JP2022043936A - Methods for determining existence state of organisms having cell wall and methods for identifying organisms having cell wall - Google Patents

Abstract

To provide simple methods for determining the existence state of organisms in a measurement sample, and simple methods for identifying organisms having a cell wall in a measurement sample.SOLUTION: A method for determining the existence state of an organism having a cell wall comprises soaking a measurement sample in an aqueous solvent to prepare a liquid sample, or providing a measurement sample in an aqueous solvent as a liquid sample; and detecting one or more sRNA species in the liquid sample to determine the existence state of the organism having the cell wall in the liquid sample on the basis of the existence state of the one or more sRNA species, where the one or more sRNA species comprise at least one of the sRNA species represented by SEQ ID Nos 15-54. A method for identifying an organism having a cell wall identifies the organism having the cell wall which exists in a measurement sample on the basis of the existence state of the one or more sRNA species.SELECTED DRAWING: None

Description

The present disclosure relates to a method for determining the existence state of an organism having a cell wall and a method for identifying an organism having a cell wall.

In the field where hygiene management such as food manufacturing, medical care, welfare, and home is required, it is important to manage organisms such as bacteria that have an unfavorable effect on the human body. Most of the bacteria in the environment are harmless, but some bacteria cause food poisoning, spoilage or spoilage of products, and are a major obstacle to people's lives.

In recent years, attempts to detect bacteria by some method (so-called "visualization") and use the detection results as an index for hygiene management related to bacteria are becoming widespread. Here, when detecting a bacterium, the most basic detection method is a culture method. The culture method is a method of culturing a bacterium on a medium and detecting the bacterium based on the morphology of the bacterium.

As a method for detecting a microorganism other than the culture method, a method for recognizing a surface antigen of a microorganism with an antibody (antibody method) can be mentioned. Typical examples of the antibody method include an immunochromatography method, a latex agglutination method, and an ELISA method.

Examples of the method for detecting a microorganism other than the above method include a method for detecting a microorganism based on a gene contained in the microorganism (gene method). The gene method is a method for identifying the type of a microorganism by examining the presence or absence of a nucleic acid sequence constituting a part of a gene contained in the microorganism to be detected. Nucleic acid molecules containing nucleic acid sequences used for identification include DNA and ribosomal RNA called 16S rRNA. For example, in Japanese Patent Application Laid-Open No. 2013-93, Mycobacterium avium and Mycobacterium avium are detected based on the nucleotide sequence of 16S rRNA.

DNA is a nucleic acid possessed by almost all organisms, and 16S rRNA is a nucleic acid possessed by almost all organisms. These nucleic acids are present in large quantities in the living body. Therefore, DNA is suitable as a target for detection, and has been conventionally used for research on detection of microorganisms based on gene sequences. Similarly, 16S rRNA is also suitable as a detection target and has been conventionally used for research on the detection of microorganisms based on gene sequences. In the sequence of DNA, there is a part having a conservative sequence among species and a part having a different sequence for each species. Species can be identified based on the part where the sequence is different for each species. Similarly, in the sequence of 16s rRNA, there is a part having a conservative sequence among species and a part having a different sequence for each species. Species can be identified based on the part where the sequence is different for each species.

An object of the present disclosure is to provide a determination method capable of easily determining the existence state of an organism in a measurement sample, and an identification method capable of easily identifying an organism contained in the measurement sample.

<1> Immersing the measurement sample in an aqueous solvent to prepare a liquid sample, or preparing a measurement sample that is an aqueous solvent as a liquid sample.
To detect the presence or absence of one or more types of sRNA in the liquid sample,
Determining the existence state of an organism having a cell wall based on the existence state of one or more types of sRNA.
Including
The one or more sRNAs comprises at least one of the sRNAs represented by SEQ ID NOs: 15-54.
A method for determining the existence state of an organism having a cell wall.
<2> The determination method according to <1>, wherein the one or more types of sRNA include at least one of the sRNAs represented by SEQ ID NOs: 19 to 21 and 40.
<3> The determination method according to <1> or <2>, wherein the one or more types of sRNA show a specific expression state in an organism having the cell wall.
<4> Any one of <1> to <3>, in which determining the existence state of the organism having the cell wall includes determining the overall existence state of two or more kinds of organisms having the cell wall. Judgment method described in 1.
<5> The determination method according to any one of <1> to <4>, wherein detecting the presence state of the sRNA includes detecting the abundance of the sRNA.
<6> The determination method according to any one of <1> to <5>, wherein the organism having the cell wall includes at least one selected from the group consisting of Escherichia coli, Citrobacter freundii, and Salmonella gallinarum.
<7> The determination method according to any one of <1> to <5>, wherein the organism having a cell wall contains a verotoxin-producing bacterium.
<8> The measurement sample is a measurement sample obtained by collecting airborne substances, and determining the existence state of an organism having a cell wall in the air determines the existence state of an organism having a cell wall existing in the air. The determination method according to any one of <1> to <7>, which includes the above.
<9> The determination method according to any one of <1> to <8>, wherein the immersion is performed at a temperature within the temperature range of 0 ° C to 50 ° C.
<10> The determination method according to any one of <1> to <9>, wherein the number of bases of each of the one or more types of sRNA is in the range of 5 to 500.
<11> The one or more types of sRNA are EC-5p-36 having the nucleotide sequence represented by SEQ ID NO: 1, EC-3p-40 having the nucleotide sequence represented by SEQ ID NO: 2, and SEQ ID NO: 10. EC-5p-79 having a nucleotide sequence represented by, EC-3p-393 having a nucleotide sequence represented by SEQ ID NO: 11, fox_milRNA_5 having a nucleotide sequence represented by SEQ ID NO: 9, and represented by SEQ ID NO: 4. 1 described in any one of <1> to <10> further comprising at least one selected from the group consisting of miR156 having a nucleotide sequence and miR716b having a nucleotide sequence represented by SEQ ID NO: 5. Judgment method.
<12> The determination method according to any one of <1> to <11>, wherein the aqueous solvent contains a reagent for nucleic acid amplification.
<13> The determination method according to any one of <1> to <12>, wherein the detection of the existence state of the one type or a plurality of types of sRNA is performed by isothermal gene amplification.
<14> The determination method according to <13>, wherein the isothermal gene amplification is performed at a temperature within the temperature range of 10 ° C to 40 ° C.
<15> The determination method according to any one of <1> to <12>, wherein the presence state of the one type or a plurality of types of sRNA is detected by PCR.
<16> Immersing the measurement sample in an aqueous solvent to prepare a liquid sample, or preparing a measurement sample that is an aqueous solvent as a liquid sample.
To detect the presence or absence of one or more types of sRNA in the liquid sample,
To identify an organism having a cell wall present in the measurement sample based on the presence state of the one or more types of sRNA.
Including
The one or more sRNAs comprises at least one of the sRNAs represented by SEQ ID NOs: 15-54.
A method for identifying an organism having a cell wall.
<17> The identification method according to <16>, wherein the one or more kinds of sRNAs contain at least one kind of sRNA represented by SEQ ID NOs: 19 to 21 and 40.
<18> The identification method according to <16> or <17>, wherein the one or more types of sRNA show a specific expression state depending on an organism having a cell wall.
<19><16> to <18>, identifying an organism having a cell wall present in the measurement sample includes identifying one or more of two or more candidate organisms. The identification method according to any one of them.
<20> The identification method according to any one of <16> to <19>, wherein detecting the presence state of the sRNA comprises detecting the abundance of the sRNA.
<21> The measurement sample is a measurement sample obtained by collecting airborne substances, and identifying an organism having the cell wall includes identifying an organism having a cell wall existing in the air. <16>> To <20> according to any one of the identification methods.
<22> The identification method according to any one of <16> to <21>, wherein the immersion is performed at a temperature within the temperature range of 0 ° C to 50 ° C.
<23> The identification method according to any one of <16> to <22>, wherein the number of bases of each of the one or more types of sRNA is in the range of 5 to 500.
<24> The one or more types of sRNA are EC-5p-36 having the nucleotide sequence represented by SEQ ID NO: 1, EC-3p-40 having the nucleotide sequence represented by SEQ ID NO: 2, and SEQ ID NO: 10. EC-5p-79 having a nucleotide sequence represented by, EC-3p-393 having a nucleotide sequence represented by SEQ ID NO: 11, fox_milRNA_5 having a nucleotide sequence represented by SEQ ID NO: 9, and represented by SEQ ID NO: 4. The invention according to any one of <16> to <23>, further comprising at least one selected from the group consisting of miR156 having a nucleotide sequence and miR716b having a nucleotide sequence represented by SEQ ID NO: 5. Identification method.
<25> The identification method according to any one of <16> to <24>, wherein the aqueous solvent contains a reagent for nucleic acid amplification.
<26> The identification method according to any one of <16> to <25>, wherein the detection of the existence state of the one type or a plurality of types of sRNA is performed by isothermal gene amplification.
<27> The identification method according to <26>, wherein the isothermal gene amplification is performed at a temperature within the temperature range of 10 ° C to 40 ° C.
<28> The identification method according to any one of <16> to <25>, wherein the presence or absence of the one or more types of sRNA is detected by PCR.

According to the present disclosure, there is provided a determination method capable of easily determining the existence state of an organism having a cell wall in a measurement sample, and an identification method capable of easily identifying an organism having a cell wall contained in the measurement sample.

E. in Reference Example 5 It is a figure which shows the result of the detection by the isothermal gene amplification of the coli-derived sRNA. It is a figure which shows the result of the electrophoresis of the nucleic acid extract in Reference Example 10.

The contents of the present disclosure will be described in detail below. The description of the constituents described below may be based on the representative embodiments of the present disclosure, but the present disclosure is not limited to such embodiments.
In the numerical range described stepwise in the present disclosure, the upper limit value or the lower limit value described in one numerical range may be replaced with the upper limit value or the lower limit value of the numerical range described in another stepwise description. .. Further, in the numerical range described in the present disclosure, the upper limit value or the lower limit value of the numerical range may be replaced with the values shown in Examples and Reference Examples.

Further, in the present disclosure, the description of the content of a component means the total amount of the plurality of substances contained in the case where a plurality of substances corresponding to each component are contained, unless otherwise specified.

Further, in the present disclosure, "% by mass" and "% by weight" are synonymous, and "parts by mass" and "parts by weight" are synonymous.
In the present disclosure, when a plurality of elements are listed using "or" or "or", a combination of the plurality of elements is selected unless a technical contradiction occurs, unless otherwise specified. Do not rule out what to do.
Even if an element is expressed in the singular form in the present disclosure, the existence of a plurality of elements is not excluded unless a technical contradiction arises, unless otherwise specified.
Further, in the present disclosure, a plurality of exemplary embodiments described separately may be combined with each other to form a new embodiment as long as they do not contradict each other.

Among the methods for detecting organisms, the culture method is extremely sensitive and highly reliable. However, there are some problems with the culture method. For example, it takes one to several days to culture, so it takes time to obtain results, it is difficult to apply to bacteria that are difficult to culture, and special techniques are required to identify bacteria after culture. The problem with the culture method is that the disposal of the cultured bacteria requires a sterilization operation such as an autoclave, and the volume of the waste is bulky, so that it takes time and cost to dispose of the bacteria.

Further, in the case of the antibody method, for example, the immunochromatography method and the latex agglutination method have an advantage that the operation is simple because the microorganism can be detected only by contacting the sample. However, the immunochromatography method and the latex agglutination method have a problem that the detection sensitivity is low and the detection cannot be performed without the presence of high-concentration microbial cells. The ELISA method is a method with higher sensitivity than the immunochromatographic method and the like, but it takes time and effort because cleaning and color development operations are required.

Further, the conventional gene method is not convenient because it takes time and effort to extract DNA or 16s rRNA from a microorganism by denaturing the cell membrane. Specifically, DNA or 16s rRNA was trapped inside the cell by the cell membrane of the microorganism and was considered difficult to measure directly. To analyze DNA and 16S rRNA, denature the cell membrane with a strong denaturing agent such as phenol, guanidine salt, sodium hydroxide (a denaturing agent strong enough to denature the cell membrane) to remove the nucleic acid, and then remove the denaturing agent or remove the denaturing agent. An operation to neutralize is required. As described above, in the conventional gene method, the operation of treating with a denaturing agent and the operation of removing or neutralizing the denaturing agent are troublesome, so that the operation is complicated and not convenient as compared with the culture method and the immunochromatography method. .. There is also a method of extracting nucleic acid from cells by heating. As an example of this method, there is also an example in which a solution containing bacteria is heated at 100 ° C. for 10 minutes and used for nucleic acid amplification. However, in order to use the heat treatment, a dedicated device is required, and it is necessary to consider the safety at the time of heating.

