JP2022080107A - Elastin production promoter - Google Patents

Abstract

To provide an elastin production promoter containing Clitoria ternatea and/or Rhododendron ferrugineum extract, and an agent for enhancing the elasticity of fascia or aponeurosis, and a composition for improving or preventing ptosis.SOLUTION: The present invention discloses a cosmetic preparation, a pharmaceutical, a quasi agent and a food for improving or preventing ptosis, containing Clitoria ternatea and/or Rhododendron ferrugineum extract. The inventive Clitoria ternatea and/or Rhododendron ferrugineum extract has great actions of promoting elastin production and enhancing the elasticity of fascia or aponeurosis and shows effect of improving or preventing ptosis.SELECTED DRAWING: None

Description

The present invention relates to an elastin production promoter in myofibroblasts, characterized by containing chow bean and / or alpenrose, an elastic enhancer in fascia or aponeurosis, and a composition for improving or preventing ptosis. It is a thing.

Myofibroblasts are one of the cells constituting the fascia (Non-Patent Document 1). The presence of the aponeurosis has been confirmed by electron microscopic observation (Non-Patent Document 2). Myofibroblasts are a major cell population expressing elastin and are considered to be important for the construction of elastic fibers (Non-Patent Document 3).

Elastic fibers are important for elasticity in the fascia (Non-Patent Document 4) and contribute to the determination of the elasticity of the entire tissue (Non-Patent Document 5). Since the amount of elastin in human fascia decreases with aging (Non-Patent Document 6), it is considered that the elasticity of fascia and the elasticity of the entire tissue decrease with aging.

As a structure that pulls up the eyelid, the connecting fascia formed by fusing the levator tendon membrane, the posterior fascia of the anterior tarsal muscle, and the orbital septum sends elastic fibers to the tarsal plate and functions together with the orbicularis oculi muscle and the Muller muscle. A structure for pulling up the tarsal plate is shown (Non-Patent Document 7). In addition, the amount of elastin in the levator aponeurosis is reduced in the ptosis group and the aging group, which are sagging upper eyelids (Non-Patent Document 8). Therefore, elastin production and the accompanying enhancement of elasticity in the connective fascia formed by fusion of the levator aponeurosis, the posterior fascia of the anterior orbicularis oculi muscle, and the orbital septum are important for the improvement and prevention of ptosis. it is conceivable that. Treatment of ptosis is widely performed by surgical operation (Non-Patent Document 9), but since surgical operation is painful, non-surgical treatment is required. Oxymetazoline, phenylephrine (Patent Document 1), and pilocarpine (Patent Document 2) are known as compositions administered as a method of non-surgical treatment.

So far, antioxidants (Patent Document 3), paxillin stimulants (Patent Document 4) and the like, which are characterized by containing an extract of Clitoria ternatea as an active ingredient, are known. Further, a method for inducing hair growth using an extract of alpenrose (Patent Document 5), an external composition for preventing wrinkles (Patent Document 6), and the like are known. However, known are known of elastin production promoters in myofibroblasts, elastic enhancers in fascia or aponeurosis, and compositions for improving or preventing ptosis, which are characterized by containing butterfly bean or alpenrose. Not.

Special table 2014-506927 Special table 2018-520176 JP-A-2007-16003 Special table 2013-515504 Special table 2015-52083 Special table 2015-178464

REACH, 14-15, 10030 (2019) Acta. Morphor. Acad. Sci. Hung. , 28 (1-2), 71-82 (1980) Scientific Reports, 8,8334 (2018) Rev. Hosp. Clin. Fac. Med. S. Paulo, 57 (6), 265-270 (2002) A Practical Guide to Fascial Manipulation 2017, 59-92 Gegenbaurs Morphor. Jahrb. , 136 (6), 645-652 (1990) Ophthalmic. Last. Reconstr. Surg. , 9, 1-10 (1993) Archives of Asthetic Plastic Surgery, 21 (2), 37-42 (2015) Hiroshi Mizuno, Juntendo Medical Magazine, 59, 321-326 (2013)

Therefore, the problem to be solved by the present invention is to find a plant-derived component that enhances elastin production, to have a clear point of action, and to improve or improve an excellent elastin production promoter, an elastic enhancer in fascia or aponeurosis, and ptosis. It is to provide a composition for prevention.

