RU2395583C2 - Microorganism detection method and microorganism detection set - Google Patents

Abstract

FIELD: chemistry; biochemistry.

SUBSTANCE: invention relates to biotechnology and is a method of detecting living cells of a microorganism through differentiation of living cells from dead cells or damaged cells in a test specimen. The method involves a step for treating the test specimen with topoisomerase poison or DNA-gyrase poison, a step for extracting DNA from the test specimen and amplification of the target section of the extracted DNA through a polymerase chain reaction (PCR), where the length of the target section is between 900 and 3000 nucleotides, and a step for analysing the amplification product.

EFFECT: invention enables high-accuracy determination of presence of living organisms.

52 cl, 18 dwg, 2 tbl, 4 ex

Description

FIELD OF TECHNOLOGY

The present invention relates to a method for detecting a microorganism present in food or clinical samples, as well as to a kit for detecting a microorganism. More specifically, the present invention relates to a method and kit with which it is possible to selectively detect live cells of a microorganism present in food products or clinical samples.

BACKGROUND

To determine the number of living bacteria in food products, clinical samples or the environment, a cup culture method is usually used. However, using this method takes approximately two days to obtain the result.

Due to the improvement of sterilization and food processing methods, there is an increasing need for methods to distinguish between the living and dead state of microorganisms present in the test samples, even in cases where the number of cells is extremely low. In particular, in the areas of food safety inspection and clinical testing, attempts are being made to develop a method for the rapid detection of bacteria, which allows one to determine the presence or absence of bacteria and their number, by PCR amplification of the bacteria-specific genes to obtain a quantity that can be visually detected . However, when bacterial DNA is used as a template, noise is also detected due to dead cells originally present in the test sample, and, therefore, a positive result obtained by PCR does not allow an unambiguous conclusion about the presence of live bacteria. Therefore, at present, the PCR method is not widely used in the areas of sanitary food inspection and clinical testing, although it is a highly sensitive and fast method.

Attempts are currently being made to develop a method for detecting and quantifying only living cells in a test sample by obtaining cDNA by PCR using reverse transcriptase, mRNA as a template, and primers specific for different bacteria. However, in this method, reverse transcription of mRNA from dead cells is not inhibited, and if 10 ⁴ cfu / ml, or 10 ⁴ cfu / g, or more dead cells are present in the test sample, noise due to the presence of dead cells is detected. Therefore, this method does not allow to clearly distinguish between a living and a dead state.

A method for distinguishing between the living and dead state of microorganisms, such as bacteria, using the PCR method, is described in patent documents 1 and 2. However, methods for differential detection of live and dead conditions of microorganisms, such as bacteria, using the PCR method have the following problems.

To illustrate the method disclosed in Patent Document 1, examples of detection of dead cells in food products subjected to high temperature sterilization for a long time, 100 ° C for 10-30 minutes, and microorganisms present in food products subjected to sterilization with ethanol or formaldehyde are given. . However, in reality, such methods, especially the latter, are not used for pasteurization of food products. Moreover, examples of the detection of only living organisms in products subjected to pasteurization methods that are currently widely used in the food industry, which include low-temperature long-term pasteurization (LTLT pasteurization), high-temperature short-term pasteurization (HTST pasteurization) or ultrahigh temperature pasteurization (pasteurization, are not given). UHT), as well as the detection of only live specific pathogenic bacteria in clinical samples of patients with an infectious disease receiving an antibiotic ki. In addition, in the case of a test sample of a food product or a clinical sample containing dead cells at a concentration of 10 ⁴ cfu / ml or higher, the number of final PCR amplification products obtained from dead cells exceeds the sensitivity limit of the method of Patent Document 1, and therefore, cannot to determine whether a living response from living or dead cells was obtained by analyzing the test sample by PCR.

Patent Document 2 then discloses a method for differentially detecting living and dead cells, which is based on the fact that the RNA / DNA molar ratio in dead cells is lower than in living cells. This method is carried out as follows: the total RNA is extracted, a DNA complementary to it is obtained using the reverse transcription reaction, then PCR is performed to calculate the Ct value, and the molar concentration of RNA is determined using the previously obtained calibration curve. Separately, the region of the chromosomal DNA corresponding to the aforementioned RNA is amplified by PCR to obtain the Ct value, the concentration of chromosomal DNA is calculated using a calibration curve, and the molar ratio of RNA / DNA is determined. That is, the implementation of the above method requires complex extraction of total RNA, two stages of the reverse transcription reaction and PCR. Therefore, from the point of view of quantitative indicators and time consumption, this method is worse than the usual PCR method using DNA as a template. In addition, in living cells, RNA is produced continuously, while in dead cells, RNA decomposes at an early stage. Therefore, the specified method lacks stability. In addition, in a food product or a clinical sample containing a large number of dead cells, using this method, you can determine live cells only if their number is 1/10 of the number of dead cells. Thus, this method is undesirable to use in the areas of sanitary inspection of food products and clinical testing, where speed, high sensitivity and accuracy are required.

Patent Document 1: International Patent Application, Unexamined Japanese Publication No. 2000-530118.

Patent Document 2: International Patent Publication WO2002 / 052034, brochure.

DESCRIPTION OF THE INVENTION

The tasks solved by the invention

The aim of the present invention is to provide a method for the selective detection of living cells (viable and cultivable) of a microorganism present in a food product or clinical sample against dead or damaged cells (damaged cells, in other words, are called viable but not cultivable cells ( VNC cells)), that is, the creation of a method for rapid detection, alternative to the cultivation method, but surpassing it in characteristics, as well as a kit used to conduct way shown.

Ways to solve problems

The authors of the present invention have carried out thorough research to create a method for detecting living and dead cells, applicable to different sterilization methods, which is highly sensitive, suitable for sanitary inspection of food products and, in addition, allows the detection of specific pathogenic bacteria in patients with an infectious disease in hospitals or clinical centers. As a result, the authors found that a method for differential detection of living and damaged microorganism cells in a test sample by treating such a sample with topoisomerase poison and / or DNA gyrase poison or by treating the test sample with ethidium monoazide, irradiating with visible light and treating with topoisomerase poison and / or DNA poison β-gyrase, different from ethidium monoazide, allows selective amplification of the chromosomal DNA of living cells by PCR, and created a quick method, which is an alternative to the cultivation method. Thus, the inventors have completed the present invention.

Thus, the present invention relates to a method for detecting living cells of a microorganism in a test sample, which comprises the following steps:

a) the stage of processing the test sample with topoisomerase poison and / or DNA gyrase poison,

b) a step for extracting the DNA from the test sample and amplifying the target region of the extracted DNA by PCR and

c) a step for analyzing the amplification product.

In a preferred embodiment of the above method, the amplification product is analyzed using a standard curve reflecting the ratio of the amount of microorganism and the amplification product obtained using standard samples of the microorganism.

In a preferred embodiment of the above method, PCR is carried out in real time with simultaneous analysis of the product.

In a preferred embodiment of the above method, the test sample may be milk, a dairy product, a food product obtained using milk or a dairy product as a raw material, a blood sample, a urine sample, a cerebrospinal fluid sample, a synovial fluid sample, and a pleural fluid sample.

In a preferred embodiment of the above method, the microorganism is a bacterium.

In a preferred embodiment of the above method, the target region is a 23S rRNA gene. In this embodiment, PCR is preferably carried out using a primer kit containing primers SEQ ID NO: 1 and 2, or a primer kit containing primers SEQ ID NO: 3 and 4.

In a preferred embodiment of the above method, the microorganism is a pathogenic bacterium. In this embodiment, the target region is preferably a pathogenic gene. In addition, in this embodiment, PCR is preferably performed using a primer kit containing primers SEQ ID NO: 7 and 8.

In a preferred embodiment of the above method, the topoisomerase venom is selected from amsacrine, camptothecin, doxorubicin, ellipticin, etoposide, mitoxantrone, sintopin, topotecan and CP-115953.

In a preferred embodiment of the above method, the DNA gyrase venom is selected from ciprofloxacin, ofloxacin, enoxacin, pefloxacin, fleroxacin, norfloxacin, nalidixic acid, oxolinic acid and pyromidic acid.

In a preferred embodiment of the above method, the topoisomerase venom and / or the DNA gyrase venom is ethidium monoazide, and the method comprises the step of irradiating the test sample to which ethidium monoazide is added with visible light.

In a preferred embodiment of the above method, the test sample is treated with ethidium monoazide and topoisomerase poison and / or DNA gyrase poison other than ethidium monoazide.

In a preferred embodiment of the above method, before the aforementioned step a), the following is carried out:

d) the step of treating the test sample with topoisomerase and / or DNA gyrase.

The present invention also relates to a kit for the detection of living cells of a microorganism in a test sample by PCR, which contains the following components: topoisomerase poison and / or DNA gyrase poison and primers for amplification of the target portion of the DNA of the microorganism detected by PCR.

In a preferred embodiment, the above kit contains topoisomerase and / or DNA gyrase.

In a preferred embodiment of the above kit, the topoisomerase venom is selected from amsacrine, camptothecin, doxorubicin, ellipticin, etoposide, mitoxantrone, saintopine, topotecan and CP-115953.

In a preferred embodiment of the above kit, the DNA gyrase venom is selected from ciprofloxacin, ofloxacin, enoxacin, pefloxacin, fleroxacin, norfloxacin, nalidixic acid, oxolinic acid and pyromidic acid.

In a preferred embodiment, the above kit contains ethidium monoazide and topoisomerase poison and / or DNA gyrase poison other than ethidium monoazide.

In a preferred embodiment of the above kit, said primers include primers of SEQ ID NO: 1 and 2 or primers of SEQ ID NO: 3 and 4.

In another preferred embodiment of the above kit, said primers include primers SEQ ID NO: 7 and 8.

BRIEF DESCRIPTION OF THE DRAWINGS

[FIG. 1] Electrophoresis photographs showing the effect of intracellular DNAse of damaged cells on Listeria chromosomal DNA (damaged cells), the effect of amsacrine on Listeria chromosomal DNA (damaged cells) and the effect of amsacrine on Listeria chromosomal DNA (living cells):

Non: untreated.

Amsacrine (-): Amsacrine is not added,

Amsacrine (+): Amsacrine is added,

1: Incubation at 30 ° C for 24 hours,

2: Incubation at 30 ° C for 48 hours,

3: Incubation at 30 ° C for 72 hours.

[FIG. 2] Electrophoresis photographs showing the effect of intracellular DNAse of damaged cells on Enterobacter chromosomal DNA (damaged cells):

Non: untreated.

1: Incubation at 37 ° C for 24 hours,

2: Incubation at 37 ° C for 48 hours,

3: Incubation at 37 ° C for 72 hours.

[FIG. 3] Photographs of electrophoresis demonstrating the effect of ciprofloxacin on Enterobacter chromosomal DNA (living cells and damaged cells):

Non: untreated.

1: Incubation at 37 ° C for 1.5 hours,

2: Incubation at 37 ° C for 3.5 hours,

3: Incubation at 37 ° C for 5 hours,

4: Incubation at 37 ° C for 72 hours.

[FIG. 4] Photographs of electrophoresis showing the effect of intracellular DNAse of damaged cells on Listeria chromosomal DNA (damaged cells):

Non: untreated.

1: Incubation at 30 ° C for 24 hours,

2: Incubation at 30 ° C for 48 hours,

3: Incubation at 30 ° C for 72 hours.

[FIG. 5] Photographs of electrophoresis showing the effect of ciprofloxacin on Listeria chromosomal DNA (living cells and damaged cells):

Non: untreated.