In consideration of the above situation, as a result of diligent research, the inventors of the present application added water or cells of an organism having a cell wall to water in an aqueous solution containing an additional component that does not significantly increase the cell degenerative action. It has been found that sRNA in cells can be extracted by immersing the cells of an organism having a cell wall in the cells. This finding is amazing. This is because, for cells of organisms that do not have a cell wall, when the cells are immersed in a hypotonic solution, the cell membrane ruptures due to osmotic pressure, and DNA and 16s RNA are taken out into the surrounding environment without using the above-mentioned denaturant. On the other hand, according to the conventional wisdom of technology, such a method cannot be applied to the cells of an organism having a cell wall. More specifically, since the structure of the cells of an organism having a cell wall is maintained by the cell wall, the cell membrane does not rupture due to a change in the osmotic pressure of the surrounding environment, and lysis is difficult. Therefore, from the conventional general technical knowledge, it is considered difficult to release the nucleic acid existing in the cell of an organism having a cell wall into the surrounding environment without the above-mentioned degeneration operation of the cell membrane. Therefore, it is surprising that sRNA can be extracted extracellularly from the cells of an organism having a cell wall by immersion in water.

The method for determining the existence state of an organism having a cell wall according to the present disclosure is as follows.
To prepare a liquid sample by immersing the measurement sample in an aqueous solvent, or to prepare a measurement sample that is an aqueous solvent as a liquid sample.
To detect the presence or absence of one or more types of sRNA in the liquid sample,
Determining the existence state of an organism having a cell wall based on the existence state of one or more types of sRNA.
Including
The one or more sRNAs comprises at least one of the sRNAs represented by SEQ ID NOs: 15-54.
It is a method for determining the existence state of an organism having a cell wall (hereinafter, also simply referred to as “determination method according to the present disclosure”). In addition, the method for identifying an organism having a cell wall according to the present disclosure is described.
To prepare a liquid sample by immersing the measurement sample in an aqueous solvent, or to prepare a measurement sample that is an aqueous solvent as a liquid sample.
To detect the presence or absence of one or more types of sRNA in the liquid sample,
To identify an organism having a cell wall present in the measurement sample based on the presence state of the one or more types of sRNA.
Including
The one or more sRNAs comprises at least one of the sRNAs represented by SEQ ID NOs: 15-54.
It is a method for identifying an organism having a cell wall (hereinafter, also simply referred to as “identification method according to the present disclosure”).

According to the determination method according to the present disclosure, the existence state in the measurement sample of the organism having the cell wall to be detected can be easily determined. Further, according to the identification method according to the present disclosure, it is possible to easily identify the type of organism having a cell wall contained in the measurement sample. In the determination method and identification method according to the present disclosure, phenol, guanidine salt, ionic surfactant, short chain alcohol (monohydric or divalent straight chain, branched chain or alicyclic C2-C8 alcohol) described later will be used. Since it is not necessary to use a strong denaturing agent such as alcohol or sodium hydroxide other than), the determination or identification can be easily performed.

The determination method according to the present disclosure and the identification method according to the present disclosure can also be collectively expressed as the methods described below:
To prepare a liquid sample by immersing the measurement sample in an aqueous solvent, or to prepare a measurement sample that is an aqueous solvent as a liquid sample.
To detect the presence or absence of one or more types of sRNA in the liquid sample,
To obtain the existence state or identification of an organism having a cell wall in the measurement sample based on the existence state of one or more kinds of sRNA.
The method (hereinafter, also referred to as Method A according to the present disclosure), wherein the one or more kinds of sRNA contains at least one kind of sRNA represented by SEQ ID NOs: 15 to 54.
Further, the more specific embodiment described in the column of "Means for solving the problem" can be applied to the above method A as well.

Organisms contain short RNA fragments called small RNAs. Small RNA (hereinafter, also referred to as “sRNA”) plays an important role in controlling life processes such as development, differentiation, transposon silencing, and virus protection. Since sRNA has important functions in cells, sRNA expressed in the same organism has a conservative nucleotide sequence, that is, the expression profiles of various sRNAs are in multiple cells of the same organism. It is common among them. On the other hand, between different species, the sRNA expression profile is differential depending on the species. Therefore, as with DNA and 16S rRNA, the information on sRNA present in the measurement sample can be used for discriminating the species. The ability to discriminate species using sRNA was first discovered in the present disclosure.

For example, in the organism (A), the sRNA (A) having the nucleotide sequence (A) is expressed, but the sRNA (B) having the nucleotide sequence (B) is not expressed, and in the organism (B), the sRNA ( If B) is expressed but sRNA (A) is not expressed, the presence of sRNA (A) is detected in the measurement sample, but the presence of sRNA (B) is not detected. It can be determined that the cells of the organism (B) exist but do not exist. However, when the sRNA (A) is an sRNA expressed in an organism (C) other than the organism (A) and (B), the presence of the sRNA (A) is detected in the measurement sample, but the sRNA. If the presence of (B) is not detected, it can be determined that one or more cells of the organism (A) and the organism (C) are present, but the cells of the organism (B) are not present.

Although the existence of sRNA itself has been known from the past, it was thought that sRNA cannot be taken out of cells having a cell wall without using a strong denaturing agent, as in the case of DNA and 16S rRNA described above. .. However, in the present disclosure, surprisingly, when a cell having a cell wall is placed in an aqueous solvent, the intracellular sRNA is contained in the peripheral aqueous solvent without destroying the cell membrane with a strong denaturer or the like. It was found to be extracted (ie, leak into the aqueous solvent). The extraction is also possible at room temperature. The sRNA extracted in the aqueous solvent can be used for detecting the presence of a specific organism of interest and identifying the type of organism present in the measurement sample. Therefore, according to the present disclosure, it is possible to easily detect a specific organism of interest without any trouble, and to identify the type of organism present in the measurement sample.

Furthermore, since sRNA has a short chain length, it is less susceptible to RNase attack than 16S rRNA, and analysis can be performed more stably. Further, since the number of copies of the sRNA in the cell is several thousand to tens of thousands at most, it is possible to obtain information on the existence state of the sRNA with high sensitivity.

Hereinafter, the determination method according to the present disclosure and the determination method according to the present disclosure will be described together. Unless otherwise specified, the matters described below apply to both the determination method according to the present disclosure and the identification method according to the present disclosure, and also apply to the method A according to the present disclosure.

<Organisms with cell walls>
The organism having a cell wall in the determination method according to the present disclosure and the identification method according to the present disclosure is not particularly limited, and may be an organism having an arbitrary cell wall. Generally, cells other than animal cells, such as plant cells and microbial cells, have a cell wall. The organism having the cell wall may be a fungus such as yeast, slime mold, mold, or a bacterium such as Escherichia coli. The object to be determined or identified does not have to be the whole organism, but may be a part of the organism. This is because sRNA is also present in the part of the organism, and even the detection of the part of the organism gives information about the existence of the organism. Examples of the part of the organism include a part of a multicellular organism, for example, pollen of a plant. However, the biological part is preferably a part that maintains the shape of the cell. If the part of the organism does not maintain the shape of the cell, the intracellular component may have already flowed out to the surrounding medium before immersion in the aqueous solvent or preparing the measurement sample which is the aqueous solvent. Because there is. As described above, the determination method according to the present disclosure describes determining the existence state of an organism having a cell wall, and the identification method according to the present disclosure describes identifying an organism having a cell wall. The organism having a cell wall referred to here represents a concept including a part of an organism. Therefore, it is sufficient to provide information about a species or group of species for the determined state of existence or identification. In fact, for example, in the case of detection of a herbaceous plant, it is general that the measurement sample contains not the whole organism but a part thereof, but the determination method or the identification method according to the present disclosure. Thereby, a determination result or an identification result regarding the existence of an organism species or a group of organisms can be obtained. Therefore, the organism in the determination method and the identification method according to the present disclosure may be a plant, and in this case, the component contained in the measurement sample may be, for example, pollen.

The organism having a cell wall may be, for example, an organism whose existence can be a problem in hygiene management at a site where hygiene management is required (food manufacturing, medical treatment, welfare, home, etc.). Examples of such organisms include pathogenic microorganisms and putrefactive microorganisms. The pathogenic microorganism may be a pathogenic fungus, and examples thereof include Trichophyton, Candida, Aspergillus and the like. The pathogenic bacterium may be a pathogenic bacterium, for example, Gram-positive bacteria (eg, staphylococcus, rentha, pneumococcus, enterococci, diphtheria, tuberculosis, leprosy, charcoal, shigella, etc. Welsh, tetanus, botulinum, etc.), Gram-negative (gonococcus, encephalomyelitis, salmonella, Escherichia coli, pyogenic, shigella, influenza, pertussis, cholera, enteritis vibrio, asinetobacter, campylobacter, regionera) , Helicobacter, etc.). The pathogenic bacterium may be a verotoxin-producing bacterium. Bacteria of each genus such as Pseudomonas, Micrococcus, Vibrio, and Flavobacterium in the case of fish and shellfish, and each genus of Pseudomonas, Acromobacter, Micrococcus, Flabobacterium, etc. in the case of livestock meat, as rotting microorganisms. When the bacteria are rice and noodles, the bacteria of the genus Pseudomonas can be mentioned.

In certain embodiments, the organism having the cell wall may be a bacterium belonging to the family Enterobacteriaceae. Examples include Citrobacter bacteria such as Citrobacter freundii, Edwardsiella bacteria such as Edwardsiella tarda, Enterobacter bacteria such as Enterobacter aerogenes, E. cloacae, E. gergoviae, and E. sakazakii, Escherichia coli and E. Escherichia bacteria such as albertii, Hafnia bacteria such as Hafnia alvei, Klebsiella bacteria such as Klebsiella oxytoca and K. pneumoniae, Kluyvera bacteria such as Kluyvera ascorbata and K. cryocrescens, and Morganella bacteria such as Morganella morganii. Bacteria, Proteus bacteria such as Proteus mirabilis and P. vulgaris, Providencia bacteria such as Providencia alcalifaciens, P. rettgeri, and P. stuartii, Salmonella bacteria such as Salmonella enterica, Serratia liquefaciens and S. marcescens, etc. Examples include bacteria of the genus Serratia, bacteria of the genus Shigella such as Shigella boydii, S. dysenteriae, S. flexneri, and S. sonnei, and bacteria of the genus Yersinia such as Yersinia enterocolitica, Y. pestis, and Y. pseudotuberculosis. The cell wall-bearing organism preferably comprises at least one selected from the group consisting of Escherichia coli, Citrobacter freundii, and Salmonella gallinarum. In another embodiment, the organism having the cell wall comprises a plant, which may be a black pine. In another embodiment, the cell wall-bearing organism comprises a verotoxin-producing bacterium.

The organism having a cell wall contained in the aqueous solvent preferably includes an organism having a cell wall in which the cell wall and the cell membrane are not destroyed, or an organism having no cell wall in which the cell membrane is not destroyed. That is, it is preferable that the organism having the cell wall has not undergone cell crushing treatment, membrane destruction treatment, or the like. This is because if the cell wall or cell membrane is destroyed, sRNA has already flowed out from the organism, and there is a possibility that sRNA cannot be extracted. In the determination method according to the present disclosure and the identification method according to the present disclosure, in the process up to the detection of the existence state of sRNA, a treatment that destroys the cell wall and / or the cell membrane of the organism having the cell wall (cell disruption treatment, It is preferable not to include film breaking treatment, etc.).

In the determination method and the identification method according to the present disclosure, since sRNA leaked from a cell having a cell wall into an aqueous solvent is used for detection, a treatment for removing a substance that hinders such leakage may be performed in advance.

<Measurement sample>
The measurement sample in the determination method according to the present disclosure is a sample used for determining the existence state of an organism having a cell wall to be detected, and the measurement sample in the identification method according to the present disclosure is an identification of an organism having a cell wall. It is a sample used for. About the existence state of the organism having a cell wall When an organism having a cell wall exists in an object (hereinafter, also referred to as an analysis object) to be analyzed, as long as the measurement sample is prepared to include the organism, the measurement sample There is no particular limitation, and the measurement sample may be the analysis target itself or a sample prepared from the analysis target by arbitrary treatment. The objects to be analyzed are, for example, the surface of an object such as the surface of a workbench, the object itself such as food, a liquid such as tap water, a gas such as air, and a bacterial cell of unknown biological species. From the viewpoint of simplifying the work, it is preferable that the measurement sample is the analysis target itself.

For example, when it is desired to analyze an organism having a cell wall existing in a liquid as an analysis target, the liquid itself may be used as a measurement sample, or the liquid that has been subjected to a treatment such as dilution may be used as a measurement sample. May be good. Further, for example, when it is desired to analyze an organism existing on the surface of an object as an analysis target (for example, the surface of a workbench), the surface is wiped with a wipe, a cotton swab, etc., and the wipe, the cotton swab, etc., or a part thereof is wiped. It may be used as a measurement sample.

