JP2022043935A - Methods for determining viable cell number of organisms having cell wall and method for evaluating resistance of organisms having cell wall to test substances - Google Patents

Abstract

To provide methods for quickly determining the viable cell number of organisms having a cell wall, and methods for quickly evaluating the resistance of the organisms having the cell wall to test substances.SOLUTION: A method for determining the viable cell number of an organism having a cell wall comprises measuring the abundance of one or more sRNAs in a liquid sample which may contain viable cell(s) of the organism having a cell wall, and determining the viable cell number of the organism having the cell wall in the liquid sample on the basis of the measured sRNA abundance. The resistance of the organism having the cell wall to a test substance is evaluated on the basis of the measured abundance of sRNA.SELECTED DRAWING: None

Description

The present disclosure relates to a method for measuring the number of living cells of an organism having a cell wall and a method for evaluating the resistance of the organism having a cell wall to a test substance.

In the field where hygiene management such as food manufacturing, medical care, welfare, and home is required, it is important to manage organisms such as bacteria that have an unfavorable effect on the human body. Most of the bacteria in the environment are harmless, but some bacteria cause food poisoning, spoilage or spoilage of products, and are a major obstacle to people's lives.

In recent years, attempts to detect bacteria by some method (so-called "visualization") and use the detection results as an index for hygiene management related to bacteria are becoming widespread. Here, when detecting a bacterium, the most basic detection method is a culture method. The culture method is a method of culturing a bacterium on a medium and detecting the bacterium based on the morphology of the bacterium.

As a method for detecting a microorganism other than the culture method, a method for recognizing a surface antigen of a microorganism with an antibody (antibody method) can be mentioned. Typical examples of the antibody method include an immunochromatography method, a latex agglutination method, and an ELISA method.

Examples of the method for detecting a microorganism other than the above method include a method for detecting a microorganism based on a gene contained in the microorganism (gene method). The gene method is a method for identifying the type of a microorganism by examining the presence or absence of a nucleic acid sequence constituting a part of a gene contained in the microorganism to be detected. Nucleic acid molecules containing nucleic acid sequences used for identification include DNA and ribosomal RNA called 16S rRNA. For example, in Japanese Patent Application Laid-Open No. 2013-93, Mycobacterium avium and Mycobacterium avium are detected based on the nucleotide sequence of 16S rRNA.

DNA is a nucleic acid possessed by almost all organisms, and 16S rRNA is a nucleic acid possessed by almost all organisms. These nucleic acids are present in large quantities in the living body. Therefore, DNA is suitable as a target for detection, and has been conventionally used for research on detection of microorganisms based on gene sequences. Similarly, 16S rRNA is also suitable as a detection target and has been conventionally used for research on the detection of microorganisms based on gene sequences. In the sequence of DNA, there is a part having a conservative sequence among species and a part having a different sequence for each species. Species can be identified based on the part where the sequence is different for each species. Similarly, in the sequence of 16s rRNA, there is a part having a conservative sequence among species and a part having a different sequence for each species. Species can be identified based on the part where the sequence is different for each species.

It is an object of the present embodiment to provide a method for rapidly measuring the number of living cells of an organism having a cell wall and a method for rapidly evaluating the resistance of the organism having a cell wall to a test substance.

<1> Measuring the abundance of one or more sRNAs in a liquid measurement sample that may contain living cells of an organism having a cell wall.
Based on the abundance of the measured sRNA, the number of living cells of the organism having the cell wall in the liquid measurement sample can be determined.
A method for measuring the number of living cells of an organism having a cell wall in a liquid measurement sample.
<2> Immersing a measurement sample that may contain living cells of an organism having a cell wall in an aqueous solvent to prepare a liquid measurement sample, or an aqueous solvent that may contain living cells of an organism having a cell wall. The measuring method according to <1> above, which comprises preparing a measuring sample as a liquid measuring sample.
<3> The measuring method according to <2>, wherein the aqueous solvent contains at least one selected from the group consisting of a nonionic surfactant and a nucleic acid amplification reagent.
<4> The measuring method according to <2> or <3>, wherein the immersion is performed at a temperature within a temperature range of 0 ° C to 50 ° C.
<5> To determine the number of living cells of an organism having a cell wall, refer to the data showing the correlation between the abundance of sRNA prepared in advance and the number of living cells of the organism having a cell wall, and the presence of the sRNA. The measuring method according to any one of <1> to <4>, which comprises converting an amount into the number of living cells of an organism having a cell wall.
<6> The measuring method according to any one of <1> to <5>, wherein the organism having the cell wall is an organism that has been treated with an antibiotic.
<7> The organism having the cell wall is an organism that has been treated with an antibiotic.
To determine the number of living cells of an organism having a cell wall, refer to the data showing the correlation between the abundance of sRNA prepared in advance and the number of living cells of the organism having a cell wall, and determine the abundance of the sRNA. Including converting to the viable cell number of the organism having the cell wall,
The data is data obtained by measuring the abundance of sRNA and the number of living cells in a liquid sample for calibration obtained by performing the antibiotic treatment on an organism having the cell wall.
The measuring method according to any one of <1> to <4>.
<8> The measuring method according to <6> or <7>, wherein the antibiotic treatment is at least one treatment selected from the group consisting of an antibiotic treatment, a natural standing treatment, and a heat treatment.
<9> The measuring method according to any one of <1> to <8>, wherein the one or more kinds of sRNA show a specific expression state in the organism having the cell wall.
<10> The measuring method according to any one of <1> to <9>, wherein the organism having the cell wall contains at least one selected from the group consisting of Escherichia coli, Citrobacter freundii, and Salmonella gallinarum.
<11> The measuring method according to any one of <1> to <9>, wherein the organism having the cell wall includes a plant.
<12> The measuring method according to any one of <1> to <9>, wherein the organism having a cell wall contains a verotoxin-producing bacterium.
<13> The liquid measurement sample is a liquid measurement sample obtained by collecting airborne substances, and measuring the number of living cells of an organism having a cell wall is a living cell of an organism having a cell wall existing in the air. The measuring method according to any one of <1> to <12>, which comprises measuring a number.
<14> The measuring method according to any one of <1> to <13>, wherein the number of bases of each of the one or a plurality of sRNAs is in the range of 5 to 500.
<15> The one or more sRNAs are EC-5p-36 having the nucleotide sequence represented by SEQ ID NO: 1, EC-3p-40 having the nucleotide sequence represented by SEQ ID NO: 2, and SEQ ID NO: 11. EC-5p-79 having a nucleotide sequence represented by SEQ ID NO: 12, EC-3p-393 having a nucleotide sequence represented by SEQ ID NO: 12, fox_milRNA_5 having a nucleotide sequence represented by SEQ ID NO: 10, and represented by SEQ ID NO: 4. The present invention according to any one of <1> to <14>, which comprises at least one selected from the group consisting of miR156 having a nucleotide sequence and miR716b having a nucleotide sequence represented by SEQ ID NO: 5. Measuring method.
<16> The measuring method according to any one of <1> to <15>, wherein the abundance of one or more kinds of sRNA is measured by isothermal gene amplification.
<17> The measuring method according to <16>, wherein the isothermal gene amplification is performed at a temperature within the temperature range of 10 ° C to 40 ° C.
<18> The measuring method according to any one of <1> to <17>, wherein the abundance of one or more kinds of sRNA is measured by PCR.
<19> To measure the abundance of one or more sRNAs in a liquid evaluation sample containing an organism having a cell wall exposed to a treatment in contact with a test substance in an aqueous solvent.
Based on the measured abundance of sRNA, the number of living cells of the organism having the cell wall in the liquid evaluation sample is determined, and the resistance of the organism having the cell wall to the test substance is evaluated.
A method for assessing the resistance of an organism having a cell wall to a test substance, including.
<20> The evaluation according to <19>, wherein the organism having the cell wall is immersed in the aqueous solvent for 5 minutes or more before measuring the abundance of the one or more kinds of sRNA. Method.
<21> The above <19> or <20>, wherein the test substance contains at least one selected from the group consisting of a bactericidal agent, an antibacterial agent, a disinfectant, an antifungal agent, a disinfectant, an antibiotic, and a preservative. Evaluation method described in.

The present disclosure provides a method for rapidly measuring the viable cell number of an organism having a cell wall and a method for rapidly evaluating the resistance of an organism having a cell wall to a test substance.

E. in Reference Example 4 It is a figure which shows the result of the detection by the isothermal gene amplification of the coli-derived sRNA. It is a figure which shows the result of the detection by the isothermal gene amplification of the black pine pollen-derived sRNA in Reference Example 5. It is a figure which shows the result of the electrophoresis of the nucleic acid extract in Reference Example 10.

The contents of the present disclosure will be described in detail below. The description of the constituents described below may be based on the representative embodiments of the present disclosure, but the present disclosure is not limited to such embodiments.
In the numerical range described stepwise in the present disclosure, the upper limit value or the lower limit value described in one numerical range may be replaced with the upper limit value or the lower limit value of the numerical range described in another stepwise description. .. Further, in the numerical range described in the present disclosure, the upper limit value or the lower limit value of the numerical range may be replaced with the value shown in the examples.

Further, in the present disclosure, the description of the content of a component means the total amount of the plurality of substances contained in the case where a plurality of substances corresponding to each component are contained, unless otherwise specified.

Further, in the present disclosure, "% by mass" and "% by weight" are synonymous, and "parts by mass" and "parts by weight" are synonymous.
Further, in the present disclosure, a plurality of exemplary embodiments described separately may be combined with each other to form a new embodiment as long as they do not contradict each other.
In the present disclosure, when a plurality of elements are listed using "or" or "or", a combination of the plurality of elements is selected unless a technical contradiction occurs, unless otherwise specified. Do not rule out what to do.
Even if an element is expressed in the singular form in the present disclosure, the existence of a plurality of elements is not excluded unless a technical contradiction arises, unless otherwise specified.

The culture method is also used as a method for quantifying microorganisms. Among the methods for quantifying organisms, the culture method is extremely sensitive and highly reliable. In the culture method, the number of live bacteria contained in the sample can be quantified by culturing the sample using the medium as a nutrient to form a bacterial population (colony). However, there are some problems with the culture method. For example, it takes one to several days to culture and form colonies, so it takes time to obtain results, it is difficult to apply to bacteria that are difficult to culture, and autoclave is used to dispose of cultured bacteria. Since sterilization operations such as are required and the volume of waste is bulky, it takes time and cost to dispose of the waste, which is a problem of the culture method.

Further, in the case of the antibody method, for example, the immunochromatography method and the latex agglutination method have an advantage that the operation is simple because the microorganism can be detected only by contacting the sample. However, the immunochromatography method and the latex agglutination method have a problem that the detection sensitivity is low and the detection cannot be performed without the presence of high-concentration microbial cells. The ELISA method is a method with higher sensitivity than the immunochromatographic method and the like, but it takes time and effort because cleaning and color development operations are required.

Further, the conventional gene method is not convenient because it takes time and effort to extract DNA or 16s rRNA from a microorganism by denaturing the cell membrane. Specifically, DNA or 16s rRNA was trapped inside the cell by the cell membrane of the microorganism and was considered difficult to measure directly. To analyze DNA and 16S rRNA, denature the cell membrane with a strong denaturing agent such as phenol, guanidine salt, sodium hydroxide (a denaturing agent strong enough to denature the cell membrane) to remove the nucleic acid, and then remove the denaturing agent or remove the denaturing agent. An operation to neutralize is required. As described above, in the conventional gene method, the operation of treating with a denaturing agent and the operation of removing or neutralizing the denaturing agent are troublesome, so that the operation is complicated and not convenient as compared with the culture method and the immunochromatography method. ..
Moreover, as described above, the genetic method is a method including an operation of destroying the cell membrane or cell wall of a microorganism, so that it is a method for quantifying the total amount of live microorganisms and dead microorganisms, and only living microorganisms are used. It is a method that cannot be quantified.

Organisms contain short RNA fragments called small RNAs. Small RNA (hereinafter, also referred to as “sRNA”) plays an important role in controlling life processes such as development, differentiation, transposon silencing, and virus protection. Since sRNA has important functions in cells, sRNA expressed in the same organism has a conservative nucleotide sequence, that is, the expression profiles of various sRNAs are in multiple cells of the same organism. It is common among them. On the other hand, between different species, the sRNA expression profile is differential depending on the species. Therefore, as with DNA and 16S rRNA, the information on sRNA present in the measurement sample can be used for discriminating the species. It was first discovered by the inventor of the present application that the species can be discriminated using sRNA.

For example, in the organism (A), the sRNA (A) having the nucleotide sequence (A) is expressed, but the sRNA (B) having the nucleotide sequence (B) is not expressed, and in the organism (B), the sRNA ( If B) is expressed but sRNA (A) is not expressed, the presence of sRNA (A) is detected in the measurement sample, but the presence of sRNA (B) is not detected. It can be determined that the cells of the organism (B) exist but do not exist. However, when the sRNA (A) is an sRNA expressed in an organism (C) other than the organism (A) and (B), the presence of the sRNA (A) is detected in the measurement sample, but the sRNA. If the presence of (B) is not detected, it can be determined that one or more cells of the organism (A) and the organism (C) are present, but the cells of the organism (B) are not present.

In consideration of the above situation, as a result of diligent research, the inventor of the present application has found that sRNA in cells of an organism having a cell wall can be extracted into a solvent around the cells to detect sRNA.

The inventor of the present application has advanced research and found that there is a correlation between the number of living cells of an organism having a cell wall treated with an antibiotic and the abundance of sRNA obtained from the organism having the cell wall. Furthermore, depending on the treatment method (for example, antibiotic treatment) of the organism having the cell wall, the number of living cells of the organism having the cell wall subjected to the treatment and the abundance of sRNA obtained from the organism having the cell wall are set. We have found that correlations (eg, positive or negative correlations) are determined. Specifically, the abundance of one or more sRNAs in a liquid measurement sample that may contain living cells of an organism having a cell wall is measured, and based on the measured abundance of sRNAs. It was found that the number of living cells of an organism having a cell wall in the liquid measurement sample can be measured by including the determination of the number of living cells of the organism having the cell wall in the liquid measurement sample. As described above, the treatment is carried out by the correlation between the number of living cells of the organism and the abundance of sRNA in the liquid measurement sample, and further by the treatment method (for example, antibiotic treatment) of the organism having a cell wall. It is unexpected that the correlation (eg, positive or negative correlation) between the number of viable cells of the organism having the cell wall and the abundance of sRNA obtained from the organism having the cell wall is determined. It was a result. Based on these findings, the present disclosure provides a method for rapidly measuring the viable cell number of an organism having a cell wall and a method for rapidly evaluating the resistance of an organism having a cell wall to a test substance.

The method for measuring the number of viable cells of an organism having a cell wall in the liquid measurement sample according to the present disclosure is the presence of one or more sRNAs in the liquid measurement sample which may contain living cells of the organism having a cell wall. Includes measuring the amount and determining the number of viable cells of the organism having the cell wall in the liquid measurement sample based on the measured abundance of sRNA (hereinafter, simply "measurement according to the present disclosure"). Also called "method").
Further, the method for evaluating the resistance of an organism having a cell wall to a test substance according to the present disclosure is one or more in a liquid evaluation sample containing an organism having a cell wall exposed to a treatment in contact with the test substance in an aqueous solvent. The abundance of a plurality of types of sRNA is measured, and the number of living cells of the organism having the cell wall in the liquid evaluation sample is determined based on the measured abundance of the sRNA, and the test of the organism having the cell wall is performed. Includes (hereinafter, also simply referred to as “evaluation method according to the present disclosure”) to evaluate resistance to a substance.

According to the measurement method according to the present disclosure, the number of living cells of an organism having a cell wall in a liquid measurement sample can be rapidly measured based on the measured abundance of sRNA. Further, according to the evaluation method according to the present disclosure, the resistance of an organism having a cell wall to a test substance can be rapidly evaluated based on the measured abundance of sRNA.

Although the existence of sRNA itself has been known from the past, as in the case of DNA and 16S rRNA described above, sRNA is also outside the cell having a cell wall unless the cell is destroyed by mechanical disruption of the cell or cell membrane lysis. It was thought that it could not be taken out. However, in the present disclosure, surprisingly, when a cell having a cell wall is placed in a solvent, the intracellular sRNA is extracted into the solvent around the cell (that is, leaks into the solvent). Was found. The extraction is also possible at room temperature. The sRNA extracted in the solvent can be used to detect the presence of a specific organism of interest and to identify the type of organism present in the measurement sample.

Further, in the present disclosure, it was found that there is a correlation between the number of living cells of an organism having a cell wall and the abundance of sRNA extracted in the solvent around the organism having the cell wall. Furthermore, it has been found that the correlation is determined by the method of treating an organism having a cell wall.

