JP2022059183A - Model animals of hematopoietic insufficiency, growth retardation, high carcinogenicity, and mental dysfunction - Google Patents

Abstract

To provide at least one kind of model animal selected from the group consisting of hematopoietic insufficiency, growth retardation, high carcinogenicity, and mental dysfunction.SOLUTION: Provided is at least one kind of model animal selected from the group consisting of hematopoietic insufficiency, growth retardation, high carcinogenicity, and mental dysfunction, the function and/or expression of ADH5 gene being defective or reduced, and one or both of the paired chromosomes having mutations on the function and/or expression reduction of ALDH2 gene.SELECTED DRAWING: None

Description

The present invention relates to a model animal of hematopoietic deficiency, stunted growth, high carcinogenicity, mental dysfunction and the like.

Decreased ability to degrade various aldehydes in the body increases various types of endogenous DNA damage. Aldehydes primarily produce DNA interstrand crosslinks (ICLs) and non-enzymatic DNA-protein crosslinks (DPCs). In this regard, individuals with genetically impaired aldehyde degradation function may exhibit symptoms such as hematopoietic deficiency, stunted growth, high carcinogenicity, microcephaly, underweight, and mental retardation. Non-Patent Document 1 reports the production of mice lacking both the Adh5 gene and the Aldh2 gene. However, in Non-Patent Document 1, the above-mentioned symptoms, particularly hematopoietic insufficiency and carcinogenicity, have not been analyzed, and since the survival time of mice is extremely short, advanced or delayed pathological conditions are not mentioned at all. not.

’The failure of two major formaldehyde catabolism enzymes (ADH5 and ALDH2) leads to partial synthetic lethality in C57BL / 6 mice’, Nakamura et al. Genes and Environment (2020) 42:21.

It is an object of the present invention to provide at least one model animal selected from the group consisting of hematopoietic deficiency, stunted growth, high carcinogenicity, and mental dysfunction.

As a result of diligent research in view of the above problems, the present inventor may be an animal in which the function and / or expression of the ADH5 gene is deleted or decreased, and the function of the ALDH2 gene is reduced in one of the paired chromosomes. For example, it was found that it can be used as a model animal of at least one selected from the group consisting of hematopoietic deficiency, stunted growth, high carcinogenicity, and mental dysfunction. The present inventor has completed the present invention as a result of further research based on this finding. That is, the present invention includes the following aspects.

Item 1. Hematopoietic dysfunction, stunted growth, hypercarcinogenicity, and psychiatry, in which the function and / or expression of the ADH5 gene is deficient or reduced, and the function and / or expression of the ALDH2 gene is reduced in one or both of the paired chromosomes. At least one model animal selected from the group consisting of dysfunction.

Item 2. Item 2. The model animal according to Item 1, wherein the ADH5 gene is deficient in both of the paired chromosomes.

Item 3. Item 2. The model animal according to Item 1 or 2, wherein the reduced function mutation of the ALDH2 gene is a mutation in the multimer formation region.

Item 4. Item 3. The model animal according to Item 3, wherein the ALDH2 gene hypofunction mutation is a mutation that causes a mutation in the mouse ALDH2 protein E506 or a corresponding amino acid.

Item 5. Item 3. The model animal according to Item 3 or 4, wherein the reduced function mutation of the ALDH2 gene is a mutation that causes the replacement of the mouse ALDH2 protein E506 or the corresponding amino acid with lysine.

Item 6. Item 6. The model animal according to any one of Items 1 to 5, wherein the mental dysfunction includes mental retardation.

Item 7. A fertilized egg, sperm or embryo, which develops in the model animal according to any one of Items 1 to 6.

Item 8. A cell in which the function and / or expression of the ADH5 gene is deleted or reduced, and the function and / or expression of the ALDH2 gene is reduced in one or both of the paired chromosomes.

Item 9. Hematopoietic dysfunction, stunted growth, hypercarcinogenicity, and mental dysfunction using the model animal according to any one of Items 1 to 6, the fertilized egg, sperm or embryo according to Item 7, or the cell according to Item 8. A method for screening at least one preventive agent, ameliorating agent, or an exacerbating causative agent selected from the group consisting of.

Item 10. (A) The step of administering or contacting the test substance to the model animal according to any one of Items 1 to 6, the fertilized egg, sperm or embryo according to Item 7, or the cell according to Item 8.
(B) Selected from the group consisting of hematopoietic deficiency, stunted growth, hypercarcinogenicity, and mental dysfunction of the model animal, the fertilized egg, sperm or embryo, or the cell to which the test substance was administered or contacted. A step of evaluating at least one phenotype, and (c1) a group consisting of hematopoietic deficiency, stunted growth, hypercarcinogenicity, and mental dysfunction when the phenotype is cured or alleviated. The step of selecting as at least one preventive agent or ameliorating agent selected from the above, or (c2) when the phenotype is deteriorated, the test substance is subjected to hematopoietic deficiency, stunted growth, high carcinogenicity, and mentality. The process of selecting as at least one exacerbating substance selected from the group consisting of dysfunction,
9. The screening method according to Item 9.

INDUSTRIAL APPLICABILITY According to the present invention, it is possible to provide at least one model animal selected from the group consisting of hematopoietic deficiency, stunted growth, high carcinogenicity, and mental dysfunction. Further, it is also possible to provide a preventive agent, an improving agent, a method for screening an exacerbation-causing substance, or the like using the model animal.