When it is desired to analyze an organism having a cell wall existing inside an object as an object to be analyzed (for example, inside a food), the whole or a part of the object may be used as a measurement sample, or the object may be immersed in a liquid. The liquid thus obtained may be used as a measurement sample. If an organism having a cell wall is present in the object due to immersion, it is considered that a part or all of the organism is transferred to the liquid. When it is desired to analyze an organism existing in the air using air as an analysis target, a sample obtained by collecting airborne substances existing in the air may be used as a measurement sample. The collection can be performed by a filter, centrifugation (for example, cyclone type separation), simply opening the container and leaving it to stand (for example, opening the lid of a petri dish or the like and leaving it to stand). ..

As described above, the measurement sample is collected on an air filtration filter such as a liquid as an analysis target, a diluted liquid, a wipe whose surface is wiped as an analysis target, a cotton swab, or the like. It can be an object, a liquid obtained by immersing the collected material in a liquid, an deposit attached to a container open to the surrounding atmosphere, or the like. Alternatively, the organism itself can be used as a measurement sample for the purpose of identifying the type of organism having a cell wall that has already been obtained.

<Aqueous solvent>
The aqueous solvent in the determination method according to the present disclosure and the identification method according to the present disclosure is a liquid mainly composed of water, and the aqueous solvent may be pure water itself, and is added to water as long as it does not cause denaturation of the cell membrane. It may be an aqueous solution containing the above-mentioned components (hereinafter, also referred to as “coexisting components”). It is preferable that the content of the solvent component other than water in the aqueous solvent is as small as possible, and the amount of the solvent component other than water is 1% by mass or less, 0.1% by mass or less, and 0.01% by mass with respect to the amount of water. Hereinafter, it may be 0.001% by mass or less, or 0% by mass (that is, it may contain only water as a solvent component). Further, in the present disclosure, the "aqueous solvent" does not contain a component that denatures the cell membrane and destroys the membrane, or contains only a small amount that does not cause the degeneration of the cell membrane. In other words, the aqueous solvent has the basic properties common to water in that it does not cause denaturation of the cell membrane, and is a solvent that can contain coexisting components as long as this basic property is not impaired. .. Therefore, the aqueous solvent according to the present disclosure includes an extract for destroying the cell membrane and taking out the intracellular component (for example, the cell component extract EXTRAGEN (manufactured by Toso Corporation) referred to in Japanese Patent Publication No. 2013-93). ) Is not included.

However, the aqueous solvent may contain 65% by mass or less of monovalent or divalent straight chain, branched chain or alicyclic C2-C8 alcohol, and acetone in the total amount thereof. The addition of certain types of alcohols in such amounts can increase the efficiency of extraction of sRNA into aqueous solvents. Specifically, the content of each of the monovalent or divalent linear, branched or alicyclic C2-C8 alcohol, and acetone is 65% by mass or less with respect to the total amount of the aqueous solvent. It may be 60% by mass or less, 55% by mass or less, 50% by mass or less, 40% by mass or less, or 30% by mass or less. It may be 20% by mass or less, 10% by mass or less, or 5.0% by mass or less. The lower limit of the content of the monovalent or divalent linear, branched or alicyclic C2-C8 alcohol in the aqueous solvent is not particularly limited and may be 0% by mass (non-containing). The content of monovalent or divalent straight chain, branched chain or alicyclic C2-C8 alcohol in the aqueous solvent may be 0.5% by mass or more, and 1.0% by mass or more. It may be 5.0% by mass or more, 10% by mass or more, 20% by mass or more, or 40% by mass or more. The above upper limit value and lower limit value may be arbitrarily combined to form a numerical range.
When the aqueous solvent contains two or more of monovalent or divalent linear, branched or alicyclic C2-C8 alcohols, and acetone, the total amount thereof is also preferably within the above range. ..

The monovalent straight chain, branched chain or alicyclic C2-C8 alcohol is preferably a monovalent straight chain, branched chain or alicyclic C2-C5 alcohol, and the monovalent straight chain, branched chain or alicyclic C2-C5 alcohol is preferable. More preferably, it is a branched chain or alicyclic C2-C4 alcohol. Examples of monovalent linear, branched or alicyclic C2-C8 alcohols include ethanol, 1-propanol, 2-propanol, 1-butanol, 2-butanol, 2-methyl-2-propanol, 1 -Pentanol, 2-pentanol, 3-pentanol, 2-methyl-1-butanol, 2-methyl-2-butanol, 3-methyl-1-butanol, 3-methyl-2-butanol, 2,2- Examples include dimethyl-1-propanol.
The divalent straight chain, branched chain or alicyclic C2-C8 alcohol is preferably a divalent straight chain, branched chain or alicyclic C2-C6 alcohol, and the divalent straight chain, branched chain or alicyclic C2-C6 alcohol. More preferably, it is a branched chain or alicyclic C2-C4 alcohol. Examples of divalent linear, branched or alicyclic C2-C8 alcohols are 1,2-ethanediol, 1,2-propanediol, 1,3-propanediol, 1,2-butanediol. , 1,3-Butanediol, 1,4-Butanediol, 2,3-Butanediol.
One or more of these monovalent or divalent straight chain, branched chain or alicyclic C2-C8 alcohols can be arbitrarily selected and used.

The pH of the aqueous solvent is preferably in the range of pH 5 to pH 9, and more preferably in the range of pH 6 to pH 8, from the viewpoint of preventing denaturation of the cell membrane under strongly acidic or alkaline conditions. , The pH is more preferably in the range of pH 6.5 to pH 7.5. As described above, the aqueous solvent may contain coexisting components other than the solvent. The total content of coexisting components other than the solvent is 30% by mass or less, 10% by mass or less, 1% by mass or less, 0.1% by mass or less, 0.01% by mass or less, or 0 with respect to the total amount of the aqueous solvent. It may be 001% by mass or less. Examples of coexisting components other than the solvent that may be contained in the aqueous solvent include salts, buffers, surfactants, DTTs, RNase inhibitors and the like. Since sRNA has a short chain length, it is less susceptible to RNase attack than longer RNAs such as 16S rRNA, but it is possible to further stabilize sRNA by coexisting with RNA stabilizers such as DTT and RNase inhibitors. Can be done.

The aqueous solvent does not contain the co-existing component in an amount that denatures the cell membrane and destroys the membrane. From the viewpoint of preventing denaturation of the cell membrane, the aqueous solvent is phenol, guanidine, the above-mentioned monovalent or divalent linear, branched or alicyclic alcohols other than C2-C8 alcohols, ionic surfactants, and the like. And it is preferable that strong alkali such as NaOH is not contained. Aqueous solvent is phenol, guanidine, alcohols other than the above-mentioned monovalent or divalent linear, branched or alicyclic C2-C8 alcohols, ionic surfactants, and denaturing components such as strong alkalis such as NaOH. In the case of containing, the total content thereof is preferably 0.1% by mass or less, preferably 0.01% by mass or less, and 0.001% by mass or less with respect to the total amount of the aqueous solvent. It is more preferable to have. If the denaturing component such as strong alkali is not contained, or if the content is within the above range even if the denaturing component is contained, additional treatment for removing these denaturing component may be performed after preparation of the liquid sample by immersion. It becomes unnecessary, and identification of an organism having a cell wall can be performed more easily. From this viewpoint as well, it is preferable that the denatured component is not contained, or even if it is contained, it is within the above-mentioned content range.

Since the surfactant denatures and destroys the cell membrane depending on the type and amount thereof, it is necessary to limit the type and amount when the aqueous solvent contains the surfactant. The surface tension of the aqueous solvent is preferably 50 mN / m to 72.8 mN / m (surface tension of water) at 20 ° C., more preferably 60 mN / m to 72.8 mN / m, and more preferably 65 mN / m to 65 mN / m. It is more preferably 72.8 mN / m, and even more preferably 70 mN / m to 72.8 mN / m. When the aqueous solvent contains a surfactant, the surfactant is preferably a nonionic surfactant, and examples of the nonionic surfactant include a Tween series surfactant (eg, Tween-20). NP-40, Triton series surfactants (eg Triton X-100) and the like can be mentioned.

From the viewpoint of making the properties of the aqueous solvent close to that of pure water, the salt concentration in the aqueous solvent is preferably 0 mol / L to 0.2 mol / L, preferably 0 mol / L to 0.1 mol / L. More preferably, it is more preferably 0 mol / L to 0.05 mol / L.

The coexisting component does not have to be a solvent component, and may be fine particles suspended in water, a water-soluble substance, or the like. Further, the aqueous solvent may contain a nucleic acid amplification reagent as a coexisting component. The nucleic acid amplification reagent is a reagent necessary for nucleic acid amplification, including a polymerase, nucleotide triphosphate (mixture of dNTP), primer, Mg ²⁺ ion and the like. The nucleic acid amplification reagent preferably contains a polymerase having an activity (reverse transcription activity) capable of synthesizing a DNA strand using RNA as a template. Nucleic acid amplification reagents may contain weak detergents such as Triton X-100 (particularly nonionic surfactants), but at concentrations for nucleic acid amplification reagents, they denature cells and destroy the membrane. Therefore, the surfactant in the nucleic acid amplification reagent may be contained in the aqueous solvent as it is. For example, when the aqueous solvent contains Triton X-100, the content of Triton X-100 is 0.01 with respect to the total amount of the aqueous solvent from the viewpoint of preventing denaturation of the cell membrane and efficiently amplifying nucleic acid. It is preferably from% by mass to 5% by mass, more preferably from 0.05% by mass to 3% by mass, and even more preferably from 0.1% by mass to 2% by mass. The nucleic acid amplification reagent may be, for example, a reagent for PCR, a reagent for isothermal gene amplification, or the like. By including the nucleic acid amplification reagent in the aqueous solvent, it is possible to perform nucleic acid amplification as it is without performing reagent addition operation or temperature cycle operation using a liquid sample containing sRNA leaked from cells having a cell wall. Become.

Examples of coexisting components other than the solvent in the aqueous solvent include nonionic surfactants of 5.0% by mass or less based on the total amount of the aqueous solvent, and antibacterial agents of 1.0% by mass or less based on the total amount of the aqueous solvent. Peptides and reducing agents of 1.0 M or less are also included. Nonionic surfactants are compounds that have a hydrophilic group and a hydrophobic group in one molecule and do not have a group that dissociates into ions in water. The nonionic surfactant may have a hydroxy group, for example, a hydrophilic polyoxyalkylene (polyoxypropylene, polyoxyethylene, etc.) chain moiety and hydrophobicity such as alkyl, aryl, alkylene, arylene, etc. It may be a compound having a moiety. Alternatively, the nonionic surfactant may be a polyol ester type, an alkanolamide type, an alkyl glucoside, an alkoxylate type, or a fatty acid alkyl ester type. More specifically, it may be a polyoxyethylene alkyl ether type, a polyoxyethylene alkyl phenyl ether type or the like. Specific examples of the nonionic surfactant include polysorbate 20 (eg, Tween 20), polysorbate 80 (eg, Tween 80), nonoxynolsphenol ethoxylate (NP-40), octylphenol ethoxylate (eg, Triton X-100), and It may contain at least one selected from the group consisting of poly (ethylene glycol) -block-poly (propylene glycol) -block-poly (ethylene glycol) (eg, Synperoinc F108).

The content of the nonionic surfactant in the aqueous solvent is 5.0% by mass or less with respect to the total amount of the aqueous solvent from the viewpoint of reducing damage to the cell membrane of the organism having a cell wall. The content of the nonionic surfactant in the aqueous solvent may be 4.0% by mass or less, 3.0% by mass or less, or 2.0% by mass with respect to the total amount of the aqueous solvent. It may be less than or equal to%, or may be less than or equal to 1.5% by mass.
The lower limit of the range of the content of the nonionic surfactant in the aqueous solvent is not particularly limited, and may be 0% by mass (non-containing). The content of the nonionic surfactant in the aqueous solvent may be 0.01% by mass or more, 0.1% by mass or more, or 0.3% by mass or more. It may be 0.5% by mass or more, or 0.7% by mass or more. The above upper limit value and lower limit value may be arbitrarily combined to form a numerical range.

The antibacterial peptide is not particularly limited as long as it is an antibacterial peptide known in the art. The antibacterial peptide is basically an amphipathic peptide having a hydrophilic surface and a hydrophobic surface, whereby it can be present on the cell membrane. Examples of antibacterial peptides include the anionic peptides maximin H5 and dermicidin; the linear cationic α-helix peptides containing no cysteine residues, such as secropine, andropin, moricin, seratotoxin, melittin, and maginin (magainine I). And Maginin II), dermaceptin, bonbinin, blevinin-1, escretin, buforin II, CAP18, and LL37; prolin, arginine, phenylalanine, and tryptophan, which are cationic peptides rich in one or more, avaesin, apidaecin, prophenin, Indolicidin; as well as blevinin, protegrin, tachypresin, defensin, and drosomycin containing disulfide bonds. One or more kinds of antibacterial peptides known in the art can be arbitrarily selected and used.