The treated organism having the cell wall is released by a mechanism in which the number of living cells of the organism having the cell wall correlates with the abundance of sRNA obtained from the organism having the cell wall and the treatment method of the organism having the cell wall. The mechanism by which the amount of sRNA is different is estimated as follows.
Living cells of an organism having a cell wall actively release sRNA in proportion to the abundance of living cells of an organism having a cell wall. For dead cells of an organism with a cell wall, sRNA remains encapsulated in the dead cells of the organism with a cell wall unless the cell wall or cell membrane is broken. On the other hand, the amount of sRNA released by an organism having an antibiotic-treated (eg, antibiotic-treated, naturally-leaved, or heat-treated) cell wall varies depending on the treatment method.

For example, when an organism having a cell wall is naturally left to be treated, the number of living cells of the organism having the cell wall is reduced and the amount of sRNA released by the organism having the cell wall is also reduced as compared with the untreated organism. The treatment condition of natural neglect treatment is a gentle treatment condition for an organism having a cell wall. Therefore, when an organism having a cell wall is naturally left untreated, the cell wall or cell membrane does not break, and the sRNA does not temporarily flow out excessively due to shock. Therefore, the number of living cells of an organism having a cell wall that has been naturally left to be treated and the abundance of sRNA have a positive correlation.
Further, when the organism having a cell wall is heat-treated (for example, treated at 95 ° C. for 10 minutes) and then washed, the number of living cells of the organism having the cell wall is reduced as compared with the untreated organism, and the organism has the cell wall. The amount of sRNA released by the organism is also reduced. In the case of heat treatment, sRNA is temporarily excessively discharged due to the shock of heat treatment. Therefore, in the absence of the washing treatment described below, the number of living cells of the organism having the heat-treated cell wall and the abundance of sRNA have a negative correlation.
However, if the washing treatment is performed before measuring the sRNA, the spilled sRNA is removed, and the abundance of the sRNA actively released by the living cells of the organism having the cell wall can be measured. Therefore, the number of living cells of an organism having a cell wall washed after heat treatment and the abundance of sRNA have a positive correlation. The washing treatment involves precipitating cells by natural sedimentation or centrifugation and suspending them in a new solvent such as water, collecting cells by a filter and suspending them in a new solvent such as water. It can be done by such as.

For example, when an organism having a cell wall is treated with ampicillin, the number of living cells of the organism having the cell wall is reduced, but the amount of sRNA released by the organism having the cell wall is increased as compared with the untreated organism. In the case of ampicillin treatment, the damage caused by ampicillin treatment causes a large amount of sRNA to flow out from the dead cells. Therefore, the number of living cells of an organism having an ampicillin-treated cell wall and the abundance of sRNA have a negative correlation.
The present disclosure is not limited to the above estimation mechanism.

Therefore, if the treatment method to be applied to an organism having a cell wall is determined, the correlation between the number of living cells in the liquid measurement sample and the abundance of sRNA when the treatment method is used is determined. In other words, the number of living cells can be obtained from the abundance of sRNA based on the data showing the correlation between the abundance of sRNA and the number of living cells of an organism having a cell wall. Such a correlation (the data) can be obtained, for example, by previously measuring the abundance of sRNA and the number of living cells in a liquid sample for calibration obtained by performing the treatment on an organism having a cell wall. However, the method for obtaining the correlation (the data) is not limited to this. When the number of living cells is measured in advance, it can be measured by using, for example, a culture method.

Utilizing the correlation between the number of viable cells of the above-mentioned cell-walled organism and the abundance of sRNA obtained from the cell-walled organism, the resistance of the cell-walled organism to the test substance is rapidly evaluated. You can also do it. Since contact with the test substance is also an example of the above treatment, the corresponding correlation (data showing the correlation between the abundance of sRNA and the number of living cells of the organism having a cell wall) is determined once the test substance is determined. Thereby, in a liquid evaluation sample containing an organism having a cell wall exposed to a treatment in contact with a test substance, the number of living cells can be determined by measuring the abundance of sRNA released from the organism. Based on the obtained number of viable cells, the effect of the test substance on the organism having a cell wall (whether it has an inhibitory effect, a promoting effect, has neither an inhibitory effect nor a promoting effect, etc.) Can be evaluated. When the above-mentioned liquid sample for calibration is used to obtain data showing the correlation between the abundance of sRNA and the number of viable cells of an organism having a cell wall, the number of viable cells is measured for the liquid sample for calibration. In some cases, the effect of the test substance on the organism is already known. Even in that case, it is possible to detect changes in the responsiveness of the organism to the test substance (for example, acquisition of resistance, etc.) by determining the number of living cells in the liquid evaluation sample.
The liquid evaluation sample containing an organism having a cell wall exposed to the treatment in contact with the test substance is a sample containing an organism having a cell wall exposed to the treatment in contact with the test substance but not containing the test substance itself. It may be a sample containing an organism having a cell wall and a test substance. In addition, as will be described later, when evaluating the effect of the test substance on living organisms, it is not essential to actually determine the number of living cells, but it is raw based on the value of the sRNA abundance that reflects the number of living cells. The evaluation may be performed without determining the number of cells.

Since sRNA has a short chain length, it is less susceptible to RNase attack than 16S rRNA and can be analyzed more stably. Further, since the number of copies of sRNA in the cell is several thousand to tens of thousands at most, information on the abundance of sRNA can be obtained with high sensitivity.

<Organisms with cell walls>
The organism having a cell wall in the measurement method according to the present disclosure and the evaluation method according to the present disclosure is not particularly limited, and may be an organism having an arbitrary cell wall. Generally, cells other than animal cells, such as plant cells and microbial cells, have a cell wall. The organism having the cell wall may be a fungus such as yeast, slime mold, mold, or a bacterium such as Escherichia coli. The object to be measured or evaluated does not have to be the whole organism, but may be a part of the organism. This is because sRNA is also present in the part of the organism, and even the detection of the part of the organism gives information about the existence of the organism. Examples of the part of the organism include a part of a multicellular organism, for example, pollen of a plant. However, the biological part is preferably a part that maintains the shape of the cell. If the part of the organism does not maintain the shape of the cell, it is possible that the intracellular components have already flowed out to the surrounding medium before preparing the liquid measurement sample or preparing the liquid evaluation sample. Because there is. As described above, the measurement method according to the present disclosure describes measuring the number of living cells of an organism having a cell wall, and the evaluation method according to the present disclosure evaluates the resistance of an organism having a cell wall to a test substance. However, the organism having a cell wall referred to here represents a concept including a part of the organism. Therefore, it is sufficient to provide information about the species or group of species in the measured abundance or assessment. In fact, for example, in the case of measurement of herbaceous plants, it is common that what is contained in the liquid measurement sample or the liquid evaluation sample is not the whole organism but a part thereof. By such a measurement method or an evaluation method, a measurement result or an evaluation result regarding an organism or a group of organisms can be obtained. Therefore, the organism in the measurement method and evaluation method according to the present disclosure may be a plant, and in this case, the liquid measurement sample or the component contained in the liquid evaluation sample may be, for example, pollen.

The organism having a cell wall may be, for example, an organism whose existence can be a problem in hygiene management at a site where hygiene management is required (food manufacturing, medical treatment, welfare, home, etc.). Examples of such organisms include pathogenic microorganisms and putrefactive microorganisms. The pathogenic microorganism may be a pathogenic fungus, and examples thereof include Trichophyton, Candida, Aspergillus and the like. The pathogenic bacterium may be a pathogenic bacterium, for example, Gram-positive bacteria (eg, staphylococcus, rentha, pneumococcus, enterococci, diphtheria, tuberculosis, leprosy, charcoal, shigella, etc. Welsh, tetanus, botulinum, etc.), Gram-negative (gonococcus, encephalitis, salmonella, Escherichia coli, pyogenic, shigella, influenza, pertussis, cholera, enteritis vibrio, asinetobacter, campylobacter, regionera) , Helicobacter, etc.). The pathogenic bacterium may be a verotoxin-producing bacterium. Bacteria of each genus such as Pseudomonas, Micrococcus, Vibrio, and Flavobacterium in the case of fish and shellfish, and each genus of Pseudomonas, Acromobacter, Micrococcus, Flabobacterium, etc. in the case of livestock meat, as rotting microorganisms. When the bacteria are rice and noodles, the bacteria of the genus Pseudomonas can be mentioned.

In certain embodiments, the cell wall-bearing organism preferably comprises at least one selected from the group consisting of Escherichia coli, Citrobacter freundii, and Salmonella gallinarum. In another embodiment, the organism having the cell wall comprises a plant, which may be a black pine. In another embodiment, the cell wall-bearing organism comprises a verotoxin-producing bacterium.

In the measurement method and the evaluation method according to the present disclosure, since sRNA leaked from a cell having a cell wall into an aqueous solvent is used for measurement, a treatment for removing a substance that hinders such leakage may be performed in advance.

The organism contained in the liquid measurement sample or the liquid evaluation sample preferably includes an organism having a cell wall in which the cell wall and the cell membrane are not destroyed, or an organism having no cell wall in which the cell membrane is not destroyed. That is, it is preferable that the organism has not undergone cell disruption treatment, membrane destruction treatment, or the like. This is because if the cell wall or cell membrane is destroyed, sRNA has already flowed out from the organism, and there is a possibility that sRNA cannot be extracted. In the measurement method according to the present disclosure and the evaluation method according to the present disclosure, the cell wall and / or the cell membrane of the organism is destroyed in the process from the sample to be measured or the evaluation to the detection of the abundance of sRNA. It is preferable not to include treatment (cell disruption treatment, membrane destruction treatment, etc.).

<Measurement sample>
The measurement sample in the measurement method according to the present disclosure is a sample used for measuring the number of living cells of an organism having a cell wall to be measured, and the measurement sample in the evaluation method according to the present disclosure is resistance to a test substance. It is a sample used for sex evaluation. Regarding the number of living cells of an organism having a cell wall When an organism having a cell wall is present in an object to be analyzed (hereinafter, also referred to as an analysis object), measurement is performed as long as the measurement sample is prepared to include the living cells. The sample is not particularly limited, and the measurement sample may be the analysis target itself or a sample prepared from the analysis target by any treatment. The objects to be analyzed are, for example, the surface of an object such as the surface of a workbench, the object itself such as food, a liquid such as tap water, a gas such as air, and a bacterial cell of unknown biological species. From the viewpoint of simplifying the work, it is preferable that the measurement sample is the analysis target itself.

For example, when it is desired to analyze an organism having a cell wall existing in a liquid as an analysis target, the liquid itself may be used as a measurement sample, or the liquid that has been subjected to a treatment such as dilution may be used as a measurement sample. May be good. Further, for example, when it is desired to analyze an organism existing on the surface of an object as an analysis target (for example, the surface of a workbench), the surface is wiped with a wipe, a cotton swab, etc., and the wipe, the cotton swab, etc., or a part thereof is wiped. It may be used as a measurement sample.

When it is desired to analyze an organism having a cell wall existing inside an object as an object to be analyzed (for example, inside a food), the whole or a part of the object may be used as a measurement sample, or the object may be immersed in a liquid. The liquid thus obtained may be used as a measurement sample. When it is desired to analyze an organism existing in the air using air as an analysis target, a sample obtained by collecting airborne substances existing in the air may be used as a measurement sample. The collection can be performed by a filter, centrifugation (for example, cyclone type separation), simply opening the container and leaving it to stand (for example, opening the lid of a petri dish or the like and leaving it to stand). ..

As described above, the measurement sample is collected on an air filtration filter such as a liquid as an analysis target, a diluted liquid, a wipe whose surface is wiped as an analysis target, a cotton swab, or the like. It can be an object, an deposit attached to a container open to the surrounding atmosphere, or the like. Alternatively, the organism itself can be used as a measurement sample for the purpose of identifying the type of organism having a cell wall that has already been obtained.

<Aqueous solvent>
In the measurement method according to the present disclosure, the solvent of the liquid measurement sample that may contain living cells of an organism having a cell wall may be any solvent as long as sRNA can be extracted, but the cell wall of the organism having a cell wall may be used. Alternatively, an aqueous solvent is preferable from the viewpoint that sRNA can be easily extracted from living cells without destroying the cell membrane.
As a result of diligent research, the inventor of the present application immerses the cells of an organism having a cell wall in water or an aqueous solution containing an additional component that does not significantly increase the cell degenerative action in addition to water. It was found that sRNA in cells can be extracted. This finding is amazing. This is because, for cells of organisms that do not have a cell wall, when the cells are immersed in a hypotonic solution, the cell membrane ruptures due to osmotic pressure, and DNA and 16s RNA are taken out into the surrounding environment without using the above-mentioned denaturant. On the other hand, according to the conventional wisdom of technology, such a method cannot be applied to the cells of an organism having a cell wall. More specifically, since the structure of the cells of an organism having a cell wall is maintained by the cell wall, the cell membrane does not rupture due to a change in the osmotic pressure of the surrounding environment, and lysis is difficult. Therefore, from the conventional general technical knowledge, it is considered difficult to release the nucleic acid existing in the cell of an organism having a cell wall into the surrounding environment without the above-mentioned degeneration operation of the cell membrane. Therefore, it is surprising that sRNA can be extracted extracellularly from the cells of an organism having a cell wall by immersion in water.

In the measurement method according to the present disclosure, it is possible to prepare a liquid measurement sample by immersing a measurement sample that may contain living cells of an organism having a cell wall in an aqueous solvent, or to include living cells of an organism having a cell wall. It is preferable to include preparing a measurement sample which is an aqueous solvent having a property as a liquid measurement sample. Also in the evaluation method according to the present disclosure, it is preferable to immerse the organism having a cell wall in an aqueous solvent.
The aqueous solvent in the measurement method according to the present disclosure and the evaluation method according to the present disclosure is a liquid mainly composed of water, and the aqueous solvent may be pure water itself, and is added to water as long as it does not cause denaturation of the cell membrane. It may be an aqueous solution containing the above-mentioned components (hereinafter, also referred to as “coexisting components”). It is preferable that the content of the solvent component other than water in the aqueous solvent is as small as possible, and the amount of the solvent component other than water is 1% by mass or less, 0.1% by mass or less, and 0.01% by mass with respect to the amount of water. Hereinafter, it may be 0.001% by mass or less, or 0% by mass (that is, it may contain only water as a solvent component). Further, in the present disclosure, the "aqueous solvent" does not contain a component that denatures the cell membrane and destroys the membrane, or contains only a small amount that does not cause the degeneration of the cell membrane. In other words, the aqueous solvent has the basic properties common to water in that it does not cause denaturation of the cell membrane, and is a solvent that can contain coexisting components as long as this basic property is not impaired. .. Therefore, the aqueous solvent according to the present disclosure includes an extract for destroying the cell membrane and taking out the intracellular component (for example, the cell component extract EXTRAGEN (manufactured by Toso Corporation) referred to in Japanese Patent Publication No. 2013-93). ) Is not included.

However, the aqueous solvent may contain 65% by mass or less of monovalent or divalent straight chain, branched chain or alicyclic C2-C8 alcohol, and acetone in the total amount thereof. The addition of certain types of alcohols in such amounts can increase the efficiency of extraction of sRNA into aqueous solvents. Specifically, the content of each of the monovalent or divalent straight chain, branched chain or alicyclic C2-C8 alcohol, and acetone is 65% by mass or less with respect to the total amount of the aqueous solvent. It may be 60% by mass or less, 55% by mass or less, 50% by mass or less, 40% by mass or less, or 30% by mass or less. It may be 20% by mass or less, 10% by mass or less, or 5.0% by mass or less.
The lower limit of the content of the monovalent or divalent linear, branched or alicyclic C2-C8 alcohol in the aqueous solvent is not particularly limited and may be 0% by mass (non-containing). The content of monovalent or divalent straight chain, branched chain or alicyclic C2-C8 alcohol in the aqueous solvent may be 0.5% by mass or more, and 1.0% by mass or more. It may be 5.0% by mass or more, 10% by mass or more, 20% by mass or more, or 40% by mass or more. The above upper limit value and lower limit value may be arbitrarily combined to form a numerical range.
When the aqueous solvent contains two or more of monovalent or divalent linear, branched or alicyclic C2-C8 alcohols, and acetone, the total amount thereof is also preferably within the above range. ..

The monovalent straight chain, branched chain or alicyclic C2-C8 alcohol is preferably a monovalent straight chain, branched chain or alicyclic C2-C5 alcohol, and the monovalent straight chain, branched chain or alicyclic C2-C5 alcohol is preferable. More preferably, it is a branched chain or alicyclic C2-C4 alcohol. Examples of monovalent linear, branched or alicyclic C2-C8 alcohols include ethanol, 1-propanol, 2-propanol, 1-butanol, 2-butanol, 2-methyl-2-propanol, 1 -Pentanol, 2-pentanol, 3-pentanol, 2-methyl-1-butanol, 2-methyl-2-butanol, 3-methyl-1-butanol, 3-methyl-2-butanol, 2,2- Examples include dimethyl-1-propanol.
The divalent straight chain, branched chain or alicyclic C2-C8 alcohol is preferably a divalent straight chain, branched chain or alicyclic C2-C6 alcohol, and the divalent straight chain, branched chain or alicyclic C2-C6 alcohol. More preferably, it is a branched chain or alicyclic C2-C4 alcohol. Examples of divalent linear, branched or alicyclic C2-C8 alcohols are 1,2-ethanediol, 1,2-propanediol, 1,3-propanediol, 1,2-butanediol. , 1,3-Butanediol, 1,4-Butanediol, 2,3-Butanediol.
One or more of these monovalent or divalent straight chain, branched chain or alicyclic C2-C8 alcohols can be arbitrarily selected and used.