Postnatal crosses between Adh5 ^+/- Aldh2 ^{+ / KI} female mice (Adh5 gene fragment allyl deficiency and Aldh2 fragment allyl E506K mutation; +/- / KI notation is the same below) and Adh5 ^+/- Aldh2 ^{KI / KI} male mice Two-week mouse observation frequency (Obs.) And expected frequency (Exp.). The chi-square test showed that there was no significant difference between the frequency of observation and the frequency of expectation, and the Adh5 gene Aldh2 gene double-deficient mouse (Adh5 ^-/- Aldh2 ^{KI / KI} ) and the Adh5 gene-deficient Aldh2 gene fragment. Allyl E506K mutant-carrying mice (Adh5 ^-/- Aldh2 ^{+ / KI} ) give birth almost normally without intrauterine dysgenesis (p = 0.17). A representative photograph of Test Example 2 is shown. Blue arrows indicate Adh5 ^-/- Aldh2 ^{KI / KI} mice. P0 shows the photograph immediately after birth, and P2, P7, and P9 indicate the photograph after 2, 7, and 9 days after birth. Immediately after birth, Adh5 gene Aldh2 gene double-deficient mice have a solid size similar to that of littermates, but growth retardation is observed about 1 week after birth. The results of body weight measurement of Test Example 2 (0 days, 2 weeks, or 6 weeks after birth) are shown. ** p <0.01, *** p <0.001 show significant in one-way ANOVA with Tukey's multiple comparison test. Immediately after birth, Adh5 gene Aldh2 gene double-deficient mice weigh about the same as littermates, but stunted growth is observed 2 weeks after birth. The survival rate measurement result of Test Example 2 is shown. The Kaplan-Meyer curve using the logarithmic order (Mantel-Cox) test showed that the survival rate of Adh5 gene Aldh2 gene double-deficient mice (Adh5 ^-/- Aldh2 ^{KI / KI} ) was higher than that of mice of other genotypes. It shows that it is significantly reduced (p <0.0001). The measurement result of the number of nucleated bone marrow cells of Test Example 3 is shown. Nucleated bone marrow cells in both femurs and tibias from 3-week-old mice were quantified (mean ± sd, n = at least 5). * p <0.05 and *** p <0.001 indicate that they are significant in one-way ANOVA using Tukey's multiple comparison test. Significant decrease in bone marrow cell count in Adh5 gene Aldh2 gene double deficient mice (Adh5 ^-/- Aldh2 ^{KI / KI} ) and Adh5 gene deficient Aldh2 gene fragment allyl E506K mutation-carrying mice (Adh5 ^-/- Aldh2 ^{+ / KI} ) be. The measurement results of the hematopoietic cell subset of Test Example 3 are shown. The measurement results of the individual after 3 weeks of age are shown (mean ± sd, n = at least 5 animals). LKS (Lin --c ^- Kit ⁺ Sca-1 ⁺ ), HSC (Lin --c ^- Kit ⁺ Sca-1 ⁺ CD150 ^{+ CD48-} ), CLP (Lin --c ^- Kit ^low Sca-1 ^low CD127 ⁺ CD135 ⁺ ), CMP (Lin --c ^- Kit ⁺ Sca ^- 1 --CD34 ⁺ CD16 / 32- ⁾ . * p <0.05, ** p <0.01, *** p <0.001 show significant in one-way ANOVA using Tukey's multiple comparison test. Adh5 gene Aldh2 gene double-deficient mice (Adh5 ^-/- Aldh2 ^{KI / KI} ) have a marked decrease in hematopoietic stem cells. The measurement results of the hematopoietic cell subset of Test Example 3 are shown. The measurement results of the individual after 3 weeks of age are shown (mean ± sd, n = at least 5 animals). MPP (Lin --c ^- Kit ⁺ Sca ^- 1 ⁺ CD150 ^--CD48- ), HPC1 (Lin --c ^- Kit ⁺ Sca-1 ⁺ CD150 ^{--CD48 +} ), MEP (Lin --c ^- Kit ⁺ Sca ^- 1 --CD34- ⁾ CD16 / 32- ⁾ , GMP (Lin --c ^- Kit ⁺ Sca ^- 1 --CD34 ⁺ CD16 / 32 ⁺ ), HPC2 (Lin --c ^- Kit ⁺ Sca-1 ⁺ CD150 ⁺ CD48 ⁺ ). ** p <0.01, *** p <0.001 show significant in one-way ANOVA with Tukey's multiple comparison test. Adh5 gene Aldh2 gene double-deficient mice (Adh5 ^-/- Aldh2 ^{KI / KI} ) have a marked decrease in hematopoietic stem cells. The measurement results of the hematopoietic cell subset of Test Example 3 are shown. The measurement results of individuals after 8 to 9 months of age are shown (mean ± sd, n = at least 5 animals). LKS (Lin --c ^- Kit ⁺ Sca-1 ⁺ ), HSC (Lin --c ^- Kit ⁺ Sca-1 ⁺ CD150 ^{+ CD48-} ), CLP (Lin --c ^- Kit ^low Sca-1 ^low CD127 ⁺ CD135 ⁺ ), CMP (Lin --c ^- Kit ⁺ Sca ^- 1 --CD34 ⁺ CD16 / 32- ⁾ . * p <0.05, ** p <0.01 show significant in one-way ANOVA with Tukey's multiple comparison test. Adh5 gene-deficient Aldh2 gene fragment Allyl E506K mutation-carrying mice (Adh5 ^-/- Aldh2 ^{+ / KI} ) have a marked decrease in hematopoietic stem cells. The measurement results of the hematopoietic cell subset of Test Example 3 are shown. The measurement results of individuals from 8 to 9 months after birth are shown (mean ± sd, n = at least 5 animals). MPP (Lin --c ^- Kit ⁺ Sca ^- 1 ⁺ CD150 ^--CD48- ), HPC1 (Lin --c ^- Kit ⁺ Sca-1 ⁺ CD150 ^{--CD48 +} ), MEP (Lin --c ^- Kit ⁺ Sca ^- 1 --CD34- ⁾ CD16 / 32- ⁾ , GMP (Lin --c ^- Kit ⁺ Sca ^- 1 --CD34 ⁺ CD16 / 32 ⁺ ), HPC2 (Lin --c ^- Kit ⁺ Sca-1 ⁺ CD150 ⁺ CD48 ⁺ ). *** p <0.001 indicates significant in one-way ANOVA with Tukey's multiple comparison test. Adh5 gene-deficient Aldh2 gene fragment Allyl E506K mutation-carrying mice (Adh5 ^-/- Aldh2 ^{+ / KI} ) have a marked decrease in hematopoietic stem cells.