The content of the antibacterial peptide in the aqueous solvent is 1.0% by mass or less with respect to the total amount of the aqueous solvent from the viewpoint of reducing damage to the cell membrane of the organism having a cell wall. The content of the antibacterial peptide in the aqueous solvent may be 0.8% by mass or less, 0.5% by mass or less, or 0.2% by mass or less with respect to the total amount of the aqueous solvent. It may be present, or it may be 0.15% by mass or less.
The lower limit of the range of the content of the antibacterial peptide in the aqueous solvent is not particularly limited, and may be 0% by mass (not contained). The content of the antibacterial peptide in the aqueous solvent may be 0.001% by mass or more, 0.005% by mass or more, 0.01% by mass or more, or 0.05. It may be mass% or more, and may be 0.07 mass% or more. The above upper limit value and lower limit value may be arbitrarily combined to form a numerical range.

The reducing agent is not particularly limited as long as it is a reducing agent known in the art. Examples of reducing agents include oxalic acid, formic acid, gallic acid, ascorbic acid, β-mercaptoethanol, and dithiothreitol. The reducing agent is preferably a reducing agent having a mercapto group, and may be, for example, β-mercaptoethanol or dithiothreitol. As the reducing agent, one or a plurality of types of reducing agents known in the art can be arbitrarily selected and used.

The concentration of the reducing agent in the aqueous solvent is 1.0 M or less from the viewpoint of reducing damage to the cell membrane of the organism having a cell wall. The concentration of the reducing agent in the aqueous solvent may be 0.8 M or less, 0.5 M or less, 0.2 M or less, or 0.15 M or less. good.
The lower limit of the range of the concentration of the reducing agent in the aqueous solvent is not particularly limited, and may be 0M (non-containing). The concentration of the reducing agent in the aqueous solvent may be 0.001 M or more, 0.005 M or more, 0.01 M or more, or 0.05 M or more. It may be 0.07M or more. The above upper limit value and lower limit value may be arbitrarily combined to form a numerical range.

<Immersion>
The immersion in the determination method according to the present disclosure and the identification method according to the present disclosure may be performed at room temperature or while heating or cooling. Soaking is preferably performed at a temperature within the temperature range of 0 ° C. to 50 ° C., more preferably at a temperature within the temperature range of 4 ° C. to 40 ° C., so as not to cause degeneration of the cell membrane as much as possible. It is more preferably performed at a temperature within the temperature range of 40 ° C., further preferably performed at a temperature within the temperature range of 20 ° C. to 40 ° C., and further preferably performed at a temperature within the temperature range of 25 ° C. to 40 ° C. More preferably, it is carried out at a temperature within the temperature range of 30 ° C. to 37 ° C. The immersion may be performed at room temperature.
The immersion time is not particularly limited as long as extracellular leakage of sRNA occurs in an amount sufficient for detection. The soaking time is, for example, 10 seconds to 30 hours, may be 10 seconds to 10 hours, may be 1 minute to 5 hours, or may be 5 minutes to 1 hour. The soaking time may be 0.5 hours to 6 hours, 0.7 hours to 4.5 hours, or 0.8 hours to 2 hours. The method of immersion is not particularly limited, and if the measurement sample contains an organism having a cell wall, any treatment that causes the organism to come into contact with an aqueous solvent can be mentioned. When the measurement sample is a solid sample (eg, cotton swab, wipe, filter, analysis target itself or part thereof, or cells), the immersion is performed, for example, in an aqueous solvent stored in a container as the measurement sample. This can be done by immersing a solid sample.
As described above, since the organism itself having a cell wall can be used as a measurement sample, the organism having a cell wall may be immersed alone in an aqueous solvent, or the organism having a cell wall attached to another object may be immersed in each object. It may be immersed in an aqueous solvent.
By dipping, when an organism having a cell wall is present in the measurement sample, leakage of sRNA to the outside of the cell occurs, and a liquid sample containing sRNA in an aqueous solvent can be obtained.

<Measurement sample that is an aqueous solvent>
If the analysis target is in the state of an aqueous solvent from the beginning, the analysis target itself can be used as a measurement sample and used as it is as a liquid sample. For example, tap water can be used as it is as a liquid sample to determine the existence state of an organism having a cell wall in tap water, or to identify an organism having a cell wall contained in tap water. Since the analysis target may contain an organism having a cell wall, the aqueous solvent as the above-mentioned measurement sample may include an organism having a cell wall.
If the analysis target is a liquid but you want to perform pretreatment because of a large amount of impurities, use a method such as filtering, centrifuging, dialysis, etc. to remove the contaminants, and then use a measurement sample that is an aqueous solvent. It may be prepared and this measurement sample may be used as a liquid sample. For example, when inspecting an organism having a cell wall in muddy water, the mud in the muddy water is removed by filtration or the like, and then a filtrate (a measurement sample that may contain an organism having a cell wall) is used as a liquid sample to form the cell wall. It is possible to determine the existence state of an organism having a cell wall or identify an organism having a cell wall. As described above, since the aqueous solvent may contain a coexisting component other than water, an organism having a cell wall that may be contained in the measurement sample can be contained as a coexisting component in the aqueous solvent.
By immersing the analysis target in an aqueous solvent, a measurement sample that is an aqueous solvent can also be prepared. Specifically, a measurement sample which is an aqueous solvent can be obtained by migrating an organism having a cell wall from an analysis object into an aqueous solvent. As described above, the immersion may be an immersion for the purpose of preparing a measurement sample which is an aqueous solvent by transferring the organism having a cell wall to an aqueous solvent instead of extracting the sRNA. The immersion conditions in that case are the same as the above conditions.
It is also a preferred embodiment that the aqueous solvent does not contain coexisting components other than the above-mentioned organism having a cell wall. If an organism having a cell wall that may be contained in the measurement sample is in contact with the aqueous solvent for a certain period of time (for example, the time exemplified as the example of the immersion time above), the measurement sample is actually the cell wall. (In the case of containing an organism having sRNA) Leakage of sRNA occurs from the organism, and a liquid sample containing the same sRNA as in the case of the above immersion is obtained. The embodiment using the measurement sample as an aqueous solvent is, for example, determination of the existence state of an organism having a cell wall in water (for example, tap water, sewage, etc.) as an analysis target, or water (for example, tap water, sewage, etc.). It can be used to identify organisms having a cell wall contained therein.
As long as the operation is such that the organism having the cell wall comes into contact with the aqueous solvent, the operation is described above by immersing the measurement sample in the aqueous solvent to prepare a liquid sample, or preparing the measurement sample which is the aqueous solvent as the liquid sample. Included in doing. When the measurement sample is immersed in an aqueous solvent to prepare a liquid sample, the operation is to artificially elapse for the extraction of sRNA while allowing the aqueous solvent in which the measurement sample is immersed to stand or stir. It may be an operation. When the measurement sample is a liquid sample, it may be artificially aged for extraction of sRNA while standing still or stirring.

Leakage of sRNA from cells with a cell wall as described in the "immersion" and "measurement samples that are aqueous solvents" sections above is surprisingly a phenomenon that occurs specifically in sRNA, not in nucleic acids in general. be. Therefore, for example, even if a cell having a cell wall is immersed in an aqueous solvent in an attempt to leak 16S rRNA, which has been conventionally used for discriminating organisms, into the aqueous solvent, the 16S rRNA can be obtained from the cell having the cell wall. It does not leak at all, or if it does, it leaks only in low amounts that are insufficient for use in detecting species. It is considered that this difference is partly due to the difference in length between 16S rRNA (about 1600 bases) and sRNA. That is, sRNA, which has a shorter chain length than mRNA and 16S rRNA, surprisingly leaks into an aqueous solvent outside the cell having a cell wall without destroying the cell membrane. On the other hand, larger molecules such as mRNA and 16S rRNA do not show such leakage substantially and cannot be taken out of the cell having a cell wall without an extraction operation accompanied by degeneration of the cell membrane.

<SRNA>
The sRNA in the determination method according to the present disclosure and the identification method according to the present disclosure is also referred to as small RNA, and means a short RNA contained in a cell. The specific chain length of the sRNA is preferably 5 to 500 bases, more preferably 8 to 500 bases, even more preferably 10 to 200 bases, and 12 to 100 bases. It is more preferably present, and particularly preferably 15 to 30 bases.
In addition, among sRNA, there is also microRNA which is RNA of about 20 to 30 bases contained in eukaryotic cells. Further, even in prokaryotes, a particularly short sRNA having the same degree may be referred to as microRNA-size small RNA.

Research is underway on sRNA present in organisms with cell walls, and the sequence information of sRNA found in each organism is Rfam (EMBL EBI), Small RNA Database (MD Anderson Cancer Center), miRBase (Griffiths- In addition to being stored in databases such as the Jones lab at the Faculty of Biology, Medicine and Health, University of Manchester) and the National Center for Biotechnology Information (NCBI), various reports have been made in academic papers. Therefore, information on sRNA contained in various organisms can be obtained by a known method such as database search (see Kyorin Medical Association Journal Vol. 41, No. 1, pp. 13-18, April 2010). For example, using Nucleotide BLAST (https://blast.ncbi.nlm.nih.gov/Blast.cgi) for the nucleic acid sequences contained in the National Center for Biotechnology Information (NCBI) database and the nucleic acid sequences to be searched. Can be compared and searched for the same sequence (including information on the organism from which the same sequence is derived).

sRNA is differentially expressed depending on the type of organism. For example, by referring to a sequence database such as Rfam, Small RNA Database, miRBase, National Center for Biotechnology Information (NCBI) database, it is possible to search which one or more organisms a specific sRNA is expressed. It is also possible to search for which one or more types of sRNA are expressed in a specific organism. In the determination method according to the present disclosure, it is preferable that one or more kinds of sRNAs exhibit a specific expression state in a specific organism of interest. By doing so, the existence state of the organism can be better discriminated from the existence state of the sRNA.

Here, the "specific expression state" does not have to be an sRNA that is expressed only in the organism having the specific cell wall or not expressed only in the organism having the specific cell wall, and has the specific cell wall. Only in organisms with a specific cell wall, such as sRNA, which is expressed only in a group of organisms with a specific cell wall, including organisms, or not only in a group of organisms with a specific cell wall, including organisms with the specific cell wall. Means a concept that also includes sRNAs that are not completely specific to.
Also in the identification method according to the present disclosure, it is preferable that one or more kinds of sRNAs for which the existence state is detected show a specific expression state depending on the organism having a cell wall.

As described above, in the determination method according to the present disclosure and the identification method according to the present disclosure, strong alkali treatment, guanidine treatment, phenol, and the above-mentioned short chain alcohol (monovalent or divalent straight chain, branched chain or alicyclic). The sRNA can be leaked to an aqueous solvent outside the cell having a cell wall without denaturing the cell membrane with an alcohol other than the C2-C8 alcohol of the formula), an ionic surfactant, or the like. Therefore, the use of a denaturant is not required, the treatment time with the denaturant is not required, and the aqueous solvent leaking the sRNA can be used as it is for the subsequent treatment (for example, nucleic acid amplification treatment for detecting sRNA). Can be served.

<Existence state>
In the determination method according to the present disclosure and the identification method according to the present disclosure, the "existence state" may simply indicate the presence or absence of existence, and also refers to the abundance amount (existence amount 0, that is, including the case where it does not exist). May be. In other words, "detecting the existence state" may be to obtain binary information as to whether or not it exists, but in addition to whether or not it exists, information on the amount of existence when it exists may also be obtained. It may be what you get. The abundance information also contains information about the existence or nonexistence. Similarly, "determining the existence state" may be a binary determination as to whether or not it exists, but in addition to determining whether or not it exists, up to the determination of the amount of existence when it exists. May also be done. Here, the abundance amount is not limited to the absolute abundance amount, and may be a relative abundance amount with respect to a comparison target such as a negative control or a positive control.

<Detection of existence state>
The determination method according to the present disclosure and the identification method according to the present disclosure are not particularly limited as to the method for detecting the existence state of sRNA. Methods for detecting the presence of sRNA include hybridization with a labeled nucleic acid probe (including Northern blotting) and nucleic acid amplification. Nucleic acid amplification may be any method for amplifying DNA or RNA, and examples thereof include PCR (Primerase Chain Reaction) method, RT-PCR (Reverse Translation-PCR) method, LCR (Ligase Chain Reaction) method, and SDA (Strand). Displacement Amplification) method, NASBA (Nucleic Acid Sequence-based Amplification) method, TRC (Transcription Reverse-transcription Concerted Reaction) method, LAMP (Loop-mediated Isothermal Amplification) method, RT-LAMP (Reverse Transcription-LAMP) method, ICAN ( Isothermal and Chimeric Primer-initiated Amplification of Nucleic Acids) method, RCA (Rolling Cycle Amplification) method, Smart Amp (Smart Amplification process) method, TMA (Transcription-mediated Amplification) method, TAS (transcription Amplification System) method, 3SR (Self -Each amplification method such as the sustainable Sequence Synchronization System) method can be mentioned. In the case of a method in which RNA cannot be directly amplified, sRNA may be reverse transcribed with reverse transcriptase to convert it into DNA, and then nucleic acid amplification may be performed. In certain embodiments, the detection of the presence of one or more sRNAs is performed by isothermal gene amplification or PCR.