As a result of diligent studies to solve the above problems, the present inventors have found that Clitoria ternatea and / or alpenrose extract has an excellent elastin production promoting effect in myofibroblasts. Furthermore, the present inventors have found that a composition containing a butterfly bean or an alpenrose extract has an excellent effect of enhancing elasticity in fascia or aponeurosis, and an effect of improving or preventing ptosis, and have completed the present invention. ..

That is, the present invention improves or prevents an elastin production promoter in myofibroblasts, an elastic enhancer in fascia or aponeurosis, and ptosis, which is characterized by containing an extract of butterfly bean and / or alpenrose. With respect to the composition for.

The extract of Clitoria ternatea and / or alpenrose of the present invention was excellent in the effect of promoting elastin production in myofibroblasts. In addition, an elastin production promoter, an elastic enhancer in fascia or aponeurosis, and a composition for improving or preventing ptosis, which are characterized by containing this extract, are safe and have an effect of improving or preventing ptosis. Was excellent.

The myofibroblasts in the present invention are also called active fibroblasts and cause accumulation of extracellular matrix such as fibers, that is, fibrosis. In the body, fibroblasts are affected by cytokines such as transforming growth factor-β1 (TGF-β1), growth factors such as platelet-derived growth factor (PDGF), and mechanical stress to express α-smooth muscle actin. Transforms into myofibroblasts.

The fascia in the present invention refers to superficial fascia, deep fascia (aponeurosis fascia), epimysium, perimysium, endomysium, etc. It has elastin fibers that contribute to the strength and collagen fibers that contribute to the strength, and functions as a buffering material for the gliding of muscle fibers. In addition, the fascia tissue in a broad sense includes high-density flat tissue sheets (separation, joint capsule, aponeurosis, organ capsule, striate), ligaments, and tendons.

The aponeurosis in the present invention is a strong connective tissue fiber bundle located at both ends of the skeletal muscle and mediating the attachment of the muscle to the bone, and particularly refers to a membranous tendon.

Elastin in the present invention is a fibrous extracellular matrix protein and is a major component of elastic fibers. Elastin is distributed in almost whole body organs and tissues such as blood vessels, ligaments, lungs, and skin, and is involved in the maintenance of elasticity. In addition, elastin is synthesized as tropoelastin in myofibroblasts, fibroblasts or smooth muscle cells, and is produced by self-assembly of tropoelastin and intermolecular interaction with fibrillin.

The ptosis in the present invention refers to a tendonous ptosis, and the levator palpebra muscle tendon membrane, which should originally exist up to the anterior surface of the tarsal plate, comes off from the tarsal plate with aging, and the tip portion is the tarsal plate. It is a symptom that makes it difficult to raise the eyelids as a result of retreating from the upper edge. This causes the generation of proprioception via the mechanical receptors of the Muller muscle and the hypertonicity of the sympathetic nerve, resulting in many autonomic symptoms such as eyestrain, stiff shoulders, headache, and photophobia.

The Clitoria ternatea used in the present invention is a plant belonging to the genus Clitoria ternatea in the family Fabales, and has a scientific name: Clitria ternatea. It is native to Southeast Asia and is distributed in tropical and subtropical regions. Clitoria ternatea is a climbing annual and grows well to 5 meters in length. The leaflets are oval and form 5 to 9 odd pinnate compound leaves. Also known as Critria, Clitoria ternatea, Indigo butterfly, Butterfly pea, and Anchan.

As the extract of Clitoria ternatea in the present invention, a plant body of Clitoria ternatea is used, and as a site, a part or a whole plant such as flowers, legumes, leaves, roots and the like can be used. .. Callus obtained by tissue culture of a plant may be used. Preferably, "Clitoria ternatea flower extract BG-50" (Koei Kogyo) is commercially available, and it may be used.

The alpenrose used in the present invention is a plant belonging to the genus Azalea of the order Azalea, and has a scientific name: Rhododendron ferrugineum. Alpenrose is one of the Swiss Alps plants, distributed in the European Alps, the Pyrenees and the Jura Mountains, and grows in the subalpine region of 1600-2200 meters. Alpenrose is a perennial evergreen shrub with characteristic dark pink to purple hermaphroditic flowers and dark green oval leaves.

As the extract of alpenrose in the present invention, a plant of alpenrose is used. Callus obtained by tissue culture of a plant may be used. Preferably, "Alpine Rose Active" (H Holstein) is commercially available and can be used.

