JP2020094062A - Agent for increasing fatty acid content in living body - Google Patents

Abstract

To provide an agent for increasing fatty acid content in a living body which accelerates generation of fatty acid in a living body to increase the total fatty acid amount in a living body, an agent for increasing highly unsaturated fatty acid content in a living body which accelerates generation of highly unsaturated fatty acid in a living body to increase the amount of highly unsaturated fatty acid in a living body, a modifier of fatty acid composition in a living body which accelerates generation of highly unsaturated fatty acid in a living body to increase the amount of highly unsaturated fatty acid, and modifies fatty acid composition in a living body, and an expression promoter of highly unsaturated fatty acid synthetic gene which accelerates expression of a highly unsaturated fatty acid synthetic gene in a living body to increase the expression level of the gene.SOLUTION: An agent for increasing fatty acid content in a living body, an agent for increasing highly unsaturated fatty acid content in a living body, a modifier of fatty acid composition in a living body, or an expression promoter of a highly unsaturated fatty acid synthetic gene which have Pyrus communis L. extract as an active ingredient.SELECTED DRAWING: None

Description

The present invention relates to a fatty acid content-increasing agent in vivo, a polyunsaturated fatty acid content-increasing agent in vivo, a fatty acid composition modifier in vivo, and a polyunsaturated fatty acid synthesis gene expression promoter.

Polyunsaturated fatty acids (polyunsaturated fatty acids) such as docosahexaenoic acid (hereinafter also referred to as “DHA”) and eicosapentaenoic acid (hereinafter also referred to as “EPA”) are one of the nutrients that are difficult to produce in the human body. Is. These highly unsaturated fatty acids prevent or improve thrombotic diseases, arteriosclerotic diseases, hyperlipidemia, hypertension, atopic dermatitis, senile dementia, anti-allergic action, anti-inflammatory action, learning ability or memory ability. It has been attracting attention as a component showing effects such as improvement of eyesight, suppression of deterioration of visual acuity, improvement of athletic ability, and the like. Therefore, many dietary supplements containing highly unsaturated fatty acids are sold.

The polyunsaturated fatty acid such as EPA and DHA has a property that the double bond site is easily oxidized and easily converted into various peroxides or oxides. It is known that these peroxides and oxides are toxic to humans and animals.
Therefore, methods for preventing the oxidation of highly unsaturated fatty acids in vivo have been proposed so far. For example, Patent Literature 1 describes an agent for improving lipid metabolism in an animal body, which contains L-ascorbic acid phosphates and/or α-tocopherol phosphates. In addition, Patent Document 2 describes an in vivo DHA synthesis promoter using fucoxanthin as an in vivo DHA synthesis promoter.

On the other hand, large amounts of highly unsaturated fatty acids are accumulated in fats of fish such as sardines, horse mackerel, mackerel, salmon, and herring. However, many fish themselves are known to have low ability to synthesize highly unsaturated fatty acids such as EPA and DHA in vivo. Therefore, in order to accumulate polyunsaturated fatty acids in fish fat in abundance, it is necessary to feed fish containing EPA and DHA when feeding fish. However, as feed containing a large amount of EPA and DHA, fish oil or fish meal made from natural marine fish is generally added. Therefore, problems such as environmental destruction due to resource depletion of these natural marine fish and rising raw material prices have arisen. Further, when natural marine fish are used as feed for feeding fish containing highly unsaturated fatty acids, harmful substances in the sea may be accumulated in the produced fish due to bioconcentration.
Therefore, there is a demand for a method of accumulating a large amount of polyunsaturated fatty acids in the living body without feeding natural marine fish containing a large amount of EPA and DHA as food.

JP 2001-169731 A JP, 2007-77067, A

An object of the present invention is to provide an agent that promotes the production of fatty acids in vivo and increases the total amount of fatty acids in vivo.
Another object of the present invention is to provide an agent that promotes the production of highly unsaturated fatty acids in vivo and increases the amount of highly unsaturated fatty acids in vivo.
Another object of the present invention is to provide an agent that promotes the production of polyunsaturated fatty acids in vivo to increase the amount of polyunsaturated fatty acids in vivo and modifies the fatty acid composition in vivo.
Another object of the present invention is to provide an agent that promotes the expression of a polyunsaturated fatty acid synthesis gene in vivo and increases the expression level of the gene.