1. 1. Definitions In the present specification, the expressions "contains" and "contains" include the concepts of "contains", "contains", "substantially consists" and "consists of only".

"Identity" of an amino acid sequence refers to the degree of coincidence of two or more comparable amino acid sequences with respect to each other. Therefore, the higher the match between two amino acid sequences, the higher the identity or similarity of those sequences. The level of amino acid sequence identity is determined, for example, using FASTA, a tool for sequence analysis, with default parameters. Alternatively, the algorithm BLAST by Karlin and Altschul (KarlinS, Altschul SF. “Methods for assessing the statistical significance of molecular sequence features by using general scoringschemes” Proc Natl Acad Sci USA. 87: 2264-2268 (1990), KarlinS, Altschul SF. It can be determined using “Applications and statistics for multiple high-scoring segments in molecular sequences.” Proc Natl Acad Sci USA. 90: 5873-7 (1993). A program called BLASTX based on such a BLAST algorithm has been developed. Specific methods for these analysis methods are known, and the National Center for Biotechnology Information (NCBI) website (http://www.ncbi.nlm.nih.gov/) can be referred to. The "identity" of the base sequence is also defined according to the above.

As used herein, "conservative substitution" means that an amino acid residue is replaced with an amino acid residue having a similar side chain. For example, substitution between amino acid residues having basic side chains such as lysine, arginine, and histidine is a conservative substitution. Other amino acid residues having acidic side chains such as aspartic acid and glutamic acid; amino acid residues having non-charged polar side chains such as glycine, asparagine, glutamine, serine, threonine, tyrosine and cysteine; alanine, valine, leucine, isoleucine, Amino acid residues with non-polar side chains such as proline, phenylalanine, methionine and tryptophan; amino acid residues with β-branched side chains such as threonine, valine and isoleucine; aromatic side chains such as tyrosine, phenylalanine, tryptophan and histidine Substitutions between amino acid residues are also conservative substitutions.

2. Model Animal, Cell In one aspect of the invention, the function and / or expression of the ADH5 gene is deleted or reduced, and the function and / or expression of the ALDH2 gene is reduced in one or both of the paired chromosomes. , At least one model animal selected from the group consisting of hematopoietic deficiency, stunted growth, hypercarcinogenicity, and mental dysfunction (hereinafter, may be referred to as "model animal of the present invention"). This will be described below.

The animals are not particularly limited, and examples thereof include mammals such as monkeys, mice (Mus musculus), rats, dogs, cats, rabbits, pigs, horses, cows, sheep, goats, and deer. Among these, animals that can be used as experimental animals are preferable, Mus musculus animals are more preferable, and Mus musculus is further preferable. Mammals may also be phylogenetic or hybrid. In the case of mice, examples of the strain species include C57BL / 6, C3H, ICR, and BALB / c, but C57BL / 6 is preferable. When humans are used as model animals, cells derived from healthy people or diseased patients, iPS cells, etc. are expected to be used.

The ADH5 (alcohol dehydrogenase 5) gene is a gene for an enzyme that converts formaldehyde to formic acid in a glutathione-dependent manner. In various mammals, the base sequence and amino acid sequence of the ADH5 gene are known, or can be easily determined based on the known base sequence and amino acid sequence of the ADH5 gene (for example, by identity analysis with these). can. As an example, the mouse Adh5 gene is a gene specified by NCBI Gene ID: 11532, and its amino acid sequence includes the amino acid sequence (SEQ ID NO: 4) specified by NCBI RefSeq accession number: NP_001275507.1 and NCBI RefSeq. Accession number: The amino acid sequence specified by NP_031436.2 (SEQ ID NO: 5) is mentioned, and the mRNA sequence thereof is NCBI RefSeq, the base sequence specified by NM_001288578.1 (SEQ ID NO: 6) and NCBI RefSeq. Accession number: The base sequence (SEQ ID NO: 7) specified by NM_007410.3 can be mentioned.

The ALDH2 gene (aldehyde dehydrogenase 2) is a gene for an enzyme that converts acetaldehyde to acetic acid. In various mammals, the base sequence and amino acid sequence of the ALDH2 gene are known, or can be easily determined based on the known base sequence and amino acid sequence of the ALDH2 gene (for example, by identity analysis with these). can. As an example, the mouse Aldh2 gene is a gene specified by NCBI Gene ID: 11669, and its amino acid sequence includes the amino acid sequence (SEQ ID NO: 8) specified by NCBI RefSeq accession number: NP_001295379.1 and NCBI RefSeq. Accession number: The amino acid sequence specified by NP_033786.1 (SEQ ID NO: 9) is mentioned, and the mRNA sequence thereof is NCBI RefSeq accession number: base sequence specified by NM_001308450.1 (SEQ ID NO: 10) and NCBI RefSeq. Accession number: The base sequence (SEQ ID NO: 11) specified by NM_009656.4 can be mentioned.

The ADH5 gene and ALDH2 gene targeted by the present invention also include mutants having normal functions that can occur in nature. The ADH5 gene and ALDH2 gene targeted by the present invention may have basic mutations such as substitutions, deletions, additions, and insertions as long as the enzymatic activity of the encoding protein is not significantly impaired. As the mutation, a mutation that does not cause an amino acid substitution or a mutation that causes a conservative substitution of an amino acid in the protein translated from the mRNA is preferable.