The nucleic acid amplification used to detect the presence of sRNA is preferably the LAMP method or the RCA method, which is an isothermal gene amplification method. Examples of the RCA method include a SATIC (termed signal amplifier by ternary initiation complexes) method. Isothermal gene amplification is preferable in that it is not necessary to prepare a device for amplification (a device that changes the temperature according to a temperature cycle). Since isothermal gene amplification can be performed even at a temperature within the temperature range of, for example, 10 ° C to 40 ° C, it can be performed at room temperature. In the present disclosure, the room temperature may be a temperature within the range of 20 ° C. to 40 ° C., unless otherwise specified in Examples and Reference Examples.
Further, the above-mentioned PCR may be qPCR (quantitative PCR), and qPCR may be real-time PCR. Examples of the real-time PCR include a method using Taqman (registered trademark) miRNA assay (manufactured by Thermo Scientific). By using qPCR, it becomes easy to perform a quantitative analysis of the existence state of sRNA.

Reagents such as probes or primers used for sRNA detection (hereinafter also referred to as sRNA detection reagents) may be added to the aqueous solvent after the immersion is completed, or may be previously contained in the aqueous solvent before the immersion. May be good. When the reagent for sRNA detection is previously contained in the aqueous solvent before immersion, it is preferable in that the addition operation after the completion of immersion becomes unnecessary. When the measurement sample which is an aqueous solvent is used as a liquid sample, a reagent for detecting sRNA may be added to the liquid sample, and when there is a process for preparing the measurement sample which is an aqueous solvent, the preparation thereof. A reagent for detecting sRNA may be added in the process.

Amplified nucleic acid can be used for existing amplified nucleic acid detection, for example, by attaching a fluorescent dye to a primer, visually checking the precipitate, using a nucleic acid-staining dye, hybridizing with a fluorescent probe, or subjecting to nucleic acid chromatography. It can be detected by using the method. The fluorescent probe may be arranged on a microarray. By using a microarray, the existence information of a plurality of types of sRNA can be obtained at once.
For example, by using a Taqman (registered trademark) probe, SYBR Green dye, etc., the amount of nucleic acid amplification can be measured by a fluorescent signal, and the existence state of sRNA can be known based on that information, and this method is particularly effective in qPCR. Is.

As described above, nucleic acid amplification is not essential for the detection of sRNA, and direct detection may be performed by hybridization of the fluorescent probe and sRNA without nucleic acid amplification.
In the detection operation such as nucleic acid amplification or hybridization with a probe, the full length of the sRNA may be amplified and / or a probe that hybridizes with the full length of the sRNA may be used. However, it is not essential to amplify the overall length of the sRNA and / or use a probe that hybridizes to the overall length of the sRNA. Nucleic acid amplification or hybridization may be performed on a part of the region of sRNA, for example, about 10 to 30 bases in the 3'end side region of sRNA.

The detection of the presence state of the sRNA may be performed in parallel with the extraction of the sRNA from the cell having the cell wall. For example, a sample that may contain an organism having a cell wall may be directly immersed or added to a reaction solution of an isothermal gene amplification method such as the PCR method or the SATIC method to simultaneously perform leakage and detection of sRNA. .. In the case of the isothermal gene amplification method, since there is no temperature cycle, nucleic acid amplification can be started at any time as long as the reagents required for nucleic acid amplification are available in the liquid sample.

<Determination of the existence state of organisms with cell walls>
The detection of an organism-specific sRNA having a cell wall in the measurement sample suggests the presence of the organism in the measurement sample. From the information on the abundance of sRNA specific to an organism having a cell wall in the measurement sample, it is possible to obtain information on the abundance of the organism in the measurement sample. It is the first discovery in the present disclosure that an organism existing can be discriminated based on the existence state of sRNA.

The organism in which sRNA is expressed can be known, for example, as follows. Using the nucleic acid sequence of the sRNA as a reference sequence, a nucleic acid sequence similar to the reference sequence can be obtained from the National Center for Biotechnology Information (NCBI) database at Nucleotide BLAST (https://blast.ncbi.nlm.nih.gov/Blast.cgi). ) To compare. From the obtained comparison results, the organism containing the sRNA whose nucleic acid sequence is 100% consistent with the sRNA used as the reference sequence is the organism expressing the sRNA.

Before detecting the presence of sRNA, the type of sRNA extracted extracellularly is not clear, but if a specific sRNA is detected extracellularly, it is known to have that specific sRNA. It can be determined that there are living organisms.

The organism having a cell wall in the determination method according to the present disclosure refers to an organism having a cell wall to be detected, and may be an organism having an arbitrary cell wall to be detected. By detecting the existence state of sRNA specifically expressed in the organism as compared with other organisms, the existence state of the organism can be determined. The detection of sRNA specifically expressed in the organism suggests the presence of the organism, and the absence of the sRNA suggests the absence of the organism. In the determination method according to the present disclosure, an sRNA showing an expression state specific to the organism can be selected as the sRNA for detecting the existence state according to the type of the organism whose existence state is desired to be detected in the measurement sample. preferable. The specific expression state of sRNA may be specifically expressed in an organism whose existence state is desired to be detected, or may be specifically non-expressed in an organism whose existence state is desired to be detected. However, it is preferable that at least one of the one or more types of sRNA for detecting the existence state is an sRNA specifically expressed in the organism for which the existence state is to be detected.

It should be noted that one type of sRNA is not always completely specific to one type of organism, and there may be a plurality of types of organisms expressing the same type of sRNA. However, since the expression profile of sRNA in one type of organism is different for each sRNA, it is possible to further narrow down the types of organisms that may exist based on the existence state of each of the plurality of types of sRNA. Therefore, in the determination method according to the present disclosure, the existence state of an organism may be determined based on the existence state of each of a plurality of types of sRNA. In this determination, the expression state of sRNA, which is specifically non-expressed in the organism, can also be used. The detection or non-detection of sRNA specifically non-expressed in the organism does not, by itself, suggest the existence state of the organism, but with respect to the existence state of the sRNA specifically expressed in the organism. By combining with the information of, it is possible to further narrow down the candidates of organisms showing the expression profile of those sRNAs.

As one or more types of sRNA for detecting the existence state in the determination method according to the present disclosure, an sRNA is selected so that a specific organism of interest can be better discriminated from other organisms based on its expression profile. Is preferable.

However, it is not essential in the determination method according to the present disclosure to limit the candidate of the organism having the existing cell wall to one kind, and it is sufficient to identify the candidate group consisting of a plurality of kinds of organisms. Therefore, the detection method according to the present disclosure may determine the existence state of a plurality of types of organisms, and in that case, the detection method may individually determine the existence state of each of the plurality of types of organisms. It is a comprehensive judgment of the existence state of multiple types of organisms. That is, even if the detection method cannot determine which of the plurality of types of organisms actually exists, at least one of the plurality of types of organisms constituting the candidate group (group) exists. It is enough if it can be determined that it is present.

That is, in the determination method according to the present disclosure, determining the existence state of an organism may include determining the overall existence state of two or more kinds of organisms. When the determination method according to the present disclosure includes determining the overall existence state of two or more types of organisms, determining the overall existence state of two or more types of organisms is any of the two or more types of organisms. It may include determining whether the organism is absent or at least one of two or more organisms is present, and if it is determined that at least one of two or more organisms is present, it may be included. Further, it may include determining the abundance of at least one of two or more kinds of organisms.

In this case, it is not possible to completely determine the existence state of one of the two or more organisms of interest, but the possibility of existence of one of the organisms of interest is determined. However, further tests may be performed based on the determination result, or work such as cleaning of the analysis target obtained from the measurement sample may be performed based on the determination result. That is, determining the overall existence state of two or more types of organisms may include determining the possibility of existence of a specific organism contained in the two or more types of organisms, and further, the specificity. It may include determining the estimated abundance of the organism.

By measuring the abundance of sRNA at the time of detecting the abundance of one or more kinds of sRNA, it is possible to determine the abundance of the organism described above. The abundance of sRNA can be detected by a method generally used in the art, for example, during nucleic acid amplification from sRNA, which measures the amount of fluorescence emitted from a fluorescently labeled probe that hybridizes to sRNA. It can be measured by a method such as measuring the amount of fluorescence emitted from the primer using a fluorescently labeled primer or using qPCR.

<Identification of organisms with cell walls present in the measurement sample>
From the existence state of one or more kinds of sRNA obtained from a liquid sample, one or more kinds of organisms having an sRNA expression profile matching the existence state of the sRNA can be identified. The one or more types of sRNA are preferably sRNAs that exhibit a specific expression state depending on the organism. Detecting the presence or absence of one or more sRNAs in a liquid sample may include comprehensively detecting the sRNA present in the liquid sample, but may be present in the measurement sample. It may include measuring the existence state of one or more kinds of sRNA selected in advance in consideration of the kind of a certain organism.

The specific presence state of one type of sRNA is not completely specific to the sRNA expression profile of one type of organism, and there are multiple types of organisms having an sRNA expression profile that matches the specific presence state of sRNA. In some cases. However, since the sRNA expression profile for each organism is different for each sRNA, the types of existing organisms can be further narrowed down based on the information on the existence state of each of the plurality of types of sRNA. Therefore, in the identification method according to the present disclosure, the organism existing in the sample may be identified based on the existence state of each of the plurality of types of sRNA. However, narrowing down the candidates for existing species to one type is not essential in the identification method according to the present disclosure, and it is sufficient to identify a candidate group consisting of a plurality of types of organisms.

Therefore, the identification method according to the present disclosure may identify a plurality of types of organisms, and in that case, the identification method does not individually detect the existence of each of the plurality of types of organisms. It is a comprehensive detection of the existence of multiple types of organisms. That is, although the identification method cannot detect which of the plurality of types of organisms actually exists, it is sufficient if it can detect that at least one of the plurality of types of organisms is present.

That is, even if the identification method according to the present disclosure identifies an organism existing in the measurement sample, it includes identifying that one or more of the two or more candidate organisms are present. good. If it is identified that at least one of two or more species is present, it further comprises identifying the abundance of at least one of the two or more candidate organisms. May be good. In the identification method according to the present disclosure, when identifying an organism existing in the measurement sample includes identifying that one or more of two or more candidate organisms are present. Although it is not possible to accurately identify which of the two or more candidate organisms is present, further tests may be performed based on this identification result, or measurements are made based on this identification result. Work such as cleaning of the analysis target obtained from the sample (appropriate cleaning according to the type of candidate microorganism) may be performed.

That is, identifying that one or more of the two or more candidate organisms exists means that a specific organism included in the two or more candidate organisms is considered to be an organism that may exist. It may include identifying, and may further include identifying the estimated abundance of the particular organism.

By measuring the abundance of sRNA at the time of detecting the abundance of one or more kinds of sRNA, it is possible to identify the abundance of the organism described above. This is because the abundance of sRNA in the liquid sample is considered to reflect the amount of organisms expressing the sRNA (in the simplest case, it is proportional to the amount of organisms expressing the sRNA). The abundance of sRNA can be detected by a method generally used in the art, for example, during nucleic acid amplification from sRNA, which measures the amount of fluorescence emitted from a fluorescently labeled probe that hybridizes to sRNA. It can be measured by a method such as measuring the amount of fluorescence emitted from the primer using a fluorescently labeled primer or using qPCR (for example, obtaining the Ct value in real-time PCR).

An example of identification of an organism based on the presence of one or more types of sRNA in a liquid sample in the identification method according to the present disclosure will be described. The sRNA EC-5p-36 (see SEQ ID NO: 1; 5'-UGUGGGCACUCGAAGAUACGGAU-3', Curr Microbiol. 2013 Nov; 67 (5): 609-13) is a bacterium belonging to the genus Escherichia, according to the Nucleotide BLAST search. It is commonly expressed in Shigella spp., Salmonella spp., And Citrobacter spp. From this, when EC-5p-36 is detected to be present in the liquid sample, the present organism is one or more of Escherichia bacterium, Shigella bacterium, Salmonella bacterium, and Citrobacter bacterium. Can be identified as being. In addition, EC-3p-40, which is an sRNA, is commonly expressed in Klebsilla bacterium in addition to Shigella bacterium, Salmonella bacterium, Escherichia bacterium, and Citrobacter bacterium according to the Nuclearide BLAST search. Therefore, when EC-3p-40 (SEQ ID NO: 2; 5'-GUUGUGAUUAAGCGACU-3') is detected to be present in a liquid sample, the existing organisms are Escherichia, Shigella, Salmonella, Citrobacter. It can be identified as one or more of the genus Bacteria and the Klebsilla genus. In addition, identification may be performed by combining these results. For example, since EC-5p-36 is not expressed in Klebsiella spp., But EC-3p-40 is expressed in Klebsiella spp., EC-3p-40 is present in the liquid sample but EC-5p-36 is present. If not detected, the existing organism can be identified as a Klebsiella bacterium.