Another object of the present invention is to provide a method for promoting the production of fatty acids in the living body of fish to increase the amount of fatty acids in the living body of fish.
Another object of the present invention is to provide a method for promoting the production of highly unsaturated fatty acids in the living body of fish to increase the amount of highly unsaturated fatty acids in the living body of fish.
Another object of the present invention is to provide a method for promoting the production of highly unsaturated fatty acids in a living body of fish to increase the amount of highly unsaturated fatty acids in the living body of fish and modifying the fatty acid composition in the living body.
Further, it is an object of the present invention to provide a method for promoting the expression of a polyunsaturated fatty acid synthesis gene in the living body of fish to increase the expression level of the gene.

The present inventors have made extensive studies in view of the above problems. As a result, ingestion or administration of a predetermined amount of the pear ( Pyrus communis L.) extract and the prune ( Prunus domestica ) extract significantly promotes fatty acid synthesis, particularly highly unsaturated fatty acid synthesis in vivo. I found that. And, ingestion or administration of these extracts to fish such as larva and adult fish has the effect of promoting the expression of highly unsaturated fatty acid synthesis gene, and promotes the production of fatty acids, especially highly unsaturated fatty acids in vivo. It has been found that it has the effect of increasing the total fatty acid content and the polyunsaturated fatty acid content in vivo.
The present invention has been completed based on these findings.

The present invention comprises an in-vivo fatty acid content-increasing agent, an in-vivo highly unsaturated fatty acid-increasing agent, and an in-vivo fatty acid, which comprises at least one extract selected from the group consisting of a pear extract and a prune extract as an active ingredient. The present invention relates to a composition modifier and a polyunsaturated fatty acid synthesis gene expression promoter.
The present invention also provides a method for increasing the fatty acid content in a fish body, which comprises administering to or ingesting at least one extract selected from the group consisting of a pear extract and a prune extract in a fish body, and The present invention relates to a method for increasing the content of unsaturated fatty acids, a method for modifying fatty acid composition in a living body of fish, and a method for promoting expression of a gene for highly unsaturated fatty acid synthesis in a living body of fish.

The in-vivo fatty acid content-increasing agent of the present invention can promote the production of fatty acids in vivo and increase the total amount of fatty acids in vivo.
Further, the in vivo highly unsaturated fatty acid content-increasing agent can promote the production of highly unsaturated fatty acids in vivo and increase the amount of highly unsaturated fatty acids in vivo.
The in-vivo fatty acid composition modifying agent of the present invention can modify the in-vivo fatty acid composition by promoting the production of highly unsaturated fatty acids in vivo and increasing the amount of highly unsaturated fatty acids in vivo.
The polyunsaturated fatty acid synthesis gene expression promoter of the present invention can promote the expression of the polyunsaturated fatty acid synthesis gene in vivo and increase the expression level of the gene.

Further, the method for increasing the fatty acid content in the living body of a fish of the present invention can increase the amount of the fatty acid in the living body of the fish by promoting the production of fatty acid in the living body of the fish.
Further, the method for increasing the polyunsaturated fatty acid content in the living body of a fish of the present invention can promote the production of the polyunsaturated fatty acid in the living body of fish and increase the amount of the polyunsaturated fatty acid in the living body.
Further, the method for modifying a fatty acid composition in a living body of a fish of the present invention modifies the fatty acid composition in a living body by promoting the production of a highly unsaturated fatty acid in the living body of a fish to increase the amount of the highly unsaturated fatty acid in the living body of a fish. be able to.
Furthermore, the method for promoting the expression of a polyunsaturated fatty acid synthesis gene in the living body of a fish of the present invention can promote the expression of the polyunsaturated fatty acid synthesis gene in the living body of a fish and increase the expression amount of the gene.