1: Incubation at 30 ° C for 1.5 hours,

2: Incubation at 30 ° C for 3.5 hours,

3: Incubation at 30 ° C for 5 hours,

4: Incubation at 30 ° C for 72 hours.

[FIG. 6] Real-time PCR amplification curve using Enterobacter 23S rRNA gene (living cells) treated with ciprofloxacin as a matrix (halftone photo).

[FIG. 7] TM-graph (melting curve) of the amplification product by real-time PCR using the 23S Enterobacter rRNA gene (living cells) treated with ciprofloxacin as a matrix (halftone photo).

[FIG. 8] Real-time PCR amplification curve using Enterobacter 23S rRNA gene (damaged cells) treated with ciprofloxacin as a matrix (halftone photo).

[FIG. 9] TM graph (melting curve) of the amplification product by real-time PCR using the 23S Enterobacter rRNA gene (damaged cells) treated with ciprofloxacin as a matrix (halftone photo).

[FIG. 10] Real-time PCR amplification curve using the 23S Listeria rRNA gene (living cells) treated with ciprofloxacin as a matrix (halftone photo).

[FIG. 11] Real-time PCR amplification curve using 23S Listeria rRNA gene (damaged cells) treated with ciprofloxacin as a matrix (halftone photo).

[FIG. 12] A graph of the temperature of a cell suspension contained in a microtube versus the time the microtube is immersed in boiling water.

[FIG. 13] Photographs of electrophoresis of amplification products of genes by PCR using as a matrix of 16S rRNA genes seven types of bacteria (living cells and damaged cells), treated or not treated with EMA, which are shown for each bacterium in the following order: suspension of living cells not treated with EMA a suspension of living cells treated with EMA, a suspension of damaged cells not treated with EMA, and a suspension of damaged cells treated with EMA. The same order is used in FIG. 14 and 15.

[FIG. 14] Photographs of electrophoresis of gene amplification products by PCR using four types of bacteria (living cells and damaged cells), treated or not treated with EMA, as a gene matrix of 23S rRNA.

[FIG. 15] Photographs of electrophoresis of gene amplification products by PCR using 23S Listeria rRNA (living cells and damaged cells) as a template, treated or not treated with EMA.

[FIG. 16] Photographs of electrophoresis of gene amplification products by PCR using the hlyA Listeria gene (living cells and damaged cells) as a template, treated or not treated with EMA and then treated with DNA gyrase poison or topoisomerase poison:

Non: untreated,

E: EMA,

1: EMA / ciprofloxacin,

2: EMA / camptothecin,

3: EMA / etoposide,

4: EMA / ellipticin,

5: EMA / mitoxantrone,

6: EMA / Amsacrine.

[FIG. 17] Photographs of electrophoresis of gene amplification products by PCR using 16S Listeria rRNA as a matrix (living cells and damaged cells), treated or not treated with EMA and then treated with DNA gyrase poison or topoisomerase poison:

Non: untreated,

E: EMA,

1: EMA / ciprofloxacin,

2: EMA / camptothecin,

3: EMA / etoposide,

4: EMA / ellipticin,

5: EMA / mitoxantrone,

6: EMA / Amsacrine.

[FIG. 18] Photographs of electrophoresis of gene amplification products by PCR using the 23S Listeria rRNA as a matrix (living cells and damaged cells), treated or not treated with EMA and then treated with DNA gyrase poison or topoisomerase poison:

Non: untreated,

E: EMA,

1: EMA / ciprofloxacin,

2: EMA / camptothecin,

3: EMA / etoposide,

4: EMA / ellipticin,

5: EMA / mitoxantrone,

6: EMA / Amsacrine.

BEST MODE FOR CARRYING OUT THE INVENTION

The following is a detailed description of preferred embodiments of the present invention. However, the present invention is not limited to the following preferred embodiments, which can be freely modified within the scope of the claims. In this description, unless otherwise indicated, percentages are given as a mass ratio.

<1> The method of the present invention

The method of the present invention is a method for detecting living cells of a microorganism in a test sample, which comprises the following steps:

a) the stage of processing the test sample with topoisomerase poison and / or DNA gyrase poison,

b) a step for extracting the DNA from the test sample and amplifying the target region of the extracted DNA by PCR and

c) a step for analyzing the amplification product.

In the description, “test sample” means an object in which living cells of a microorganism are detected, this term is not particularly limited provided that the presence of living cells can be detected by amplification of a specific region of chromosomal DNA by PCR. Examples include foods such as milk, dairy products, foods obtained using milk or dairy products as raw materials, blood samples, urine samples, cerebrospinal fluid samples, synovial fluid samples, pleural fluid samples and the like. Milk, dairy products, food products obtained using milk or dairy products as raw materials are particularly preferred. In the present invention, the test sample can be one of the above products and biological samples as is, or it can be obtained by diluting or concentrating one of the above products and biological samples or by treating one of the above products and biological samples different from the processing according to the method according to the present invention. Examples of processing include heat treatment, filtration, centrifugation, and the like.

A "microorganism" is an object that can be detected by the method of the present invention, this term is not particularly limited provided that it can be detected by PCR and that the poison of topoisomerase and the poison of DNA gyrase act on living cells of the microorganism differently from dead cells and damaged cells of the microorganism. Preferred examples include bacteria, hyphomycetes, yeast, and the like. Bacteria include both gram-positive and gram-negative bacteria. Examples of gram-positive bacteria include Staphylococcus bacteria such as Staphylococcus epidermidis, Streptococcus bacteria, Listeria bacteria such as Listeria monocytogenes, Bacillus bacteria such as Bacillus cereus, Mycobacterium bacteria and the like. Examples of gram-negative bacteria include intestinal bacteria, for example Escherichia bacteria, such as Escherichia coli, Enterobacter bacteria, such as Enterobacter sakazakii, Citrobacter bacteria, such as Citrobacter koseri, Klebsiella bacteria, such as Klebsiella oxytoca, and Salmonriomonas bacteria, bacteria Monmonoomonas bacteria, etc.

In the present invention, the term "living cell" refers to a cell that is capable of proliferating and possesses the metabolic activity of the microorganism (a living condition and cultivable cell) under cultivation under normal conditions and which has virtually no damage to the cell wall. An example of the metabolic activity mentioned above is ATP activity, esterase activity, etc.

The term "dead cell" refers to a cell that is unable to proliferate and does not possess the metabolic activity of the microorganism (the state of a dead cell), even if it is cultured under optimal conditions. In addition, the wall of such a cell has significant damage, although its structure is generally preserved, and a nuclear dye that has poor penetration, such as propidium iodide, can penetrate the cell wall.

The term "damaged cell" (a damaged cell or a living, but not suitable for culturing cell) refers to a cell that proliferates poorly, even if it is cultured under optimal conditions, because it has damage caused by artificial factors or environmental influences, and has more low metabolic activity than a living cell, but retains a significant level of metabolic activity in contrast to a dead cell.

Much attention is paid to the detection of bacteria in a damaged cell state by heat treatment of an average level or the administration of antibiotics, especially in the areas of food safety inspection and clinical testing, and the present invention relates to a method for detecting a microorganism that not only detects living cells, but and distinguish living cells from dead or damaged cells.

The unit of measurement for the number of living, damaged and dead cells is the number of cells / ml. The number of living cells can be approximately defined as the number of colonies (cfu / ml (colony forming units / ml)) formed by culturing cells under optimal conditions on a suitable culture medium. A standard sample of damaged cells can be obtained by heat treatment of a suspension of living cells, for example by heat treatment in boiling water. In such a sample, the number of damaged cells can be approximately determined as the number of cfu / ml in a suspension of living cells before heat treatment. Although the heat treatment time in boiling water required to obtain damaged cells varies depending on the type of microorganism, the damaged bacteria cells described in the examples can be obtained, for example, by heat treatment for approximately 50 seconds. In addition, a standard sample of damaged cells can be obtained by treatment with an antibiotic. In this case, the number of damaged cells can be approximately determined as the number of colonies (cfu / ml) formed by culturing cells under optimal conditions on a suitable culture medium after removing the antibiotic from a suspension of living cells by measuring the transmittance of visible light (wavelength: 600 nm), that is, turbidity, and comparing the obtained value with the turbidity of a suspension of living cells with a known density of living cells.

The method of the present invention is intended for the detection of living cells, and cells other than living cells may be damaged or dead cells.

In the present invention, “detection of living cells” means the determination of the presence or absence, as well as the number of living cells in a test sample. The number of living cells is not limited to the absolute value and may be the relative amount obtained by comparison with a control sample.

Further, the method of the present invention is described in stages.

(1) Stage a)

The test sample is treated with topoisomerase poison and / or DNA gyrase poison.

The present invention uses topoisomerase poison and DNA gyrase poison, which do not inhibit the activity of topoisomerase and DNA gyrase, respectively, associated with DNA cleavage, but inhibit DNA re-ligation or increase the direct rate of DNA cleavage. Preferably, the topoisomerase venom and the DNA gyrase venom are poisons that are able to bind to the chromosomal DNA of the microorganism by covalent attachment, integrate into and bind to the chromosomal DNA by covalent attachment by irradiation with visible light, simply integrate into the chromosomal DNA or complex with topoisomerase or DNA gyrase.

You can use the poison of topoisomerase, and the poison of DNA gyrase or one of them.

Preferably, the topoisomerase poison and the DNA gyrase poison are poisons that have different effects on living cells and damaged cells, dead cells, somatic cells such as bovine leukocytes, white blood cells, platelets and the like, more specifically, they are poisons, which penetrate more easily through the cell walls of damaged and dead cells and through the cell membranes of somatic cells, such as bovine leukocytes, white blood cells, platelets and the like, than through the cell walls of living cells.

Examples of topoisomerase poisons include amsacrine, camptothecin, doxorubicin, ellipticin, etoposide, mitoxantrone, sintopin, topotecan, CP-115953 and the like. You can use one type of topoisomerase poison or a combination of two or more types of this poison.

Examples of DNA gyrase poison include ciprofloxacin, ofloxacin, enoxacin, pefloxacin, fleroxacin, norfloxacin, nalidixic acid, oxolinic acid, pyromidic acid and the like. One type of DNA gyrase poison can be used independently or a combination of two or more species.

Before treatment with topoisomerase poison or DNA gyrase poison, suitable conditions are selected. For example, to select conditions that make it easy to distinguish living cells from dead and damaged cells, topoisomerase poison or DNA gyrase poison in different concentrations are added to suspensions of living cells and dead or damaged cells of the detected microorganism, incubated for different periods of time, then the cells are collected by centrifugation or another method and analyzed by PCR. Then, in order to select the conditions that make it easy to distinguish living cells of the detected microorganism from somatic cells, such as bovine leukocytes, platelets and the like, topoisomerase poison in various concentrations is added to suspensions of living cells and incubated for a predetermined time, then living cells and the above other cells are harvested by centrifugation or another method and analyzed by PCR. Examples of such conditions specifically include, in the case of amsacrine, a final concentration of from 1 to 100 μg / ml, a temperature of 25 to 37 ° C and a treatment time of 5 minutes to 48 hours, in the case of ellipticin, a final concentration of 0.05 to 5 μg / ml, a temperature of 25 to 37 ° C and a treatment time of 10 minutes to 48 hours, in the case of camptothecin, a final concentration of 1 to 100 μg / ml, a temperature of 25 to 37 ° C and a processing time of 10 minutes to 48 hours, in the case of ciprofloxacin, the final concentration is from 0.4 to 40 μg / ml, the temperature is from 25 to 37 ° C and the processing time is from 10 minutes to 48 hours, in the case of f etoposide - a final concentration of 1 to 100 μg / ml, a temperature of 25 to 37 ° C and a processing time of 5 minutes to 48 hours, and in the case of mitoxantrone, a final concentration of 0.1 to 10 μg / ml, a temperature of 25 to 37 ° C and processing time from 10 minutes to 48 hours. Processing the test sample under predetermined conditions is completed by removing the venom by dilution and / or by separating the components of the mixture by centrifugation or another method.