The pH of the aqueous solvent is preferably in the range of pH 5 to pH 9, and more preferably in the range of pH 6 to pH 8, from the viewpoint of preventing denaturation of the cell membrane under strongly acidic or alkaline conditions. , The pH is more preferably in the range of pH 6.5 to pH 7.5. As described above, the aqueous solvent may contain a coexisting component in addition to water. The total content of the coexisting components is 30% by mass or less, 10% by mass or less, 1% by mass or less, 0.1% by mass or less, 0.01% by mass or less, or 0.001% by mass with respect to the total amount of the aqueous solvent. It may be less than or equal to%. Examples of coexisting components that may be contained in the aqueous solvent include salts, buffers, surfactants, DTTs, RNase inhibitors and the like. Since sRNA has a short chain length, it is less susceptible to RNase attack than longer RNAs such as 16S rRNA, but it is possible to further stabilize sRNA by coexisting with RNA stabilizers such as DTT and RNase inhibitors. Can be done.

The aqueous solvent does not contain the co-existing component in an amount that denatures the cell membrane and destroys the membrane. From the viewpoint of preventing denaturation of the cell membrane, the aqueous solvent is phenol, guanidine, the above-mentioned monovalent or divalent linear, branched or alicyclic alcohols other than C2-C8 alcohols, ionic surfactants, and the like. And it is preferable that strong alkali such as NaOH is not contained. Aqueous solvent is phenol, guanidine, alcohols other than the above-mentioned monovalent or divalent linear, branched or alicyclic C2-C8 alcohols, ionic surfactants, and denaturing components such as strong alkalis such as NaOH. In the case of containing, the total content thereof is preferably 0.1% by mass or less, preferably 0.01% by mass or less, and 0.001% by mass or less with respect to the total amount of the aqueous solvent. It is more preferable to have. If the denaturing component such as strong alkali is not contained, or if the content is within the above range even if it is contained, these denaturing components are removed for further treatment after preparation of the liquid measurement sample by immersion or after preparation of the liquid evaluation sample. It is not necessary to perform the additional processing of the above, and the measurement method and the evaluation method according to the present disclosure can be performed more easily. From this viewpoint as well, it is preferable that the denatured component is not contained, or even if it is contained, it is within the above-mentioned content range.

Since the surfactant denatures and destroys the cell membrane depending on the type and amount thereof, it is necessary to limit the type and amount when the aqueous solvent contains the surfactant. The surface tension of the aqueous solvent is preferably 50 mN / m to 72.8 mN / m (surface tension of water) at 20 ° C., more preferably 60 mN / m to 72.8 mN / m, and more preferably 65 mN / m to 65 mN / m. It is more preferably 72.8 mN / m, and even more preferably 70 mN / m to 72.8 mN / m. When the aqueous solvent contains a surfactant, the surfactant is preferably a nonionic surfactant, and examples of the nonionic surfactant include a Tween series surfactant (eg, Tween-20). NP-40, Triton series surfactants (eg Triton X-100) and the like can be mentioned.

From the viewpoint of making the properties of the aqueous solvent close to that of pure water, the salt concentration in the aqueous solvent is preferably 0 mol / L to 0.2 mol / L, preferably 0 mol / L to 0.1 mol / L. More preferably, it is more preferably 0 mol / L to 0.05 mol / L.

The coexisting component does not have to be a solvent component, and may be fine particles suspended in water, a water-soluble substance, or the like. Further, the aqueous solvent may contain a nucleic acid amplification reagent as a coexisting component. The nucleic acid amplification reagent is a reagent necessary for nucleic acid amplification, including a polymerase, nucleotide triphosphate (mixture of dNTP), primer, Mg ²⁺ ion and the like. The nucleic acid amplification reagent preferably contains a polymerase having an activity (reverse transcription activity) capable of synthesizing a DNA strand using RNA as a template. Nucleic acid amplification reagents may contain weak detergents such as Triton X-100 (particularly nonionic surfactants), but at concentrations for nucleic acid amplification reagents, they denature cells and destroy the membrane. Therefore, the surfactant in the nucleic acid amplification reagent may be contained in the aqueous solvent as it is. For example, when the aqueous solvent contains Triton X-100, the content of Triton X-100 is 0.01 with respect to the total amount of the aqueous solvent from the viewpoint of preventing denaturation of the cell membrane and efficiently amplifying nucleic acid. It is preferably from% by mass to 5% by mass, more preferably from 0.05% by mass to 3% by mass, and even more preferably from 0.1% by mass to 2% by mass. The nucleic acid amplification reagent may be, for example, a reagent for PCR, a reagent for isothermal gene amplification, or the like. By including a reagent for nucleic acid amplification in an aqueous solvent, nucleic acid amplification can be performed as it is without performing a reagent addition operation or a temperature cycle operation using a liquid measurement sample or a liquid evaluation sample containing sRNA leaked from cells having a cell wall. It will be possible to do.

Examples of coexisting components other than the solvent in the aqueous solvent include nonionic surfactants of 5.0% by mass or less based on the total amount of the aqueous solvent, and antibacterial agents of 1.0% by mass or less based on the total amount of the aqueous solvent. Peptides and reducing agents of 1.0 M or less are also included. Nonionic surfactants are compounds that have a hydrophilic group and a hydrophobic group in one molecule and do not have a group that dissociates into ions in water. The nonionic surfactant may have a hydroxy group, for example, a hydrophilic polyoxyalkylene (polyoxypropylene, polyoxyethylene, etc.) chain moiety and hydrophobicity such as alkyl, aryl, alkylene, arylene, etc. It may be a compound having a moiety. Alternatively, the nonionic surfactant may be a polyol ester type, an alkanolamide type, an alkyl glucoside, an alkoxylate type, or a fatty acid alkyl ester type. More specifically, it may be a polyoxyethylene alkyl ether type, a polyoxyethylene alkyl phenyl ether type or the like. Specific examples of the nonionic surfactant include polysorbate 20 (eg, Tween 20), polysorbate 80 (eg, Tween 80), nonoxynolsphenol ethoxylate (NP-40), octylphenol ethoxylate (eg, Triton X-100), and It may contain at least one selected from the group consisting of poly (ethylene glycol) -block-poly (propylene glycol) -block-poly (ethylene glycol) (eg, Synperoinc F108).

The content of the nonionic surfactant in the aqueous solvent is 5.0% by mass or less with respect to the total amount of the aqueous solvent from the viewpoint of reducing damage to the cell membrane of the organism having a cell wall. The content of the nonionic surfactant in the aqueous solvent may be 4.0% by mass or less, 3.0% by mass or less, or 2.0% by mass with respect to the total amount of the aqueous solvent. It may be less than or equal to%, or may be less than or equal to 1.5% by mass.
The lower limit of the range of the content of the nonionic surfactant in the aqueous solvent is not particularly limited, and may be 0% by mass (non-containing). The content of the nonionic surfactant in the aqueous solvent may be 0.01% by mass or more, 0.1% by mass or more, or 0.3% by mass or more. It may be 0.5% by mass or more, or 0.7% by mass or more. The above upper limit value and lower limit value may be arbitrarily combined to form a numerical range.

The antibacterial peptide is not particularly limited as long as it is an antibacterial peptide known in the art. The antibacterial peptide is basically an amphipathic peptide having a hydrophilic surface and a hydrophobic surface, whereby it can be present on the cell membrane. Examples of antibacterial peptides include the anionic peptides maximin H5 and dermicidin; the linear cationic α-helix peptides containing no cysteine residues, such as secropine, andropin, moricin, seratotoxin, melittin, and maginin (magainine I). And Maginin II), dermaceptin, bonbinin, blevinin-1, escretin, buforin II, CAP18, and LL37; prolin, arginine, phenylalanine, and tryptophan, which are cationic peptides rich in one or more, avaesin, apidaecin, prophenin, Indolicidin; as well as blevinin, protegrin, tachypresin, defensin, and drosomycin containing disulfide bonds. One or more kinds of antibacterial peptides known in the art can be arbitrarily selected and used.

The content of the antibacterial peptide in the aqueous solvent is 1.0% by mass or less with respect to the total amount of the aqueous solvent from the viewpoint of reducing damage to the cell membrane of the organism having a cell wall. The content of the antibacterial peptide in the aqueous solvent may be 0.8% by mass or less, 0.5% by mass or less, or 0.2% by mass or less with respect to the total amount of the aqueous solvent. It may be present, or it may be 0.15% by mass or less.
The lower limit of the range of the content of the antibacterial peptide in the aqueous solvent is not particularly limited, and may be 0% by mass (not contained). The content of the antibacterial peptide in the aqueous solvent may be 0.001% by mass or more, 0.005% by mass or more, 0.01% by mass or more, or 0.05. It may be mass% or more, and may be 0.07 mass% or more. The above upper limit value and lower limit value may be arbitrarily combined to form a numerical range.

The reducing agent is not particularly limited as long as it is a reducing agent known in the art. Examples of reducing agents include oxalic acid, formic acid, gallic acid, ascorbic acid, β-mercaptoethanol, and dithiothreitol. The reducing agent is preferably a reducing agent having a mercapto group, and may be, for example, β-mercaptoethanol or dithiothreitol. As the reducing agent, one or a plurality of types of reducing agents known in the art can be arbitrarily selected and used.

The concentration of the reducing agent in the aqueous solvent is 1.0 M or less from the viewpoint of reducing damage to the cell membrane of the organism having a cell wall. The concentration of the reducing agent in the aqueous solvent may be 0.8 M or less, 0.5 M or less, 0.2 M or less, or 0.15 M or less. good.
The lower limit of the range of the concentration of the reducing agent in the aqueous solvent is not particularly limited, and may be 0M (non-containing). The concentration of the reducing agent in the aqueous solvent may be 0.001 M or more, 0.005 M or more, 0.01 M or more, or 0.05 M or more. It may be 0.07M or more. The above upper limit value and lower limit value may be arbitrarily combined to form a numerical range.

<Immersion>
In the measurement method according to the present disclosure and the evaluation method according to the present disclosure, it is preferable to use an aqueous solvent for the extraction of sRNA from the viewpoint that sRNA can be extracted from living cells of an organism having a cell wall. By not using a strong solvent that destroys the cell membrane or cell wall for the extraction of sRNA, it is possible to avoid a large amount of sRNA being released from the dead cells of the organism having the cell wall.
In the measurement method according to the present disclosure, the liquid measurement sample may be prepared by immersing a measurement sample that may contain living cells of an organism having a cell wall in a liquid (preferably an aqueous solvent), or the cell wall. A measurement sample which is a liquid (preferably an aqueous solvent) which may contain living cells of an organism having the above may be prepared as a liquid measurement sample. In the evaluation method according to the present disclosure, the liquid evaluation sample may be prepared by immersing a measurement sample that may contain living cells of an organism having a cell wall in a liquid (preferably an aqueous solvent), or the cell wall. A measurement sample which is a liquid (preferably an aqueous solvent) which may contain living cells of an organism having the above may be prepared as a liquid measurement sample. In the evaluation method according to the present disclosure, contact with the test substance may be performed at any of these steps.
The immersion that may be performed in the measurement method according to the present disclosure and the evaluation method according to the present disclosure may be performed at room temperature or while heating or cooling. Soaking is preferably performed at a temperature within the temperature range of 0 ° C. to 50 ° C., more preferably at a temperature within the temperature range of 4 ° C. to 40 ° C., so as not to cause degeneration of the cell membrane as much as possible. It is more preferably performed at a temperature within the temperature range of 40 ° C., further preferably performed at a temperature within the temperature range of 20 ° C. to 40 ° C., and further preferably performed at a temperature within the temperature range of 25 ° C. to 40 ° C. More preferably, it is carried out at a temperature within the temperature range of 30 ° C. to 37 ° C. The immersion may be performed at room temperature.
The immersion time is not particularly limited as long as extracellular leakage of sRNA occurs in an amount sufficient for measurement. The soaking time is, for example, 10 seconds to 30 hours, may be 10 seconds to 10 hours, may be 1.0 minutes to 5.0 hours, or may be 5.0 minutes to 1.0 hours. There may be. The soaking time may be 0.50 hours to 6.0 hours, 0.70 hours to 4.5 hours, or 0.80 hours to 2.0 hours. .. The method of immersion is not particularly limited, and if the measurement sample contains an organism having a cell wall, any treatment that causes the organism to come into contact with a liquid (preferably an aqueous solvent) can be mentioned. From the viewpoint of measuring the abundance of sRNA actively released extracellularly by living cells of an organism having a cell wall, it is preferable to immerse the cells under dipping conditions that do not damage the cell membrane or the cell wall. By measuring the abundance of sRNA actively released outside the cell by the living cells of the organism having a cell wall, the number of living cells of the organism having a cell wall can be measured.
When the measurement sample is a solid sample (eg, cotton swab, wipe, filter, analysis object itself or part thereof, or cells), the immersion is, for example, a liquid (preferably an aqueous solvent) stored in a container. This can be done by immersing a solid sample as a measurement sample in the sample.
As described above, since the organism itself having a cell wall can be used as a measurement sample, the organism having a cell wall may be immersed alone in a liquid (preferably an aqueous solvent), or the cell wall attached to another object may be immersed. The organism may be immersed in a liquid (preferably an aqueous solvent) together with the object.
By dipping, when the measurement sample contains living cells of an organism having a cell wall, leakage of sRNA to the outside of the cell occurs, and a liquid measurement sample containing sRNA in a liquid (preferably an aqueous solvent) can be obtained. ..

In the evaluation method according to the present disclosure, even if the liquid evaluation sample is prepared by immersing the measurement sample containing an organism having a cell wall in an aqueous solvent, the measurement sample which is an aqueous solvent containing an organism having a cell wall is a liquid evaluation sample. You may prepare as. From the viewpoint of extracting sRNA from living cells, at the time of measuring the abundance of one or more kinds of sRNA, the living cells of the organism having the cell wall are immersed in an aqueous solvent for a certain period of time (for example, mentioned in the description of immersion). Time) It is preferable that it has already been immersed. The contact between the organism having a cell wall and the test substance may be performed in the measurement sample before immersion or in the liquid evaluation sample, or the organism having the cell wall is brought into contact with the test substance in another liquid sample. It may be done later by removing the test substance (eg with a liquid) and immersing the organism with the cell wall in an aqueous solvent, or by any other method.

<Measurement sample that is a liquid>
In the measurement method according to the present disclosure, if the analysis target is in a liquid state (preferably an aqueous solvent) from the beginning, the analysis target itself can be used as a measurement sample and used as it is as a liquid measurement sample. For example, tap water can be used as it is as a liquid measurement sample to measure the number of living cells of an organism having a cell wall in tap water. Since the object to be analyzed may contain living cells of an organism having a cell wall, the liquid (preferably an aqueous solvent) as the above-mentioned measurement sample may contain living cells of an organism having a cell wall.
If the analysis target is a liquid but you want to perform pretreatment because of a large amount of contaminants, use a method such as filtering, centrifuging, dialysis, etc. to remove the contaminants, and then use a liquid (preferably an aqueous solvent). You may prepare a measurement sample and use this measurement sample as a liquid measurement sample. For example, when inspecting an organism having a cell wall in muddy water, after removing the mud in the muddy water by filtration or the like, a filtrate (a measurement sample that may contain living cells of the organism having a cell wall) is used as a liquid measurement sample. It can be used to measure the number of living cells of an organism having a cell wall. When the liquid is an aqueous solvent, as described above, the aqueous solvent may contain coexisting components other than water, so that the living cells of an organism having a cell wall that may be contained in the measurement sample are contained in the aqueous solvent. Can be included as a co-existing component of.
By immersing the analysis target in a liquid (preferably an aqueous solvent), a measurement sample that is a liquid (preferably an aqueous solvent) can also be prepared. Specifically, a measurement sample that is a liquid (preferably an aqueous solvent) can be obtained by migrating an organism having a cell wall from an analysis object into a liquid (preferably an aqueous solvent). As described above, the immersion is an immersion for the purpose of preparing a measurement sample which is a liquid (preferably an aqueous solvent) by transferring to a liquid (preferably an aqueous solvent) of an organism having a cell wall instead of extracting sRNA. It doesn't matter. The immersion conditions in that case are the same as the above conditions.
It is also a preferred embodiment that the liquid (preferably an aqueous solvent) does not contain coexisting components other than living cells of the above-mentioned cell wall-bearing organism. If an organism having a cell wall that may be contained in the measurement sample is in contact with the liquid (preferably an aqueous solvent) for a certain period of time (for example, the time exemplified as the example of the immersion time described above), (measurement). (When the sample actually contains an organism having a cell wall) sRNA leaks from the organism (from live cells or dead cells), and a liquid measurement sample containing the same sRNA as in the case of the above immersion is obtained. The embodiment using a measurement sample that is a liquid (preferably an aqueous solvent) can be used, for example, for measuring the number of living cells of an organism having a cell wall in water (for example, tap water, sewage, etc.) as an analysis target. ..
As long as the living cells of the organism having the cell wall are in contact with the liquid (preferably an aqueous solvent), the operation is described above and the measurement sample is immersed in a liquid (preferably an aqueous solvent) to prepare a liquid measurement sample. It is included in the process or preparing a measurement sample which is a liquid (preferably an aqueous solvent) as a liquid measurement sample. When the measurement sample is immersed in a liquid (preferably an aqueous solvent) to prepare a liquid measurement sample, the operation is performed while the liquid (preferably an aqueous solvent) in which the measurement sample is immersed is allowed to stand or stirred. It may be an operation of artificially aging for the extraction of sRNA. When the measurement sample is a liquid measurement sample, it may be artificially aged for extraction of sRNA while standing still or stirring or the like.