As used herein, the term "prevention" refers to preventing or delaying the onset of a disease or condition in an individual, or reducing the risk of developing an individual's disease or condition.
Further, in the present specification, “improvement” means improvement or alleviation of a disease, symptom or condition, prevention or delay of deterioration of a disease, symptom or condition, or reversal, prevention or delay of progression of a disease, symptom or condition. ..
Further, in the present specification, “non-therapeutic” is a concept that does not include a medical act, that is, an act of treating a human body by treatment.
In addition, in the present specification, “in vivo fatty acid composition modification” means increasing the content of highly unsaturated fatty acids in vivo, which will be described later, and increasing the content ratio of highly unsaturated fatty acids to the total amount of fatty acids in vivo. Say that.
Furthermore, in the present specification, the “living body” also includes any tissues and organs in which highly unsaturated fatty acids are present. Examples of these tissues and organs include muscle tissue, breast milk, nerve tissues such as brain and retina, myocardium, sperm, adipose tissue, and liver tissue. In the present invention, the “living body” preferably refers to muscle tissue.

The in-vivo fatty acid content increasing agent, the in-vivo highly unsaturated fatty acid content increasing agent, the in-vivo fatty acid composition modifying agent, and the highly unsaturated fatty acid synthesis gene expression-promoting agent of the present invention comprises a pear extract and a prune extract. At least one extract selected from the above is used as an active ingredient.
Further, the method for increasing the fatty acid content, the method for increasing the polyunsaturated fatty acid content, the method for modifying the fatty acid composition, and the method for accelerating the polyunsaturated fatty acid synthesis gene expression of the present invention are carried out from the group consisting of pear extract and prune extract. Fish is administered or ingested with at least one extract selected.

“Polyunsaturated fatty acid” refers to an unsaturated fatty acid having two or more unsaturated bonds. Typical polyunsaturated fatty acids include ω-such as linoleic acid, γ-linolenic acid, eicosadienoic acid, dihomo-γ-linolenic acid, arachidonic acid, docosadienoic acid, docosatetraenoic acid, docosapentaenoic acid, and calendic acid. 6 fatty acids, α-linolenic acid (hereinafter also referred to as “ALA”), stearidonic acid (hereinafter also referred to as “STD”), eicosatrienoic acid (hereinafter also referred to as “ETE”), eicosatetraenoic acid (hereinafter , "ETA"), EPA, docosapentaenoic acid (hereinafter also referred to as "DPA"), DHA, tetracosapentaenoic acid, ω-3 fatty acid such as tetracosahexaenoic acid, and ω- such as mead acid. 9 fatty acids are known.

Fatty acid elongation enzyme and fatty acid desaturase are mainly involved in the synthesis of highly unsaturated fatty acids in vivo. Here, the "fatty acid elongation enzyme" is an enzyme involved in the elongation of a fatty acid having two carbon atoms, and the "fatty acid desaturase" is an enzyme involved in the formation of a double bond of a fatty acid.
ELOVL5, ELOVL2, and ELOVL6 are known as examples of the fatty acid elongation enzyme. FADS2, DEGS2, and FAT1 are known as examples of fatty acid desaturase.