The aforementioned poison of topoisomerase and the poison of DNA gyrase more easily penetrate through the walls of damaged and dead cells than through the walls of living cells. Therefore, it is believed that during treatment for the above time periods the poisons practically do not penetrate through the walls of living cells, but penetrate through the walls of damaged cells, dead cells and living somatic cells, like dead cells. It is also believed that they can even penetrate into living somatic cells, since they do not have cell walls, but only cell membranes. It was found that as a result, topoisomerase poison or DNA gyrase poison penetrates into dead somatic cells, dead bacteria and damaged bacteria, then randomly binds to chromosomal DNA by covalent attachment, integrates into DNA or forms a complex with topoisomerase and then inhibits DNA re-ligation under the action of topoisomerase II or topoisomerase I in somatic cells, or topoisomerase IV or topoisomerase I and III, or DNA gyrase in dead or damaged cells, or increases the forward rate of cleavage DNA fragmentation, causing fragmentation of chromosomal DNA.

Since chromosomal DNA in damaged and dead cells, in contrast to living cells, is predominantly in a fragmented state, the target region of the chromosomal DNA of living cells can be amplified by PCR, while cleavage of the target region in damaged or dead cells leads to inhibition of amplification by PCR. In addition, when using, for example, amsacrine or camptothecin, cross-linking occurs, which also leads to inhibition of amplification by PCR. Therefore, the PCR method allows the selective detection of living cells against damaged or dead cells.

In dead cells, intracellular topoisomerase and / or DNA gyrase activity may not be present. In addition, the activity of these enzymes in damaged cells may be reduced or absent. Therefore, in a preferred embodiment of the present invention, the test sample is treated with step toisomerase and / or DNA gyrase before step a) (step d)). A detailed description of step d) is provided below.

In another preferred embodiment of the present invention, the topoisomerase venom or DNA gyrase venom is ethidium monoazide, and the method comprises the step of irradiating the test sample with visible light after adding ethidium monoazide. Ethidium monoazide (EMA) penetrates more easily through the cell walls of damaged or dead cells than through the walls of living cells of microorganisms. Therefore, it is believed that EMA practically does not penetrate the cell walls of living bacteria, but penetrates the cell walls of damaged and dead bacteria, as well as through the cell membranes of somatic cells, like dead cells. If white blood cells and platelets in the blood are living cells, then EMA penetrates more easily through cell membranes in sterile water or in hypotonic saline. EMA penetrates somatic cells like dead cells, damaged bacteria and dead bacteria, randomly integrates into chromosomal DNA, then, under the influence of visible light, the built-in EMA turns into nitrene and binds to chromosomal DNA by covalent attachment. It was found that after this EMA inhibits DNA re-ligation under the action of topoisomerase II in somatic cells, topoisomerase IV or DNA gyrase in damaged or dead bacteria, causing fragmentation of chromosomal DNA.

Before processing the EMA, suitable conditions are selected. For example, to select conditions that make it easy to distinguish living cells from damaged cells, EMA at different concentrations is added to suspensions of living cells and dead or damaged cells of a detected microorganism, incubated for different periods of time, irradiated with visible light, and then cells are collected by centrifugation or another method and analyzed by PCR.

Preferred conditions for irradiation with visible light are also selected by conducting an experiment similar to that described above using different irradiation periods. Namely, the EMA treatment is preferably carried out using a final concentration of from 0.5 to 100 μg / ml at a temperature of from 4 to 10 ° C for 5 minutes to 48 hours. In addition, the EMA treatment is preferably carried out using light protection. Visible light is preferably used in the range of 500 to 700 nm. Specific examples of visible light irradiation conditions include irradiation with a power of 100 to 750 W for 5 minutes to 2 hours at a distance of 10 to 50 cm from the test sample. Irradiation with visible light is preferably carried out at a low temperature, for example, by cooling a sample on ice.

In a particularly preferred embodiment of the present invention, the test sample is subjected to EMA treatment, irradiation with visible light and treatment with a topoisomerase poison and / or a DNA gyrase poison other than EMA. In this case, the procedure for treating EMA, irradiating with visible light, and treating with a topoisomerase poison and / or a DNA gyrase poison other than EMA is not particularly limited, and these treatments can be carried out simultaneously.

(2) Stage b)

DNA is extracted from a test sample processed by the method of step a), after which the target portion of the extracted DNA is amplified by PCR (White T. J. et al., Trends Genet., 5, 185 (1989)).

The method for extracting DNA from a test sample is not particularly limited provided that the extracted DNA can be used as a template for PCR, and extraction can be carried out using conventional methods for extracting DNA from microorganisms.

A DNA extraction method is described, for example, in Maniatis T., Fritsch E.F., Sambrook J. "Molecular Cloning: A Laboratory Manual", 3rd edn., Cold Spring Harbor, NY: Cold Spring Harbor Laboratory Press, 2001.

In the present invention, the “target region” is not particularly limited provided that it is a chromosomal DNA region that can be amplified by PCR using the primers of the present invention and allows microorganism detection; this region is selected depending on the task. For example, if cells other than a detectable microorganism are present in the test sample, the target region preferably contains a sequence specific for the microorganism being the object of detection. In addition, depending on the task, the target site may contain a sequence common to several types of microorganisms. A target site may consist of one site or two or more sites. Using a set of primers suitable for the target region of the detected microorganism and a set of primers suitable for chromosomal DNA of a wide range of microorganisms, it is possible to simultaneously determine the number of living cells of the detected microorganism and the number of living cells of a wide range of microorganisms. The length of the target region is usually, for example, from 80 to 3000 nucleotides, preferably from 900 to 3000 nucleotides, particularly preferably from 2000 to 3000 nucleotides. Specific examples include the 16S rRNA gene and the 23S rRNA gene. Of these, the 23S rRNA gene is preferred.

The primers used for PCR are not specifically limited provided that they provide specific amplification of the above target region. Specific examples of primers suitable for the 23S rRNA gene include a set of primers having the sequences of SEQ ID NO: 1 and 2, and a set of primers having the sequences of SEQ ID NO: 3 and 4. Examples of primers suitable for the 16S rRNA gene include a set of primers having the sequence of SEQ ID NO: 5 and 6.

If the detected microorganism is a pathogenic bacterium, examples of a target site include a pathogenic gene. Examples of the pathogenic gene include the Listeriolysin O gene (hlyA) of the Listeria bacteria, the enterotoxin gene and the Salmonella invA gene, the pathogenic E. coli verotoxin gene 0-157, the Enterobacter MMS gene (Enterobacter sakazakii), the Staphylococcus aureus enterotoxin gene, toxin gene vomiting) and the Bacillus cereus enterotoxin gene, genes of various toxins of Clostridium botulinum and the like. Examples of primers suitable for a pathogenic gene include a set of primers having the sequences of SEQ ID NO: 7 and 8.

Using primers suitable for two or more types of microorganisms, living cells of two or more types of microorganisms can be detected in a test sample. In addition, if primers specific to a particular bacterium are used, living cells of that bacterium can be detected in a test sample.

For PCR, suitable conditions can be selected that are not specifically limited provided that they provide specific amplification in accordance with the principles of PCR.

In an embodiment which, among other embodiments of the present invention, includes EMA processing and visible light processing, the use of a long target region, for example, containing 2000 or more nucleotides, allows live cells to be effectively detected using only EMA processing and visible light irradiation. Conversely, in the case of a short target region, for example consisting of 200 or less nucleotides, it is preferable to carry out the treatment with topoisomerase venom and / or a DNA gyrase venom other than EMA along with EMA treatment and irradiation with visible light.

(3) Stage c)

Then analyze the PCR amplification product. The assay method is not particularly limited provided that it allows the detection or quantification of the PCR amplification product; examples thereof include electrophoresis, real-time PCR (Nogva et al., Application of 5'-nuclease PCR for quantitative detection of Listeria monocytogenes in pure cultures and water, skim milk and unpasteurized whole milk, Appl. Environ. Microbiol., vol. 66, 2000, pp. 4266-4271; Nogva et al., Application of the 5'-nuclease PCR assay in evaluation and development of methods for quantitative detection of Campylobacter jejuni, Appl. Environ. Microbiol., vol. 66, 2000, pp.4029-4036) and the like. Using electrophoresis, you can determine the amount and size of the PCR amplification product. Using real-time PCR, you can quickly determine the amount of PCR amplification product. In the case of real-time PCR, due to the fact that changes in fluorescence intensity in 1-10 amplification cycles, as a rule, correspond to noise level and are practically equal to zero, they can be considered as values of control samples that do not contain amplification products. The fluorescence intensity value obtained by calculating the SD standard deviation for changing the fluorescence intensity in 1-10 amplification cycles and multiplying the standard deviation by 10 is determined as a threshold value. The number of the first PCR cycle in which the change in fluorescence intensity exceeds the threshold value is called the threshold cycle value (Ct value). Therefore, the larger the initial amount of the DNA matrix in the PCR solution, the lower the Ct value, and conversely, the lower the initial amount of the DNA matrix in the PCR solution, the higher the Ct value. In addition, with the same amount of DNA matrix, the increased occurrence of cleavage of the target PCR region in the matrix leads to an increase in the Ct value for PCR of this region.

The presence or absence of the amplification product can also be determined by analyzing the melting curve (TM) of the amplification product.

All of the above methods can also be used to optimize the various conditions used in the method of the present invention.

If living cells are detected by the method of the present invention, the accuracy of determining the presence or absence and quantity of living cells in the analysis of the PCR amplification product can be improved by applying a standard curve that reflects the dependence of the amount of amplification product on the amount of microorganism obtained using standard samples of the identified microorganism. Although a standard curve can be obtained in advance, it is preferable to use a standard curve obtained by simultaneously carrying out the steps of the method of the present invention for standard samples and a test sample. Moreover, if the relationship between the amount of the microorganism and the amount of DNA is established in advance, then the DNA isolated from the microorganism can also be used as a standard sample.

(4) Stage d)

As indicated above, intracellular activity of topoisomerase and / or DNA gyrase in dead cells may not be present, and chromosomal DNA cleavage is not observed even after treatment with topoisomerase poison or DNA gyrase poison. In this case, if the test sample is treated with topoisomerase and / or DNA gyrase before stage a), DNA cleavage is characteristic of dead cells, and therefore, amplification of the target region by PCR can be inhibited.

You can use topoisomerase, and DNA gyrase or one of them. In addition, one, two or more types of each enzyme can be used simultaneously.

Specific examples of reaction conditions involving topoisomerase or DNA gyrase include the conditions given below in the assignment examples. However, usually these reactions are carried out as follows: from a food product or a clinical sample, such as blood, a supernatant containing microorganisms is obtained, which is centrifuged at 4 ° C and 14000 g for 10 minutes, the supernatant is removed, 1 ml of cleavage buffer is added to the residue DNA (10 mM Tris-HCl buffer, pH 7.9, 50 mM potassium chloride, 50 mM sodium chloride, 5 mM magnesium chloride, 0.01 mM EDTA, 2.5% glycerol), topoisomerase or DNA gyrase to a final concentration of 1-50 mM and then ATP to a final concentration of 1-50 mM, after which the reaction w mixture is left at 30-37 ° C for 5-30 minutes. Since ATP is required for the functioning of topoisomerase and DNA gyrase, ATP or the ATP synthesis system is added to the test sample treated with these enzymes.