The extraction method of Clitoria ternatea and alpine rose used in the present invention is not particularly limited, and may be, for example, heat-extracted or room-temperature extracted. In addition, the plant may be used as it is for extraction, or may be dried, crushed, shredded or the like. Examples of the extraction solvent include water, lower alcohols (methanol, ethanol, 1-propanol, 2-propanol, 1-butanol, 2-butanol, etc.), liquid polyhydric alcohols (1,3-butylene glycol, propylene glycol, etc.). , Glycerin, etc.), Ketones (acetone, methyl ethyl ketone, etc.), acetonitrile, esters (ethyl acetate, butyl acetate, etc.), hydrocarbons (hexane, heptane, liquid paraffin, etc.), ethers (ethyl ether, tetrahydrofuran, propyl ether, etc.) Etc.). Polar solvents such as water, lower alcohols and liquid polyhydric alcohols are preferable, and water, ethanol, 1,3-butylene glycol and propylene glycol are particularly preferable. These solvents may be used alone or in admixture of two or more. Particularly preferable extraction solvents include water and water-ethanol mixed polar solvents. The amount of the solvent used is not particularly limited, and may be, for example, 10 times or more, preferably 20 times or more the amount of the plant body (dry weight) of Clitoria ternatea and alpine rose, but it may be concentrated after extraction or simply. It is preferably 100 times or less for convenience of operation when separating. The extraction temperature and time can be appropriately selected depending on the type of solvent used, the pressure at the time of extraction, and the like.

The extracts of butterfly bean and alpenrose may be used as they are in the extracted solution, but if necessary, concentration (concentration under reduced pressure, concentration by membrane concentration, etc.), dilution, filtration, etc. It may be used after being subjected to treatments such as decolorization, deodorization, and ethanol precipitation with activated carbon or the like. Further, the extracted solution may be subjected to treatments such as concentrated drying, spray drying, freeze-drying and the like, and used as a dried product.

In the present invention, the above-mentioned extract may be used as it is, and as long as the effect of the extract is not impaired, fats and oils, waxes, and hydrocarbons which are components used in pharmaceuticals, non-pharmaceutical products, cosmetics, foods, etc. Hydrogens, fatty acids, alcohols, esters, surfactants, metal soaps, pH adjusters, preservatives, fragrances, moisturizers, powders, UV absorbers, thickeners, pigments, antioxidants, whitening agents , Chelating agents, excipients, film agents, sweeteners, acidulants and the like may be contained.

The present invention can be used for any of pharmaceutical products, non-pharmaceutical products, cosmetics, and foods, and the dosage forms thereof include, for example, ointments, pills, tablets, capsules, eye drops, cosmetics, creams, and the like. Emulsions, gels, aerosols, essences, packs, cleaning agents, bathing agents, foundations, dusting, lipsticks, chocolates, gums, candy, beverages, powders, granules, tablets, sugar-coated tablets, syrups, pills, suspensions Examples include agents, liquids, emulsions, suppositories, solutions for injection and the like.

In the case of external use, the content of the extract used in the present invention is preferably 0.0001% by weight or more, more preferably 0.001 to 10% by weight in terms of solid matter. Further, 0.01 to 5% by weight is most preferable. If it is less than 0.0001% by weight, it is difficult to expect a sufficient effect. If it exceeds 10% by weight, the enhancement of the effect is hardly recognized and it is uneconomical.

For internal use, the intake varies depending on age, body weight, symptoms, therapeutic effect, administration method, treatment time, and the like. Usually, the daily intake per adult is preferably 5 mg or more, more preferably 10 mg to 5 g. Further, 20 mg to 2 g is most preferable.

Next, in order to explain the present invention in detail, examples of production, formulation and experimental examples of the extract used in the present invention will be given as examples, but the present invention is not limited thereto. The% shown in the production example means% by weight, and the content part shown in the formulation example means a weight part.

The extract of Clitoria ternatea of the present invention can be extracted as follows as a production example.

(Production Example 1) Preparation of 50% 1,3-butylene glycol extract of Clitoria ternatea 5 g of dried Clitoria ternatea flower was immersed in 50 mL of 50% 1,3-butylene glycol aqueous solution at room temperature for 7 days for extraction. The obtained extract was filtered to obtain 49.8 g of 1,3-butylene glycol extract of Clitoria ternatea.