As demonstrated in Examples described below, the extract used in the present invention is a gene encoding a fatty acid elongation enzyme and a fatty acid desaturase involved in the synthesis of highly unsaturated fatty acids (fatty acid elongation gene and fatty acid desaturation). Gene) is promoted. Specifically, ω-6 or ω containing elovl5 (ELOVL family member 5, elongation of long chain fatty acids) gene encoding ELOVL5 and elovl2 (elongation of very long chain fatty acids-like 2) gene encoding ELOVL2. -3 promotes the expression of the ω-6 or ω-3 fatty acid desaturation gene containing the fatty acid elongation gene and the fads2 (fatty acid desaturase 2) gene encoding FADS2.
In addition, as demonstrated in Examples described below, according to the present invention, by promoting the production of highly unsaturated fatty acids in vivo and increasing the amount of highly unsaturated fatty acids in vivo, the fatty acids in vivo can be increased. The composition can be modified. Specifically, ω-6 or ω-3 fatty acid having 18 or more carbon atoms, preferably ω-3 fatty acid having 18 or more carbon atoms, more preferably ω-3 fatty acid having 20 or more carbon atoms, and even more preferably Is an ω-3 fatty acid having 20 or more carbon atoms and 4 or more double bonds, more preferably an ω-3 fatty acid having 20 or more carbon atoms and 5 or 6 double bonds, and even more preferably EPA. By promoting the production of DHA and DHA and increasing the amount of these highly unsaturated fatty acids in vivo, the fatty acid composition in vivo can be modified. Furthermore, the total amount of total fatty acids in the body also increases.
In the present specification, the term “polyunsaturated fatty acid” means an ω-3 fatty acid having 18 or more carbon atoms (for example, ALA, STD, ETE, ETA, EPA, DPA, DHA, tetracosapentaenoic acid, tetracosa). Hexaenoic acid), preferably an ω-3 fatty acid having 20 or more carbon atoms (eg, ETE, ETA, EPA, DPA, DHA, tetracosapentaenoic acid, tetracosahexaenoic acid), more preferably 20 carbon atoms. Above, ω-3 fatty acids having 4 or more double bonds (eg, ETA, EPA, DPA, DHA, tetracosapentaenoic acid, tetracosahexaenoic acid), and more preferably double carbon atoms of 20 or more. Ω-3 fatty acids having 5 or 6 bonds (eg, EPA, DPA, DHA, tetracosapentaenoic acid, tetracosahexaenoic acid), and even more preferably EPA and DHA are preferred.

Next, each extract used in the present invention will be described.
In the present specification, "pear ( Pyrus communis L.)" is a plant belonging to the genus Pyrus of the family Rosaceae.
In the present specification, the "prune ( Prunus domestica )" is a plant of the genus Prunus of the family Rosaceae.

In the production of the extract used in the present invention, any part of the plant can be used, and whole plants, roots, tuberous roots, rhizomes, trunks, branches, stems, leaves (leaf blades, petioles, etc.), bark, sap. , Resin, flower (petal, ovary, etc.), fruit, seed, etc. can be used. Moreover, you may use combining these site|parts in multiple numbers.
For the production of the pear extract, it is preferable to extract the pear fruit.
For the production of prune extract, it is preferable to extract the fruits of prune.

The extract used in the present invention can be obtained by an ordinary extraction method used for plant extraction and the like. The extraction method can be set as appropriate and is preferably obtained by extracting the plant at room temperature or under heating, or by using an extraction device such as a Soxhlet extractor.
In the preparation of the extract used in the present invention, the plant can be used as it is or after being dried and pulverized. Further, steam distillates or pressed products of the above plants can be used as the extract, and those purified from essential oil or the like can be used, or commercially available products can also be used. Any one of the above-mentioned plants, steam distillates or compressed products thereof may be used alone, or two or more thereof may be used in combination.

The extraction solvent used for the preparation of the extract can be appropriately selected, and those commonly used for extracting plant components, for example, water; alcohols such as methanol, ethanol, propanol, butanol; ethylene glycol, propylene glycol, 1,2 -Polyhydric alcohols such as butylene glycol, 1,3-butylene glycol, 1,4-butylene glycol and 2,3-butylene glycol; ketones such as acetone and methyl ethyl ketone; esters such as methyl acetate and ethyl acetate; tetrahydrofuran Chain and cyclic ethers such as diethyl ether; polyethers such as polyethylene glycol; halogenated hydrocarbons such as dichloromethane, dichloroethane, chloroform, carbon tetrachloride; hydrocarbons such as hexane, cyclohexane, petroleum ether; benzene , Aromatic hydrocarbons such as toluene, pyridines, supercritical carbon dioxide, fats and oils, waxes, and other oils. These may be used alone or in combination of two or more.
The pear extract is preferably an extract with water, ethanol, or an aqueous solution of ethanol, more preferably an extract with water or ethanol, and even more preferably an extract with water. The prune extract is preferably an extract with water, ethanol, or an aqueous ethanol solution, more preferably an extract with ethanol or an aqueous ethanol solution, and even more preferably an extract with an aqueous ethanol solution. In addition, the pH of the extraction solvent may be adjusted by adding acid or alkali during the extraction.