<Liquid measurement sample>
The liquid measurement sample in the measurement method according to the present disclosure is a sample used for measuring the number of living cells of an organism having a cell wall to be measured. The liquid measurement sample is not particularly limited as long as sRNA can leak from the living cells of the organism.

In the measurement method according to the present disclosure, as described above, the liquid measurement sample can be prepared, for example, by immersing a measurement sample that may contain living cells of an organism having a cell wall in a solvent (preferably an aqueous solvent). Further, in the measurement method according to the present disclosure, the liquid measurement sample may be the liquid itself which may contain living cells of an organism having a cell wall.

As described above, the liquid measurement sample is preferably an aqueous solvent from the viewpoint of extracting sRNA.

<Liquid evaluation sample>
The liquid evaluation sample in the evaluation method according to the present disclosure is a sample used for evaluating the resistance of an organism having a cell wall to be evaluated to a test substance. The liquid evaluation sample is not particularly limited as long as it is prepared to contain living cells of an organism having a cell wall exposed to a treatment in contact with a test substance, and can be prepared in the same manner as the above-mentioned liquid measurement sample. Is.

Leakage of sRNA into an aqueous solvent from cells having a cell wall as described in the "immersion" section, "liquid measurement sample" section, "liquid measurement sample", and "liquid evaluation sample" section above. Surprisingly, it is not a phenomenon that occurs in general with nucleic acids, but a phenomenon that occurs particularly in sRNA. Therefore, for example, even if a cell having a cell wall is immersed in an aqueous solvent in an attempt to leak 16S rRNA, which has been conventionally used for discriminating organisms, into the aqueous solvent, the 16S rRNA can be obtained from the cell having the cell wall. It does not leak at all, or if it does, it leaks only in low amounts that are insufficient for use in detecting species. It is considered that this difference is partly due to the difference in length between 16S rRNA (about 1600 bases) and sRNA. That is, sRNA, which has a shorter chain length than mRNA and 16S rRNA, surprisingly leaks into an aqueous solvent outside the cell having a cell wall without destroying the cell membrane. On the other hand, larger molecules such as mRNA and 16S rRNA do not show such leakage substantially and cannot be taken out of the cell having a cell wall without an extraction operation accompanied by degeneration of the cell membrane.

<SRNA>
The sRNA in the measurement method according to the present disclosure and the evaluation method according to the present disclosure is also referred to as small RNA, and means a short RNA contained in a cell. The specific chain length of the sRNA is preferably 5 to 500 bases, more preferably 8 to 500 bases, even more preferably 10 to 200 bases, and 12 to 100 bases. It is more preferably present, and particularly preferably 15 to 30 bases.
In addition, among sRNA, there is also microRNA which is RNA of about 20 to 30 bases contained in eukaryotic cells. Further, even in prokaryotes, a particularly short sRNA having the same degree may be referred to as microRNA-size small RNA.

In the measurement method according to the present disclosure and the evaluation method according to the present disclosure, from the viewpoint of measuring the abundance of sRNA actively released extracellularly by living cells of an organism having a cell wall, the cells are encapsulated in the organism having a cell wall. It is preferable to measure the abundance of sRNA actively released to the outside of the cell among the sRNAs.

Research is underway on sRNA present in organisms with cell walls, and the sequence information of sRNA found in each organism is Rfam (EMBL EBI), Small RNA Database (MD Anderson Cancer Center), miRBase (Griffiths- In addition to being stored in databases such as the Jones lab at the Faculty of Biology, Medicine and Health, University of Manchester) and the National Center for Biotechnology Information (NCBI), various reports have been made in academic papers. Therefore, information on sRNA contained in various organisms can be obtained by a known method such as database search (see Kyorin Medical Association Journal Vol. 41, No. 1, pp. 13-18, April 2010). For example, using Nucleotide BLAST (https://blast.ncbi.nlm.nih.gov/Blast.cgi) for the nucleic acid sequences contained in the National Center for Biotechnology Information (NCBI) database and the nucleic acid sequences to be searched. Can be compared and searched for the same sequence (including information on the organism from which the same sequence is derived).

sRNA is differentially expressed depending on the type of organism. For example, by referring to a sequence database such as Rfam, Small RNA Database, miRBase, National Center for Biotechnology Information (NCBI) database, it is possible to search which one or more organisms express a specific sRNA. In addition, it is possible to search which one or more kinds of sRNA are expressed in a specific organism. In the measurement method according to the present disclosure, it is preferable that one or more kinds of sRNA show a specific expression state in a specific organism of interest. By doing so, the number of living cells of an organism can be measured more accurately from the abundance of sRNA.

Here, the "specific expression state" does not have to be an sRNA that is expressed only in the organism having the specific cell wall or not expressed only in the organism having the specific cell wall, and has the specific cell wall. Only in organisms with a specific cell wall, such as sRNA, which is expressed only in a group of organisms with a specific cell wall, including organisms, or not only in a group of organisms with a specific cell wall, including organisms with the specific cell wall. Means a concept that also includes sRNAs that are not completely specific to.
Also in the evaluation method according to the present disclosure, it is preferable that one or more kinds of sRNAs for which the abundance is to be measured show a specific expression state depending on the organism having a cell wall. By doing so, the test substance can be evaluated more accurately from the abundance of sRNA.

As described above, in the measurement method according to the present disclosure and the evaluation method according to the present disclosure, strong alkali treatment, guanidine treatment, phenol, monovalent or divalent linear, branched chain or alicyclic C2-C8 alcohol. The sRNA can be leaked to an aqueous solvent outside the cell having a cell wall without denaturing the cell membrane with an ionic surfactant other than the above. Therefore, the use of a denaturant is not required, the treatment time with the denaturant is not required, and the aqueous solvent leaking the sRNA can be used as it is for the subsequent treatment (for example, nucleic acid amplification treatment for sRNA measurement). Can be served.

<Abundance of sRNA>
In the measurement method according to the present disclosure and the evaluation method according to the present disclosure, the "abundance amount" may mean that the abundance amount is 0, that is, it does not have to exist. Here, the abundance amount is not limited to the absolute abundance amount, and may be a relative abundance amount with respect to a comparison target such as a negative control or a positive control.

<Measurement of abundance of sRNA>
The measuring method according to the present disclosure and the method for measuring the abundance of sRNA in the evaluation method according to the present disclosure are not particularly limited. Methods for measuring the abundance of sRNA include hybridization with a labeled nucleic acid probe (including Northern blotting) and nucleic acid amplification. Nucleic acid amplification may be any method for amplifying DNA or RNA, and examples thereof include PCR (Primerase Chain Reaction) method, RT-PCR (Reverse Translation-PCR) method, LCR (Ligase Chain Reaction) method, and SDA (Strand). Displacement Amplification) method, NASBA (Nucleic Acid Sequence-based Amplification) method, TRC (Transcription Reverse-transcription Concerted Reaction) method, LAMP (Loop-mediated Isothermal Amplification) method, RT-LAMP (Reverse Transcription-LAMP) method, ICAN ( Isothermal and Chimeric Primer-initiated Amplification of Nucleic Acids) method, RCA (Rolling Cycle Amplification) method, Smart Amp (Smart Amplification process) method, TMA (Transcription-mediated Amplification) method, TAS (transcription Amplification System) method, 3SR (Self -Each amplification method such as the sustainable Sequence Synchronization System) method can be mentioned. In the case of a method in which RNA cannot be directly amplified, sRNA may be reverse transcribed with reverse transcriptase to convert it into DNA, and then nucleic acid amplification may be performed. In certain embodiments, the abundance of one or more sRNAs is measured by isothermal gene amplification or PCR.

The nucleic acid amplification used for measuring the abundance of sRNA is preferably the LAMP method or the RCA method, which is an isothermal gene amplification method. Examples of the RCA method include a SATIC (termed signal amplifier by ternary initiation complexes) method. Isothermal gene amplification is preferable in that it is not necessary to prepare a device for amplification (a device that changes the temperature according to a temperature cycle). Since isothermal gene amplification can be performed even at a temperature within the temperature range of, for example, 10 ° C to 40 ° C, it can be performed at room temperature. From the viewpoint of nucleic acid amplification using sRNA actively released outside the cell as a template by living cells of an organism having a cell wall, nucleic acid amplification is preferable at room temperature without damaging the cell membrane or cell wall. By amplifying nucleic acid using sRNA actively released outside the cell as a template by living cells of an organism having a cell wall, the number of living cells of an organism having a cell wall can be accurately measured. In the present disclosure, the room temperature may be a temperature within the range of 20 ° C. to 40 ° C., unless otherwise specified in Examples and the like.
Further, the above-mentioned PCR may be qPCR (quantitative PCR), and qPCR may be real-time PCR. Examples of the real-time PCR include a method using Taqman (registered trademark) miRNA assay (manufactured by Thermo Scientific). By using qPCR, it becomes easy to perform a quantitative analysis on the abundance of sRNA.

Reagents such as probes or primers used for sRNA measurement (hereinafter also referred to as sRNA measurement reagents) may be added to the liquid measurement sample or liquid evaluation sample after the completion of immersion, or may be added to the aqueous solvent before immersion in advance. It may be included. When the reagent for sRNA measurement is previously contained in the aqueous solvent before immersion, it is preferable in that the addition operation after the completion of immersion becomes unnecessary.

In the measurement method according to the present disclosure, when a measurement sample that is a liquid (preferably an aqueous solvent) is used as a liquid measurement sample, a reagent for sRNA measurement may be added to the liquid measurement sample, or a liquid (preferably aqueous solution) may be added. If there is a process of preparing a measurement sample which is a solvent), a reagent for sRNA measurement may be added in the preparation process to prepare a liquid measurement sample.

In the evaluation method according to the present disclosure, when the liquid evaluation sample is a liquid (preferably an aqueous solvent), sRNA is added to the liquid evaluation sample containing an organism having a cell wall exposed to a treatment in contact with the test substance in the aqueous solvent. A measurement reagent may be added, or if there is a process for preparing the liquid evaluation sample, an sRNA measurement reagent may be added in the preparation process to obtain a liquid evaluation sample.

Amplified nucleic acid can be used for existing amplified nucleic acid detection, for example, by attaching a fluorescent dye to a primer, visually checking the precipitate, using a nucleic acid-staining dye, hybridizing with a fluorescent probe, or subjecting to nucleic acid chromatography. It can be detected by using the method. The fluorescent probe may be arranged on a microarray. By using a microarray, the existence information of a plurality of types of sRNA can be obtained at one time.
For example, by using a Taqman (registered trademark) probe, SYBR Green dye, etc., the amount of nucleic acid amplification can be measured by a fluorescent signal, and the abundance of sRNA can be known based on that information, and this method is particularly effective in qPCR. Is.

As described above, nucleic acid amplification is not essential in the measurement of sRNA, and direct measurement may be performed by hybridization of the fluorescent probe and sRNA without nucleic acid amplification.
In the above-mentioned measurement operation such as nucleic acid amplification or hybridization with a probe, the full length of the sRNA may be amplified and / or a probe that hybridizes with the full length of the sRNA may be used. However, it is not essential to amplify the overall length of the sRNA and / or use a probe that hybridizes to the overall length of the sRNA. Nucleic acid amplification or hybridization may be performed on a part of the region of the sRNA, for example, about 10 to 30 bases in the 3'end side region of the sRNA.

The measurement of the abundance of sRNA may be performed in parallel with the extraction of sRNA from the cell having a cell wall.
For example, in the measurement method according to the present disclosure, a measurement sample that may contain living cells of an organism having a cell wall is directly immersed or added in a reaction solution of an isothermal gene amplification method such as the PCR method or the SATIC method. , The leakage of sRNA and the measurement of the abundance of sRNA may be performed at the same time. In the case of the isothermal gene amplification method, since there is no temperature cycle, nucleic acid amplification can be started at any time as long as the reagents required for nucleic acid amplification are available in the liquid measurement sample.
In the evaluation method according to the present disclosure, the leakage of sRNA and the measurement of the abundance of sRNA may be performed at the same time.

<Antibacterial treatment>
In the measuring method according to the present disclosure, it is preferable that the organism having the cell wall is an organism treated by an antibiotic treatment. Antibiotic treatment is any treatment that can result in the death of at least some cells and is, for example, at least one selected from the group consisting of antibiotic treatment, natural neglect treatment, and heat treatment. It is a process.

Examples of antibiotic treatment include ampicillin treatment, kanamycin treatment, chloramphenicol treatment, methicillin treatment and the like. Examples of treatment conditions for antibiotic treatment include conditions for treatment with an antibiotic at a concentration of 1 μg / ml to 100 mg / ml at 0 ° C to 40 ° C for 1 minute to 10 hours.
As an example of the condition for natural leaving treatment, a single organism having a cell wall, a suspension containing an organism having a cell wall, or a culture solution itself of an organism having a cell wall is used at 0 ° C to 40 ° C for 1 day to 3 months. The conditions for standing still are mentioned.
Examples of the conditions for heat treatment include conditions for heating at 70 ° C. to 100 ° C. for 1 minute to 1 hour.

The organism having the cell wall has (i) been treated with antibiotics prior to the preparation of the liquid measurement sample, and is no longer treated with antibiotics in the liquid measurement sample for which the abundance of sRNA is to be measured. May, or (ii) have been treated with antibiotics after preparation of the sample, but no longer have to be treated with antibiotics at the time of sRNA measurement, or (iii) liquid measurement at the time of measurement of sRNA. The sample may also be treated with antibiotics.
Depending on the type of antibiotic treatment, it may be preferable to perform the above-mentioned washing treatment after the antibiotic treatment. The washing treatment removes a large amount of sRNA released from the dead cells by the shock of the antibiotic treatment, and the sRNA released by the living cells gently and actively (that is, the sRNA that is not the sRNA released by the shock state) is released. It may be possible to detect more accurately.

<Determining the number of living cells of an organism having the cell wall in a liquid measurement sample>
In the measuring method according to the present disclosure, the number of living cells of an organism having the cell wall in the liquid measurement sample is determined based on the measured abundance of sRNA.
The abundance of sRNA correlates with the number of living cells in organisms with cell walls. More specifically, depending on the treatment method of the organism having a cell wall, the larger the abundance of sRNA measured, the larger the number of living cells of the organism having a cell wall, and the larger the abundance of measured sRNA. The number of living cells in an organism having a cell wall may be small.
In the measuring method according to the present disclosure, the details of the method for determining the number of living cells of the organism having the cell wall in the liquid measurement sample based on the measured abundance of sRNA are not particularly limited. For example, by referring to the measured abundance of sRNA and the data showing the correlation between the abundance of sRNA prepared in advance and the number of living cells of the organism having a cell wall, the living cells of the organism in the liquid measurement sample can be referred to. You can find the number. That is, to determine the number of living cells of the organism having the cell wall, refer to the data showing the correlation between the abundance of sRNA prepared in advance and the number of living cells of the organism having the cell wall, and refer to the abundance of the sRNA. May include converting to the viable cell number of the organism having the cell wall.

The data showing the correlation between the abundance of the sRNA and the number of living cells of the organism having the cell wall is the number of living cells of the organism having the corresponding cell wall for each value representing the abundance of the sRNA. It is the data about the correlation to represent. The data shows that when the organism having the cell wall is an organism treated by the antibiotic treatment, the sRNA in the calibration liquid sample obtained by subjecting the organism having the cell wall to the antibiotic treatment is obtained. It can be obtained by measuring the abundance and the number of living cells in advance, but the method for obtaining the correlation (the data) is not limited to this. When the number of living cells is measured in advance, it can be measured by using, for example, a culture method. From the viewpoint of rapidly obtaining the number of living cells from the abundance of sRNA, it is preferable to prepare the data in advance.