(Production Example 2) Preparation of hot water extract of Clitoria ternatea 50 mL of water was added to 5 g of dried Clitoria ternatea flower, and the mixture was extracted at 95-100 ° C. for 2 hours. The obtained extract was filtered, the filtrate was concentrated, and freeze-dried to obtain 1.3 g of a hot water extract of Clitoria ternatea.

(Production Example 3) Preparation of 50% ethanol extract of Clitoria ternatea 5 g of dried product of the above-ground part of Clitoria ternatea was immersed in 50 mL of 50% ethanol aqueous solution at room temperature for 7 days for extraction. After filtering the obtained extract, it was concentrated and dried by an evaporator to obtain 1.18 g of a 50% ethanol extract of Clitoria ternatea.

(Production Example 4) Preparation of ethanol extract of Clitoria ternatea 5 g of dried product of the above-ground part of Clitoria ternatea was immersed in 50 mL of ethanol at room temperature for 7 days for extraction. After filtering the obtained extract, it was concentrated to dryness with an evaporator to obtain 1.15 g of an ethanol extract of Clitoria ternatea.

(Prescription example 1) Ointment prescription content (part)
1. 1. 50% 1,3-butylene glycol extract of Clitoria ternatea (Production Example 1) 0.5
2. 2. Polyoxyethylene cetyl ether (30EO) 2.0
3. 3. Glycerin monostearate 10.0
4. Liquid paraffin 5.0
5. Cetanol 6.0
6. Methyl paraoxybenzoate 0.1
7. Propylene glycol 10.0
8. [Manufacturing method] Ingredients 2 to 5 having a total amount of 100 in purified water are heated and dissolved and mixed, and kept at 70 ° C. to prepare an oil phase. Ingredients 1 and 6 to 8 are heated, dissolved and mixed, and kept at 75 ° C. to prepare an aqueous phase. An aqueous phase is added to the oil phase to emulsify, and the product is cooled to 30 ° C. with stirring to obtain a product.

(Comparative Formulation Example 1) Conventional Ointment In Formulation Example 1, 50% 1,3-butylene glycol extract of Clitoria ternatea was replaced with purified water, and the conventional ointment was used.

(Prescription example 2) Ointment prescription content (part)
1. 1. Extract of Alpenrose (H Holstein) 0.5
2. 2. Polyoxyethylene cetyl ether (30EO) 2.0
3. 3. Glycerin monostearate 10.0
4. Liquid paraffin 5.0
5. Cetanol 6.0
6. Methyl paraoxybenzoate 0.1
7. Propylene glycol 10.0
8. [Manufacturing method] Ingredients 2 to 5 having a total amount of 100 in purified water are heated and dissolved and mixed, and kept at 70 ° C. to prepare an oil phase. Ingredients 1 and 6 to 8 are heated, dissolved and mixed, and kept at 75 ° C. to prepare an aqueous phase. An aqueous phase is added to the oil phase to emulsify, and the product is cooled to 30 ° C. with stirring to obtain a product.

(Prescription example 3) Cream prescription content (part)
1. 1. 50% ethanol extract of Clitoria ternatea (Production Example 3) 0.1
2. 2. Squalene 5.5
3. 3. Olive oil 3.0
4. Stearic acid 2.0
5. Beeswax 2.0
6. Octyldodecyl myristate 3.5
7. Polyoxyethylene cetyl ether (20EO) 3.0
8. Behenyl alcohol 1.5
9. Glycerin monostearate 2.5
10. Fragrance 0.1
11. Methyl paraoxybenzoate 0.2
12.1,3-Butylene Glycol 8.5
13. [Manufacturing method] Ingredients 2 to 9 having a total amount of 100 in purified water are heated and dissolved and mixed, and kept at 70 ° C. to prepare an oil phase. Ingredients 1 and 11 to 13 are heated, dissolved and mixed, and kept at 75 ° C. to prepare an aqueous phase. An aqueous phase is added to the oil phase to emulsify, and the mixture is cooled while stirring, the component 10 is added at 45 ° C, and the product is further cooled to 30 ° C to obtain a product.