Ordinary conditions can also be applied to the extraction conditions, for example, the plant is 0° C. or higher, preferably 4° C. or higher and 100° C. or lower, preferably 80° C. or lower, more preferably 40° C. or lower for 1 minute or longer, preferably 1 hour. As mentioned above, it may be immersed or heated and refluxed for 1 day or more and 50 days or less, preferably 30 days or less. In order to improve the extraction efficiency, stirring may be performed together or homogenization treatment may be performed in a solvent. The amount of the extraction solvent used is 1 time or more, preferably 5 times or more, 100 times or less, preferably 50 times or less, more preferably 40 times or less, with respect to the dry matter equivalent weight of the plant. Is.

In the present invention, the extract obtained by the above method may be used as it is, or the highly active fraction may be fractionated by an appropriate separation means such as gel filtration, chromatography, and precision distillation. .. Further, the obtained extract may be diluted, concentrated or lyophilized, and then used in the form of powder or paste. Further, the extract obtained by the above method can be used by being redissolved in a solvent different from the above extraction solvent.
In the present invention, the “extract” includes various solvent extracts obtained by the above-mentioned extraction method, diluted solutions thereof, concentrated solutions thereof, purified fractions thereof, dried powder thereof or transfer solutions thereof.

In the present invention, one kind of the extracts may be used alone, or two kinds may be used in combination.

The forms of the in-vivo fatty acid content-increasing agent, the in-vivo highly unsaturated fatty acid-increasing agent, the in-vivo fatty acid composition-modifying agent, and the highly unsaturated fatty acid synthesis gene expression-promoting agent of the present invention can be appropriately selected. For example, the active ingredient alone may be used as the in vivo fatty acid content increasing agent, the in vivo highly unsaturated fatty acid content increasing agent, the in vivo fatty acid composition modifying agent, or the highly unsaturated fatty acid synthesis gene expression promoting agent. Alternatively, the in-vivo fatty acid content-increasing agent, the in-vivo highly unsaturated fatty acid-content increasing agent, the in-vivo fatty acid composition-modifying agent, or the highly-unsaturated fatty acid synthesis of the present invention, which comprises the active ingredient and a pharmaceutically acceptable carrier. A gene expression promoter may be used as a pharmaceutical composition. Alternatively, the in vivo fatty acid content increasing agent, the in vivo highly unsaturated fatty acid content increasing agent, the in vivo fatty acid composition modifying agent, or the highly unsaturated fatty acid synthesis gene expression promoting agent of the present invention may be contained in the food composition. Alternatively, the feed composition may contain the in vivo fatty acid content increasing agent, the in vivo highly unsaturated fatty acid content increasing agent, the in vivo fatty acid composition modifying agent, or the highly unsaturated fatty acid synthesis gene expression promoting agent.
Here, the in-vivo fatty acid content increasing agent, the in-vivo highly unsaturated fatty acid content increasing agent, the in-vivo fatty acid composition modifying agent, and the highly unsaturated fatty acid synthesis gene expression-promoting agent include the extract alone as an active ingredient. And a composition containing the extract as an active ingredient and a pharmaceutically acceptable carrier and various additives.
Hereinafter, embodiments of a composition containing the extract as an active ingredient and a pharmaceutically acceptable carrier and various additives will be described.

When preparing a pharmaceutical composition as an agent for increasing the content of in-vivo fatty acid of the present invention, an agent for increasing in-vivo highly unsaturated fatty acid content, an agent for modifying in-vivo fatty acid composition, or an agent for highly unsaturated fatty acid synthesis gene expression, usually, It is prepared as a formulation containing the active ingredient and preferably a pharmaceutically acceptable carrier. The pharmaceutically acceptable carrier generally means an inert, non-toxic, solid or liquid filler, diluent, encapsulating material, or the like that does not react with the active ingredient, such as water. , Ethanol, polyols, suitable mixtures thereof, solvents or dispersion media such as vegetable oils.