The data showing the correlation between the abundance of sRNA and the number of living cells of the organism having a cell wall can be obtained by comprehensively measuring the value of the number of living cells of the organism having a cell wall with respect to the value of the abundance of all sRNA. It is not always necessary, and by actually measuring the values at a plurality of representative points, data representing the correlation, for example, a formula representing a calibration curve such as an approximate curve or an approximate straight line may be obtained. By substituting the value of the abundance of one or more kinds of sRNA in the liquid measurement sample into the mathematical formula representing the obtained calibration curve, the number of living cells of the organism in the liquid measurement sample can be obtained. ..

It should be noted that the correlation between the value measured by the culture method or the like for the number of living cells of the organism in the liquid measurement sample and the abundance of the sRNA (for example, the abundance of sRNA and the number of living cells of the organism having a cell wall). If the number of living cells obtained (referring to the data shown) is different, for example, in the range of 1/10 to 10 times, it is practically acceptable. For example, when considering an application such as rapid determination of various bacteria in a food factory, it is more important to quickly obtain a rough value of how many bacteria are present than an accurate value of the number of bacteria.

The data showing the correlation between the abundance of the sRNA and the number of living cells of the organism having a cell wall may be stored in the apparatus as, for example, a program or data, and one or more kinds in the liquid measurement sample. When the value of the abundance of sRNA in the above is input to the apparatus or the like, the number of living cells of the organism in the liquid measurement sample may be output.

(Data showing the correlation between the abundance of sRNA and the number of living cells of organisms with cell walls)
-Method of measuring the abundance of sRNA in data showing correlation-
When the cell-walled organism contained in the liquid measurement sample is an organism that has undergone antibiotic treatment, it is used for calibration to create data showing the correlation between the abundance of sRNA and the number of living cells of the cell-walled organism. Organisms with a cell wall contained in a liquid sample (the same type of organism as an organism having a cell wall contained in a liquid measurement sample) are basically subjected to the same antibiotic treatment. Here, "same antibiotic treatment" refers to treatment with the same drug in the case of treatment with a drug, and the same type of treatment in the case of environmental conditions such as temperature (heating for heating, cooling for cooling: cooling: However, it is preferable that the temperature is the same), and the drug concentration and the treatment time may be changed. For example, if the drugs are the same, the types of action on the organism are the same, and the drug concentration and treatment time are factors that mainly affect the strength of the action. Therefore, in the process of preparing data showing the correlation between the abundance of sRNA and the number of living cells of an organism having a cell wall, the factors related to these intensities are varied, and the strength of antibiotic treatment is stepwise. It is possible to obtain a calibration liquid sample containing an organism having a certain cell wall. At this time, by measuring the number of living cells of the organism having a cell wall and the abundance of sRNA in the calibration liquid sample, the correlation between the abundance of sRNA and the number of living cells of the organism having a cell wall can be determined. The data to be shown can be prepared.

-Method of measuring the number of living cells of organisms with cell walls in the data showing correlation-
In the data showing the correlation between the abundance of sRNA and the number of living cells of the organism having a cell wall, the method for measuring the number of living cells of the organism having a cell wall is not particularly limited as long as the number of living cells of the organism can be measured. , Cultivation method such as pour culture, plate smear method, membrane filter method, or fluorescent staining method. The method for measuring the number of living cells of the organism having a cell wall is preferably a culture method from the viewpoint of high accuracy.

The organism having the cell wall is an organism that has been treated with an antibiotic, and the number of living cells of the organism having the cell wall is determined by the abundance of sRNA prepared in advance and the living cells of the organism having the cell wall. With reference to data showing correlation with numbers, the data comprises converting the abundance of the sRNA into the number of viable cells of the cell wall-bearing organism, the data being the anti-antibacterial against the cell wall-bearing organism. It is preferable that the data is obtained by measuring the abundance of sRNA and the number of living cells in the calibration liquid sample obtained by biological treatment.

(Type of sRNA to be measured)
The organism in which sRNA is expressed can be known, for example, as follows. Using the nucleic acid sequence of the sRNA as a reference sequence, a nucleic acid sequence similar to the reference sequence can be obtained from the National Center for Biotechnology Information (NCBI) database at Nucleotide BLAST (https://blast.ncbi.nlm.nih.gov/Blast.cgi). ) To compare. From the obtained comparison results, the organism containing the sRNA whose nucleic acid sequence is 100% consistent with the sRNA used as the reference sequence is the organism expressing the sRNA.

Before measuring the abundance of sRNA, the type of sRNA extracted extracellularly is not clear, but if a specific sRNA is measured extracellularly, it is known to have that specific sRNA. It can be determined that there are living organisms.

As one or more kinds of sRNA for measuring the abundance in the measurement method according to the present disclosure, an sRNA is selected so that a specific organism of interest can be better discriminated from other organisms based on its expression profile. Is preferable.

However, limiting the number of organisms having a cell wall for measuring the number of living cells to one type is not essential in the measurement method according to the present disclosure, and a candidate group consisting of a plurality of types of organisms may be measured. Therefore, the measuring method according to the present disclosure may measure the number of living cells of a plurality of types of organisms, and in that case, the measuring method individually measures the number of living cells of each of the plurality of types of organisms. It is not a thing, but a measure of the total number of living cells of multiple species of organisms. That is, even if the measurement method cannot measure the actual number of living cells of any of the plurality of organisms, at least one of the plurality of organisms constituting the candidate group (group). It suffices to be able to measure the number of viable cells. Such measurements are easily possible among multiple species of organisms with similar data showing the correlation between the abundance of sRNA and the number of viable cells of the organism having a cell wall.

That is, in the measuring method according to the present disclosure, obtaining the number of living cells of an organism may include obtaining the total number of living cells of two or more kinds of organisms. When the measurement method according to the present disclosure includes measuring the total viable cell number of two or more kinds of organisms, measuring the total viable cell number of two or more kinds of organisms is to measure the total viable cell number of two or more kinds of organisms. It may include measuring the viable cell count of at least one of two or more organisms in the absence of any of the above.

In this case, the viable cell number of one of the two or more organisms of interest cannot be completely measured, but the possibility of existence of one of the organisms of interest is confirmed. It is possible, and further tests may be performed based on the measurement results, or work such as cleaning of the analysis target obtained from the measurement sample may be performed based on the measurement results. That is, measuring the total number of viable cells of two or more organisms may include confirming the possibility of the existence of a specific organism contained in the two or more organisms, and further said. It may include measuring the viable cell count of a particular organism.

By measuring the abundance of one or more kinds of sRNA, it is possible to measure the number of viable cells of the organism having one or more kinds of cell walls as described above. This is because the abundance of sRNA in the liquid measurement sample is considered to reflect the number of living cells of the organism expressing the sRNA. The abundance of sRNA can be detected by a method generally used in the art, for example, during nucleic acid amplification from sRNA, which measures the amount of fluorescence emitted from a fluorescently labeled probe that hybridizes to sRNA. It can be measured by a method such as measuring the amount of fluorescence emitted from the primer using a fluorescently labeled primer or using qPCR (for example, obtaining the Ct value in real-time PCR).

An example of measuring the number of living cells of an organism based on the abundance of one or more kinds of sRNA in a liquid measurement sample in the measuring method according to the present disclosure will be described. The sRNA EC-5p-36 (see SEQ ID NO: 1; 5'-UGUGGGCACUCGAAGAUACGGAU-3', Curr Microbiol. 2013 Nov; 67 (5): 609-13) is a bacterium belonging to the genus Escherichia, according to the Nucleotide BLAST search. It is commonly expressed in Shigella spp., Salmonella spp., And Citrobacter spp. From this, the abundance of EC-5p-36 can be measured for measuring the viable cell number of Escherichia bacterium, Shigella bacterium, Salmonella bacterium, or Citrobacter bacterium in the liquid measurement sample. In addition, EC-3p-40, which is an sRNA, is commonly expressed in Klebsilla bacterium in addition to Shigella bacterium, Salmonella bacterium, Escherichia bacterium, and Citrobacter bacterium according to the Nuclearide BLAST search. Therefore, EC-3p-40 (SEQ ID NO: 2; 5'-GUUGUGAGUGUAAGCGAGU-3') for measuring the viable cell counts of Escherichia bacterium, Shigella bacterium, Salmonella bacterium, Citrobacter bacterium, and Klebsilla bacterium. The abundance of can be measured.

In addition, the number of living cells of an organism may be measured based on the abundance of sRNA having a specific function. For example, 24B_1 (SEQ ID NO: 3; 5'-UAACGUUAAGUGACUCUGGG-3', Scientific Reports volume 5, Article number, which is an sRNA involved in toxins (verotoxin, also called ciguatoxin) of enterohemorrhagic Escherichia coli (O-157, etc.). 10080 (see 2015)) is commonly expressed in verotoxin (ciguatoxin) -producing bacteria according to the Nucleotide blast search. Therefore, the abundance of 24B_1 can be measured for measuring the number of viable cells of verotoxin-carrying bacteria in the liquid measurement sample.

Further, in the measurement method according to the present disclosure, the total viable cell number of Escherichia bacterium, Shigella bacterium, Salmonella bacterium, and Citrobacter bacterium (whether none of them is present or one or more species is present, etc.) is determined. If you want to measure it, you can measure the abundance of EC-5p-36.

In addition, the sRNAs EC-5p-79 (SEQ ID NO: 11; 5'-UUUGCUCUUUAAAAAUC-3') and EC-3p-393 (SEQ ID NO: 12; 5'-CUCGAAGAUACGGAUCUUAAC-3') are Escherichia coli, Citrobacter. And Salmonella gallinarum. From the above, as the correspondence between sRNA and the species, at least one selected from the group consisting of EC-5p-36, EC-3p-40, EC-5p-79, and EC-3p-393, and at least one species. Combination with at least one selected from the group consisting of Escherichia coli, Citrobacter freundii, and Salmonella gallinarum, combination of fox_milRNA_5 having the nucleotide sequence represented by SEQ ID NO: 10, and Fusarium oxisporum, represented by SEQ ID NO: 4. Examples thereof include a combination of miR156 having a sequence and black pine, and a combination of miR716b having a nucleotide sequence represented by SEQ ID NO: 5 and Citrobacter cerevisiae.

In addition, the sRNAs listed in Tables 1 and 2 below have been found to be expressed in Enterobacteriaceae bacteria, such as Escherichia coli. In particular, sRNA20 to sRNA39 are sequences of tRNA. One or more sRNAs in the measurement method according to the present disclosure and the evaluation method according to the present disclosure may be selected from these sRNAs. In other words, in the measurement method according to the present disclosure and the evaluation method according to the present disclosure, the abundance of sRNA selected from these sRNAs may be measured.

In addition, for sRNA16, 17, 20-22, 24-26, 28-31, 33, and 34, the organisms whose expression has been confirmed are classified into Table 3 below and the species names for the genus Candida. It is shown in Table 4. “Yes” in Tables 3 and 4 indicates that sRNA is expressed in the organism.

The sRNA selected from the sRNAs shown in Tables 1 and 2 can also be the subject of abundance measurement in the measurement method according to the present disclosure and the evaluation method according to the present disclosure. The sRNA to be abundantly measured in the measurement method according to the present disclosure and the evaluation method according to the present disclosure is among the sRNAs represented by SEQ ID NOs: 1 to 5, SEQ ID NOs: 10 to 12, and SEQ ID NOs: 16 to 55. It is preferable to include at least one kind, and more preferably to contain at least one kind of sRNA represented by SEQ ID NOs: 1 to 5, SEQ ID NOs: 10 to 12, SEQ ID NOs: 20 to 22, and SEQ ID NO: 41. It is more preferable to contain at least one of the sRNAs represented by SEQ ID NOs: 1 to 5 and SEQ ID NOs: 10 to 12.

For example, the one or more kinds of sRNA to be measured may contain at least one kind of sRNA represented by SEQ ID NOs: 16 to 55 (that is, at least one kind of sRNA 16 to sRNA 55). ..

Further, for example, the sRNA to be measured is at least one of the sRNA represented by SEQ ID NOs: 16 to 55 (preferably at least one of the sRNA represented by SEQ ID NOs: 20 to 22 and SEQ ID NO: 41). Species) and at least one of the sRNAs represented by SEQ ID NOs: 1 to 5 and SEQ ID NOs: 10 to 12.

The sRNA to be measured consists of EC-5p-36, EC-3p-40, EC-5p-79, EC-3p-393, fox_milRNA_5, miR156, and miR716b used in the test described in Reference Example or Example. It is preferably at least one selected from the group.

Although several examples of sRNA have been mentioned above, the measuring method and the evaluation method according to the present disclosure can be similarly performed even when measuring other sRNAs. The correspondence between sRNA and organisms required for measurement or evaluation can be easily obtained from the above-mentioned database.

<Evaluation of resistance of organisms with cell walls to test substances>
The method for evaluating the resistance of an organism having a cell wall to a test substance according to the present disclosure is one or more kinds in a liquid evaluation sample containing an organism having a cell wall exposed to a treatment in contact with the test substance in an aqueous solvent. Based on the measured abundance of sRNA and the measured abundance of sRNA, the number of viable cells of the organism having the cell wall in the liquid evaluation sample was determined, and the test substance of the organism having the cell wall was obtained. Includes assessing resistance.

In the evaluation method according to the present disclosure, the number of living cells of the organism having the cell wall in the liquid evaluation sample is determined based on the measured abundance of sRNA, and the resistance of the organism having the cell wall to the test substance is evaluated. The details of the specific method are not particularly limited as long as the resistance of the cell-walled organism to the test substance can be evaluated based on the measured abundance of sRNA. For example, as for the method for obtaining the number of living cells, the method for obtaining the number of living cells of the organism having the cell wall in the measurement method according to the present disclosure can be referred to. For example, by referring to the measured abundance of sRNA and the data showing the correlation between the abundance of sRNA prepared in advance and the number of living cells of the organism having a cell wall, the living organism in the liquid evaluation sample is referred to. The number of cells can be calculated.

In the evaluation method according to the present disclosure, the liquid evaluation sample may be prepared by immersing a measurement sample containing an organism having a cell wall in an aqueous solvent, or an aqueous solvent containing an organism having a cell wall. The measurement sample may be prepared as a liquid evaluation sample. In a liquid evaluation sample containing an organism having a cell wall exposed to a treatment in contact with the test substance in an aqueous solvent, the living cells of the organism having the cell wall are exposed to the treatment in contact with the substance to be tested and then in the aqueous solvent. It is preferable to immerse in a liquid evaluation sample to prepare a liquid evaluation sample.

Furthermore, also in the evaluation method according to the present disclosure, a detailed explanation of data showing the correlation between the abundance of the sRNA and the number of living cells of the organism having a cell wall, and measurement of the number of living cells of the organism having a cell wall are given. As the detailed description of the above, the detailed description of the measurement method according to the present disclosure can be diverted. In this case, "antibiotic treatment" can be read as "treatment in contact with the test substance".

In the evaluation method according to the present disclosure, when evaluating the resistance of an organism having a cell wall to a test substance based on the abundance of sRNA, it is not always necessary to determine the number of living cells of the organism having a cell wall. In the evaluation method according to the present disclosure, it is not necessary to evaluate the resistance of an organism having a cell wall to a test substance after determining the number of living cells of an organism having a cell wall from the abundance of sRNA, that is, the abundance of sRNA. The increase or decrease in resistance of an organism having a cell wall to a test substance may be directly evaluated from the increase or decrease in cell wall. This is because the abundance of sRNA correlates with the number of living cells of the organism having a cell wall, and it is not necessary to dare to evaluate the test substance based on the value of the number of living cells of the organism having a cell wall.

In the evaluation method according to the present disclosure, evaluating the resistance of an organism having a cell wall to a test substance means, in other words, an organism having the cell wall when exposed to a treatment in which the test substance and the organism having the cell wall come into contact with each other. However, it is to confirm how much resistance it has to the test substance. The evaluation of the resistance of the organism having a cell wall to the test substance may be a quantitative evaluation or a qualitative evaluation.

<Test substance>
In the evaluation method according to the present disclosure, the test substance includes at least one selected from the group consisting of disinfectants, antibacterial agents, disinfectants, fungicides, disinfectants, antibiotics, and preservatives. That is, the test substance may have an inhibitory effect or a promoting effect on living cells of an organism having a cell wall. Examples of the antibiotic include ampicillin (Amp), kanamycin (Km), chloramphenicol (Cm), methicillin and the like.

<Measurement method according to the present disclosure and evaluation method according to the present disclosure>
According to the measurement method according to the present disclosure and the evaluation method according to the present disclosure, unlike the culture method, it is not necessary to culture the living cells of an organism that may be contained in the measurement sample. Therefore, while it is possible to measure or evaluate in a short time, it is also possible to realize high sensitivity by using nucleic acid amplification or the like. Further, the measurement method according to the present disclosure and the evaluation method according to the present disclosure can be applied to bacteria and the like that are difficult to culture. Further, unlike the culture method, the measurement method according to the present disclosure and the evaluation method according to the present disclosure require a small amount of sample, and the materials used for the treatment can be easily disposed of. In the measurement method according to the present disclosure and the evaluation method according to the present disclosure, while maintaining the advantages of the gene method, the number of living cells of the organism can be measured and the cell wall of the organism has a cell wall by a quicker and simpler operation than the conventional gene method. The resistance to the test substance can be evaluated.