<3> Set of the present invention

The kit of the present invention is a kit for detecting living cells of a microorganism in a test sample by PCR, it contains a topoisomerase poison and / or a DNA gyrase poison and primers for amplification of a target portion of a microorganism DNA detected by PCR.

The above kit includes topoisomerase poison and DNA gyrase poison described for the method of the present invention.

In a preferred embodiment, the kit of the present invention contains EMA and another topoisomerase venom and / or a DNA gyrase venom other than EMA, like a topoisomerase venom and / or a DNA gyrase venom.

In addition to the above components, the kit of the present invention contains topoisomerase and / or DNA gyrase.

The kit of the present invention may further comprise a diluent, a solution for the reaction involving topoisomerase and / or DNA gyrase, instructions describing the method of the present invention, and the like.

EXAMPLES

Further, the present invention is described in more detail using the following examples. However, the present invention is not limited to these examples.

[Example 1]

Living cells and damaged cells of the microorganism are treated with topoisomerase poison and the degree of cleavage of each chromosomal DNA is determined.

1. Obtaining samples

1-1) Obtaining suspensions of living and damaged cells

Listeria monocytogenes (Listeria monocytogenes JCM 2873, hereinafter also referred to as "Listeria"), which is a gram-positive bacterium, is cultured at 30 ° C using BHI broth, 40 ml of culture medium containing cells in a logarithmic growth phase, centrifuged at 4 ° C and 8000 g for 15 minutes, after which the supernatant is removed. 40 ml of physiological saline are added to the cells, the mixture is stirred with sufficient intensity and centrifuged again under cooling under the same conditions, the supernatant is removed, 10 ml of physiological saline is added to the cells and a suspension of living cells is obtained. The number of living cells, measured on standard culture agar medium, in suspension is 1.2 × 10 ⁹ cfu / ml.

Then, 1 ml of the above suspension of living cells is placed in a 1.5 ml micro-tube, the tube is immersed in boiling water for 50 seconds and quickly cooled with ice water to obtain a suspension of damaged cells. It is believed that such a suspension contains a small number of living and dead cells, but it mainly consists of damaged cells, therefore, the suspension cells are described as “damaged”. In addition, the method of the present invention was originally intended for the detection of living cells, and cells of a microorganism other than living cells may be damaged or dead cells. The above applies to other bacteria listed below.

1-2) Topoisomerase Poison Treatment

To 9 ml of freshly obtained BHI broth (the number of both living and damaged cells in the medium is 1.2 × 10 ⁸ cfu / ml), 1 ml of each of the previously obtained suspensions of live and damaged Listeria cells (1.2 × 10 ⁹ cfu / ml, respectively) and then 100 μl of a solution of amsacrine in DMSO with a concentration of 5 mg / ml is added to the medium. The final concentration of amsacrine is 50 μg / ml, and the final concentration of DMSO is 1%. Then, cells of each type are incubated at 30 ° C for 24 hours, 48 hours or 72 hours.

To study the effect of active DNase remaining in damaged cells on the chromosomal DNA of damaged cells, 1 ml of a suspension of damaged cells is added to 9 ml of freshly prepared BHI broth, then 100 μl of DMSO is added to the medium instead of the above amsacrine solution (final concentration of DMSO: 1%) and cells are incubated at 30 ° C for 72 hours. As controls, a suspension of living cells and a suspension of damaged cells in a volume of 1 ml each are used.

1-3) DNA extraction

Each suspension was centrifuged at 4 ° C and 8000 g for 15 minutes, after which the supernatant was completely removed. To the precipitate was added 0.5 ml of a 5 mM EDTA solution and 20 μl of a pre-prepared achromopeptidase solution (Wako Pure Chemical Industries, catalog number: 014-09661) with a concentration of 5 mg / ml containing 10 mM aqueous NaCl solution, after which the mixture was left at 50 ° C for 30 minutes. Then, 0.5 ml of 10 mM Tris-HCl buffer (pH 8.0), 20 μl of protein kinase K, 1250 units / ml (Sigma, EC 3.4.21.64), 400 μl of a pre-prepared solution of SDS in sterile water with concentration of 10% (wt./about.), after which the reaction is allowed to proceed overnight at 50 ° C.

Each treated suspension was placed in 2 ml microtubes so that the suspension occupied half the volume of the tube, 0.5 ml Tris-HCl buffer (pH 8.0) / saturated phenol was added and mixed gently for 15 minutes. Then, 0.5 ml of chloroform was added and the mixture was gently mixed for 5 minutes. The mixture is centrifuged at 4 ° C and 6000 g for 10 minutes, the upper aqueous layer is transferred to a new 2 ml microtube, 70 μl of 3M sodium acetate buffer (pH 5.2) and 1.21 ml of 99.5% cold ethanol are added after which the mixture is gently mixed. The mixture is then centrifuged at 4 ° C and 15,000 g for 10 minutes, the supernatant is removed and the residue washed with 0.4 ml of 70% cold ethanol. To the precipitate was added 0.5 ml of TE buffer (10 mM Tris-HCl buffer, 1 mM EDTA · 2Na) and then the mixture was left overnight at 4 ° C to dissolve the DNA.

To the above DNA solution, 5 μl of a pre-prepared solution of RNase (Sigma, E.C. 3.1.27.5) in sterile water with a concentration of 10 mg / ml was added and the mixture was incubated at 37 ° C for 1 hour. Then 0.25 ml of a phenol / chloroform mixture (1/1) was added and gently stirred for 10 minutes, after which 0.25 ml of chloroform was added and gently mixed for 5 minutes. The mixture was centrifuged at 4 ° C and 6000 g for 10 minutes, the upper aqueous layer was transferred to a new 2 ml microtube, 50 μl of a 3M sodium acetate aqueous solution and 1 ml of 99.5% cold ethanol were added, and the mixture was carefully mixed. The mixture is then centrifuged at 4 ° C and 15,000 g for 10 minutes, the supernatant is removed, the residue is washed with 0.4 ml of 70% cold ethanol and the precipitate is dried (the above procedure is also called "RNase treatment").

125 μl of TE buffer was added to the dry precipitate, the mixture was left overnight at 4 ° C to dissolve the DNA, and extracted DNA was obtained. The absorbance values of the purified DNA solution are measured at 260 nm and 280 nm (OD ₂₆₀ , OD ₂₈₀ , OD ₂₆₀ of the 50 μg / ml DNA solution is 1.0, cell length: 1 cm), the DNA concentration is calculated based on the OD ₂₆₀ value, and the purity of the purified DNA is determined by the ratio of OD ₂₆₀ / OD ₂₈₀ .

2. Test Results

Chromosomal DNA extracted in steps 1-3) is subjected to electrophoresis using 0.8% agarose gel. After electrophoresis is complete, the agarose gel is immersed for 20 minutes in an aqueous solution of ethidium bromide at a concentration of 1 μg / ml, then washed twice with water purified on an ion exchange column, and the degree of cleavage of chromosomal DNA is determined using a UV transducer (wavelength: 254 nm )

The above extracted DNA was analyzed by electrophoresis. The results are shown in FIG. 1. FIG. 1 shows the effect of DNase contained in damaged cells on Listeria chromosomal DNA (damaged cells) and the effect of amsacrine on Listeria chromosomal DNA (living and damaged cells).

As a result, it was found that if amsacrine is not added to the suspension of damaged Listeria cells and the cells are incubated for up to 72 hours, then for the longest DNA fragment remaining in the well and the longest DNA fragment located about 19329 bp, significant no differences are observed, therefore, the chromosomal DNA of damaged Listeria cells is poorly cleaved by DNase, the activity of which remains in the damaged cells. However, if amsacrine is added to the damaged cells and the cells are incubated for up to 72 hours, the amount of the longest DNA fragment remaining in the well is clearly reduced, therefore, it can be assumed that the state in which the chromosomal DNA is cleaved is supported by amsacrine with the participation of active DNA gyrase or topoisomerase remaining in damaged Listeria cells.

In addition, if amsacrine is added to a suspension of live Listeria cells and the cells are incubated for up to 72 hours, the amount of the longest DNA fragment remaining in the well and the longest DNA fragment located at about 19329 bp temporarily decreases for 24 hours, and with continued incubation, the amount of both DNA fragments increases in proportion to the incubation time. The result suggests that amsacrine penetrates the walls of living cells after 24 hours and provides a state in which the cleavage of chromosomal DNA occurs in living cells, with the participation of DNA gyrase or topoisomerase, and the remaining living Listeria cells are weakly or slightly exposed to amsacrine, which amplified during the second incubation.

Amsacrine is a yellow, highly hydrophobic substance. Therefore, after a short incubation time, from 1 to 30 minutes, it penetrates poorly through the intact cell walls of highly hydrophilic living cells, and therefore the living cell pellet is white. However, since the damaged cells have damaged cell walls and increased hydrophobicity, amsacrine can penetrate through the walls of the damaged cells, and therefore the sediment of the damaged cells is colored yellow. This example confirms that in living and damaged cells, amsacrine, upon penetration through the cell walls, provides a state in which chromosomal DNA is cleaved everywhere, with the participation of intracellular DNA gyrase and / or topoisomerase. However, if amsacrine acts for a short period of time, the chromosomes of the damaged cells undergo mild, but selective cleavage at random, and therefore, additional processing of the cells for a short period of time with topoisomerase poison, such as amsacrine (for example, additional treatment after treatment with topoisomerase poison, such as EMA), allows PCR to distinguish living cells from damaged or dead cells with high sensitivity.

[Example 2]

The analysis of the 23S rRNA gene is carried out by PCR using the chromosomal DNA of living and damaged cells of microorganisms treated with DNA gyrase poison.

1. Obtaining samples

1-1) Obtaining suspensions of living and damaged cells

Enterobacter sakazakii (Enterobacter sakazakii strain ATCC 51329, hereinafter also referred to as "Enterobacter"), which is a gram-negative bacterium, is cultured at 37 ° C using BHI broth, 40 ml of culture medium containing cells in a logarithmic growth phase, centrifuged at 4 ° C and 8000 g for 15 minutes, after which the supernatant is removed. 40 ml of physiological saline are added to the cells, the mixture is stirred with sufficient intensity and centrifuged again under cooling under the same conditions, the supernatant is removed, 10 ml of physiological saline is added to the cells and a suspension of living cells is obtained. The number of living cells, measured on standard culture agar medium, in this suspension is 4.4 × 10 ⁸ cfu / ml.

Then, 1 ml of the above suspension of living cells is placed in a 1.5 ml micro-tube, the tube is immersed in boiling water for 50 seconds and quickly cooled with ice water to obtain a suspension of damaged cells.

A suspension of living cells and a suspension of damaged cells of Listeria monocytogenes JCM 2873 was prepared according to the method of Example 1. The number of living cells in a suspension of living cells was 4.0 × 10 ⁸ cfu / ml.

1-2) treatment with DNA gyrase poison (ciprofloxacin)

To 9 ml of freshly obtained BHI broth (the number of living and damaged Enterobacter cells in the medium is 4.4 × 10 ⁷ cfu / ml and 4.4 × 10 ⁷ cfu / ml, respectively, and the number of living and damaged Listeria cells in the medium is 4.0 × 10 ⁷ cfu / ml and 4.0 × 10 ⁷ cfu / ml, respectively) add 1 ml of each suspension of Enterobacter (living and damaged cells) and Listeria (living and damaged cells), after which 2 ml of ciprofloxacin solution ( 130 μg / ml in physiological saline).