In addition, the identification of an organism may be based on the existence state of an sRNA having a specific function. For example, 24B_1 (SEQ ID NO: 3; 5'-UAACGUUAAGUGACUCUGGG-3', Scientific Reports volume 5, Article number, which is an sRNA involved in toxins (verotoxin, also called ciguatoxin) of enterohemorrhagic Escherichia coli (O-157, etc.). 10080 (see 2015)) is commonly expressed in verotoxin (ciguatoxin) -producing bacteria according to the Nucleotide blast search. Therefore, when 24B_1 is detected in the liquid sample, the existing organism can be identified as a verotoxin-carrying bacterium.

Further, in the determination method according to the present disclosure, the overall existence state of Escherichia bacterium, Shigella bacterium, Salmonella bacterium, and Citrobacter genus bacterium (whether none of them exists or one or more kinds exist, etc.) is determined. If you want to, you can detect the existence state of EC-5p-36. In the determination method according to the present disclosure, when it is desired to determine the existence state of a bacterium belonging to the genus Klebsiella, the existence state of EC-3p-40 and EC-5p-36 may be detected.

In addition, the sRNAs EC-5p-79 (SEQ ID NO: 10; 5'-UUUGCUCUUUAAAAAUC-3') and EC-3p-393 (SEQ ID NO: 11; 5'-CUCGAAGAUACGGAUCUUAAC-3') are Escherichia coli, Citrobacter. And Salmonella gallinarum. Based on the above, the correspondence between sRNA and the species is at least one selected from the group consisting of EC-5p-36, EC-3p-40, EC-5p-79, and EC-3p-393. Combination with at least one selected from the group consisting of Escherichia coli, Citrobacter fluendii, and Salmonella gallinarum, combination of fox_milRNA_5 having the nucleotide sequence represented by SEQ ID NO: 9, and nucleotide represented by Fusarium oxisporum. The combination of miR156 and black pine having the same, and the combination of miR716b having the nucleotide sequence represented by SEQ ID NO: 5 and Saccharomyces cerevisiae can be mentioned.

In addition, the sRNAs listed in Tables 1 and 2 below have been found to be expressed in Enterobacteriaceae bacteria, such as Escherichia coli. In particular, sRNA19 to sRNA38 are sequences of tRNA.

In addition, for sRNA15, 16, 19-21, 23-25, 27-30, 32, and 33, the organisms whose expression has been confirmed are classified into Table 3 below and the species names for the genus Candida. It is shown in Table 4. “Yes” in Tables 3 and 4 indicates that sRNA is expressed in the organism.

The sRNAs shown in Tables 1 and 2 can also be used in the determination method according to the present disclosure and the identification method according to the present disclosure. In the determination method according to the present disclosure and the identification method according to the present disclosure, the one or more kinds of sRNA for detecting the existence state is at least one kind (that is, sRNA15 to sRNA15 to sRNA represented by SEQ ID NOs: 15 to 54. At least one of sRNA54) is included. The one or more types of sRNA for detecting the existence state include at least one of the sRNAs represented by SEQ ID NOs: 19 to 21 and 40 (that is, at least one of sRNA 19 to sRNA 21 and sRNA 40). Is preferable.

The one or more types of sRNA that detect the presence state are at least one type of sRNA represented by SEQ ID NOs: 15 to 54 (that is, at least one type of sRNA 15 to sRNA 54), and also other sRNAs. It may be included. By further including other sRNAs, the accuracy of determination or identification can be further improved, and / or the existence state of an organism having a cell wall or identification of an organism having a cell wall can be performed for a wider range of species.

Therefore, for example, one type or a plurality of types of sRNA for detecting the existence state is at least one type of sRNA represented by SEQ ID NOs: 15 to 54 (preferably sRNA represented by SEQ ID NOs: 19 to 21 and 40). At least one of the sRNAs of SEQ ID NOs: 1 to 5 and 9 to 11) may be further contained.

For sRNAs other than the above, the correspondence between sRNAs and organisms necessary for determination or identification can be easily obtained from academic papers, the above-mentioned databases, and the like.

Considering the embodiments described above, the present disclosure also provides the following embodiments. That is, the method for detecting the organism to be detected according to the present disclosure is as follows.
Immersing the organism to be detected contained in the measurement sample in an aqueous solvent to prepare a liquid sample in which one or more types of sRNA specific to the organism to be detected leak into the aqueous solvent.
To detect the one or more types of sRNA in the liquid sample,
The one or more sRNAs include at least one of the sRNAs represented by SEQ ID NOs: 15-54. The method of immersing the organism to be detected in the aqueous solvent is not particularly limited as long as the organism to be detected is in contact with the aqueous solvent, and the measurement sample in the above-mentioned determination method according to the present disclosure and the identification method according to the present disclosure is immersed. Alternatively, it can be carried out in the same manner as the preparation of the measurement sample which is an aqueous solvent. Further, if one or more types of sRNA specific to the detection target organism contains at least one type of sRNA specifically expressed in the detection target organism, the other sRNAs are not specifically non-specific in the detection target organism. It may be an expressed sRNA.

As described above, in the determination method according to the present disclosure and the identification method according to the present disclosure, sRNA can be easily leaked from a cell having a cell wall into an aqueous solvent without undergoing a membrane denaturation operation with a strong denaturing agent. can. Then, by detecting the presence of the leaked sRNA (for example, by detecting the sRNA by nucleic acid amplification), the specific organism of interest requires less effort than the method of denatured the membrane to extract 16S rRNA. The existence state of the substance can be determined, and the organism present in the measurement sample can be identified. In particular, when the isothermal gene amplification method (for example, RCA method) in which the reaction proceeds at room temperature is used as the nucleic acid amplification method, no special device (for example, a device for executing a temperature cycle) is used from the beginning to the end. , The existence state of the organism can be easily determined, or the organism contained in the measurement sample can be identified.

According to the determination method according to the present disclosure and the identification method according to the present disclosure, unlike the culture method, it is not necessary to culture an organism that may be contained in the measurement sample. Therefore, while it is possible to make a determination or identification in a short time, it is also possible to realize high sensitivity by using nucleic acid amplification or the like. Further, the determination method according to the present disclosure and the identification method according to the present disclosure can be applied to bacteria and the like that are difficult to culture. Further, unlike the culture method, the determination method according to the present disclosure and the identification method according to the present disclosure require a small amount of sample, and the materials used for the treatment can be easily disposed of. In the determination method according to the present disclosure and the identification method according to the present disclosure, while maintaining the advantages of the gene method, the existence state of the organism can be determined and the organism contained in the measurement sample can be determined by a simpler operation than the conventional gene method. Can be identified.

The determination method according to the present disclosure and the identification method according to the present disclosure can be used, for example, for a simple microbiological test at a site where hygiene management is required (food manufacturing, medical treatment, welfare, home, etc.). Examples include hygiene management of products by testing for spoilage and spoilage bacteria in the food manufacturing process, prompt identification of the cause in the event of a food poisoning accident, prevention of secondary infection by detecting food poisoning bacteria in beds and waiting rooms of medical facilities, child welfare facilities and the elderly. Prevention of secondary infection of food poisoning bacteria in welfare facilities, prevention of secondary infection by detection of food poisoning bacteria when there are food poisoning patients at home, etc. can be mentioned.

The embodiments will be further described with reference to the following examples, but the present disclosure is not limited to the following examples. Further, "%" indicating the content of the components in the compositions of Examples and Reference Examples is based on mass unless otherwise specified. In the following examples and reference examples, "room temperature" was about 30 ° C.

<Method of quantifying sRNA by real-time PCR method>
In Reference Examples 1 to 3, Reference Examples 6 to 8, Example 9 and Reference Example 11, the sRNA to be determined for the existence state was quantified by the method described below.
The sRNA in the reaction solution in each of Reference Example 1 to Reference Example 3, Reference Example 6 to 8, Example 9 and Reference Example 11 was quantified by the real-time PCR method. Quantitative reagents (Taqman (registered trademark) microRNA Assays, manufactured by Applied Biosystems) and reverse transcriptase (Taqman (registered trademark) microRNA RT kit, manufactured by Applied Biosystems) custom-synthesized according to the sRNA to be quantified. The reverse transcription reaction was carried out according to the manufacturer's instructions to obtain a reverse transcription reaction solution containing the DNA formed by the reverse transcription. In the reverse transcription reaction, specifically, 1 μL of RNA sample, 1.5 μl of 10 × RT buffer, 0.15 μL of dNTP mix, 0.19 μL of RNase inhibitor, and an amount that makes the final concentration 1 × per reaction. The first solution of the custom synthetic Taqman assay (eg, 0.75 μL for 20 × Taqman assay) was used, and 1 μL of Multiscribe RT transcriptase was used to adjust the liquid volume to 15 μL with pure water. The temperature profile of the reverse transcription reaction included a step consisting of (1) 30 minutes at 16 ° C, followed by (2) 30 minutes at 42 ° C, and (3) 5 minutes at 85 ° C.

Next, a real-time PCR reaction was performed using the obtained reverse transcription reaction solution. Quantitative reagents custom-synthesized for the sRNA to be quantified (Taqman®, microRNA Assays, Applied Biosystems, and real-time PCR master mix (TaqMan® Universal PCR Master Mix II with UNG, A reaction solution was prepared according to the manufacturer's instructions using Applied Biosystems). Specifically, 2 μL of reverse transcription reaction solution, 10 μL of Universal PCR Master Mix II with UNG, and an amount that makes the final concentration 1 ×. A second solution of the custom synthetic Taqman assay (eg, 1 μL for 20 × Taqman assay) was used, and the reaction solution was adjusted to 20 μL with pure water. The prepared reaction solution was StepOnePlus. Using a real-time PCR system (manufactured by Applied Biosystems), perform real-time PCR with a temperature profile that includes 40 cycles of 15 seconds at 95 ° C and 1 minute at 60 ° C after a 10-minute step at 95 ° C. At that time, using StepOnePlus (registered trademark) real-time PCR system (manufactured by Applied Biosystems), automatic calculation of StepOnePlus software under the conditions of reagents = "Taqman reagents" and ramp speed = "Standard" (the above settings). The Ct value was calculated by (default setting except for). When quantifying by comparing with the standard, the sRNA sequence to be quantified was synthesized (RNA primer synthesis by Eurofin Genomics, HPLC purification grade), ^and 10- A dilution series was prepared in the range of ¹⁰ M to ^10-15 M, and real-time PCR was performed on the dilution series in parallel with the measurement of the sample, and the amount of sRNA was quantified by comparing the Ct values.

(Reference Example 1) Simple extraction of sRNA (EC-5p-36) contained in Escherichia coli Targeting EC-5p-36, which is a type of sRNA contained in Escherichia coli W3110 (hereinafter, simply referred to as "Escherichia coli W3110"). As a result, a simple extraction from Escherichia coli W3110 was attempted.
Colonies of E. coli W3110 were suspended in 100 μL of pure water to obtain a 90% by mass E. coli W3110 cell suspension. Based on this 90% by mass Escherichia coli W3110 cell suspension, the following three types of samples were prepared.

Sample 1) An RNase inhibitor (manufactured by Toyobo Co., Ltd.) was added to a 90 mass% Escherichia coli W3110 cell suspension to a final concentration of 0.4 U / μL to prepare 10 μL of a reaction solution. The reaction solution was allowed to stand at room temperature for 4 hours to prepare Sample 1.
Sample 2) The 90 mass% E. coli W3110 cell suspension was immediately purified with a miRNeasy kit (a cytolytic reagent containing phenol and causing cell membrane degeneration; manufactured by QIAGEN), and all sRNA was extracted to obtain Sample 2. ..

Further, as a comparison target, 10 μL of pure water was used as it was as sample 0.

EC-5p-36 was quantified for Samples 0 to 2 by the real-time PCR method. Each of the sRNA amounts in Samples 0 to 2 obtained by quantification was divided by the sRNA amount in Sample 2, and the obtained value was taken as the relative extraction rate (Table 5).

As can be seen from the results shown in Table 5, it was found that sRNA can be easily extracted from the cells and measured. The sRNA could be extracted with pure water alone.

(Reference Example 2) Simple extraction of sRNA (miR156) contained in black pine pollen miR156 (SEQ ID NO: 4; 5'-CAGAAGAUAGAGAGCACAUC-3'; http: //www.mirbase.org), which is a type of sRNA contained in black pine pollen. /; See pta-miR156a), we attempted a simple extraction from Japanese black pine pollen.
10 mg of Japanese black pine pollen (manufactured by Biosta) was suspended in 1 mL of pure water and allowed to stand at room temperature for 1 hour. Then, the quantification of miR156 was attempted by the real-time PCR method. Using RNase-free water as a negative control and water containing 1 nM synthetic miR156 (SEQ ID NO: 4; manufactured by Eurofins Genomics) as a positive control, it was compared whether sRNA (miR156) could be detected. As a result, it was confirmed that sRNA can be extracted from Japanese black pine pollen just by suspending it in pure water.