The measuring method according to the present disclosure can be used, for example, for a quick and simple microbiological examination at a site (food manufacturing, medical treatment, welfare, home, etc.) where hygiene management is required. Examples include hygiene management of products by testing for spoilage and spoilage bacteria in the food manufacturing process, prompt identification of the cause in the event of a food poisoning accident, prevention of secondary infection by detecting food poisoning bacteria in beds and waiting rooms of medical facilities, child welfare facilities and the elderly. Prevention of secondary infection of food poisoning bacteria in welfare facilities, prevention of secondary infection by detection of food poisoning bacteria when there are food poisoning patients at home, etc. can be mentioned.
The evaluation method according to the present disclosure is, for example, for quick and simple confirmation of drug-resistant bacteria at sites where hygiene management is required (food manufacturing, medical care, welfare, home, etc.), or research on drug-resistant bacteria. Can be used for. Examples include confirmation of drug-resistant bacteria in a bed or waiting room of a medical facility, evaluation of whether the bacteria collected from an infectious disease patient are mutant bacteria (for example, drug-resistant bacteria), and the like.

The embodiments will be further described with reference to the following examples, but the present disclosure is not limited to the following examples. Further, "%" indicating the content of the components in the composition of the example is based on mass unless otherwise specified. In the following examples and reference examples, "room temperature" was about 30 ° C.

<Method of quantifying sRNA by real-time PCR method>
In Reference Examples 1 to 3, Reference Examples 7 to 9, Examples 1 to 3, and Reference Examples 11 to 26, the sRNA whose abundance was to be measured was quantified by the method described below.
The sRNA in the reaction solutions in each of Reference Examples 1 to 3, Reference Examples 7 to 9, Examples 1 to 3, and Reference Examples 11 to 26 was quantified by a real-time PCR method. Quantitative reagents (Taqman (registered trademark) microRNA Assays, manufactured by Applied Biosystems) and reverse transcriptase (Taqman (registered trademark) microRNA RT kit, manufactured by Applied Biosystems) custom-synthesized according to the sRNA to be quantified. The reverse transcription reaction was carried out according to the manufacturer's instructions to obtain a reverse transcription reaction solution containing the DNA formed by the reverse transcription. In the reverse transcription reaction, specifically, 1 μL of RNA sample, 1.5 μm of 10 × RT buffer, 0.15 μL of dNTP mix, 0.19 μL of RNase inhibitor, and an amount that makes the final concentration 1 × per reaction. The first solution of the custom synthetic Taqman assay (eg, 0.75 μL for 20 × Taqman assay) was used, and 1 μL of Multiscribe RT transcriptase was used to prepare a liquid volume of 15 μL with pure water. The temperature profile of the reverse transcription reaction included a step consisting of (1) 30 minutes at 16 ° C, followed by (2) 30 minutes at 42 ° C, and (3) 5 minutes at 85 ° C.

Next, a real-time PCR reaction was performed using the obtained reverse transcription reaction solution. Quantitative reagents custom-synthesized for the sRNA to be quantified (Taqman®, microRNA Assays, Applied Biosystems, and real-time PCR master mix (TaqMan® Universal PCR Master Mix II with UNG, A reaction solution was prepared according to the manufacturer's instructions using Applied Biosystems). Specifically, 2 μL of reverse transcription reaction solution, 10 μL of Universal PCR Master Mix II with UNG, and an amount that makes the final concentration 1 ×. A second solution of custom synthetic Taqman assay (eg, 1 μL for 20 × Taqman assay) was used to prepare a reaction solution with pure water so that the volume was 20 μL. The prepared reaction solution was StepOnePlus. Using a real-time PCR system (manufactured by Applied Biosystems), perform real-time PCR with a temperature profile that includes 40 cycles of 15 seconds at 95 ° C and 1 minute at 60 ° C after a 10-minute step at 95 ° C. At that time, using StepOnePlus (registered trademark) real-time PCR system (manufactured by Applied Biosystems), automatic calculation of StepOnePlus software under the conditions of reagents = "Taqman reagents" and ramp speed = "Standard" (the above settings). The Ct value was calculated by (default setting except for). When quantifying by comparing with the standard, the sRNA sequence to be quantified was synthesized (RNA primer synthesis by Eurofin Genomics, HPLC purification grade), ^and 10- A dilution series was prepared in the range of ¹⁰ M to ^10-15 M, and real-time PCR was performed on the dilution series in parallel with the measurement of the sample, and the amount of sRNA was quantified by comparing the Ct values.

(Reference Example 1) Simple extraction of sRNA (EC-5p-36) contained in Escherichia coli Targeting EC-5p-36, which is a type of sRNA contained in Escherichia coli W3110 (hereinafter, simply referred to as "E. coli W3110"). As a result, a simple extraction from Escherichia coli W3110 was attempted.
Colonies of E. coli W3110 were suspended in 100 μL of pure water to obtain a 90% by mass E. coli W3110 cell suspension. Based on this 90% by mass Escherichia coli W3110 cell suspension, the following three types of samples were prepared.

Sample 1) An RNase inhibitor (manufactured by Toyobo Co., Ltd.) was added to a 90 mass% Escherichia coli W3110 cell suspension to a final concentration of 0.4 U / μL to prepare 10 μL of a reaction solution. The reaction solution was allowed to stand at room temperature for 4 hours to prepare Sample 1.
Sample 2) The 90 mass% E. coli W3110 cell suspension was immediately purified with a miRNeasy kit (a cytolytic reagent containing phenol and causing cell membrane degeneration; manufactured by QIAGEN), and all sRNA was extracted to obtain Sample 2. ..

Further, as a comparison target, 10 μL of pure water was used as it was as sample 0.

EC-5p-36 was quantified for Samples 0 to 2 by the real-time PCR method. Each of the sRNA amounts in Samples 0 to 2 obtained by quantification was divided by the sRNA amount in Sample 2, and the obtained value was taken as the relative extraction rate (Table 5).

As can be seen from the results shown in Table 5, it was found that sRNA can be easily extracted from the cells and measured. The sRNA could be extracted with pure water alone.

(Reference Example 2) Simple extraction of sRNA (miR156) contained in black pine pollen miR156 (SEQ ID NO: 4; 5'-CAGAAGAUAGAGAGCACAUC-3'; http: //www.mirbase.org), which is a type of sRNA contained in black pine pollen. /; See pta-miR156a), we attempted a simple extraction from Japanese black pine pollen.
10 mg of Japanese black pine pollen (manufactured by Biosuta) was suspended in 1 mL of pure water and allowed to stand at room temperature for 1 hour. Then, the quantification of miR156 was attempted by the real-time PCR method. Using RNase-free water as a negative control and water containing 1 nM synthetic miR156 (SEQ ID NO: 4; manufactured by Eurofins Genomics) as a positive control, it was compared whether sRNA (miR156) could be detected. As a result, it was confirmed that sRNA can be extracted from Japanese black pine pollen just by suspending it in pure water.

(Reference Example 3) Simple extraction of sRNA (miR716b) contained in yeast miR716b (SEQ ID NO: 5; 5'-GAGAUCUGGUGGUAGCAAAUA-3'; S . Rep., 2015, 5, 7763), we attempted a simple extraction of sRNA from baker's yeast.
The baker's yeast was cultured on an LB plate, 10 mg of baker's yeast was scraped off, suspended in 1 mL of pure water, and allowed to stand at room temperature for 1 hour. After standing, an attempt was made to extract miR716b by the real-time PCR method. Using RNase-free water as a negative control and 1 nM synthetic miR716b (SEQ ID NO: 5; manufactured by Eurofins Genomics) as a positive control, it was compared whether sRNA could be detected. As a result, it was confirmed that sRNA derived from baker's yeast could be extracted only by suspending in pure water, and it was also confirmed that the amount of extracted sRNA could be quantitatively detected.

(Reference Example 4) Detection of Escherichia coli-derived sRNA (EC-5p-36) by isothermal gene amplification method E. coli, which is a type of sRNA contained in Escherichia coli, was targeted at E. coli. An attempt was made to detect sRNA simply extracted from coli with an aqueous solvent by an isothermal gene amplification method (SATIC method; Anal Chem. 2016 Jul 19; 88 (14): 7137-44)).

<Synthesis of cyclized T1B-EC-5p-36>
First, a primer, which is a synthetic single-stranded DNA having the following nucleotide sequence, was ordered from Eurofin genomics and obtained.
Primer sequence (SEQ ID NO: 6): 5'-CCCCAAAAATCCGTATCTTCGAGTGCCACAAAAAAAGAAGCTGTTGTTGTTGTCGAAGAAGAAAAGT-3'(5'phosphorylation, HPLC purification)

Next, the above synthetic single-stranded DNA was cyclized according to the manual using a CircLigase II ssDNA Ligation kit (manufactured by Lucien). That is, in a PCR tube, 15 μL of RNase-free water (manufactured by Qiagen), 1 μL of the above synthetic single-stranded DNA of 10 pmol / μL, 2 μL of CircLigase II 10 × Reaction Buffer, 1 μL of 50 mM MnCl ₂ , and CircLigase II ssDNALig. Was added in an amount of 1 μL. After mixing, the PCR tube was treated on a thermal cycler at 60 ° C. for 1 hour and at 80 ° C. for 10 minutes to obtain 500 nM circularized DNA (hereinafter referred to as “circulated T1B-EC-5p-36”). .. This was diluted 5-fold with RNase-free water to give 100 nM cyclized T1B-EC-5p-36.

<Synthesis of cyclized T2>
First, a primer, which is a synthetic single-stranded DNA having the following nucleotide sequence, was ordered from Eurofin genomics and obtained.
Primer sequence (SEQ ID NO: 7): 5'-CCCAACCTACCCACCCTCAAAGAAAAAAAAGTGATAATTGTTGTCGAAGAAGAAAAAAAATT-3'(5'phosphorylation, HPLC purification)

Next, a circularized T1B- was used except that the primer (T2) of SEQ ID NO: 7 was used instead of the primer of SEQ ID NO: 6 (T1B-EC-5p-36) using the CircLigase II ssDNA Ligation kit (manufactured by Lucien). The same operation as in the synthesis of EC-5p-36 was carried out to obtain 500 nM cyclized DNA (hereinafter referred to as "cyclized T2"). This was diluted 1.25-fold with RNase-free water to give 400 nM cyclized T2.

<Synthesis of primer P2>
Primers with the following nucleotide sequences were ordered from Eurofin genomics to obtain synthetic primers.
Primer sequence (SEQ ID NO: 8): 5'-GAAGCTGTTGTTACTACT-3'(unmodified, HPLC purified)

The primer was diluted with RNase-free water to prepare 480 nM primer P2.

<E. Detection of sRNA derived from coli by isothermal gene amplification method>
By φ29 DNA polymerase (kit manufactured by New England Biolabs), E.I. An attempt was made to detect sRNA derived from colli. That is, 5.8 μL of RNase-free water, 2 μL of 480 μM primer P2, 2 μL of 100 nM cyclized T1B-EC-5p-36, 2 μL of 400 nM cyclized T2, and 10 mM each in a PCR tube per sample. 2 μL of dNTP Mix and 2 μL of 10 × φ29 DNA polymerase reaction buffer, 0.2 μL of kit-attached BSA and 2 μL of φ29 DNA polymerase were mixed to prepare a premix. To this premix, 2 μL of a colony cultured in LB medium of Escherichia coli W3110 suspended in 1 mL of RNase-free water was added to prepare a sample. Further, 2 μL of 10 nM synthetic EC-5p-36 (SEQ ID NO: 1; manufactured by Eurofins Genomics) was added to the premix as a positive control. Further, 2 μL of RNase-free water was added to the premix as a negative control.

Samples, positive controls, and negative controls were each incubated at 37 ° C. for 16 hours. Subsequently, 2 μL of a 100-fold diluted solution of SYBR Gold Nuclear Acid Gel Stein (manufactured by Invitrogen), which is a reagent whose fluorescence intensity is enhanced by binding to nucleic acid, was added to the solution after incubation and mixed. The reaction solution thus obtained was irradiated with black light (365 nm), and fluorescent color development was observed. As a result, strong yellow-green fluorescence was observed in the sample and the positive control, but only weak yellow fluorescence derived from SYBR Gold Nucleic Acid Gel Stein was observed in the negative control. Therefore, in the sample, it was shown that the sRNA extracted from Escherichia coli W3110 with an aqueous solvent was amplified by isothermal gene amplification, and the amplified product could be detected by fluorescence. A comparison of fluorescence between the negative control and the sample is shown in FIG. In FIG. 1, + represents a sample and − represents a negative control.

(Reference Example 5) Detection of sRNA derived from Japanese black pine pollen by the isothermal gene amplification method E. An attempt was made to detect black pine pollen-derived sRNA by the same operation as the detection method of the coli-derived sRNA by the isothermal gene amplification method.

<Synthesis of cyclized T1B-miR156>
T1B-miR156 was prepared in the same manner as in the preparation of T1B-EC-5p-36 of Reference Example 4. First, a primer, which is a synthetic single-stranded DNA having the following nucleotide sequence, was ordered from Eurofin genomics and obtained.
Primer sequence (SEQ ID NO: 9): 5'-CCCCAAAAAGGAGCGATGTGCTCTTTACTTTCTGAAAAAGAAGCTGTTGTTGTTGTCGAAGAAGAAAAGT-3'(5'phosphorylation, HPLC purification)

A 100 nM circularized DNA (hereinafter referred to as “circulated T1B-miR156”) was obtained in the same manner as in Reference Example 4 except that the primer of SEQ ID NO: 9 was used instead of the primer of SEQ ID NO: 6.

<Synthesis of cyclized T2>
Cyclic T2 was obtained in the same manner as in Reference Example 4.

<Synthesis of primer P2>
Primer P2 was obtained by the same method as in Reference Example 4.

<Detection of Japanese black pine pollen-derived sRNA by isothermal gene amplification method>
In the same manner as in Reference Example 4, an attempt was made to detect sRNA derived from Japanese black pine pollen. That is, the cyclized T1B-miR156 was used instead of the cyclized T1B-EC-5p-36 of Reference Example 4, and the synthetic miR-156 (SEQ ID NO: 4: manufactured by Eurofin Genomics) was used instead of the synthetic EC-5p-36. The same experiment as in Reference Example 4 was carried out except that the aqueous suspension of black pine pollen was used instead of the aqueous suspension of the cultured colony of Escherichia coli W3110. As a result, strong yellow-green fluorescence was observed in the sample (black pine pollen water suspension) and positive control (synthetic miR-156), but in the negative control (RNase-free water), it was derived from SYBR Gold Nucleic Acid Gel Stein. Only weak yellow fluorescence was seen. Therefore, in the sample, it was shown that the sRNA extracted from the black pine pollen with an aqueous solvent was amplified by isothermal gene amplification, and the amplified product could be detected by fluorescence. A comparison of fluorescence between the negative control and the sample is shown in FIG. In FIG. 2, + represents a sample and − represents a negative control.

(Reference Example 6) Extraction of sRNA from Fusarium oxysporum Fusarium oxysporum IFO5942 was cultured on an LB plate for 3 days. Then, 1 mg of the cells was scraped off and suspended in 1 mL of water containing a 1% by mass RNase inhibitor (manufactured by Toyobo Co., Ltd.). Immediately after suspension or after standing at 25 ° C. for 16 hours, the suspension was filtered through a 100K Amicon Ultra 0.5 filter (manufactured by Merck Millipore), and 10 μL of the filtrate was diluted with 90 μL of sterile water. After allowing to stand at 25 ° C. for 16 hours, 10 μL of SYBR Gold Nucleic Acid Gel Stein (manufactured by Thermo Scientific) diluted 1000-fold was added. The fluorescence of the suspension (excitation wavelength: 495 nm, emission wavelength 540 nm) was measured with a fluorescence plate reader (Spectramax 3i, manufactured by Molecular Probes). The fluorescence intensity immediately after suspension was 3.4 × 10 ⁶ RFU, but increased to 4.2 × 10 ⁶ RFU after 2 hours. From this, it was confirmed that sRNA was released from Fusarium by suspending Fusarium in water, and that its quantitative measurement was possible.

(Reference example 7) E. Detection of sRNA derived from coli (EC-5p-36) and sRNA derived from Fusarium oxysporum (fox_milRNA_5) Fusarium oxysporum IFO5942 was cultured on an LB plate at 25 ° C. for 3 days. Next, the cells were scraped off, suspended in 1 mL of pure water, and allowed to stand at room temperature for 1 hour. The Fusarium oxysporum cell suspension after standing was diluted with pure water so that the value of OD600 was 0.01 to obtain an OD0.01 Fusarium cell suspension.