To study the effect of active DNase remaining in the damaged cells on the chromosomal DNA of the damaged cells, 1 ml of each of the suspensions of the damaged cells Enterobacter and Listeria is added to 9 ml of freshly prepared BHI broth, and then 2 ml of physiological saline is added instead of the above ciprofloxacin.

Suspensions of Enterobacter (living and damaged cells) are then obtained, which are cultured at 37 ° C for 1 hour and 30 minutes, 3 hours and 30 minutes, 5 hours and 72 hours. Then get suspensions of Listeria (living and damaged cells), which are cultured at 37 ° C for 1 hour and 30 minutes, 3 hours and 30 minutes, 5 hours and 72 hours. In addition, suspensions of live and damaged Enterobacter and Listeria cells, to which ciprofloxacin was not added, were used as controls corresponding to a culture time of 0 hours.

All suspensions are centrifuged at 4 ° C and 8000 g for 15 minutes, the supernatant is completely removed and the precipitate is collected. Enterobacter and Listeria DNA are extracted using the following methods.

1-3) DNA extraction

Enterobacter DNA is extracted as follows.

To the precipitate was added 0.5 ml of 10 mM Tris-HCl buffer (pH 8.0), 10 μl of protein kinase K, 1250 units / ml (Sigma, EC 3.4.21.64) and 200 μl of a pre-prepared solution of SDS in sterile water with a concentration of 10% (w / v), after which the reaction was allowed to proceed overnight at 50 ° C. To the treated suspension, add 0.5 ml of a mixture of 1M Tris-HCl buffer (pH 8.0) / saturated phenol and mix gently for 15 minutes. Then, 0.5 ml of chloroform was added and the mixture was gently mixed for 5 minutes. The mixture is centrifuged at 4 ° C and 6000 g for 10 minutes, the upper aqueous layer is transferred to a new 2 ml microtube, 70 μl of 3M sodium acetate buffer (pH 5.2) and 1.29 ml of 99.5% cold ethanol are added after which the mixture is gently mixed. The mixture is then centrifuged at 4 ° C and 15,000 g for 10 minutes, the supernatant is removed and the residue washed with 0.4 ml of 70% cold ethanol. 0.5 ml of TE buffer (10 mM Tris-HCl buffer, 1 mM EDTA · 2Na) was added to the precipitate, and then the mixture was left overnight at 4 ° C to dissolve the DNA.

To the above DNA solution, 5 μl of a pre-prepared solution of RNase (Sigma, E.C. 3.1.27.5) in sterile water with a concentration of 10 mg / ml was added and the mixture was incubated at 37 ° C for 1 hour. Then 0.25 ml of a phenol / chloroform mixture (1/1) was added and gently stirred for 10 minutes, after which 0.25 ml of chloroform was added and gently mixed for 5 minutes. The mixture was centrifuged at 4 ° C and 6000 g for 10 minutes, the upper aqueous layer was transferred to a new 2 ml microtube, 50 μl of a 3M sodium acetate aqueous solution and 1 ml of 99.5% cold ethanol were added and mixed carefully. The mixture is then centrifuged at 4 ° C and 15,000 g for 10 minutes, the supernatant is removed, the residue is washed with 0.4 ml of 70% cold ethanol and the precipitate is dried (the above procedure is also called "RNase treatment").

125 μl of TE buffer was added to the dry precipitate, the mixture was left overnight at 4 ° C to dissolve the DNA, and extracted DNA was obtained. The absorbance values of the purified DNA solution are measured at 260 nm and 280 nm (OD ₂₆₀ , OD ₂₈₀ , OD ₂₆₀ of the 50 μg / ml DNA solution is 1.0, cell length: 1 cm), the DNA concentration is calculated based on the OD ₂₆₀ value, and the purity of the purified DNA is determined by the ratio of OD ₂₆₀ / OD ₂₈₀ .

Listeria DNA was extracted as described in Example 1, Step 1-3) DNA Extraction.

1-4) Electrophoresis of amplification products by PCR

Chromosomal DNA extracted in steps 1-3) is subjected to electrophoresis using 0.8% agarose gel. After electrophoresis is complete, the agarose gel is immersed for 20 minutes in an aqueous solution of ethidium bromide at a concentration of 1 μg / ml, then washed twice with water purified on an ion exchange column, and the degree of cleavage of chromosomal DNA is determined using a UV transducer (wavelength: 254 nm )

2. Test method (PCR using 23S rRNA gene as a template and electrophoresis)

2-1) Obtaining a PCR working mixture

Get a working mixture (total volume: 50 μl), which contains the following components:

Ex-Taq (Takara Shuzo, catalog number: RR001B): 0.25 μl

10 × Ex-Taq buffer (Takara Shuzo, catalog number: RR001B): 5 μl

dNTP mixture (Takara Shuzo, catalog number: RR001B): 4 μl

5 pmol / μl SEQ ID NO: 1 (23S-F) DNA: 2.5 μl

5 pmol / μl of SEQ ID NO: 2 (23S-R) DNA: 2.5 μl

5 pmol / μl SEQ ID NO: 3 (23S-MF) DNA: 2.5 μl

5 pmol / μl SEQ ID NO: 4 (23S-MR) DNA: 2.5 μl

2 × SYBA Green (BMA, Part Number: 50513): 10 μl

sterile water: 15.75 μl

DNA template (15 ng / μl): 10 μl

For amplification of almost the entire 23S rRNA region, primers with the sequences SEQ ID NO: 1 and 2 are used, which provide amplification of a fragment of approximately 2840 bp in size, mainly from gram-negative bacteria. Primers SEQ ID NOs: 3 and 4, corresponding to the central region of 23S rRNA, provide amplification of a fragment of approximately 900 bp. from gram-positive bacteria (and also from gram-negative bacteria).

2-2) PCR thermal cycle profile for amplification of 23S rRNA gene

The PCR thermal cycle profile for amplification of the Enterobacter 23S rRNA gene is shown in Table 1.

Table 1 Cycle Number of repetitions Stage Time Aging Temperature (° C) Interval of temperature increase (° C) one one one 03:00 a.m. four 2 one one 00:30 94 3 40 one 00:20 94 2 00:30 55 3 2:30 a.m. 72 four one one 03:00 a.m. 95 5 350 one 00:08 60 0.1 6 ∞ four

The PCR thermal cycle profile for amplification of the 23S Listeria rRNA gene is shown in Table 2.

table 2 Cycle Number of repetitions Stage Time Aging Temperature (° C) Interval of temperature increase (° C) one one one 03:00 a.m. four 2 one one 00:30 94 3 40 one 00:20 94 2 00:30 46 3 01:00 72 four one one 03:00 a.m. 95 5 350 one 00:08 60 0.1 6 ∞ four

All DNA solutions obtained in stages 1-3) are diluted to 15 ng / μl with TE buffer and 10 μl of the diluted solution is used as the DNA template in stages 2-1). That is, in 50 μl of the PCR reaction mixture contains 150 ng of the DNA matrix. As a negative control, 10 μl of TE buffer is used.

PCR and TM analysis (analysis of the melting temperature) of the amplification product is carried out in accordance with the above-mentioned PCR thermal cycle profile shown in paragraph 2-2) using an i Cycler real-time PCR device (Biorad, model number: iQ ) The threshold value (boundary value) of real-time PCR is determined by multiplying the standard deviation SD of the amount of fluorescence obtained using SYBA Green for 0-10 cycles by 10. Subsequently, in each real-time PCR amplification curve, the number of cycles exceeding the threshold value is denoted as "Ct value".

3. Test Results

The test results of this example are shown in FIG. 2-11. In FIG. Figure 2 shows the effect of intracellular DNase on Enterobacter chromosomal DNA (damaged cells). In FIG. Figure 3 shows the effect of ciprofloxacin on the chromosomal DNA of the same bacterium (living and damaged cells). In FIG. Figure 4 shows the effect of intracellular DNAse of damaged cells on Listeria chromosomal DNA (damaged cells). In FIG. Figure 5 shows the effect of ciprofloxacin on the chromosomal DNA of the same bacterium (living and damaged cells).

In addition, in FIG. Figure 6 shows the kinetic curve of amplification by real-time PCR using the live cryptofloxacin-treated Enterobacter 23S rRNA gene matrix. In FIG. 7 shows the results of the analysis of the TM curve of the amplification product indicated in FIG. 6. Similarly, the real-time PCR kinetic curve and the result of the analysis of the TM curve for damaged cells of the same bacterium treated with the same agent are shown in FIG. 8 and 9, respectively. In addition, the real-time kinetic curve of PCR for live and damaged Listeria cells treated with the same agent is shown in FIG. 10 and 11, respectively.

The results shown in FIG. 2 show that the chromosomal DNA of damaged cells is slightly cleaved by DNase, which remains in the damaged Enterobacter cells for 72 hours. However, as shown in FIG. 3, even if ciprofloxacin acts on damaged cells for 1.5-5 hours, DNA cleavage occurs to a much higher degree than under the action of the aforementioned DNase. In the case of living cells, the amount of a long chromosomal DNA fragment of approximately 19329 bp, on the contrary, increases, indicating that the short-term exposure to ciprofloxacin leads to more intense cleavage of chromosomal DNA by bacterial DNA gyrase in damaged cells compared to living cells .

As shown in FIG. 4, in damaged Listeria cells, cleavage of a long chromosomal DNA fragment of approximately 19329 bp under the action of intracellular DNase occurs to a small extent even after 72 hours. However, as shown in FIG. 5, the effect of ciprofloxacin on damaged cells for 72 hours leads to much more intense DNA cleavage under the action of the aforementioned DNase. It can be concluded that ciprofloxacin has the same effect and effect on living cells.

If exposure to ciprofloxacin lasts for 72 hours, the formation of PCR products is markedly suppressed for both living and damaged Enterobacter cells. However, as calculations show, Ct (living cells, exposure to ciprofloxacin for 72 hours) is Ct (living cells, lack of ciprofloxacin) = 13, and Ct (damaged cells, exposure to ciprofloxacin for 72 hours) is Ct (damaged cells, absence ciprofloxacin) = 17, the formation of PCR products is more strongly suppressed in the case of damaged cells. That is, if PCR is completed after 27 cycles, in the case of living cells, the result is positive, and in the case of damaged cells, negative. Thus, the data obtained confirm that the use of ciprofloxacin makes it possible to distinguish between living and damaged cells. Also in the case of Listeria, if the PCR is completed after 20 cycles, in the case of living cells, the result is positive, and in the case of damaged cells, negative, as shown in FIG. 10 and FIG. 11 respectively. Thus, the data obtained confirm that the use of the drug allows us to distinguish between living and damaged cells.

Analysis of TM curves of amplification products by PCR chromosomal DNA of living and damaged Enterobacter sakazakii cells treated with ciprofloxacin for 72 hours, shown in FIG. 7 and 9, shows that the PCR amplification product in the case of living cells corresponds to the 23S rRNA gene used as a template, while the PCR amplification product in the case of damaged cells does not correspond to the target amplification product. In the case of damaged cells, it is believed that the PCR amplification product is a 23S rRNA gene fragment resulting from several cleavages of the 23S rRNA gene of template DNA. As described above, the obtained data show that living and damaged cells can be differentially detected by PCR after treatment with ciprofloxacin.

[Example 3]

The analysis of chromosomal DNA of living and damaged cells of microorganisms treated with EMA is carried out by PCR using the 16S rRNA gene or 23S rRNA gene as a matrix.