In the ADH5 gene and ALDH2 gene targeted by the present invention, for example, the amino acid sequence of the protein encoded by the gene is 95% or more of the amino acid sequence of the wild-type ADH5 gene and the protein encoded by the ALDH2 gene of the allogeneic animal. A gene having, preferably 98% or more, more preferably 99% or more identity. In addition, the ADH5 gene and ALDH2 gene targeted by the present invention have, for example, the amino acid sequence of the protein encoded by the ADH5 gene and the ALDH2 gene having the same amino acid sequence of the wild-type ADH5 gene and the ALDH2 gene of the allogeneic animal. Or one or more (eg, 2-10, preferably 2-5, more preferably 2-3, even more preferably 2) have been substituted, deleted, added or inserted into the amino acid sequence. It is a gene, which is an amino acid sequence.

In the model animal of the present invention, the function and / or expression of the ADH5 gene targeted by the present invention is deleted or decreased. That is, in the model animal of the present invention, a mutation is introduced into the ADH5 gene so that the function and / or expression of the ADH5 gene targeted by the present invention is deleted or reduced. Here, the "function" of the ADH5 gene indicates the original activity of the ADH5 protein, the enzyme activity of converting formaldehyde to formic acid in a glutathione-dependent manner. Also, "expression" of the ADH5 gene includes both the expression of ADH5 mRNA and the expression of ADH5 protein, but is preferably the expression of ADH5 protein. "Deficiency" indicates that the activity of the ADH5 protein and / or the expression level of the ADH5 gene is below the detection limit in the sample obtained from the model animal of the present invention. In addition, "decreased" means that the activity of ADH5 protein and / or the expression level of ADH5 gene is the activity of ADH5 protein and / or the expression level of ADH5 gene before the introduction of mutation in the sample obtained from the model animal of the present invention. It indicates that it is lower than (for example, 1/20, 1/50, 1/100, 1/200, 1/500, 1/1000, 1/2000, 1/5000, 1/10000 or less). The activity of the ADH5 protein and / or the expression level of the ADH5 gene can be measured according to a known method.

The mutation introduced into the ADH5 gene is not particularly limited as long as it is a mutation in which the function and / or expression of the ADH5 gene is deleted or decreased. Examples of the mutation include a gene deletion (gene disruption), a mutation in a protein coding region, a mutation in a splicing regulatory region, a mutation in an expression control region (for example, a promoter, an activator, an enhancer, etc.) and the like. Mutations in the protein coding region include, for example, mutations corresponding to S75N and A278P in the human ADH5 protein. Among these, gene deletion (gene disruption) is preferable. In the model animal of the present invention, the mutation of the ADH5 gene is carried on both of the paired chromosomes.

In the model animal of the present invention, one or both of the paired chromosomes has the function and / or expression-lowering mutation of the ALDH2 gene targeted by the present invention as described above. That is, in the model animal of the present invention, a mutation is introduced into the ALDH2 gene so that the function and / or expression of the ALDH2 gene targeted by the present invention is reduced in one or both of the paired chromosomes. .. Examples of the mutation include a mutation in a protein coding region, a mutation in a splicing regulatory region, a mutation in an expression control region (for example, a promoter, an activator, an enhancer, etc.) and the like. The mutation is preferably a mutation (amino acid substitution, deletion, insertion) in the protein coding region of the ALDH2 gene. Here, the "function" of the ALDH2 gene indicates the original activity of the ALDH2 protein, the enzymatic activity of converting acetaldehyde to acetic acid. Further, "decreased" means that the activity of ALDH2 protein and / or the expression level of ALDH2 gene did not disappear in the sample obtained from the model animal of the present invention, and the activity of ALDH2 protein and / or the activity of ALDH2 protein before the introduction of the mutation did not disappear. Alternatively, it indicates that the expression level is lower than the expression level of the ALDH2 gene (for example, 1 to 30%, preferably 2 to 20%, more preferably 5 to 10%). This allows for longer survival while exhibiting at least one phenotype selected from the group consisting of hematopoietic deficiency, stunted growth, high carcinogenicity, and mental dysfunction, making it a more suitable model for analysis. You can get an animal. The activity of the ALDH2 protein and / or the expression level of the ALDH2 gene can be measured according to a known method.

The mutation in the protein coding region of the ALDH2 gene is not particularly limited as long as it is a mutation that reduces the function of the ALDH2 gene. Regions involved in functional decline in ALDH2 protein include regions to which coenzymes (NAD ⁺ ) are added (coenzyme binding pocket regions), central regions of catalysis (cysteine residues that are the active center, etc.), and multimers. An adhesive region (multimer formation region) and the like for this purpose can be mentioned. In the model animal of the present invention, it is preferable that the hypofunction mutation of the ALDH2 gene is a mutation that causes a mutation in the multimer formation region of the ALDH2 protein. The mutation in the multimer formation region is preferably E506 (glutamic acid, which is the 506th amino acid from the N-terminal) of the mouse ALDH2 protein (SEQ ID NO: 9) or the corresponding amino acid mutation in other species. The corresponding amino acids in other species can be easily identified by identity analysis with the mouse ALDH2 protein. More specifically, for example, the amino acid sequence of the mouse ALDH2 protein (SEQ ID NO: 9: amino acid sequence 1) is compared with the amino acid sequence of an organism other than mouse (amino acid sequence 2) so that the identity is maximized. When both are arranged in parallel, the residue corresponding to the amino acid residue E506 in the amino acid sequence 1 (preferably an acidic amino acid residue, more preferably a glutamic acid residue) in the amino acid sequence 2 is referred to as "corresponding amino acid". Can be determined to be. The mutation of the corresponding amino acid in E506 or other species in mice is preferably a substitution mutation, more preferably a substitution with lysine or the like.