(Reference Example 3) Simple extraction of sRNA (miR716b) contained in yeast miR716b (SEQ ID NO: 5; 5'-GAGAUCUGGUGGUAGCAAAUA-3'; S . Rep., 2015, 5, 7763), we attempted a simple extraction of sRNA from baker's yeast.
The baker's yeast was cultured on an LB plate, 10 mg of baker's yeast was scraped off, suspended in 1 mL of pure water, and allowed to stand at room temperature for 1 hour. After standing, an attempt was made to extract miR716b by the real-time PCR method. Using RNase-free water as a negative control and 1 nM synthetic miR716b (SEQ ID NO: 5; manufactured by Eurofins Genomics) as a positive control, it was compared whether sRNA could be detected. As a result, it was confirmed that sRNA derived from baker's yeast could be extracted only by suspending in pure water, and it was also confirmed that the amount of extracted sRNA could be quantitatively detected.

(Reference Example 4) Detection of Escherichia coli-derived sRNA (EC-5p-36) by isothermal gene amplification method EC-5p-36, which is a type of sRNA contained in Escherichia coli, was targeted at E. coli. An attempt was made to detect sRNA simply extracted from coli with an aqueous solvent by an isothermal gene amplification method (SATIC method; Anal Chem. 2016 Jul 19; 88 (14): 7137-44).

<Synthesis of cyclized T1B-EC-5p-36>
First, a primer, which is a synthetic single-stranded DNA having the following nucleotide sequence, was ordered from Eurofin genomics and obtained.
Primer sequence (SEQ ID NO: 6): 5'-CCCCAAAAATCCGTATCTTCGAGTGCCACAAAAAAAGAAGCTGTTGTTGTTGTCGAAGAAGAAAAGT-3'(5'phosphorylation, HPLC purification)

Next, the above synthetic single-stranded DNA was cyclized according to the manual using a CircLigase II ssDNA Ligation kit (manufactured by Lucien). That is, in a PCR tube, 15 μL of RNase-free water (manufactured by Qiagen), 1 μL of the above synthetic single-stranded DNA of 10 pmol / μL, 2 μL of CircLigase II 10 × Reaction Buffer, 1 μL of 50 mM MnCl ₂ , and CircLigase II ssDNALig. Was added in an amount of 1 μL. After mixing, the PCR tube was treated on a thermal cycler at 60 ° C. for 1 hour and at 80 ° C. for 10 minutes to obtain 500 nM circularized DNA (hereinafter referred to as “circulated T1B-EC-5p-36”). .. This was diluted 5-fold with RNase-free water to give 100 nM cyclized T1B-EC-5p-36.

<Synthesis of cyclized T2>
First, a primer, which is a synthetic single-stranded DNA having the following nucleotide sequence, was ordered from Eurofin genomics and obtained.
Primer sequence (SEQ ID NO: 7): 5'-CCCAACCTACCCACCCTCAAAGAAAAAAAAGTGATAATTGTTGTCGAAGAAGAAAAAAAATT-3'(5'phosphorylation, HPLC purification)

Next, a circularized T1B- was used except that the primer (T2) of SEQ ID NO: 7 was used instead of the primer of SEQ ID NO: 6 (T1B-EC-5p-36) using the CircLigase II ssDNA Ligation kit (manufactured by Lucien). The same operation as in the synthesis of EC-5p-36 was carried out to obtain 500 nM cyclized DNA (hereinafter referred to as "cyclized T2"). This was diluted 1.25-fold with RNase-free water to give 400 nM cyclized T2.

<Synthesis of primer P2>
Primers with the following nucleotide sequences were ordered from Eurofin genomics to obtain synthetic primers.
Primer sequence (SEQ ID NO: 8): 5'-GAAGCTGTTGTTACTACT-3'(unmodified, HPLC purified)

The primer was diluted with RNase-free water to prepare 480 nM primer P2.

<E. Detection of sRNA derived from coli by isothermal gene amplification method>
By φ29 DNA polymerase (kit manufactured by New England Biolabs), E.I. An attempt was made to detect sRNA derived from colli. That is, 5.8 μL of RNase-free water, 2 μL of 480 μM primer P2, 2 μL of 100 nM cyclized T1B-EC-5p-36, 2 μL of 400 nM cyclized T2, and 10 mM each in a PCR tube per sample. 2 μL of dNTP Mix and 2 μL of 10 × φ29 DNA polymerase reaction buffer, 0.2 μL of kit-attached BSA and 2 μL of φ29 DNA polymerase were mixed to prepare a premix. To this premix, 2 μL of a colony cultured in LB medium of Escherichia coli W3110 suspended in 1 mL of RNase-free water was added to prepare a sample. Further, 2 μL of 10 nM synthetic EC-5p-36 (SEQ ID NO: 1; manufactured by Eurofins Genomics) was added to the premix as a positive control. Further, 2 μL of RNase-free water was added to the premix as a negative control.

Samples, positive stoves, and negative controls were each incubated at 37 ° C. for 16 hours. Subsequently, 2 μL of a 100-fold diluted solution of SYBR Gold Nuclear Acid Gel Stein (manufactured by Invitrogen), which is a reagent whose fluorescence intensity is enhanced by binding to nucleic acid, was added to the solution after incubation and mixed. The reaction solution thus obtained was irradiated with black light (365 nm), and fluorescent color development was observed. As a result, strong yellow-green fluorescence was observed in the sample and the positive control, but only weak yellow fluorescence derived from SYBR Gold Nucleic Acid Gel Stein was observed in the negative control. Therefore, in the sample, it was shown that the sRNA extracted from Escherichia coli W3110 with an aqueous solvent was amplified by isothermal gene amplification, and the amplified product could be detected by fluorescence. A comparison of fluorescence between the negative control and the sample is shown in FIG. In FIG. 1, + represents a sample and − represents a negative control.

(Reference Example 5) Extraction of sRNA from Fusarium oxysporum Fusarium oxysporum IFO5942 was cultured on an LB plate for 3 days. Then, 1 mg of the cells was scraped off and suspended in 1 mL of water containing a 1% by mass RNase inhibitor (manufactured by Toyobo Co., Ltd.). Immediately after suspension or after standing at 25 ° C. for 16 hours, the suspension was filtered through a 100K Amicon Ultra 0.5 filter (manufactured by Merck Millipore), and 10 μL of the filtrate was diluted with 90 μL of sterile water. After allowing to stand at 25 ° C. for 16 hours, 10 μL of SYBR Gold Nucleic Acid Gel Stein (manufactured by Thermo Scientific) diluted 1000-fold was added. The fluorescence of the suspension (excitation wavelength: 495 nm, emission wavelength 540 nm) was measured with a fluorescence plate reader (Spectramax 3i, manufactured by Molecular Probes). The fluorescence intensity immediately after suspension was 3.4 × 10 ⁶ RFU, but increased to 4.2 × 10 ⁶ RFU after 2 hours. From this, it was confirmed that sRNA was released from Fusarium by suspending Fusarium in water, and that its quantitative measurement was possible.

(Reference example 6) E. Detection of sRNA derived from coli (EC-5p-36) and sRNA derived from Fusarium oxysporum (fox_milRNA_5) Fusarium oxysporum IFO5942 was cultured on an LB plate at 25 ° C. for 3 days. Next, the cells were scraped off, suspended in 1 mL of pure water, and allowed to stand at room temperature for 1 hour. The Fusarium oxysporum cell suspension after standing was diluted with pure water so that the value of OD600 was 0.01 to obtain an OD0.01 Fusarium cell suspension.

In addition, Escherichia coli W3110 was cultured on an LB plate at 37 ° C. for 1 day. Next, the colonies were scraped off, suspended in 100 μL of pure water, and allowed to stand at room temperature for 1 hour. The E. coli W3110 cell suspension after standing was diluted with pure water so that the value of OD600 was 0.1 to obtain an OD0.1 Escherichia coli W3110 cell suspension.
Using the cell suspension thus obtained, quantification of EC-5p-36 and fox_milRNA_5 was attempted by real-time PCR method. EC-5p-36 sRNA (SEQ ID NO: 1) is an sRNA expressed in Escherichia coli W3110 but not in Fusarium oxysporum IFO5942. On the other hand, fox_milRNA_5 sRNA (see SEQ ID NO: 9; 5'-UCCGGUAUUGGUAGUGGC-3', PLoS One. 2014 Aug 20; 9 (8): e104956.) Is not expressed in E. coli W3110, but is expressed in Fusarium oxysporum IFO42. ..

Real-time PCR was performed on the OD0.01 Fusarium cell suspension and the OD0.1 Escherichia coli W3110 cell suspension using 1 μL of a sample according to the above <method for quantifying sRNA by real-time PCR method>. In each case where the detection target was fox_milRNA_5 and the detection target was EC-5p-36, a Taqman® Assay primer having a nucleotide sequence corresponding to the detection target was used. Table 8 shows the results of Ct values obtained by StepOnePlus® real-time PCR system (manufactured by Applied Biosystems).

From the results in Table 8, it was found that fox_milRNA_5 can be specifically detected from Fusarium, and EC-5p-36 can be specifically detected from Escherichia coli W3110. It was also shown that real-time PCR enables quantitative detection of sRNA.

(Reference Example 7) Examination of temperature conditions during extraction treatment Escherichia coli DH5α was sown on an LB plate and cultured, and the resulting colonies were suspended in 2 mL of LB medium and shake-cultured at 37 ° C. and 180 rpm for 24 hours. went. Then, 40 μL of the culture solution was collected, inoculated into 4 mL of LB medium, and shaken at 37 ° C. and 180 rpm for 4 hours. Then, the culture broth was centrifuged at 3000 G for 5 minutes, the supernatant was removed by suction, and then sterile water was added. At this time, OD600 was measured and adjusted to OD = 0.1 with sterile water to prepare an E. coli suspension.

Three 500 μL samples were prepared from the prepared E. coli suspension and allowed to stand at 5 ° C, 25 ° C, or 37 ° C for 1 hour, respectively. The E. coli suspension was then filtered through a 0.22 μm filter.

Reverse transcription reaction and real-time PCR were performed on EC-5p-36 and 16S rRNA in the filtrate. 1 μL of filtrate is collected as an RNA sample, real-time PCR is performed for EC-5p-36 according to the above <method for quantifying sRNA by real-time PCR method>, and 16S rRNA is described below for <16S rRNA by real-time PCR method>. Real-time PCR was performed according to the quantification method>. The results of Ct values obtained by the real-time PCR method are shown in Table 9. It was found that all 16S rRNAs were extracted only at low concentrations. On the other hand, EC-5p-36 was extracted in an amount sufficient to determine the presence at any temperature of 10 ° C, 25 ° C, and 37 ° C. Further, since the Ct value decreased as the temperature at the time of extraction (immersion) increased, it can be observed that the higher the temperature, the easier the extraction. As described above, it can be seen that EC-5p-36 (base number 23), which has a relatively small number of bases, has a low Ct value and can be stably detected. On the other hand, 16S rRNA having a relatively large number of bases (about 1500 bases) has a high Ct value and is difficult to detect.

The method for quantifying 16S rRNA by the real-time PCR method is described below.
<Method of quantifying 16S rRNA by real-time PCR method>
The 16S rRNA to be determined for the existence state was quantified by the method described below. A 1 μL RNA sample was used and prepared so that the liquid volume was 10 μL. The reverse transcription reaction was carried out in 10 μL of the reaction solution, which was composed of 100 nM primer (SEQ ID NO: 12: CCGGGAACGTATTCACC), 0.4% by volume of Moloney Murine Leukemia Virus Reverse Transcriptase (manufactured by Promega), 20% by volume. It was a solution containing 5X Reaction Buffer, 0.4 mM each dNTP, 0.1% by volume RNase primer (manufactured by Toyo Spinning Co., Ltd.), and 10% by volume of the above extract (RNA sample). The temperature profile of the reverse transcription reaction included a step consisting of (1) 30 minutes at 16 ° C, followed by (2) 20 minutes at 42 ° C, and (3) 5 minutes at 85 ° C.