1. Obtaining samples

1-1) Obtaining suspensions of gram-negative bacteria (living and damaged cells)

Each of Escherichia coli DH5or (hereinafter also referred to as "Escherichia coli"), Citrobacter koseri (Citrobacter koseri JCM 1658, hereinafter also referred to as "Citrobacter"), Salmonella enteritidis (Salmonella enteritidis HD 604, hereinafter also referred to as "Salmonella") and Klebsiella oxytoca (Klebsiella oxytoca JCM 1665, hereinafter also referred to as "Klebsiella") was cultured at 37 ° C using BHI broth, 40 ml of culture medium containing cells in a logarithmic growth phase, centrifuged at 4 ° C and 8000 g for 15 minutes after which the supernatant is removed. 40 ml of physiological saline are added to the cells, the mixture is stirred with sufficient intensity and centrifuged again under cooling under the same conditions, the supernatant is removed, 10 ml of physiological saline is added to the cells and a suspension of living cells is obtained. The number of living cells in the resulting suspensions is for Escherichia coli: 3.2 × 10 ⁸ cfu / ml, for Citrobacter: 6.7 × 10 ⁷ cfu / ml, for Salmonella: 1.9 × 10 ⁸ cfu / ml and for Klebsiella: 4.8 × 10 ⁸ cfu / ml.

Then, 1 ml of each of the above suspensions of living cells is placed in 1.5 ml microtubes, the tubes are immersed in boiling water for 50 seconds and quickly cooled with ice water to obtain a suspension of damaged cells.

1-2) Obtaining suspensions of gram-positive bacteria (living and damaged cells)

Bacillus cereus (Bacillus cereus JCM 2152, hereinafter also referred to as "Bacillus") and Staphylococcus epidermidis (Staphylococcus epidermidis KD, hereinafter also referred to as "Staphylococcus") are cultured at 37 ° C, and Listeria monocytogenes (Listeria monocytogenes JM 28 further also "Listeria") is cultured at 30 ° C, respectively, in BHI broth, 40 ml of each culture medium containing cells in a logarithmic growth phase (trophozoites in the case of Bacillus), centrifuged at 4 ° C and 8000 g for 15 minutes, after whereupon the supernatant is removed. Then, 40 ml of physiological saline is added to the cells, the mixture is stirred with sufficient intensity and centrifuged again under cooling under the same conditions, the supernatant is removed, 10 ml of physiological saline is added to the cells, and a suspension of living cells is obtained. The number of living cells in the resulting suspensions is for Bacillus: 3.0 × 10 ⁷ cfu / ml, for Listeria: 1.3 × 10 ⁸ cfu / ml and for Staphylococcus: 1.1 × 10 ⁶ cfu / ml.

Then, 1 ml of each of the above suspensions of living cells is placed in 1.5 ml microtubes, the tubes are immersed in boiling water for 50 seconds and quickly cooled with ice water to obtain a suspension of damaged cells.

2. Testing method

2-1) Stages of EMA processing and visible light exposure

10 μl of a 1000 μg / ml EMA solution obtained by dissolving EMA (Sigma, catalog number: E2028) in sterile water and filtering the solution through a 0.45 μm microfilter is added to each suspension of gram-negative bacteria (living and damaged cells) and gram-positive bacteria (living and damaged cells) in a volume of 1 ml, after which the mixture is left at 4 ° C for 30 minutes, protecting it from light. The suspension was then placed on ice and irradiated with visible light of 500 W power for 10 minutes using a lamp (FLOOD PRF, 100 V, 500 W, Iwasaki Electric Co., Ltd.) located 20 cm from the suspension. The above steps of adding an EMA solution and irradiating with visible light can also be called an “EMA treatment”. Separately, to 1 ml of each suspension of gram-negative bacteria (living and damaged cells) and gram-positive bacteria (living and damaged cells) 10 μl of sterile water is added instead of the EMA solution, after which the mixture is subjected to the EMA treatment described above.

2-2) DNA extraction

Micro-tubes containing live and damaged cells of gram-negative and gram-positive bacteria (in each case treated and not treated with EMA) are centrifuged at 4 ° C and 15,000 g for 10 minutes. 990 μl of physiological saline is added to each microtube, after which the mixture is stirred with sufficient intensity. Then the entire volume of the mixture was transferred to a 2 ml microtube and centrifuged at 4 ° C and 15000 g for 10 minutes, after which the supernatant was removed. Then using the method of example 1, stage 1-3) DNA extraction, carry out the extraction, determine the concentration and purity of DNA.

3. PCR using the 16S rRNA gene or 23S rRNA gene as a template

3-1) Obtaining a working mixture of PCR

Get a working mixture (total volume: 50 μl), which contains the following components:

Ex-Taq (Takara Shuzo, catalog number: RR001B): 0.25 μl

10 × Ex-Taq buffer (Takara Shuzo, catalog number: RR001B): 5 μl

dNTP mixture (Takara Shuzo, catalog number: RR001B): 4 μl

5 pmol / μl SEQ ID NO: 1 (23S-F) DNA: 2.5 μl

5 pmol / μl of SEQ ID NO: 2 (23S-R) DNA: 2.5 μl

5 pmol / μl SEQ ID NO: 3 (23S-MF) DNA: 2.5 μl

5 pmol / μl SEQ ID NO: 4 (23S-MR) DNA: 2.5 μl

5 pmol / μl SEQ ID NO: 5 (16S-F) DNA: 2.5 μl

5 pmol / μl of SEQ ID NO: 6 (16S-R) DNA: 2.5 μl

2 × SYBA Green (BMA, Part Number: 50513): 10 μl

sterile water: 15.75 μl

DNA template (15 ng / μl): 10 μl

3-2) PCR thermal cycle profile for amplification of the 16S rRNA gene

The PCR thermal cycle profile for amplification of the 16S rRNA gene for all bacteria is shown in Table 3.

Table 3 Cycle Number of repetitions Stage Time Aging Temperature (° C) Interval of temperature increase (° C) one one one 03:00 a.m. four 2 one one 00:30 94 3 40 one 00:20 94 2 00:30 55 3 01:30 72 four one one 03:00 a.m. 95 5 350 one 00:08 60 0.1 6 ∞ four

3-3) PCR thermal cycle profile for amplification of 23S rRNA gene

The PCR thermal cycle profile for amplification of the 23S rRNA gene for all bacteria is shown in table 4 (gram-negative bacteria) or table 5 (gram-positive bacteria).

Table 4 Cycle Number of repetitions Stage Time Aging Temperature (° C) Interval of temperature increase (° C) one one one 03:00 a.m. four 2 one one 00:30 94 3 40 one 00:20 94 2 00:30 46 or 55 3 2:30 a.m. 72 four one one 03:00 a.m. 95 5 350 one 00:08 60 0.1 6 ∞ four

Table 5 Cycle Number of repetitions Stage Time Aging Temperature (° C) Interval of temperature increase (° C) one one one 03:00 a.m. four 2 one one 00:30 94 3 40 one 00:20 94 2 00:30 46 3 01:00 72 four one one 03:00 a.m. 95 5 350 one 00:08 60 0.1 6 ∞ four

3-4) PCR

All DNA solutions obtained in stages 1-3) are diluted to 15 ng / μl with TE buffer and 10 μl of the diluted solution is used as the DNA template in stages 2-1). That is, in 50 μl of the PCR reaction mixture contains 150 ng of the DNA matrix. As a negative control, 10 μl of TE buffer is used.

PCR and TM analysis (melting point analysis) of the amplification product is carried out in accordance with the above-mentioned PCR thermal cycle profile, shown in paragraph 3-2) or 3-3), using an i Cycler real-time PCR device (Biorad , model number: iQ). The threshold value (boundary value) and the Ct value for real-time PCR are determined, as in example 2, stage 2-3).

3-5) Agarose gel electrophoresis

Using Seakem GTG agarose (FMC, catalog number: 50070) and TAE buffer (4.84 g / L Tris, 1.142 ml / L acetic acid, 0.149 g / L EDTA · 2Na), 0.8% agarose gel was obtained in X-EcoT14I hydrolyzate (Takara Shuzo, code: 3401) and Ladder DNA 100 bp were used as markers (Takara Shuzo, Code: 3407A). For each gram-negative and gram-positive bacteria, 10 μl of a PCR solution is placed in a well and subjected to electrophoresis. When bromphenol blue (BPB) migrates to approximately 90% of the gel, electrophoresis is stopped.

The gel in which electrophoresis is carried out is immersed for 20 minutes in an aqueous solution of ethidium bromide at a concentration of 1 μg / ml, then washed twice with water purified on an ion-exchange column, and then the PCR amplification product is observed using a UV transmission device (254 nm) .

4. Test Results

In FIG. 12 shows the temperature change of a bacterial suspension over time when a 1.5 ml microtube containing 1 ml of a bacterial suspension is immersed in boiling water. From the relationship shown in FIG. 12, it can be concluded that heat treatment by immersion in boiling water for 50 seconds, used to obtain suspensions of damaged cells, is a slightly more intense heat treatment than high-temperature short-term pasteurization carried out at 72-75 ° C for 15-16 seconds (HTST pasteurization), and therefore corresponds to such heat treatment as ultra-high temperature pasteurization (UHT pasteurization).

The results of differential detection of living and damaged cells using the 16S rRNA gene as a matrix are shown in FIG. 13, and the results of differential detection of living and damaged cells using the 23S rRNA gene as a matrix are shown in FIG. 14 and 15, respectively. In FIG. 13-15 PCR solutions for each bacterium are loaded onto the gel in the following order: suspensions of untreated EMA live cells, suspensions of untreated EMA live cells, suspensions of untreated EMA damaged cells, and suspensions of treated EMA damaged cells.

As shown in FIG. 13, if the 16S rRNA gene is used as a template, PCR amplification products for EMA-treated damaged Citrobacter and Klebsiella cells are not detected, therefore, living and damaged cells can be clearly distinguished. In the case of EMA-treated damaged cells of other bacteria, amplification products are present, and therefore, living and damaged cells cannot be clearly distinguished.

On the other hand, the results shown in FIG. 14 and 15 show that if the 23S rRNA gene is used as a template, living and damaged cells can be clearly distinguished after treatment with EMA in both gram-negative bacteria and gram-positive bacteria. If a test sample containing bacterial damaged cells at a level of 10 ⁸ cfu / ml as the background of the sample and 150 ng of the DNA matrix in a volume of 50 μl is used for PCR, the PCR of the damaged cells is completely suppressed, while the PCR of living cells is practically not suppressed. In addition, it was also shown that PCR can also be completely inhibited in the case of damaged cells contained in cow's milk in an amount of 10 ⁵ to 10 ⁷ cfu / ml, which allows the detection of living cells in low concentration. Therefore, this method can be used for screening common bacteria in the field of sanitary inspection of food products. In addition, in patients suffering from sepsis and impaired liver function, a high concentration of 10 ⁴ cfu / ml or higher of living and damaged cells can be observed in the blood, in which case only living cells can be detected using the method of the present invention.

[Example 4]

The pathogenic bacterium is treated with EMA and topoisomerase poison or DNA gyrase poison, after which living and damaged cells are differentially detected by PCR using the pathogenic gene as a matrix.

1. Obtaining a bacterial culture (living cells)

Suspensions of living and damaged Listeria cells (Listeria monocytogenes JCM 2873) were prepared according to the method of Example 1. The number of living cells in a suspension of living cells was 1.3 × 10 ⁵ cfu / ml.

2. Testing method

2-1) Stages of EMA processing and visible light exposure

Previously obtained suspensions of living and damaged Listeria cells were subjected to EMA and visible light irradiation according to the method of Example 3. EMAs most likely penetrate gram-positive bacteria cells that do not have an outer membrane, even if the cells are alive and have intact cell walls. Therefore, the incubation time of the suspension at 4 ° C in the absence of light after adding EMA is reduced to 5 minutes, and the time of irradiation with visible light is also reduced to 5 minutes. In addition, 10 μl of sterile water is added to the suspensions of living and damaged cells instead of the EMA solution, after which the above treatments are carried out.