In the model animal of the invention, if there is a hypofunction mutation in the protein coding region of the ALDH2 gene, preferably a mutation in the multimer formation region, more preferably a mouse E506 or a corresponding amino acid mutation, on one of the paired chromosomes. Only preferably having the above mutations.

The model animal of the present invention has at least one phenotype selected from the group consisting of hematopoietic deficiency, stunted growth, hypercarcinogenicity, and mental dysfunction (preferably mental retardation). More specifically, phenotypes include anemia, bone marrow cell depletion, small head, underweight, organ contraction, low muscle mass, low fat mass (especially low subcutaneous fat mass), spinal deformity, leukemia, mental retardation, etc. Be done.

Further, in one embodiment of the present invention, a cell in which the function and / or expression of the ADH5 gene is deleted or decreased, and the function and / or expression of the ALDH2 gene is reduced in one or both of the paired chromosomes. (In the present specification, it may be referred to as "cell of the present invention").

The cells of the present invention are used as at least one model cell selected from the group consisting of hematopoietic deficiency, stunted growth, hypercarcinogenicity, and mental dysfunction (preferably mental retardation), for example, for analysis of the disease, therapeutic agent. It can be used for screening and the like. The cells are not particularly limited to primary cultured cells or cell lines, and are, for example, nerve cells, blood cells, hematopoietic stem cells / precursor cells, spouses (sperm, eggs), fibroblasts, epithelial cells. , Vascular endothelial cells, hepatocytes, keratin-producing cells, muscle cells, epidermal cells, endocrine cells, ES cells, iPS cells, tissue stem cells, cancer cells and the like. The cell-derived organism is also not particularly limited, and examples thereof include mammals such as humans, monkeys, mice (Mus musculus), rats, dogs, cats, rabbits, pigs, horses, cows, sheep, goats, and deer. ..

3. 3. Method for producing model animal and cell The method for producing the model animal of the present invention and the cell of the present invention is not particularly limited, and various known gene-mutated animal production techniques can be used. As an example, the following method can be mentioned.

The present invention, in one embodiment, comprises introducing mutations into the ADH5 and ALDH2 genes in animal cells, at least selected from the group consisting of hematopoietic deficiency, stunted growth, hypercarcinogenicity, and mental dysfunction. It relates to a method for producing one type of model animal (in the present specification, it may be referred to as "the method for producing the present invention").

The cell to be introduced into the mutation is not particularly limited, but is preferably a fertilized egg from the viewpoint of efficiency in producing a model animal.

The method for introducing the mutation is not particularly limited, but from the viewpoint of efficiency of model animal production, at least one selected from the group consisting of a target-specific nuclease, an expression cassette of the nuclease, and mRNA of the nuclease, and a donor DNA. Examples thereof include a method of introducing an introductory substance containing the above into cells.

The target-specific nuclease is not particularly limited as long as it is a nuclease capable of specifically cleaving a specific site on genomic DNA to induce a mutation. Examples of target-specific nucleases include Cas protein, TALEN protein, ZFN protein and the like.

The CRISPR / Cas system using Cas protein uses Cas protein, which is a nuclease (RGN; RNA-guided nuclease), and guide RNA. By introducing the system into the cell, the guide RNA can bind to the target site and the DNA can be cleaved by the Cas protein attracted to the binding site.

The TALEN system using the TALEN protein uses an artificial nuclease (TALEN) that contains the DNA binding domain of a transcriptional activator-like (TAL) effector in addition to the DNA cleavage domain (eg, the FokI domain). By introducing the system into the cell, TALEN binds to the target site via the DNA binding domain, where DNA is cleaved. The DNA binding domain that binds to the target site can be designed according to a known scheme (eg Zhang F et al. (2011) Nature Biotechnology 29 (2); this paper is incorporated herein by reference). ..

The ZFN system using ZFN proteins uses an artificial nuclease (ZFN) containing a nucleic acid cleavage domain conjugated to a DNA binding domain containing a zinc finger array. By introducing the system into the cell, ZFNs bind to the target site via the DNA binding domain, where the DNA is cleaved. The DNA binding domain that binds to the target site can be designed according to a known scheme.

Among the target-specific nucleases, the Cas protein is preferable from the viewpoint that the cleavage site can be determined more freely. The Cas protein is preferably Cas9 protein.

The target-specific nuclease expression cassette is not particularly limited as long as it is a DNA capable of expressing the target-specific nuclease in the cells of the object of the production method of the present invention. Typical examples of a target-specific nuclease expression cassette include a promoter and DNA containing a target-specific nuclease coding sequence placed under the control of the promoter. In addition, the target-specific nuclease expression cassette may constitute a vector by itself or together with other sequences (for example, drug resistance gene, origin of replication, etc.). The type of vector is not particularly limited.

When the target-specific nuclease is a Cas protein, the introduction in the production method of the invention further comprises at least one selected from the group consisting of a guide RNA expression cassette and a guide RNA.

The guide RNA is not particularly limited as long as it is used in the CRISPR / Cas system, and can induce the Cas protein to the target site of the genomic DNA, for example, by binding to the target site of the genomic DNA and binding to the Cas protein. Various things can be used.

The target-specific nuclease is not particularly limited as long as it is a nuclease capable of specifically cleaving a specific site on genomic DNA to induce a mutation. Examples of target-specific nucleases include Cas protein, TALEN protein, ZFN protein and the like.

The CRISPR / Cas system using Cas protein uses Cas protein, which is a nuclease (RGN; RNA-guided nuclease), and guide RNA. By introducing the system into the cell, the guide RNA can bind to the target site and the DNA can be cleaved by the Cas protein attracted to the binding site.