(Prescription example 4) Cream prescription content (part)
1. 1. Alpenrose extract (H Holstein) 0.1
2. 2. Squalene 5.5
3. 3. Olive oil 3.0
4. Stearic acid 2.0
5. Beeswax 2.0
6. Octyldodecyl myristate 3.5
7. Polyoxyethylene cetyl ether (20EO) 3.0
8. Behenyl alcohol 1.5
9. Glycerin monostearate 2.5
10. Fragrance 0.1
11. Methyl paraoxybenzoate 0.2
12.1,3-Butylene Glycol 8.5
13. [Manufacturing method] Ingredients 2 to 9 having a total amount of 100 in purified water are heated and dissolved and mixed, and kept at 70 ° C. to prepare an oil phase. Ingredients 1 and 11 to 13 are heated, dissolved and mixed, and kept at 75 ° C. to prepare an aqueous phase. An aqueous phase is added to the oil phase to emulsify, and the mixture is cooled while stirring, the component 10 is added at 45 ° C, and the product is further cooled to 30 ° C to obtain a product.

(Prescription example 5) Toner prescription content (part)
1. 1. Hot water extract of Clitoria ternatea (Production Example 2) 0.1
2.1,3-butylene glycol 8.0
3. 3. Glycerin 2.0
4. Xanthan gum 0.02
5. Citric acid 0.01
6. Sodium citrate 0.1
7. Ethanol 5.0
8. Methyl paraoxybenzoate 0.1
9. Polyoxyethylene hydrogenated castor oil (40EO) 0.1
10. Appropriate amount of fragrance 11. [Manufacturing method] Ingredients 1 to 6 and 11 having a total amount of 100 in purified water and components 7 to 10 are uniformly dissolved, and both are mixed and filtered to obtain a product.

(Prescription example 6) Emulsion prescription content (part)
1. 1. Ethanol extract of Clitoria ternatea (Production Example 4) 0.01
2. 2. Squalene 5.0
3. 3. Olive oil 5.0
4. Jojoba oil 5.0
5. Cetanol 1.5
6. Glycerin monostearate 2.0
7. Polyoxyethylene cetyl ether (20EO) 3.0
8. Polyoxyethylene sorbitan monooleate (20EO) 2.0
9. Fragrance 0.1
10. Propylene glycol 1.0
11. Glycerin 2.0
12. Methyl paraoxybenzoate 0.2
13. [Manufacturing method] Ingredients 1 to 8 having a total amount of 100 in purified water are heated and dissolved and mixed, and kept at 70 ° C. to prepare an oil phase. Ingredients 10 to 13 are heated and dissolved, mixed, and kept at 75 ° C. to prepare an aqueous phase. An aqueous phase is added to the oil phase to emulsify, and the mixture is cooled while stirring, component 9 is added at 45 ° C, and the product is further cooled to 30 ° C to obtain a product.

(Prescription example 7) Gel preparation Prescription content (part)
1. 1. 50% 1,3-butylene glycol extract of Clitoria ternatea (Production Example 1) 0.05
2. 2. Alpenrose extract (H Holstein) 0.05
3. 3. Ethanol 5.0
4. Methyl paraoxybenzoate 0.1
5. Polyoxyethylene hydrogenated castor oil (60EO) 0.1
6. Appropriate amount of fragrance 7.1,3-butylene glycol 5.0
8. Glycerin 5.0
9. Xanthan gum 0.1
10. Carboxyvinyl polymer 0.2
11. Potassium hydroxide 0.2
12. [Manufacturing method] Ingredients 2 to 6 and components 1 and 7 to 12 having a total amount of 100 in purified water are uniformly dissolved, and the two are mixed to obtain a product.

(Prescription example 8) Pack prescription content (part)
1. 1. Hot water extract of Clitoria ternatea (Production Example 2) 0.05
2. 2. Extract of Alpenrose (H Holstein) 0.05
3. 3. Polyvinyl alcohol 12.0
4. Ethanol 5.0
5.1,3-butylene glycol 8.0
6. Methyl paraoxybenzoate 0.2
7. Polyoxyethylene hydrogenated castor oil (20EO) 0.5
8. Citric acid 0.1
9. Sodium citrate 0.3
10. Appropriate amount of fragrance 11. [Manufacturing method] Ingredients 1 to 11 having a total amount of 100 in purified water are uniformly dissolved to prepare a product.