2-2) Treatment with topoisomerase poison or DNA gyrase poison

After completion of the above stages of the EMA treatment and irradiation with visible light, the microtubes containing the treated suspensions are centrifuged at 4 ° C and 15000 g for 10 minutes, after which the supernatant is removed. To the cells add 1 ml of physiological saline, the mixture is stirred with sufficient intensity and centrifuged under the same conditions. The supernatant is removed, 1 ml of physiological saline is added to the cells, and the mixture is stirred with sufficient intensity. As described above, 1 tube contains 1 ml of a suspension of live cells not treated with EMA, 7 tubes contains 1 ml of a suspension of living cells not treated with EMA, 1 tube contains 1 ml of a suspension of damaged cells not treated with EMA, and 7 tubes contain 1 ml of a suspension of damaged cells treated with EMA.

Suspensions of living and damaged cells treated with EMA are divided into 6 groups, each of which includes 1 tube with a suspension of living cells and 1 tube with a suspension of damaged cells. To the suspensions of the first group add 8 μl of a solution of ciprofloxacin (0.5 mg / ml, in physiological saline), which is a DNA gyrase poison, to the suspensions of the second group add 10 μl of a solution of camptothecin (1 mg / ml, in dimethyl sulfoxide), which is a topoisomerase poison, 10 μl of etoposide solution (1 mg / ml, in dimethyl sulfoxide), which is a topoisomerase poison, is added to the suspensions of the third group; 5 μl of ellipticin solution (0.1 mg / ml, in dimethyl sulfoxide) is added to the suspensions of the fourth group which is presented is a topoisomerase poison, 10 μl of mitoxantrone solution (0.1 mg / ml, in dimethyl sulfoxide), which is a topoisomerase poison, is added to the suspensions of the fifth group, and 10 μl of amsacrine solution (1 mg / ml in dimethyl sulfoxide) is added to the suspensions of the sixth group ), which is a poison of topoisomerase, respectively. Each sample was incubated at 30 ° C for 30 minutes, then the sample was completely transferred to a 2 ml microtube and centrifuged at 4 ° C and 15,000 g for 10 minutes, after which the supernatant was removed.

2-3) DNA extraction step

DNA is extracted from all previously obtained samples according to the method of example 1, step 1-3) DNA extraction.

3. PCR using different Listeria genes as templates

3-1) Amplification of the pathogenic gene Listeria, gene listeriocin O (hlyA)

3-1-1) Obtaining a PCR working mixture

Get a working mixture (total volume: 50 μl), which contains the following components:

Ex-Taq (Takara Shuzo, catalog number: RR001B): 0.25 μl

10 × Ex-Taq buffer (Takara Shuzo, catalog number: RR001B): 5 μl

dNTP mixture (Takara Shuzo, catalog number: RR001B): 4 μl

5 pmol / μl SEQ ID NO: 7 (hlyA-F) DNA: 2.5 μl

5 pmol / μl SEQ ID NO: 8 (hlyA-R) DNA: 2.5 μl

2 × SYBA Green (BMA, Part Number: 50513): 10 μl

sterile water: 15.75 μl

DNA template (15 ng / μl): 10 μl

3-1-2) PCR thermal cycle profile for hlyA gene amplification

Table 6 Cycle Number of repetitions Stage Time Aging Temperature (° C) Interval of temperature increase (° C) one one one 03:00 a.m. four 2 one one 00:30 94 3 fifty one 00:20 95 2 01:00 60 four one one 03:00 a.m. 95 5 350 one 00:08 60 0.1 6 ∞ four

3-1-3) PCR

All DNA solutions obtained in the above Steps 2-3) are diluted to 15 ng / μl with TE buffer and 10 μl of the diluted solution is used as the DNA template in the Steps 3-1-1 above). That is, in 50 μl of the PCR reaction mixture contains 150 ng of the DNA matrix. As a negative control, 10 μl of TE buffer is used.

PCR is carried out in accordance with the above-mentioned PCR thermal cycle profile shown in paragraph 3-1-2 above, using a real-time PCR device i Cycler (Biorad, model number: iQ).

3-2) Amplification of the 16S rRNA and 23S rRNA genes

3-2-1) Obtaining a PCR working mixture

The working mixture (total volume: 50 μl) was obtained according to the method of example 3, stage 3-1) Obtaining a working mixture of PCR.

3-2-2) PCR thermal cycle profile for amplification of the 16S rRNA gene

Use the "PCR thermal cycle profile for amplification of the 16S rRNA gene" shown in example 3, step 3-2) (table 3).

3-2-3) PCR thermal cycle profile for amplification of the 23S rRNA gene of a gram-positive bacterium

Use the "PCR thermal cycle profile for amplification of the 23S gram-positive bacteria rRNA gene" shown in Example 3, Step 3-3) (Table 5).

3-2-4) PCR

All DNA solutions obtained in stages 2-3) are diluted to 15 ng / μl with TE buffer and 10 μl of the diluted solution is used as a DNA template in the above steps 3-1-1) or 3-2-1). That is, in 50 μl of the PCR reaction mixture contains 150 ng of the DNA matrix. As a negative control, 10 μl of TE buffer is used.

PCR is carried out in accordance with the above-mentioned PCR thermal cycle profile shown in paragraph 3-2-2) or 3-2-3) above using a real-time PCR device i Cycler (Biorad, model number: iQ) .

3-3) Electrophoresis of PCR amplification product in agarose gel

Electrophoresis is carried out according to the method of example 2, stage 1-4) Electrophoresis of the PCR amplification product. A 3% agarose gel is used to detect the hlyA gene amplification product.

4. Test Results

The results obtained using the hlyA gene as a template are shown in FIG. 16, and the results obtained using the 16S rRNA gene and 23S rRNA gene as a template are shown in FIG. 17 and 18, respectively.

The results shown in FIG. 16 and 17 show that when hlyA and 16S rRNA genes are used as a template, amplification of the DNA of damaged cells after EMA treatment is only slightly suppressed. However, if along with the EMA treatment, the treatment is carried out with topoisomerase poison or DNA gyrase poison, the amplification of the DNA of damaged cells is suppressed more strongly. In particular, after using etoposide, mitoxantrone or amsacrine along with EMA, when using the hlyA gene as a matrix, and after using camptothecin, etoposide, ellipticin or amsacrine along with EMA, when using the 16S rRNA gene as a matrix, the amplification of damaged DNA is suppressed to a large extent.

In addition, the results shown in FIG. 18 show that when using the 23S rRNA gene as a template, the PCR of living cells is also significantly suppressed after treatment with EMA and other topoisomerase venom or DNA gyrase venom.

In order to quickly conduct differential detection of living, damaged, and dead cells of a particular pathogenic bacterium, it is preferable to use a shorter portion of the gene, for example, 100-200 bp in size, providing increased specificity for the pathogenic gene. It is believed that if the target region has the short length indicated above, it does not cleave, and its amplification occurs even if EMA penetrates the cell walls of damaged cells and causes DNA cleavage, and as a result, PCR suppression does not occur. On the other hand, even if a very short hlyA gene of 113 bp is used as the template, after treatment with EMA in combination with topoisomerase poison or DNA gyrase poison, PCR of damaged Listeria cells with a concentration of 10 ⁸ cfu / ml is almost completely suppressed, then how the PCR of living cells is not suppressed.

It is believed that this occurs, for example, as a result of the fact that the topoisomerase venom causes random cross-linking of DNA at positions different from those in which cross-linking occurs under the influence of EMA, inhibiting the re-ligation of cleaved sites and the re-ligation under the action of still active intracellular DNA -girazyes of bacterial topoisomerases I, III, and IV in damaged cells, which leads to widespread DNA cleavage to a greater extent than after treatment with EMA alone, and even short target gene size 100-200 bp

Therefore, reliable differential detection of live, damaged, or dead cells of a specific pathogenic bacterium in a food product or various clinical samples containing background damaged cells of a specific pathogenic bacterium in high concentration can be performed. However, in order to inhibit the formation of the PCR amplification product in the case of dead cells, it is preferable to add ATP and Mg ²⁺ in advance, as well as topoisomerase or DNA gyrase (enzyme), since topoisomerase or DNA gyrase in dead cells, unlike damaged cells, can be found in inactivated state.

For example, in the sputum of a tuberculosis patient receiving an anti-tuberculosis drug, at the middle or late stage of treatment, the concentration of damaged Mycobacterium tuberculosis cells as a result of the action of this agent is from 10 ⁸ to 10 ⁹ cfu / ml. And even in this case, the method of the present invention allows only living cells to be detected.

[Example assignment 1] Obtaining test samples from food

A method of obtaining one of the test samples suitable for use in the method of the present invention is described below using cow's milk infected with a microorganism as a food product.

An EDTA solution is added to the cow's milk to obtain a final concentration of 1-5 mM, preferably 2 mM, and Tween 80 to obtain a final concentration of 0.1-0.5%, preferably 0.1%, after which the mixture is centrifuged at 4 ° C and 10,000 g for 10 minutes. It is desirable to add lipase (Sigma, EC 3.1.1.3) to obtain a final concentration of 10-20 u / ml, after which the reaction mixture is left to stand at 30-37 ° C for a period of 30 minutes to 1 hour, then proteinase K is added ( Sigma, EC 3.4.21.64) to give a final concentration of 20 units / ml and incubate the mixture for a period of 30 minutes to 1 hour. The surface lipid layer and the middle aqueous layer are removed and a precipitate is collected. The precipitate contains bacteria and somatic cells, such as breast epithelial cells and bovine leukocytes, and if the mixture is centrifuged at 10,000 g or more, it may additionally contain micellar protein degradation products (products of incomplete degradation of micellar casein) resulting from incomplete decomposition by K. proteinases. Presumably, products of incomplete degradation of micellar casein consist of highly hydrophobic α, β casein submicelles.

A physiological solution is added to the precipitate, the volume of which is equal to the initial volume of the mixture, to obtain a suspension that is centrifuged at 4 ° C and 100 g for 5 minutes, after which the supernatant containing microorganisms and the like are collected.

[Assignment Example 2] Obtaining Test Samples from Blood

(one)

An equal volume of saline is added to the heparinized blood, after which the mixture is centrifuged at 4 ° C and 10,000 g for 5 minutes, the supernatant is removed, and the precipitate is collected. The precipitate contains bacteria, platelets, mononuclear cells such as monocytes and lymphocytes, granulocytes and red blood cells.

[Assignment Example 3] Obtaining Test Samples from Blood

(2)

An equal volume of saline is added to the heparinized blood, after which the mixture is centrifuged at 4 ° C and 100 g for 5 minutes to divide the mixture into plasma and blood cells (mononuclear cells such as monocytes and lymphocytes, granulocytes and erythrocytes), after which plasma containing microorganisms is collected.

[Assignment Example 4] Obtaining Test Samples from Blood

(3)

An equal volume of saline is added to heparinized blood. Ficoll pack [Amersham Bioscience, 5.7 g / 100 ml of ficoll 400, 9 g / 100 ml of sodium diatrizoate, density: 1.077 g / ml], the volume of which is equal to the volume of twice diluted heparinized blood, is first added to the sterile tube then the aforementioned twice diluted heparinized blood is slowly layered on it, holding the tube in an inclined state. The layers are then centrifuged at 4 ° C and 100 g for 5 minutes, after which the supernatant containing microorganisms is collected. Preferably, before layering the twice-diluted heparinized blood onto a ficoll pack, a lipase solution (Sigma, EC 3.1.1.3) is added to a final concentration of 10-20 units / ml, then a solution of deoxyribonuclease I (Sigma, EC 3.1.21.1) is added, 10-50 units / ml, the reaction mixture is incubated at 30-37 ° C for a period of 30 minutes to 1 hour, after which proteinase K (Sigma, EC 3.4.21.64) is added to a final concentration of 10-20 units / ml and the reaction mixture is incubated at 30-37 ° C for a period of 30 minutes to 1 hour.