The TALEN system using the TALEN protein uses an artificial nuclease (TALEN) that contains the DNA binding domain of a transcriptional activator-like (TAL) effector in addition to the DNA cleavage domain (eg, the FokI domain). By introducing the system into the cell, TALEN binds to the target site via the DNA binding domain, where DNA is cleaved. The DNA binding domain that binds to the target site can be designed according to a known scheme (eg Zhang F et al. (2011) Nature Biotechnology 29 (2); this paper is incorporated herein by reference). ..

The ZFN system using ZFN proteins uses an artificial nuclease (ZFN) containing a nucleic acid cleavage domain conjugated to a DNA binding domain containing a zinc finger array. By introducing the system into the cell, ZFNs bind to the target site via the DNA binding domain, where the DNA is cleaved. The DNA binding domain that binds to the target site can be designed according to a known scheme.

Among the target-specific nucleases, the Cas protein is preferable from the viewpoint that the cleavage site can be determined more freely. The Cas protein is preferably Cas9 protein.

The target-specific nuclease expression cassette is not particularly limited as long as it is a DNA capable of expressing the target-specific nuclease in the cells of the object of the production method of the present invention. Typical examples of a target-specific nuclease expression cassette include a promoter and DNA containing a target-specific nuclease coding sequence placed under the control of the promoter. In addition, the target-specific nuclease expression cassette may constitute a vector by itself or together with other sequences (for example, drug resistance gene, origin of replication, etc.). The type of vector is not particularly limited.

When the target-specific nuclease is a Cas protein, the introduction in the production method of the invention further comprises at least one selected from the group consisting of a guide RNA expression cassette and a guide RNA.

The guide RNA is not particularly limited as long as it is used in the CRISPR / Cas system, and can induce the Cas protein to the target site of the genomic DNA, for example, by binding to the target site of the genomic DNA and binding to the Cas protein. Various things can be used.

The target site of the target-specific nuclease is not particularly limited.

The donor DNA that can be used in the production method of the present invention is, for example, a donor DNA that contains at least one portion of the ALDH2 gene and has a mutation that causes a mutation in the multimer formation region of the ALDH2 protein encoded by the gene.

The donor DNA is a single-stranded DNA containing a base sequence arranged in the order of the 5'side homology arm sequence, the donor DNA sequence, and the 3'side homology arm sequence from the 5'side.

Any base sequence can be adopted as the donor DNA sequence. The donor DNA sequence is preferably a donor DNA sequence containing a coding sequence for a multimer formation region and in which a part of the multimer formation region is mutated.

The 5'side homology arm sequence is a homologous sequence of the base sequence on the 5'side of the target site outside the target-specific nuclease, and the 3'side homology arm sequence is the base sequence on the 3'side of the target site outside the target-specific nuclease. Is a homologous sequence of.

The method for introducing the introduced substance into the cells is not particularly limited, and known methods such as a microinjection method, a lentivirus method, a retrovirus method and the like can be adopted.

The model animal of the present invention can be obtained by developing the mutant-introduced cells into embryos as needed and transplanting them into foster mothers to obtain offspring.

The fertilized eggs, sperms and embryos (for example, frozen embryos) obtained in the process of the production method of the present invention can occur in the model animal of the present invention, and these are also aspects of the present invention. Further, a fertilized egg obtained by fertilizing a sperm and / or an egg of the model animal of the present invention is also a fertilized egg that can be generated in the model animal of the present invention, and such a fertilized egg is also an aspect of the present invention. .. These fertilized eggs are not particularly limited as long as they can be generated in a living body from a cryopreservation state, and examples thereof include eggs immediately after fertilization, pronuclear stage embryos, early embryos, and blastocysts.

Items other than the above explanation are the same as those in "2. Model animals and cells".

Four. Uses of model animals and cells The model animals of the present invention and fertilized eggs, sperms and embryos generated therein, and the cells of the present invention are selected from the group consisting of hematopoietic deficiency, stunted growth, high carcinogenicity, and mental dysfunction. It can be used for pathological analysis, preventive method development, therapeutic method development, etc. of at least one type.

The present invention, in one aspect thereof, is a group consisting of hematopoietic deficiency, stunted growth, high carcinogenicity, and mental dysfunction using the model animal of the present invention, a fertilized egg or embryo generated therein, or the cells of the present invention. It relates to a method for screening at least one preventive agent, ameliorating agent, or an exacerbating causative agent selected from the above.

The screening method is not particularly limited as long as the model animal of the present invention or the cells of the present invention is used, and for example, steps (a), (b), and (c1) or (c2):
(A) The step of administering or contacting the test substance to the model animal according to any one of claims 1 to 6, the fertilized egg, sperm or embryo according to claim 7, or the cell according to claim 8.
(B) Selected from the group consisting of hematopoietic deficiency, stunted growth, hypercarcinogenicity, and mental dysfunction of the model animal, the fertilized egg, sperm or embryo, or the cell to which the test substance was administered or contacted. A step of evaluating at least one phenotype, and (c1) a group consisting of hematopoietic deficiency, stunted growth, hypercarcinogenicity, and mental dysfunction when the phenotype is cured or alleviated. The step of selecting as at least one preventive agent or ameliorating agent selected from the above, or (c2) when the phenotype is deteriorated, the test substance is subjected to hematopoietic deficiency, stunted growth, high carcinogenicity, and mentality. The process of selecting as at least one exacerbating substance selected from the group consisting of dysfunction,
including.

The type of the test substance is not particularly limited as long as it can be a candidate for a therapeutic drug. Examples thereof include proteins, peptides, non-peptide compounds (nucleotides, amines, sugars, lipids, etc.), organic small molecule compounds, inorganic compounds, fermentation products, cell extracts, plant extracts, animal tissue extracts and the like. ..

Administration can be performed according to known methods. For example, enteral administration such as oral administration, tube feeding, and enema administration; parenteral administration such as intravenous administration, transarterial administration, intramuscular administration, intracardiac administration, subcutaneous administration, intradermal administration, and intraperitoneal administration. Can be mentioned.