(Prescription example 9) Foundation prescription content (part)
1. 1. 50% ethanol extract of Clitoria ternatea (Production Example 3) 0.1
2. 2. Stearic acid 2.4
3. 3. Polyoxyethylene sorbitan monostearate (20EO) 1.0
4. Polyoxyethylene cetyl ether (20EO) 2.0
5. Cetanol 1.0
6. Liquid lanolin 2.0
7. Liquid paraffin 3.0
8. Isopropyl myristate 6.5
9. Sodium Carboxymethyl Cellulose 0.1
10. Bentonite 0.5
11. Propylene glycol 4.0
12. Triethanolamine 1.1
13. Methyl paraoxybenzoate 0.2
14. Titanium dioxide 8.0
15. Talc 4.0
16. Bengala 1.0
17. Yellow iron oxide 2.0
18. Appropriate amount of fragrance 19. [Manufacturing method] Ingredients 2 to 8 having a total amount of 100 in purified water are dissolved by heating and kept at 80 ° C. to prepare an oil phase. Ingredient 9 is well swollen with Ingredient 19, followed by Add Ingredients 1 and 10-13 and mix uniformly. Ingredients 14 to 17 pulverized and mixed by a pulverizer are added thereto, and the mixture is stirred with a homomixer and kept at 75 ° C. to prepare an aqueous phase. The aqueous phase is added to this oil phase while stirring to emulsify. Then, it is cooled, the component 18 is added at 45 ° C., and the product is cooled to 30 ° C. while stirring.

(Prescription example 10) Prescription content for bath (part)
1. 1. Ethanol extract of Clitoria ternatea (Production Example 4) 0.1
2. 2. Sodium bicarbonate 50.0
3. 3. Yellow No. 202 (1) Appropriate amount 4. Appropriate amount of fragrance 5. [Manufacturing method] Ingredients 1 to 5 having a total amount of 100 with sodium sulfate are uniformly mixed to prepare a product.

(Prescription example 11) Powder prescription content (part)
1. 1. Hot water extract of Clitoria ternatea (Production Example 2) 1.0
2. 2. Dried cornstarch 39.0
3. 3. Microcrystalline Cellulose 60.0
[Manufacturing method] Ingredients 1 to 3 are mixed to prepare a powder.

(Prescription example 12) Tablet prescription content (part)
1. 1. Ethanol extract of Clitoria ternatea (Production Example 4) 5.0
2. 2. Dried cornstarch 25.0
3. 3. Carboxymethyl cellulose calcium 20.0
4. Microcrystalline Cellulose 40.0
5. Polyvinylpyrrolidone 7.0
6. Talc 3.0
[Manufacturing method] Ingredients 1 to 4 are mixed, and then an aqueous solution of ingredient 5 is added as a binder to form granules. Ingredient 6 is added to the molded granules and the mixture is locked. One tablet weighs 0.52 g.

(Prescription example 13) Tablet confectionery prescription content (part)
1. 1. Ethanol extract of Clitoria ternatea (Production Example 4) 2.0
2. 2. Dried cornstarch 49.8
3. 3. Erythritol 40.0
4. Citric acid 5.0
5. Sucrose fatty acid ester 3.0
6. Fragrance 0.1
7. Purified water 0.1
[Manufacturing method] Ingredients 1 to 4 and 7 are mixed and granulated. Ingredients 5 and 6 are added to the molded granules and the mixture is locked. One grain is 1.0 g.

(Prescription example 14) Beverage prescription content (part)
1. 1. Hot water extract of Clitoria ternatea (Production Example 2) 0.05
2. 2. Stevia 0.05
3. 3. Malic acid 5.0
4. Fragrance 0.1
5. Purified water 94.8
[Manufacturing method] Ingredients 2 and 3 are dissolved in a small amount of water. Then, components 1, 4 and 5 are added and mixed.

Next, in order to explain the effect of the present invention in detail, an experimental example will be given.