[Assignment Example 5] Obtaining Test Samples from Blood

(four)

Monopoly ™ [Amersham Bioscience, a mixture of ficoll and metrizoate, density: 1.115 g / ml], the volume of which is 1/2 the volume of heparinized blood, is first added to the sterile tube, and then heparinized blood is slowly layered on it, keeping the tube in an inclined state. The layers are then centrifuged at 4 ° C and 100 g for 5 minutes, after which the supernatant containing bacteria is collected.

Industrial application

The method of the present invention allows to selectively detect living cells (viable and cultivable condition) of a microorganism present in food products or clinical samples against dead cells (dead state) and damaged cells (viable but not cultivable condition), method It is an alternative to the cultivation method, but surpasses it in characteristics.

LIST OF SEQUENCES

<110> Morinaga Milk Industry Co., Ltd.

<120> A method for detecting a microorganism and a kit for detecting a microorganism

<130> OP-C5307-PCT

<160> 8

<170> PatentIn version 3.1

<210> 1

<211> 25

<212> DNA

<213> Artificial

<220>

<223> primer 23S-F

<400> 1

cagtcagagg cgatgaagga cgtgc 25

<210> 2

<211> 25

<212> DNA

<213> Artificial

<220>

<223> primer 23S-R

<400> 2

ccggttagct caacccatcg ctgcg 25

<210> 3

<211> 21

<212> DNA

<213> Artificial

<220>

<223> primer 23S-MF

<400> 3

accaggattt tggcttagaa g 21

<210> 4

<211> 20

<212> DNA

<213> Artificial

<220>

<223> primer 23S-MR

<400> 4

cacttacccc gacaaggaat 20

<210> 5

<211> 16

<212> DNA

<213> Artificial

<220>

<223> primer 16S-F

<400> 5

agtttgatcc tggctc 16

<210> 6

<211> 16

<212> DNA

<213> Artificial

<220>

<223> primer 16S-R

<400> 6

ggctaccttg ttacga 16

<210> 7

<211> 19

<212> DNA

<213> Artificial

<220>

<223> hlyA-F primer

<400> 7

tgcaagtcct aagacgcca 19

<210> 8

<211> 24

<212> DNA

<213> Artificial

<220>

<223> hlyA-R primer

<400> 8

cactgcatctccgtggtatactaa 24

Claims (52)

1. A method for detecting living cells of a microorganism by differentiating living cells from dead cells or damaged cells in a test sample, which comprises the following steps:
a) the step of treating the test sample with topoisomerase poison or DNA gyrase poison,
b) a step for extracting DNA from the test sample and amplifying the target region of the extracted DNA by PCR, where the length of the target region is from 900 to 3000 nucleotides, and
c) a step for analyzing the amplification product. 2. A method for detecting living cells of a microorganism by differentiating living cells from dead cells or damaged cells in a test sample, which comprises the following steps:
a) the stage of processing the test sample with the poison of topoisomerase and the poison of DNA gyrase,
b) a step for extracting DNA from the test sample and amplification of the target region of the extracted DNA by PCR, where the length of the target region is from 100 to 3000 nucleotides, and
c) a step for analyzing the amplification product. 3. The method according to claim 1, where the amplification product is analyzed using a standard curve that reflects the dependence of the amount of amplification product on the amount of microorganism, which is obtained using standard samples of the microorganism. 4. The method according to claim 2, where the amplification product is analyzed using a standard curve reflecting the dependence of the amount of amplification product on the amount of microorganism, which is obtained using standard samples of the microorganism. 5. The method according to claim 3, where the PCR is carried out in real time simultaneously with the analysis of the amplification product. 6. The method according to claim 4, where the PCR is carried out in real time simultaneously with the analysis of the amplification product. 7. The method according to any one of claims 1 to 6, where the test sample is milk, a dairy product, a food product obtained using milk or a dairy product as a raw material, a blood sample, a urine sample, a sample of cerebrospinal fluid, a sample of synovial fluid, and pleural fluid sample. 8. The method according to any one of claims 1 to 6, where the microorganism is a bacterium. 9. The method of claim 8, where the target region is a pPHK 23S gene. 10. The method according to claim 9, where the PCR is carried out using a set of primers containing primers SEQ ID NO: 1 and 2, or a set of primers containing primers SEQ ID NO: 3 and 4. 11. The method according to any one of claims 1 to 6, where the microorganism is a pathogenic bacterium. 12. The method according to claim 11, where the target region is preferably a pathogenic gene. 13. The method according to item 12, where the PCR is preferably carried out using a set of primers containing primers SEQ ID NO: 7 and 8. 14. The method according to any one of claims 1 to 6, 9-10 and 12, 13, wherein the topoisomerase venom is selected from amsacrine, camptothecin, doxorubicin, ellipticin, etoposide, mitoxantrone, sintopin, topotecan and CP-115953. 15. The method according to any one of claims 1 to 6, 9-10 and 12, 13, wherein the DNA gyrase poison is selected from ciprofloxacin, ofloxacin, enoxacin, pefloxacin, fleroxacin, norfloxacin, nalidixic acid, oxolinic acid and pyromidic acid. 16. The method according to any one of claims 1 to 6, 9-10 and 12, 13, wherein the topoisomerase venom and / or the DNA gyrase venom is ethidium monoazide, and the method includes the step of irradiating the test sample to which ethidium monoazide is added, visible by the light. 17. The method according to clause 16, where the test sample is treated with ethidium monoazide and topoisomerase poison and / or DNA gyrase poison other than ethidium monoazide. 18. The method according to any one of claims 1 to 6, 9-10 and 12 and 13, where before stage a) is carried out:
d) the step of treating the test sample with topoisomerase and / or DNA gyrase. 19. A kit for detecting living cells of a microorganism by differentiating living cells from dead cells or damaged cells in a test sample and detecting living cells by PCR, which contains the following components:
topoisomerase poison or DNA gyrase poison and primers for amplification of the target portion of the DNA of the microorganism detected by PCR, where the length of the target portion is from 900 to 3000 nucleotides. 20. A kit for detecting living cells of a microorganism by differentiating living cells from dead cells or damaged cells in a test sample and detecting living cells by PCR, which contains the following components:
topoisomerase poison and DNA gyrase poison and primers for amplification of the target portion of the DNA of the microorganism detected by PCR, where the length of the target portion is from 100 to 3000 nucleotides. 21. The kit according to claim 19, which further comprises topoisomerase and / or DNA gyrase. 22. The kit according to claim 20, which further comprises topoisomerase and / or DNA gyrase. 23. A kit according to any one of claims 19-22, wherein the topoisomerase venom is selected from amsacrine, camptothecin, doxorubicin, ellipticin, etoposide, mitoxantrone, sintopin, topotecan and CP-115953. 24. A kit according to any one of claims 19-22, wherein the DNA gyrase poison is selected from ciprofloxacin, ofloxacin, enoxacin, pefloxacin, fleroxacin, norfloxacin, nalidixic acid, oxolinic acid and pyromidic acid. 25. A kit according to any one of claims 19-22, which contains ethidium monoazide and topoisomerase poison and / or DNA gyrase poison other than ethidium monoazide. 26. The kit according to any one of paragraphs.19-22, where the set of primers contains primers SEQ ID NO: 1 and 2 or primers SEQ ID NO: 3 and 4. 27. The kit according to any one of paragraphs.19-22, where the set of primers contains primers SEQ ID NO: 7 and 8. 28. The method according to claim 7, where the microorganism is a bacterium. 29. The method according to claim 7, where the microorganism is a pathogenic bacterium. 30. The method according to claim 7, where the topoisomerase venom is selected from amsacrine, camptothecin, doxorubicin, ellipticin, etoposide, mitoxantrone, sintopin, topotecan and CP-115953. 31. The method of claim 8, wherein the topoisomerase venom is selected from amsacrine, camptothecin, doxorubicin, ellipticin, etoposide, mitoxantrone, sintopin, topotecan, and CP-115953. 32. The method according to claim 11, where the topoisomerase venom is selected from amsacrine, camptothecin, doxorubicin, ellipticin, etoposide, mitoxantrone, sintopin, topotecan and CP-115953. 33. The method according to claim 7, where the DNA gyrase poison is selected from ciprofloxacin, ofloxacin, enoxacin, pefloxacin, fleroxacin, norfloxacin, nalidixic acid, oxolinic acid and pyromidic acid. 34. The method of claim 8, where the DNA gyrase poison is selected from ciprofloxacin, ofloxacin, enoxacin, pefloxacin, fleroxacin, norfloxacin, nalidixic acid, oxolinic acid and pyromidic acid. 35. The method according to claim 11, where the DNA gyrase poison is selected from ciprofloxacin, ofloxacin, enoxacin, pefloxacin, fleroxacin, norfloxacin, nalidixic acid, oxolinic acid and pyromidic acid. 36. The method according to claim 7, where the topoisomerase poison and / or the DNA gyrase poison is ethidium monoazide, and the method includes the step of irradiating the test sample to which ethidium monoazide is added with visible light. 37. The method of claim 8, wherein the topoisomerase venom and / or DNA gyrase venom is ethidium monoazide, and the method comprises the step of irradiating the test sample to which ethidium monoazide is added with visible light. 38. The method according to claim 11, where the topoisomerase venom and / or DNA gyrase venom is ethidium monoazide, and the method comprises the step of irradiating the test sample to which ethidium monoazide is added with visible light. 39. The method according to claim 7, where before stage a) is carried out:
d) the step of treating the test sample with topoisomerase and / or DNA gyrase. 40. The method of claim 8, where before stage a) is carried out:
d) the step of treating the test sample with topoisomerase and / or DNA gyrase. 41. The method according to claim 11, where before stage a) is carried out:
d) the step of treating the test sample with topoisomerase and / or DNA gyrase. 42. The method according to 14, where before stage a) is carried out:
d) the step of treating the test sample with topoisomerase and / or DNA gyrase. 43. The method according to clause 15, where before stage a) is carried out:
d) the step of treating the test sample with topoisomerase and / or DNA gyrase. 44. The method according to clause 16, where before stage a) is carried out:
d) the step of treating the test sample with topoisomerase and / or DNA gyrase. 45. The kit according to item 23, which contains ethidium monoazide and topoisomerase poison and / or DNA gyrase poison, other than ethidium monoazide. 46. The kit according to paragraph 24, which contains ethidium monoazide and topoisomerase poison and / or DNA gyrase poison other than ethidium monoazide. 47. The kit according to item 23, where the set of primers contains primers SEQ ID NO: 1 and 2 or primers SEQ ID NO: 3 and 4. 48. The kit according to paragraph 24, where the set of primers contains primers SEQ ID NO: 1 and 2 or primers SEQ ID NO: 3 and 4. 49. The kit according A.25, where the set of primers contains primers SEQ ID NO: 1 and 2 or primers SEQ ID NO: 3 and 4. 50. The kit according to item 23, where the set of primers contains primers SEQ ID NO: 7 and 8. 51. The kit according to paragraph 24, where the set of primers contains primers SEQ ID NO: 7 and 8. 52. The kit according A.25, where the set of primers contains primers SEQ ID NO: 7 and 8.

Images