Phenotypic evaluation can be performed according to or according to known methods. For example, to evaluate phenotypes such as hematopoietic deficiency, stunted growth, hypercarcinogenicity, and mental dysfunction by quantification of bone marrow cells, quantification of hematopoietic cell subset, weight measurement, visual observation, CT analysis, dissection, behavior test, etc. Can be done.

By using the selected test substance as a treatment candidate substance and proceeding with further analysis, a useful therapeutic agent can be selected.

Items other than the above explanation are the same as those in "2. Model animals and cells".

Hereinafter, the present invention will be described in detail based on examples, but the present invention is not limited to these examples.

Test example 1. Creation of mutant mice
Using the CRISPR / Cas9 method, gene-edited mice with single or double mutations of Adh5 ^-/- and Aldh2-E506K (corresponding to human ALDH2-E504K, referred to herein as Aldh2-KI) were generated. ..

Specifically, the CRISPR / Cas9 method was performed as follows. The following reagents were purchased from Integrated DNA Technologies: HiFi Cas9 Nuclease V3, tracrRNA, crRNA (MmAdh5 exon2: TAAGGCTGCAGTCGCCTGGG (SEQ ID NO: 1), MmAldh2 exon12: GGCGTACACAGAAGTGAAGA (SEQ ID NO: 2)), and ssODN (MmAldh2-E506 ACTCCGTGGCCTGGCC (SEQ ID NO: 3). Mononuclear mouse embryos were prepared by thawing frozen embryos (CLEA Japan) and culturing them in KSOM medium (ARK Resource). Electroporation is performed on 100-150 embryos 1 hour after thawing, 40 μl serum-free containing 100 ng / l HiFi Cas9 Nuclease V3, 100 ng / l Adh5 gRNA, 100 ng / l Aldh2 gRNA, and 300 ng / l ss ODN. It was placed in a chamber containing medium (Opti-MEM, Thermo). These were electroporated with a 5 mm gap electrode (CUY505P5, NepaGene) in a NEPA21 super electroporator (NepaGene). The polling pulses for electroporation were a voltage of 225 V, a mouse embryo pulse width of 1 ms, a pulse interval of 50 ms, and a pulse number of 4. The first and second transplanted pulses had a voltage of 20 V, a pulse width of 50 ms, a pulse sensation of 50 ms, and a pulse number of 5. Mouse embryos that had developed to the 2-cell stage after electroporation were transplanted into the oviducts of surrogate mothers anesthetized with sevoflurane or isoflurane (mylan).

Adh5 ^+/- Aldh2 ^{WT / KI} female mice and Adh5 ^+/- Aldh2 ^{KI / KI} male mice were mated and the genotypes of the offspring were measured. Adh5 ^-/- Aldh2 ^{KI / KI} mice were born in a Mendelian ratio (Fig. 1).

Test example 2. Phenotype evaluation 1
The mice obtained in Test Example 1 were observed and weighed. The results are shown in FIGS. 2 and 3. Weight and size of Adh5 ^-/- Aldh2 ^{KI / KI} mice indicate no prenatal growth retardation. In Adh5 ^-/- Aldh2 ^{KI / KI} mice, severe growth deficiency with poor weight gain was prominent in all mice 1-2 weeks after birth. Adh5 ^-/- Aldh2 ^{WT / KI} mice also lost weight compared to Adh5 ^-/- or Aldh2 ^{KI / KI} mice between 2 and 6 weeks of age. Computer tomography (CT) and anatomical analysis were performed. CT analysis uses the CosmoScan FX system (RIGAKU) to target anesthetized mice with X-ray tube (90 kV), current (88 A), visual field (60 mm), and voxel size (240 m) parameters. Was set and implemented. The data was analyzed and visualized with 3D Slicer v4.10.2. As a result, Adh5 ^-/- Aldh2 ^{KI / KI} mice had a small body, extremely reduced organs, decreased muscle and subcutaneous fat mass, and multiple strains of abnormalities including lordosis at 3 weeks after birth. However, all animals were successfully breastfed by their mothers. Adh5 ^-/- Aldh2 ^{WT / KI} showed symptoms similar to those of Adh5 ^-/- Aldh2 ^{KI / KI} mice at 6 months of age, but were much milder. Furthermore, in middle-aged Adh5 ^-/- Aldh2 ^{WT / KI} (8-9 months), skin pigmentation was observed in the tail, and it was found to show Fanconi anemia-like characteristics. Survival rates were measured for these mice. The results are shown in FIG. All Adh5 ^-/- Aldh2 ^{KI / KI} mice showed anemia and severe weakness and died of cachexia within 4 weeks of age, but Adh5 ^-/- Aldh2 ^{WT / KI} mice and mice with other genotypes. So, no situation was found to be detrimental to survival during this period. Also, Adh5 ^-/- or Aldh2 ^{KI / KI} mice showed no apparent developmental impairment consistent with previous reports.

Test example 3. Phenotype evaluation 2
The mice obtained in Test Example 1 were measured for nucleated bone marrow cells and a subset of hematopoietic cells. Specifically, it was carried out as follows.

