 3 'direction to the 5' direction, The (3m + 1) region, (3m + 1) region, (3m + 2) region and (3m + 3) region of (m + 1) th polynucleotide having (3m + 1) region pair with each other to form a duplex, The (3m + 3) region of the (m + 1) th polynucleotide, the (3m + 4) region, the (3m + 5) region, and the (3m + 6) region in order from the 5 ′ direction to the 3 ′ direction ( The (3m + 4) region of the m + 2) polynucleotide paired to form a duplex (m is an odd number of 3 or more and (p-1) or less), and the 3p region of the pth polynucleotide A pseudo-circular double-stranded polynucleotide, wherein the first regions of the first polynucleotide each pair to form a double strand.   A gene expression inhibitor comprising the polynucleotide pair according to claim 9 as an active ingredient.   A gene expression inhibitor comprising the pseudo-circular double-stranded polynucleotide according to claim 11 or 12 as an active ingredient. The gene expression inhibitor according to claim 12, wherein each of the first region and the third region is any of the following.
(1) The sense strand of the first gene to be suppressed and the sense strand of the second gene to be suppressed (2) The sense strand of the first gene to be suppressed and the second gene to be suppressed Antisense strand (3) The antisense strand of the first gene to be suppressed and the sense strand of the second gene to be suppressed (4) The antisense strand of the first gene to be suppressed and the expression suppressed Antisense strand of the second gene