Experimental Example 1 Effect of extract of butterfly bean and alpenrose on elastin expression in myofibroblasts FBN2 (fibrillin 2) and EMILIN2 (elastin microfibrill interfacer 2) are glycoproteins involved in the formation of elastic fibers, and their expression. Elastin production is promoted by increasing the amount of elastin. Therefore, the expression levels of FBN2 and EMILIN2 mRNA were measured. Human skin fibroblasts (NB1RGB) were seeded in 6-well plates and cultured in DMEM medium containing 10% FBS under 37 ° C. and 5% CO ₂ conditions. When the semiconfluent state was reached, the cells were replaced with DMEM medium containing 10% FBS prepared to have a final concentration of 2 ng / mL TGF-β1 and differentiated into myofibroblasts. Three days later, the Clitoria ternatea extract (Production Example 1) or Alpenrose extract (H Holstein) prepared so that the final concentration was 200 μg / mL as the solid content concentration and dissolved in DMEM medium containing no FBS was used. Added. Total RNA was extracted 24 hours after the addition. Extraction of total RNA from cells was performed using RNAiso Plus (Takara Bio), and the total amount of RNA was determined by absorbance at 260 nm using a spectrophotometer (NanoDrop). The mRNA expression level was measured by the real-time RT-PCR method based on the total RNA extracted from the cells. For the real-time RT-PCR method, High Capacity RNA-to- cDNA Kit (Applied Biosystems) and SYBR Select Master Mix (Applied Biosystems) were used. That is, after a reverse transcription reaction of 500 ng of total RNA, a PCR reaction (95 ° C: 15 seconds, 60 ° C: 60 seconds, 40 cycles) was performed. For other operations, the expression levels of FBN2 and EMILIN2 mRNA were determined as a ratio to the expression level of β-actin mRNA, which is an internal standard, according to a predetermined method. The FBN2 and EMILIN2 expression promotion rate was calculated as the ratio of the expression levels of FBN2 and EMILIN2 mRNA in the sample-added group to the expression levels of FBN2 and EMILIN2 mRNA in the control (non-sampled) group of human fibroblasts and myofibroblasts. The primers used to measure the expression level of each gene are as follows.

Primer set for FBN2 CCCAGTACAAAAAGATATGTCCTC (SEQ ID NO: 1)
AGGGTCATACAAAGAGGTTCACCACTG (SEQ ID NO: 2)
Primer set for EMILIN2 AAAGCCACAGATAATGAACCC (SEQ ID NO: 3)
GAACCTTCTCCCTAGCACC (SEQ ID NO: 4)
Primer set for β-actin CACTCTTCAGCCTTCCTTCC (SEQ ID NO: 5)
GTGTTGGGCGTACAGGTCTTG (SEQ ID NO: 6)

The experimental results on the expression of FBN2 mRNA are shown in Table 1. The expression level of FBN2 mRNA in myofibroblasts was increased by Clitoria ternatea and alpenrose extract. In addition, the expression level was significantly increased in myofibroblasts as compared with human fibroblasts. The same effect was observed in the extract of Clitoria ternatea (Production Examples 2, 3 and 4).

Table 2 shows the experimental results on the expression of EMILIN2 mRNA. The expression level of EMILIN2 mRNA in myofibroblasts was increased by Clitoria ternatea and alpenrose extract. In addition, the expression level was significantly increased in myofibroblasts as compared with human fibroblasts. The same effect was observed in the extract of Clitoria ternatea (Production Examples 2, 3 and 4).

Therefore, Clitoria ternatea and alpenrose extracts promoted elastin expression in myofibroblasts.

Experimental Example 2 Use test (improvement of ptosis)
A use test was conducted using each ointment obtained in Formulation Examples 1 and 2 and Comparative Formulation Example 1. After applying the sample to the eyelids of 20 female subjects twice every morning and evening for 3 consecutive months, the degree of eye opening was measured. The degree of eye opening was calculated from the ratio of the size of the black eyes when the eyes were opened and when the eyes were open.

As a result, the degree of eye opening was significantly increased before and after continuous use when the ointments of Formulation Examples 1 and 2 were used as compared with the case of using the ointment of Comparative Formulation Example 1. Therefore, the extracts of Clitoria ternatea and alpenrose according to the present invention showed an excellent effect of improving ptosis. During the test period, there were no skin problems and there was no problem in terms of safety.

Elastin production promoters, elastic enhancers in fascia or aponeurosis, compositions for improving or preventing ptosis, which are characterized by containing an extract of butterfly bean and / or alpenrose according to the present invention. It exerts an excellent improvement effect for the purpose of each agent. Therefore, it is possible to provide pharmaceuticals, quasi-drugs, cosmetics and foods for the purpose of improving or preventing ptosis.

Claims (3)

An elastin production promoter in myofibroblasts, characterized by containing Clitoria ternatea and / or alpenrose. An elastic enhancer in fascia or aponeurosis, characterized by containing Clitoria ternatea and / or alpenrose. A composition for improving or preventing ptosis, which comprises Clitoria ternatea and / or alpine rose.