Next, a real-time PCR reaction was performed using the obtained reverse transcription reaction solution. A 2 μL reverse transcription reaction solution was used, and the volume was adjusted to 20 μL. The PCR reaction solution was Primer 1 of 300 nM (SEQ ID NO: 13: AGAGTTTGATCATGGCTCAG), Primer 2 of 300 nM (SEQ ID NO: 14: CCGGGAACGTATTCACC), and 200 μM each of dNTP (CleanAmpTM Hot Start dNTP Mix, Sigma-Al). Note: Pre-filtered and purified with Mercon Ultra 50 K centrifugal primer from Merck Millipore), 50 mM KCl, 2.25 mM MgCl ₂ , 10 mM Tris-HCl (pH 8.3), 1 × EvaGreen (Biotium Inc. CA,). (Obtained from USA), 0.05 units / μL eukalyote-made thermostable DNA polymerase (see J Clin Microbiol. 2011 49 (9) 3316-3320), and 10% by volume of the above reverse transfer reaction solution were used. The temperature profile of this real-time PCR reaction consists of 40 cycles of a denaturation step at 95 ° C. for 10 minutes followed by a cycle consisting of 94 ° C. for 10 seconds, 65 ° C. for 20 seconds, 72 ° C. for 30 seconds, and 85 ° C. for 10 seconds. It was included. Using StepOnePlus (registered trademark) real-time PCR system (manufactured by Applied Biosystems), with the conditions of reagents = "SYBR Green reagents" and ramp speed = "Standard" (other than these, default settings), StepOnePlus software automatically calculates C. The value was calculated.

(Reference Example 8) Detection of bacteria belonging to Enterobacteriaceae Escherichia coli, Citrobacter fluendii, and Salmonella gallinarum, which are bacteria belonging to Enterobacteriaceae, were inoculated on an LB plate and cultured, and 2 mL of the resulting colonies were cultivated. The cells were suspended in LB medium and shake-cultured at 37 ° C. and 180 rpm for 24 hours. Then, 40 μL of the culture solution was collected, inoculated into 4 mL of LB medium, and shaken at 37 ° C. and 180 rpm for 24 hours. Then, the culture broth was centrifuged at 3000 G for 5 minutes, the supernatant was removed by suction, and then sterile water was added. At this time, OD600 was measured and adjusted to OD = 1 with sterile water to prepare a bacterial suspension.

Three 500 μL samples were prepared from the prepared bacterial suspension and allowed to stand at 5 ° C, 25 ° C, or 37 ° C for 1 hour, respectively. Then, the bacterial suspension was filtered through a 0.22 μm filter.

Reverse transcription reaction and real-time PCR were performed on sRNA (EC-5p-36, EC-3p-40 and EC-5p-79) in the filtrate. Using 1 μL of each of the filtrates, real-time PCR was performed according to the above <method for quantifying sRNA by real-time PCR method>. Table 10 shows the results of Ct values obtained by a real-time PCR system (manufactured by Applied Biosystems). In each case, the Ct value was 30 or less, and the presence of Enterobacteriaceae bacteria to be investigated was detected.

(Example 9) Detection of bacteria belonging to Enterobacteriaceae by sRNAs 19, 20, 21 and 40 Preparation of a bacterial suspension with OD = 1 was carried out in the same manner as in Reference Example 8. Three 500 μL samples were prepared from the prepared bacterial suspension and allowed to stand at 5 ° C, 25 ° C, or 37 ° C for 1 hour, respectively.

Next, reverse transcription reaction and real-time PCR were performed on sRNA (sRNA19, sRNA20, sRNA21 and sRNA40) in the bacterial suspension after standing. Real-time PCR was performed according to the above <method for quantifying sRNA by real-time PCR method> using 1 μL each of the bacterial suspensions after standing. Table 11 shows the results of Ct values obtained by a real-time PCR system (manufactured by Applied Biosystems). In each case, the Ct value was 30 or less, and the presence of Enterobacteriaceae bacteria to be investigated was detected. Therefore, it was shown that microorganisms of Enterobacteriaceae can also be detected by using tRNA of Enterobacteriaceae and other sRNAs.

(Reference Example 10) Electrophoresis of nucleic acid extract Escherichia coli W3110 was seeded on an LB plate and cultured, and the resulting colonies were suspended in 2 mL of LB medium and shake-cultured at 37 ° C. and 180 rpm for 24 hours. .. Then, 100 μL of the culture solution was collected, inoculated into 10 mL of LB medium, and shaken at 37 ° C. and 180 rpm for 4 hours. Then, the culture broth was centrifuged at 3000 G for 5 minutes, the supernatant was removed by suction, and then sterile water was added. At this time, OD600 was measured and adjusted to OD = 1 with sterile water to prepare a bacterial suspension.

A 500 μL bacterial suspension was allowed to stand at 37 ° C. for 1 hour. The suspension was then centrifuged at 3000 G for 5 minutes and the supernatant was filtered through a 0.22 μm filter. Mix 10 μL of filtrate and 2 μL of 6x Loading buffer (manufactured by Takara Bio Inc.), add to 2 mass% agarose gel (LO3, manufactured by Takara Bio Inc.), and in TAE (Tris-acetate with EDTA) buffer. Electrophoresed. The results are shown in FIG. As a ladder, Gene ladder window 1 (manufactured by Nippon Gene Co., Ltd.) was used (lane 2 on the right side). 0.01% by mass SYBR Green II (manufactured by Takara Bio Inc.) was used as the fluorescent substance for staining the nucleic acid. Lane 1 on the left side is the lane where the filtrate is loaded.

As a result of electrophoresis, fluorescence was observed in a region having a length of 500 bases or less, particularly a region having a length of 100 bases or less. Fluorescence depends on the concentration of the substance, but if it is a small molecule substance, the number of molecules is large even with the same fluorescence, so it was shown that the substance concentration (number of molecules) of nucleic acids with a length of 100 bases or less is particularly high. ..

(Reference Example 11) Detection of aerial cells Escherichia coli DH5α was seeded on an LB plate and cultured, and the resulting colonies were suspended in 2 mL of LB medium and shake-cultured at 37 ° C. and 180 rpm for 24 hours. Then, 100 μL of the culture solution was collected, inoculated into 10 mL of LB medium, and shaken at 37 ° C. and 180 rpm for 4 hours. Then, the culture broth was centrifuged at 3000 G for 5 minutes, the supernatant was removed by suction, and then sterile water was added. At this time, OD600 was measured and adjusted to OD = 1 with sterile water to prepare an E. coli suspension. The resulting E. coli suspension was placed in a 30 mL glass spray.

An empty petri dish (9 cm in diameter) for collecting aerial cells and a petri dish (9 cm in diameter) containing LB solid medium were placed on a table as positive controls, and the E. coli suspension was sprayed once from 30 cm above the sky by a glass spray. The petri dish containing the LB solid medium was covered and placed in an incubator at 37 ° C. and cultured for 1 day. For an empty petri dish, 500 μL of sterilized water was added, the sterilized water was spread throughout the petri dish with a spreader, and then the liquid in the petri dish was collected and allowed to stand at 37 ° C. for 1 hour. When the abundance of EC-5p-36 was measured by the real-time PCR method according to the above <method for quantifying sRNA by the real-time PCR method> from the collected liquid from an empty petri dish, the Ct value was 28 or less, and EC-5p-36. The existence of was confirmed. On the other hand, as a negative control, when the real-time PCR method was directly performed on sterile water and the abundance of EC-5p-36 was measured, the Ct value was 33 or more, and the existence of EC-5p-36 was denied. In addition, colony formation was observed from the positive control LB petri dish.

From the results of Reference Example 11, it was suggested that the determination method and the identification method according to the present disclosure can also be applied to the measurement sample obtained by collecting the aerial cells.

All documents, patent applications, and technical standards described herein are to the same extent as if the individual documents, patent applications, and technical standards were specifically and individually stated to be incorporated by reference. Incorporated by reference herein.

Claims (28)

To prepare a liquid sample by immersing the measurement sample in an aqueous solvent, or to prepare a measurement sample that is an aqueous solvent as a liquid sample.
To detect the presence or absence of one or more types of sRNA in the liquid sample,
Determining the existence state of an organism having a cell wall based on the existence state of one or more types of sRNA.
Including
The one or more sRNAs comprises at least one of the sRNAs represented by SEQ ID NOs: 15-54.
A method for determining the existence state of an organism having a cell wall. The determination method according to claim 1, wherein the one or more kinds of sRNAs contain at least one kind of sRNA represented by SEQ ID NOs: 19 to 21 and 40. The determination method according to claim 1 or 2, wherein the one or more kinds of sRNA show a specific expression state in the organism having the cell wall. The invention according to any one of claims 1 to 3, wherein determining the existence state of the organism having a cell wall includes determining the overall existence state of two or more kinds of organisms having a cell wall. Judgment method. The determination method according to any one of claims 1 to 4, wherein detecting the presence state of the sRNA includes detecting the abundance of the sRNA. The determination method according to any one of claims 1 to 5, wherein the organism having a cell wall comprises at least one selected from the group consisting of Escherichia coli, Citrobacter freundii, and Salmonella gallinarum. The determination method according to any one of claims 1 to 5, wherein the organism having a cell wall contains a verotoxin-producing bacterium. The measurement sample is a measurement sample obtained by collecting airborne substances, and determining the existence state of an organism having a cell wall includes determining the existence state of an organism having a cell wall existing in the air. , The determination method according to any one of claims 1 to 7. The determination method according to any one of claims 1 to 8, wherein the immersion is performed at a temperature within the temperature range of 0 ° C to 50 ° C. The determination method according to any one of claims 1 to 9, wherein the number of bases of each of the one type or a plurality of types of sRNA is in the range of 5 to 500. The one or more types of sRNA are represented by EC-5p-36 having the nucleotide sequence represented by SEQ ID NO: 1, EC-3p-40 having the nucleotide sequence represented by SEQ ID NO: 2, and SEQ ID NO: 10. EC-5p-79 having a nucleotide sequence, EC-3p-393 having a nucleotide sequence represented by SEQ ID NO: 11, fox_milRNA_5 having a nucleotide sequence represented by SEQ ID NO: 9, and a nucleotide sequence represented by SEQ ID NO: 4. The determination method according to any one of claims 1 to 10, further comprising at least one selected from the group consisting of miR156 having miR156 and miR716b having a nucleotide sequence represented by SEQ ID NO: 5. .. The determination method according to any one of claims 1 to 11, wherein the aqueous solvent contains a reagent for nucleic acid amplification. The determination method according to any one of claims 1 to 12, wherein the detection of the existence state of the one or a plurality of types of sRNA is performed by isothermal gene amplification. 13. The determination method according to claim 13, wherein the isothermal gene amplification is performed at a temperature within the temperature range of 10 ° C to 40 ° C. The determination method according to any one of claims 1 to 12, wherein the presence or absence of the one or a plurality of types of sRNA is detected by PCR. To prepare a liquid sample by immersing the measurement sample in an aqueous solvent, or to prepare a measurement sample that is an aqueous solvent as a liquid sample.
To detect the presence or absence of one or more types of sRNA in the liquid sample,
To identify an organism having a cell wall present in the measurement sample based on the presence state of the one or more types of sRNA.
Including
The one or more sRNAs comprises at least one of the sRNAs represented by SEQ ID NOs: 15-54.
A method for identifying an organism having a cell wall. 16. The identification method of claim 16, wherein the one or more sRNAs comprises at least one of the sRNAs represented by SEQ ID NOs: 19-21 and 40. The identification method according to claim 16 or 17, wherein the one or more kinds of sRNA show a specific expression state depending on an organism having a cell wall. Any of claims 16 to 18, wherein identifying an organism having a cell wall present in the measurement sample includes identifying one or more of two or more candidate organisms. The identification method described in item 1. The identification method according to any one of claims 16 to 19, wherein detecting the presence state of the sRNA comprises detecting the abundance of the sRNA. 16 to claims, wherein the measurement sample is a measurement sample obtained by collecting airborne substances, and identifying an organism having the cell wall includes identifying an organism having a cell wall existing in the air. Item 2. The identification method according to any one of items 20. The identification method according to any one of claims 16 to 21, wherein the immersion is performed at a temperature within the temperature range of 0 ° C to 50 ° C. The identification method according to any one of claims 16 to 22, wherein the number of bases of each of the one or a plurality of types of sRNA is in the range of 5 to 500. The one or more types of sRNA are represented by EC-5p-36 having the nucleotide sequence represented by SEQ ID NO: 1, EC-3p-40 having the nucleotide sequence represented by SEQ ID NO: 2, and SEQ ID NO: 10. EC-5p-79 having a nucleotide sequence, EC-3p-393 having a nucleotide sequence represented by SEQ ID NO: 11, fox_milRNA_5 having a nucleotide sequence represented by SEQ ID NO: 9, and a nucleotide sequence represented by SEQ ID NO: 4. The identification method according to any one of claims 16 to 23, further comprising at least one selected from the group consisting of miR156 having miR156 and miR716b having the nucleotide sequence represented by SEQ ID NO: 5. The identification method according to any one of claims 16 to 24, wherein the aqueous solvent contains a reagent for nucleic acid amplification. The identification method according to any one of claims 16 to 25, wherein the detection of the existence state of one or more kinds of sRNA is performed by isothermal gene amplification. 26. The identification method according to claim 26, wherein the isothermal gene amplification is performed at a temperature within the temperature range of 10 ° C to 40 ° C. The identification method according to any one of claims 16 to 25, wherein the presence or absence of the one or a plurality of types of sRNA is detected by PCR.

Images