BM cells were flushed from the femur and tibia using a 26G needle, the spleen and thymus were separated by disruption, followed by Ca ²⁺ and Mg ² supplemented with 1% heat-inactivated bovine serum (Gibco). ⁺ Cell strainer was passed through a free Hank buffered salt solution (HBSS, Gibco). Red blood cells (RBC) were lysed by resuspending the cells in RBC lysis buffer (eBioscience) for 5 minutes at room temperature. The cells were filtered through a 70 μm cell strainer to give a single cell suspension. The number of cells was measured with a hemocytometer. The antibodies used for FACS analysis were as follows. FITC-conjugated lineage cocktail (# 133302, BioLegend), CD41 (FITC, # 133903, BioLegend), FcεRIα (FITC, # 134305, BioLegend), CD117 (APC, # 105811, BioLegend), Sca-1 (PE, # 108107) , BioLegend), CD48 (Brilliant Violet 421, # 103428, BioLegend), CD150 (APC / Fire 750, # 115940, BioLegend), CD135 (Brilliant Violet 421, # 135313, BioLegend), CD127 (PE / Cy7, # 135014, BioLegend), CD16 / 32 (Brilliant Violet 421, # 135313, BioLegend), CD34 (APC / Fire 750, # 135014, BioLegend), CD3ε (Alexa Fluor 488, # 100321, BioLegend), CD19 (APC, # 152410, BioLegend) ), CD4 (PE, # 130310, BioLegend), CD8a (APC, # 100712, BioLegend). Antibody staining was performed at 4 ° C. for 20 minutes. Dead cells were excluded by staining with 7-AAD (BioLegend). Data were acquired with a CytoFLEX S FACS analyzer (Beckman Coulter) and analyzed with FlowJo v10.6.2.

Some of the results are shown in FIGS. 5-9. In pathological stage (3 weeks old) Adh5 ^-/- Aldh2 ^{KI / KI} mice, the total number of nucleated bone marrow cells from the tibia and femur was significantly reduced compared to other animals. Consistently, the number of pluripotent self-replicating hematopoietic stem cells defined by Lin --c ^- Kit ⁺ Sca-1 ⁺ CD150 ^{+ CD48-} (CD150 ⁺ long-term hematopoietic stem cells [LT-HSCs]) is Adh5- ^{/ --Significantly} decreased in Aldh2 ^{KI / KI} mice. Similar trends are seen in Lin --c ^- Kit ⁺ Sca-1 ⁺ CD150 ^--CD48- ( ^{CD150 -} pluripotent progenitor cells [MPPs]) and Lin --c ^- Kit ⁺ Sca-1 ⁺ CD150 ^{--CD48 +} (CD48 ⁺ restriction). Immature hematopoietic progenitor cells, including progenitor cells [HPC-1]) cells, were also observed. Lin ^--c -Kit ^low Sca-1 ^low CD127 ⁺ CD135 ⁺ (common lymphoid progenitor cells [CLPs]), Lin --c ^- Kit ⁺ Sca ^- 1 --CD34 ⁺ CD16 / 32- ⁽ CD34 ⁺ common myeloid progenitor cells [] The number of further differentiated progenitor cells, including CMPs)) and Lin --c ^- Kit ⁺ Sca ^- 1 ^--CD34 --CD16 / 32- (terrythrocyte lineage ^- restricted progenitors [MEPs]), is also Adh5- ^{/ --Significantly} decreased in Aldh2 ^{KI / KI} mice. Peripheral blood lymphocyte counts and thymus and spleen weights were reduced without significant changes in lymphocyte distribution in these organs in relation to the reduction in CLP in Adh5 ^-/- Aldh2 ^{KI / KI} mice. Adh5 ^-/- Aldh2 ^{+ / KI} mice showed no abnormalities in bone marrow cells at 3 weeks of age, but at 8-9 months of age, MPP and CLP numbers were compared to Adh5 or Aldh2 gene-deficient mice alone. It was significantly reduced.

Claims (10)

Hematopoietic dysfunction, stunted growth, hypercarcinogenicity, and psychiatry, in which the function and / or expression of the ADH5 gene is deficient or reduced, and the function and / or expression of the ALDH2 gene is reduced in one or both of the paired chromosomes. At least one model animal selected from the group consisting of dysfunction. The model animal according to claim 1, wherein the ADH5 gene is deficient in both of the paired chromosomes. The model animal according to claim 1 or 2, wherein the reduced function mutation of the ALDH2 gene is a mutation that causes a mutation in the multimer formation region of the ALDH2 protein. The model animal according to claim 3, wherein the ALDH2 gene hypofunction mutation is a mutation that causes a mutation in the mouse ALDH2 protein E506 or a corresponding amino acid. The model animal according to claim 3 or 4, wherein the reduced function mutation of the ALDH2 gene is a mutation that causes the replacement of the mouse ALDH2 protein E506 or the corresponding amino acid with lysine. The model animal according to any one of claims 1 to 5, wherein the mental dysfunction includes mental retardation. A fertilized egg, sperm or embryo, which develops in the model animal according to any one of claims 1 to 6. A cell in which the function and / or expression of the ADH5 gene is deleted or reduced, and the function and / or expression of the ALDH2 gene is reduced in one or both of the paired chromosomes. Hematopoietic dysfunction, stunted growth, hypercarcinogenicity, and the use of the model animal according to any one of claims 1 to 6, the fertilized egg, sperm or embryo according to claim 7, or the cell according to claim 8. A method for screening at least one preventive agent, ameliorating agent, or an exacerbating causative agent selected from the group consisting of mental dysfunction. (A) The step of administering or contacting the test substance to the model animal according to any one of claims 1 to 6, the fertilized egg, sperm or embryo according to claim 7, or the cell according to claim 8.
(B) Selected from the group consisting of hematopoietic deficiency, stunted growth, hypercarcinogenicity, and mental dysfunction of the model animal, the fertilized egg, sperm or embryo, or the cell to which the test substance was administered or contacted. A step of evaluating at least one phenotype, and (c1) a group consisting of hematopoietic deficiency, stunted growth, hypercarcinogenicity, and mental dysfunction when the phenotype is cured or alleviated. The step of selecting as at least one preventive agent or ameliorating agent selected from the above, or (c2) when the phenotype is deteriorated, the test substance is subjected to hematopoietic deficiency, stunted growth, high carcinogenicity, and mentality. The process of selecting as at least one exacerbating substance selected from the group consisting of dysfunction,
9. The screening method according to claim 9.

Images