In addition, Escherichia coli W3110 was cultured on an LB plate at 37 ° C. for 1 day. Next, the colonies were scraped off, suspended in 100 μL of pure water, and allowed to stand at room temperature for 1 hour. The E. coli W3110 cell suspension after standing was diluted with pure water so that the value of OD600 was 0.1 to obtain an OD0.1 Escherichia coli W3110 cell suspension.
Using the cell suspension thus obtained, quantification of EC-5p-36 and fox_milRNA_5 was attempted by real-time PCR method. EC-5p-36 sRNA (SEQ ID NO: 1) is an sRNA expressed in Escherichia coli W3110 but not in Fusarium oxysporum IFO5942. On the other hand, fox_milRNA_5 sRNA (see SEQ ID NO: 10; 5'-UCCGGUAUUGGUAGUGGC-3', PLoS One. 2014 Aug 20; 9 (8): e104956.) Is not expressed in E. coli W3110, but is expressed in Fusarium oxysporum IFO42. ..

Real-time PCR was performed on the OD0.01 Fusarium cell suspension and the OD0.1 Escherichia coli W3110 cell suspension using 1 μL of a sample according to the above <method for quantifying sRNA by real-time PCR method>. In each case where the detection target was fox_milRNA_5 and the detection target was EC-5p-36, a Taqman® Assay primer having a nucleotide sequence corresponding to the detection target was used. Table 8 shows the results of Ct values obtained by StepOnePlus® real-time PCR system (manufactured by Applied Biosystems).

From the results in Table 8, it was found that fox_milRNA_5 can be specifically detected from Fusarium, and EC-5p-36 can be specifically detected from Escherichia coli W3110. It was also shown that real-time PCR enables quantitative detection of sRNA.

(Reference Example 8) Examination of temperature conditions during extraction treatment Escherichia coli DH5α was sown on an LB plate and cultured, and the resulting colonies were suspended in 2 mL of LB medium and shake-cultured at 37 ° C. and 180 rpm for 24 hours. went. Then, 40 μL of the culture solution was collected, inoculated into 4 mL of LB medium, and shaken at 37 ° C. and 180 rpm for 4 hours. Then, the culture broth was centrifuged at 3000 G for 5 minutes, the supernatant was removed by suction, and then sterile water was added. At this time, OD600 was measured and adjusted to OD = 0.1 with sterile water to prepare an E. coli suspension.

Three 500 μL samples were prepared from the prepared E. coli suspension and allowed to stand at 5 ° C, 25 ° C, or 37 ° C for 1 hour, respectively. The E. coli suspension was then filtered through a 0.22 μm filter.

Reverse transcription reaction and real-time PCR were performed on EC-5p-36 and 16S rRNA in the filtrate. 1 μL of filtrate is collected as an RNA sample, real-time PCR is performed for EC-5p-36 according to the above <method for quantifying sRNA by real-time PCR method>, and 16S rRNA is described below for <16S rRNA by real-time PCR method>. Real-time PCR was performed according to the quantification method>. The results of Ct values obtained by the real-time PCR method are shown in Table 9. It was found that all 16S rRNAs were extracted only at low concentrations. On the other hand, EC-5p-36 was extracted in an amount sufficient to determine the presence at any temperature of 10 ° C, 25 ° C, and 37 ° C. Further, since the Ct value decreased as the temperature at the time of extraction (immersion) increased, it can be observed that the higher the temperature, the easier the extraction. As described above, it can be seen that EC-5p-36 (base number 23), which has a relatively small number of bases, has a low Ct value and can be stably detected. On the other hand, 16S rRNA having a relatively large number of bases (about 1500 bases) has a high Ct value and is difficult to detect.

The method for quantifying 16S rRNA by the real-time PCR method is described below.
<Method of quantifying 16S rRNA by real-time PCR method>
The 16S rRNA to be determined for the existence state was quantified by the method described below. A 1 μL RNA sample was used and prepared so that the liquid volume was 10 μL. The reverse transcription reaction was performed in 10 μL of the reaction solution, which was composed of 100 nM primer (SEQ ID NO: 13: CCGGGAACGTATTCACC), 0.4% by mass of Moloney Murine Leukemia Virus Reverse Transcriptase (manufactured by Promega), 20% by volume. It was a solution containing 5X Reaction Buffer, 0.4 mM each dNTP, 0.1% by volume of RNase primer (manufactured by Toyo Spinning Co., Ltd.), and 10% by volume of the above extract (RNA sample). The temperature profile of the reverse transcription reaction included a step consisting of (1) 30 minutes at 16 ° C, followed by (2) 20 minutes at 42 ° C, and (3) 5 minutes at 85 ° C.

Next, a real-time PCR reaction was performed using the obtained reverse transcription reaction solution. A 2 μL reverse transcriptase reaction solution was used, and the volume was adjusted to 20 μL. The PCR reaction solution was Primer 1 of 300 nM (SEQ ID NO: 14: AGAGTTTGATCATGGCTCAG), Primer 2 of 300 nM (SEQ ID NO: 15: CCGGGAACGTATTCACC), and 200 μM each of dNTP (CleanAmpTM Hot Start dNTP Mix, Sigma-Al). Note: Pre-filtered and purified with Mercon Ultra 50 K centrifugal primer from Merck Millipore), 50 mM KCl, 2.25 mM MgCl ₂ , 10 mM Tris-HCl (pH 8.3), 1 × EvaGreen (Biotium Inc. CA,). (Obtained from USA), 0.05 units / μL eukalyote-made thermostable DNA polymerase (see J Clin Microbiol. 2011 49 (9) 3316-3320), and 10% by volume of the above reverse transfer reaction solution were used. The temperature profile of this real-time PCR reaction consists of 40 cycles of a denaturation step at 95 ° C. for 10 minutes followed by a cycle consisting of 94 ° C. for 10 seconds, 65 ° C. for 20 seconds, 72 ° C. for 30 seconds, and 85 ° C. for 10 seconds. It was included. Using StepOnePlus (registered trademark) real-time PCR system (manufactured by Applied Biosystems), with the conditions of reagents = "SYBR Green reagents" and ramp speed = "Standard" (other than these, default settings), StepOnePlus software automatically calculates C. The value was calculated.

(Reference Example 9) Detection of bacteria belonging to Enterobacteriaceae Escherichia coli, Citrobacter fluendii, and Salmonella gallinarum, which are bacteria belonging to Enterobacteriaceae, were inoculated on an LB plate and cultured, and 2 mL of the resulting colonies were cultivated. The cells were suspended in LB medium and shake-cultured at 37 ° C. and 180 rpm for 24 hours. Then, 40 μL of the culture solution was collected, inoculated into 4 mL of LB medium, and shaken at 37 ° C. and 180 rpm for 24 hours. Then, the culture broth was centrifuged at 3000 G for 5 minutes, the supernatant was removed by suction, and then sterile water was added. At this time, OD600 was measured and adjusted to OD = 1 with sterile water to prepare a bacterial suspension.

Three 500 μL samples were prepared from the prepared bacterial suspension and allowed to stand at 5 ° C, 25 ° C, or 37 ° C for 1 hour, respectively. Then, the bacterial suspension was filtered through a 0.22 μm filter.

Reverse transcription reaction and real-time PCR were performed on sRNA (EC-5p-36, EC-3p-40 and EC-5p-79) in the filtrate. Using 1 μL of each of the filtrates, real-time PCR was performed according to the above <method for quantifying sRNA by real-time PCR method>. Table 10 shows the results of Ct values obtained by a real-time PCR system (manufactured by Applied Biosystems). In each case, the Ct value was 28 or less, and the presence of Enterobacteriaceae bacteria to be investigated was detected.

(Reference Example 10) Electrophoresis of nucleic acid extract Escherichia coli W3110 was seeded on an LB plate and cultured, and the resulting colonies were suspended in 2 mL of LB medium and shake-cultured at 37 ° C. and 180 rpm for 24 hours. .. Then, 100 μL of the culture solution was collected, inoculated into 10 mL of LB medium, and shaken at 37 ° C. and 180 rpm for 4 hours. Then, the culture broth was centrifuged at 3000 G for 5 minutes, the supernatant was removed by suction, and then sterile water was added. At this time, OD600 was measured and adjusted to OD = 1 with sterile water to prepare a bacterial suspension.

A 500 μL bacterial suspension was allowed to stand at 37 ° C. for 1 hour. The suspension was then centrifuged at 3000 G for 5 minutes and the supernatant was filtered through a 0.22 μm filter. Mix 10 μL of filtrate and 2 μL of 6x Loading buffer (manufactured by Takara Bio Inc.), add to 2 mass% agarose gel (LO3, manufactured by Takara Bio Inc.), and in TAE (Tris-acetate with EDTA) buffer. Electrophoresed. The results are shown in FIG. As a ladder, Gene ladder window 1 (manufactured by Nippon Gene Co., Ltd.) was used (lane 2 on the right side). 0.01% by mass SYBR Green II (manufactured by Takara Bio Inc.) was used as the fluorescent substance for staining the nucleic acid. Lane 1 on the left side is the lane where the filtrate is loaded.

As a result of electrophoresis, fluorescence was observed in a region having a length of 500 bases or less, particularly a region having a length of 100 bases or less. Fluorescence depends on the concentration of the substance, but if it is a small molecule substance, the number of molecules is large even with the same fluorescence, so it was shown that the substance concentration (number of molecules) of nucleic acids with a length of 100 bases or less is particularly high. ..

(Reference Example 11) Detection of aerial cells Escherichia coli DH5α was seeded on an LB plate and cultured, and the resulting colonies were suspended in 2 mL of LB medium and shake-cultured at 37 ° C. and 180 rpm for 24 hours. Then, 100 μL of the culture solution was collected, inoculated into 10 mL of LB medium, and shaken at 37 ° C. and 180 rpm for 4 hours. Then, the culture broth was centrifuged at 3000 G for 5 minutes, the supernatant was removed by suction, and then sterile water was added. At this time, OD600 was measured and adjusted to OD = 1 with sterile water to prepare an E. coli suspension. The obtained E. coli suspension was placed in a 30 mL glass spray.

An empty petri dish (9 cm in diameter) for collecting aerial cells and a petri dish (9 cm in diameter) containing LB solid medium were placed on a table as positive controls, and the E. coli suspension was sprayed once from 30 cm above the sky by a glass spray. The petri dish containing the LB solid medium was covered and placed in an incubator at 37 ° C. and cultured for 1 day. For an empty petri dish, 500 μL of sterilized water was added, the sterilized water was spread throughout the petri dish with a spreader, and then the liquid in the petri dish was collected and allowed to stand at 37 ° C. for 1 hour. When the abundance of EC-5p-36 was measured by the real-time PCR method according to the above <method for quantifying sRNA by the real-time PCR method> from the collected liquid from an empty petri dish, the Ct value was 28 or less, and EC-5p-36. The existence of was confirmed. On the other hand, as a negative control, when the real-time PCR method was directly performed on sterile water and the abundance of EC-5p-36 was measured, the Ct value was 33 or more, and the existence of EC-5p-36 was denied. In addition, colony formation was observed from the positive control LB petri dish.

From the results of Reference Example 11, it was shown that the measurement method and the evaluation method according to the present disclosure are also applicable to the measurement sample obtained by collecting the aerial cells.

(Example 1) Measurement of viable cell number of ampicillin-treated organism (1-1) Preparation of mother liquor Escherichia coli W3110 was applied to an LB plate and cultured, and the colonies were suspended in 2 mL of LB medium and 37 ° C. , The shaking culture was carried out at 180 rpm for 24 hours. Then, 40 μL of the culture solution was collected, inoculated into 4 mL of LB medium, and shaken at 37 ° C. and 180 rpm for 5 hours. Then, the culture broth was centrifuged at 3000 G for 3 minutes, the supernatant was removed by suction, and then sterile water was added. At this time, OD600 was measured and adjusted to OD = 1.1 with sterile water. This was dispensed into 90 μL. Hereinafter, the dispensed bacterial solution is also referred to as a mother's solution.

(1-2) Ampicillin (Amp) Treatment 10 μL of an ampicillin aqueous solution was added to 90 μL of the mother liquor to prepare a bacterial solution having an ampicillin concentration of 10 mg / mL and an OD = 1.0. Then, this was left at 4 ° C. for 1 hour to obtain a liquid (Amp-treated liquid) in which the bacteria were treated with ampicillin.
Next, 5 μL of the Amp-treated solution and 5 μL of the mother liquor prepared at OD = 1 with sterilized water were mixed to prepare an Amp-treated solution (half-volume Amp-treated solution) having an Amp concentration of half. 10 μL of each of the Amp-treated solution and the half-volume Amp-treated solution was collected, and 10 μL of sterile water was added to each, and each was diluted 2-fold. Each diluted solution was left at 37 ° C. for 1 hour to extract sRNA, which was used as a measurement sample.

(1-3) Measurement of abundance of sRNA and preparation of calibration curve The above-mentioned measurement sample is filtered, 1 μL of filtrate is collected, and EC-5p-36 is targeted for quantification of sRNA by the above-mentioned <real-time PCR method. Real-time PCR was performed by the method described in Method>. In addition, the viable cell count of the measurement sample was measured by the smearing method of the dilution plate method using the LB plate medium. The results are shown in Table 11.
Next, for each treatment intensity, three points of no treatment, weak treatment (half amount Amp treatment liquid), and strong treatment (Amp treatment liquid) are plotted by the number of bacteria (cfu / μL) and sRNA concentration (pM), and an approximate formula is used. It was created. The obtained approximate expression is shown in Table 11.

(1-4) Measurement of the number of living cells of an organism The mother liquor prepared in the same manner as in (1-1) above on a day different from the day on which the operations (1-1) to (1-3) were performed. Was used as the subject. Of the ampicillin treatments in (1-2) above, the subject was subjected to the same treatment as the series (strong treatment intensity) in which the final concentration of ampicillin was 10 mg / mL, and sRNA was extracted to extract sRNA (1-3). The concentration of EC-5p-36 was measured in the same manner as above. The concentration of EC-5p-36 was 0.52 pM. The concentration of the obtained EC-5p-36 was applied to the calibration curve obtained in (1-3) above, and the viable cell count obtained from the calibration curve was determined. The result was 1.8 × 10 ² cfu / μL.
For verification, the viable cell count was measured by the dilution plate method in the same manner as in (1-3) above, and the viable cell count was 1.6 × 10 ² cfu / μL (Table 12). In Table 12, the fluctuation amount indicates how many times the difference was changed by comparing the viable cell count obtained by the dilution plate method with the viable cell count obtained from the calibration curve.

(Example 2) Measurement of viable cell number of organisms left to stand naturally (2-1) Preparation of mother liquor Escherichia coli W3110 was applied to an LB plate and cultured, and the colonies were suspended in 2 mL of LB medium to 37. Shaking culture was carried out at ° C. and 180 rpm for 24 hours to obtain a mother liquor.

(2-2) Natural leaving treatment 90 μL of the mother liquor was stored at 25 ° C. for 40 days and left to stand naturally. At this time, OD600 was measured, and a liquid (left-behind treatment liquid) prepared with sterilized water at OD = 1.0 was obtained.
Next, 10 μL of the neglected treatment liquid and 10 μL of the mother liquor prepared at OD = 1 with sterilized water were mixed to obtain a 2-fold diluted neglected treatment liquid (half amount of the neglected treatment liquid). Each diluted solution was left at 37 ° C. for 1 hour to extract sRNA, which was used as a measurement sample.

(2-3) Measurement of abundance of sRNA and preparation of calibration curve Similar to (1-3) above in Example 1, the above-mentioned <method for quantifying sRNA by real-time PCR method for EC-5p-36. >, Real-time PCR was performed by the method described in. In addition, the viable cell count of the measurement sample was measured by the smearing method of the dilution plate method using the LB plate medium. The results are shown in Table 11.
Next, for each treatment intensity, three points of no treatment, weak treatment (half-volume neglected treatment liquid), and strong treatment (leaving treatment liquid) are plotted by the number of bacteria (cfu / μL) and sRNA concentration (pM), and an approximate formula is used. It was created. The obtained approximate expression is shown in Table 11.

(2-4) Measurement of the number of living cells of an organism The mother liquor prepared in the same manner as in (2-1) above on a day different from the day on which the operations (2-1) to (2-3) were performed. Was used as the subject. The subject is subjected to the same treatment as the series (weak treatment intensity) diluted 2-fold with the mother liquor prepared at OD = 1.0 with sterile water in the natural leaving treatment of (2-2) above to sRNA. Was extracted, and the concentration of EC-5p-36 was measured in the same manner as in (2-3). The concentration of EC-5p-36 was 0.0012 pM. The concentration of the obtained EC-5p-36 was applied to the calibration curve obtained in (2-3) above, and the viable cell count obtained from the calibration curve was determined. The result was 4.8 × 10 ¹ cfu / μL.
For verification, the viable cell count was measured by the dilution plate method in the same manner as in (2-3) above, and the viable cell count was 3.8 × 10 ¹ cfu / μL (Table 12).

(Example 3) Measurement of viable cell number of heat-treated (with washing treatment) (3-1) Preparation of mother liquor Escherichia coli W3110 was applied to an LB plate and cultured, and the colonies were suspended in 2 mL of LB medium. After turbidity, the cells were shake-cultured at 37 ° C. and 180 rpm for 24 hours to obtain a mother liquor.

(3-2) Heat treatment (with cleaning treatment)
10 μL of sterile water was added to 90 μL of the mother liquor, and two preparations adjusted to OD = 1.0 were prepared. One was heated at 95 ° C. for 10 minutes and the other was an unheated untreated liquid. Then, both were centrifuged at 3,000 rpm for 3 minutes to remove the supernatant. After suspending the precipitate by adding 1 ml of sterile water, the precipitate was centrifuged at 3,000 rpm for 3 minutes to remove the supernatant. 100 μL of sterile water containing 1% Triton X-100 was added to the precipitate and suspended. Each suspension was left at 37 ° C. for 1 hour to extract sRNA. Then, the filtrate was centrifuged at 14,000 rpm for 2 minutes with an ultrafiltration filter having a molecular weight cut off of 300 K, and the filtrates were recovered from both (heat-treated (with cleaning treatment) liquid and liquid without treatment strength).
Next, 10 μL of the heat-treated (with cleaning treatment) liquid was sampled, and 10 μL of the liquid without treatment strength was added and diluted 2-fold (half-volume heat-treated (with cleaning treatment) liquid).

(3-3) Measurement of abundance of sRNA and preparation of calibration curve Similar to (1-3) above in Example 1, the above-mentioned <method for quantifying sRNA by real-time PCR method for EC-5p-36. >, Real-time PCR was performed by the method described in. In addition, the viable cell count of the measurement sample was measured by the smearing method of the dilution plate method using the LB plate medium. The results are shown in Table 11.
Next, for each treatment intensity, the number of bacteria (cfu / μL) and sRNA were divided into three points: no treatment, weak treatment (half-volume heat treatment (with cleaning treatment) liquid), and strong treatment (heat treatment (with cleaning treatment) liquid). Plots were made in terms of concentration (pM) to create an approximate expression. The obtained approximate expression is shown in Table 11.

(3-4) Measurement of the number of living cells of an organism The mother liquor prepared in the same manner as in (3-1) above on a day different from the day on which the operations (3-1) to (3-3) were performed. Was used as the subject. The collected filtrate was used as it was for sRNA measurement of the subject, except that the heat treatment conditions were changed to 1 minute at 60 ° C. in the heat treatment (with washing treatment) of (3-2) above. The same treatment as the series (strong treatment intensity) was applied to extract sRNA, and the concentration of EC-5p-36 was measured. The concentration of EC-5p-36 was 0.15 pM. The concentration of the obtained EC-5p-36 was applied to the calibration curve obtained in (3-3) above, and the viable cell count obtained from the calibration curve was determined. The result was 38 cfu / μL.
For verification, the viable cell count was measured by the dilution plate method in the same manner as in (3-3) above, and the viable cell count was 11 cfu / μL (Table 12).

(Reference example 12) Heat treatment (no cleaning treatment)
(12-1) Preparation of mother liquor Escherichia coli W3110 was applied to an LB plate and cultured, and the colonies were suspended in 2 mL of LB medium and shake-cultured at 37 ° C. and 180 rpm for 24 hours to obtain a mother liquor. ..

(12-2) Heat treatment (no cleaning treatment)
10 μL of sterile water was added to 90 μL of the mother liquor, and two preparations adjusted to OD = 1.0 were prepared. One of them was heated at 95 ° C. for 10 minutes to obtain a heat-treated liquid (heat-treated (no cleaning treatment) liquid). 5 μL of the heat-treated (no washing treatment) liquid and 5 μL of the unheated liquid were mixed to prepare a half-volume heat-treated (no washing treatment) liquid (half-volume heat-treated (no washing treatment) liquid).
Next, 10 μL of each of the heat-treated (no washing treatment) liquid and the half-volume heat-treated (no washing treatment) liquid was sampled, and 10 μL of sterile water was added to dilute the mixture 2-fold. Each diluted solution was left at 37 ° C. for 1 hour to extract sRNA, which was used as a measurement sample.

(12-3) Measurement of abundance of sRNA and preparation of calibration curve Similar to (1-3) above in Example 1, the above-mentioned <method for quantifying sRNA by real-time PCR method for EC-5p-36. >, Real-time PCR was performed by the method described in. In addition, the viable cell count of the measurement sample was measured by the smearing method of the dilution plate method using the LB plate medium. The results are shown in Table 11.
Next, for each treatment intensity, the number of bacteria (cfu / μL) and sRNA were divided into three points: no treatment, weak treatment (half-volume heat treatment (no washing treatment) liquid), and strong treatment (heat treatment (no washing treatment) liquid). Plots were made in terms of concentration (pM) to create an approximate expression. The obtained approximate expression is shown in Table 11.

(Reference Example 13) Naturally left (13-1) Preparation of mother liquor A mother liquor was obtained in the same manner as in Example 2.

(13-2) Natural leaving treatment An untreated liquid and a half-volume standing treatment liquid were obtained in the same manner as in Example 2 except that an untreated sample (without treatment strength) was also obtained. The untreated sample was carried out in the same manner as in the items (1) and (2) in the preparation of the common untreated sample for Example 1, Example 2 and Reference Example 12 described later.
Then, sRNA was extracted and used as a measurement sample in the same manner as in Example 2.

(13-3) Measurement of abundance of sRNA and preparation of calibration curve Real-time PCR was performed in the same manner as in Example 2 except that EC-3p-40 was targeted. In addition, the viable cell count of the measurement sample was measured by the smearing method of the dilution plate method using the LB plate medium. The results are shown in Table 11.
Next, for each treatment intensity, three points of no treatment, weak treatment (half-volume neglected treatment liquid), and strong treatment (leaving treatment liquid) are plotted by the number of bacteria (cfu / μL) and sRNA concentration (pM), and an approximate formula is used. It was created. The obtained approximate expression is shown in Table 11.

In addition, in the above-mentioned Example 1 (ampicillin treatment), Example 2 (natural leaving treatment), and Reference Example 12 (heat treatment (no cleaning treatment)), the untreated (no treatment strength) samples are common to the following. The sample was used.
(1) Preparation of mother liquor Escherichia coli W3110 was applied to an LB plate and cultured, the colonies were suspended in 2 mL of LB medium, and shaken at 37 ° C. and 180 rpm for 24 hours to obtain a mother liquor.

(2) Treatment 10 μL of the mother liquor was collected, and 10 μL of sterile water was added to the solution to dilute it 2-fold. The diluted solution was left at 37 ° C. for 1 hour to extract sRNA, which was used as a measurement sample.

(3) Measurement of abundance of sRNA Similar to (1-3) above in Example 1, real-time PCR was performed by the method described in the above-mentioned <Method for quantifying sRNA by real-time PCR method>. The results are shown in Table 11.

As can be seen from the results shown in Table 11, in each treatment condition group, the number of living cells of the organism having a cell wall and the abundance of sRNA obtained from the organism having the cell wall are correlated. It was confirmed that. Furthermore, as can be seen from the results shown in Table 12, the difference between the viable cell count obtained by the dilution plate method and the viable cell count obtained by the measuring method according to the present disclosure is small, and the present disclosure relates to this. It can be seen that the viable cell count could be measured accurately by the measuring method.
Further, in Examples 1 to 3, it took 3 hours from the start of the operation to the identification of the viable cell count. On the other hand, it took 24 hours to specify the viable cell count by the dilution plate method. From this, it can be seen that the measurement method according to the present disclosure is simple and quick.

(Reference Example 14) Detection of bacteria belonging to Enterobacteriaceae by sRNA 20, 21, 22 and 41 Each bacterium belonging to Enterobacteriaceae, Escherichia coli, Citrobacter fluendii, and Salmonella gallinarum is inoculated on an LB plate. After culturing, the resulting colonies were suspended in 2 mL of LB medium and shake-cultured at 37 ° C. and 180 rpm for 24 hours. Then, 40 μL of the culture solution was collected, inoculated into 4 mL of LB medium, and shaken at 37 ° C. and 180 rpm for 24 hours. Then, the culture broth was centrifuged at 3000 G for 5 minutes, the supernatant was removed by suction, and then sterile water was added. At this time, OD600 was measured and adjusted to OD = 1 with sterile water to prepare a bacterial suspension. Three 500 μL samples were prepared from the prepared bacterial suspension and allowed to stand at 5 ° C, 25 ° C, or 37 ° C for 1 hour, respectively.

Next, reverse transcription reaction and real-time PCR were performed on sRNA (sRNA20, sRNA21, sRNA22 and sRNA41) in the bacterial suspension after standing. Real-time PCR was performed according to the above <method for quantifying sRNA by real-time PCR method> using 1 μL each of the bacterial suspensions after standing. Table 13 shows the results of Ct values obtained by a real-time PCR system (manufactured by Applied Biosystems). In each case, the Ct value was 30 or less, and the presence of Enterobacteriaceae bacteria to be investigated was detected. Therefore, it was shown that microorganisms of Enterobacteriaceae can also be detected by using tRNA of Enterobacteriaceae and other sRNAs.

(Reference Example 15) E. Examination of the effect of additives during sRNA extraction from coli E. coli W3110 was applied to an LB plate and cultured, and the resulting colonies were suspended in 2 mL of LB medium and shake-cultured at 37 ° C. and 180 rpm for 24 hours. rice field. 40 μL of the obtained culture broth was collected, inoculated into 4 mL of LB medium, and shake-cultured at 37 ° C. and 180 rpm for 5 hours. Then, the culture broth was centrifuged at 3000 G for 3 minutes, the supernatant was removed by suction, and then sterile water was added. OD600 was measured and diluted with sterile water so that the value of OD600 was 1.0 to obtain an OD1.0 E. coli W3110 suspension.

10 μL of OD1.0 E. coli W3110 suspension was collected, 10 μL of Triton X-100 was added so that the final concentration was 1% by mass, and the mixture was diluted with sterile water so that the value of OD600 was 0.5. , Was left at 37 ° C. for 1 hour. EC-5p-36 was quantified by real-time PCR using a liquid sample left for 1 hour. Specifically, 1 μL of a liquid sample was collected, and real-time PCR was performed according to the above <method for quantifying sRNA by real-time PCR method> to determine the Ct value. Separately, the Ct value was obtained by the real-time PCR method for the control (Reference Example 26 without the additive) prepared in the same manner as above except that Triton X-100 was not added. The Ct value of Reference Example 15 was subtracted from the Ct value of Reference Example 26, and the obtained value (that is, the decrease in Ct value as compared with the control without additives) was defined as the “score”. If the score is positive, it indicates that the Ct value has decreased, that is, the amount of sRNA extracted has increased. On the contrary, when the score is negative, it indicates that the Ct value has increased, that is, the amount of sRNA extracted has decreased. In addition, for the reference example in which the score was described as "below the detection limit", amplification of sRNA was not observed and a Ct value was not obtained (that is, the amount of sRNA extracted decreased to below the detection limit. ). The results for each additive are shown in Table 14.

(Reference Examples 16 to 25)
The score was the same as that of Reference Example 15 except that the additives shown in Table 14 were used and the final concentration was as shown in Table 14 so that the concentration of the E. coli W3110 suspension was the same as that of Reference Example 15. Was measured. For example, in the case of Synperoinc F108 of Reference Example 16, 10 μL was added to 10 μL of the OD1.0 Escherichia coli W3110 suspension using a 2% by mass aqueous solution of Synperoinc F108, and the value of OD600 became 0.5 and Synperoinc. The final concentration of F108 (concentration in the obtained liquid sample) was set to 1% by mass. The results of Reference Examples 16 to 25 are also shown in Table 14.

As can be seen from the results shown in Table 14, nonionic surfactants, antimicrobial peptides, monovalent or divalent C2-C8 alcohols, acetone, and reducing agents are used within the content ranges specified in the present disclosure. If so, it was confirmed that the inclusion of these additives has the effect of improving the extraction efficiency of sRNA. On the other hand, it was confirmed that when the anionic surfactant, the cationic surfactant, and the oxidizing agent were used as additives, the extraction efficiency of sRNA was conversely lowered.

All documents, patent applications, and technical standards described herein are to the same extent as if the individual documents, patent applications, and technical standards were specifically and individually stated to be incorporated by reference. Incorporated by reference herein.

Claims (21)

Measuring the abundance of one or more sRNAs in a liquid measurement sample that may contain living cells of an organism with a cell wall.
Based on the abundance of the measured sRNA, the number of living cells of the organism having the cell wall in the liquid measurement sample can be determined.
A method for measuring the number of living cells of an organism having a cell wall in a liquid measurement sample. Immerse a measurement sample that may contain live cells of an organism with a cell wall in an aqueous solvent to prepare a liquid measurement sample, or measure that is an aqueous solvent that may contain live cells of an organism that has a cell wall. The measuring method according to claim 1, wherein the sample is prepared as a liquid measuring sample. The measuring method according to claim 2, wherein the aqueous solvent contains at least one selected from the group consisting of a nonionic surfactant and a reagent for nucleic acid amplification. The measuring method according to claim 2 or 3, wherein the immersion is performed at a temperature within the temperature range of 0 ° C. to 50 ° C. To determine the number of living cells of an organism having a cell wall, refer to the data showing the correlation between the abundance of sRNA prepared in advance and the number of living cells of the organism having a cell wall, and determine the abundance of the sRNA. The measuring method according to any one of claims 1 to 4, which comprises converting into the number of living cells of the organism having a cell wall. The measuring method according to any one of claims 1 to 5, wherein the organism having a cell wall is an organism that has been treated with an antibiotic. The organism having the cell wall is an organism that has undergone antibiotic treatment.
To determine the number of living cells of an organism having a cell wall, refer to the data showing the correlation between the abundance of sRNA prepared in advance and the number of living cells of the organism having a cell wall, and determine the abundance of the sRNA. Including converting to the viable cell number of the organism having the cell wall,
The data is data obtained by measuring the abundance of sRNA and the number of living cells in a calibration liquid sample obtained by subjecting an organism having the cell wall to the antibiotic treatment. The measuring method according to any one of claims 1 to 4. The measuring method according to claim 6 or 7, wherein the antibiotic treatment is at least one treatment selected from the group consisting of an antibiotic treatment, a natural leaving treatment, and a heat treatment. The measuring method according to any one of claims 1 to 8, wherein the one or more kinds of sRNA show a specific expression state in the organism having the cell wall. The measuring method according to any one of claims 1 to 9, wherein the organism having a cell wall comprises at least one selected from the group consisting of Escherichia coli, Citrobacter freundii, and Salmonella gallinarum. The measuring method according to any one of claims 1 to 9, wherein the organism having a cell wall includes a plant. The measuring method according to any one of claims 1 to 9, wherein the organism having a cell wall contains a verotoxin-producing bacterium. The liquid measurement sample is a liquid measurement sample obtained by collecting airborne substances, and measuring the number of living cells of an organism having a cell wall is to measure the number of living cells of an organism having a cell wall existing in the air. The measuring method according to any one of claims 1 to 12, which comprises the above. The measuring method according to any one of claims 1 to 13, wherein the number of bases of each of the one or a plurality of sRNAs is in the range of 5 to 500. The one or more sRNAs are represented by EC-5p-36 having the nucleotide sequence represented by SEQ ID NO: 1, EC-3p-40 having the nucleotide sequence represented by SEQ ID NO: 2, and SEQ ID NO: 11. EC-5p-79 having a nucleotide sequence, EC-3p-393 having a nucleotide sequence represented by SEQ ID NO: 12, fox_milRNA_5 having a nucleotide sequence represented by SEQ ID NO: 10, and a nucleotide sequence represented by SEQ ID NO: 4. The measuring method according to any one of claims 1 to 14, comprising at least one selected from the group consisting of miR156 having miR156 and miR716b having the nucleotide sequence represented by SEQ ID NO: 5. The measuring method according to any one of claims 1 to 15, wherein the abundance of one or more kinds of sRNA is measured by isothermal gene amplification. The measuring method according to claim 16, wherein the isothermal gene amplification is performed at a temperature within a temperature range of 10 ° C to 40 ° C. The measuring method according to any one of claims 1 to 17, wherein the abundance of one or more kinds of sRNA is measured by PCR. To measure the abundance of one or more sRNAs in a liquid evaluation sample containing an organism with a cell wall exposed to treatment in contact with the test substance in an aqueous solvent.
Based on the measured abundance of sRNA, the number of living cells of the organism having the cell wall in the liquid evaluation sample is determined, and the resistance of the organism having the cell wall to the test substance is evaluated.
A method for assessing resistance to a test substance of an organism having a cell wall, including. The evaluation method according to claim 19, wherein the organism having the cell wall is immersed in the aqueous solvent for 5 minutes or more before measuring the abundance of the one or more kinds of sRNA. The evaluation according to claim 19 or claim 20, wherein the test substance comprises at least one selected from the group consisting of a bactericidal agent, an antibacterial agent, a disinfectant, an antifungal agent, a disinfectant, an antibiotic, and a preservative. Method.

Images