The pharmaceutical composition is orally administered, for example, in the oral cavity, skin, subcutaneously, mucosa, intravenously, intraarterially, intramuscularly, intraperitoneally, intravaginally, pulmonary, intracerebrally, Administered to the eye and intranasally. Oral preparations include tablets, granules, fine granules, powders, capsules, chewable tablets, pellets, syrups, solutions, suspensions and inhalants.

The pharmaceutical composition may further contain additives conventionally used in the pharmaceutical field. Such additives include, for example, excipients, binders, disintegrants, lubricants, antioxidants, coloring agents, corrigents, etc., which can be used as necessary. In order to give sustained release so that it can act for a long time, it may be coated with a known retarder or the like. If necessary, other additives and agents such as antacid and gastric mucosa protective agent may be added.

The pharmaceutical composition can be applied in the form of an oral composition, an external composition, an internal composition, etc., and is preferably used in the form of an internal composition. In addition to the above-mentioned active ingredients, various components commonly used in oral compositions can be incorporated into the oral composition.

The in-vivo fatty acid content increasing agent, in-vivo highly unsaturated fatty acid content increasing agent, in-vivo fatty acid composition modifying agent, and highly unsaturated fatty acid synthesis gene expression promoting agent are added to foods, beverages, feeds, pet foods or It can be used as a mixture with these. Alternatively, it can be used as it is as food, beverage, feed, or pet food. In addition to general foods, it can be treated, prevented or improved by increasing the content of fatty acids in the body, increasing the content of highly unsaturated fatty acids in the body, modifying the composition of fatty acids in the body, and promoting the expression of highly unsaturated fatty acid synthesis genes. Use by adding or blending to foods and drinks that indicate the concept of treatment, prevention or improvement of diseases or conditions, that is, health foods, foods with functional claims, foods for patients, foods for specified health uses, etc. You can Health foods, foods with functional claims, foods for the sick and foods for specified health use are, for example, various formulation forms such as fine granules, tablets, granules, powders, capsules, syrups, liquids and liquid foods. Can be used as A food composition in the form of a pharmaceutical preparation can be produced in the same manner as a pharmaceutical preparation, and the active ingredient and a carrier acceptable as a food, for example, a suitable excipient and the like are mixed and then produced by a conventional means. can do. Furthermore, liquid food compositions, semi-solid food compositions, noodles, confectioneries, spreads, etc., the in-vivo fatty acid content increasing agent, in-vivo highly unsaturated fatty acid content increasing agent, in-vivo fatty acid composition modifying agent, Alternatively, a food composition can be produced by adding or mixing a polyunsaturated fatty acid synthesis gene expression promoter.

Food compositions include various food additives, for example, antioxidants, flavors, various esters, organic acids, organic acid salts, inorganic acids, inorganic acid salts, inorganic salts, pigments, emulsifiers, preservatives, seasonings. Additives such as sweeteners, sweeteners, acidulants, fruit juice extracts, vegetable extracts, nectar extracts, pH adjusters and quality stabilizers may be added alone or in combination.

As the feed, cattle, pigs, chickens, sheep, horses, feed for livestock used for goats, etc., feed for small animals used for rabbits, rats, mice, etc., eels, catfish, carp, crucian carp, smelt, smelt, oikawa, Thailand, Feed for seafood used for yellowtail, yellowtail, flounder, troutfish, skipjack, tuna, amberjack, salmon, trout, cod, tilapia, turbot, mackerel, saury, puffer fish, sea bass, horse mackerel, ayu, eel, char, yamame, shrimp, etc. , Pet foods used for dogs, cats, small birds, squirrels, and the like.
The feed may be blended with components generally used as feed ingredients such as meat, protein, bran, meal, sugar, vitamins and minerals. In addition to these, gelling agents, shape-retaining agents, pH adjusters, seasonings, preservatives, nutritional supplements and the like which are generally used in feeds can also be added as required.

The content of the above-mentioned active ingredient in the in-vivo fatty acid content-increasing agent, the in-vivo highly unsaturated fatty acid-increasing agent, the in-vivo fatty acid composition-modifying agent, and the highly-unsaturated fatty acid synthesis gene expression-promoting agent of the present invention can be appropriately determined.
For example, when the form of the in-vivo fatty acid content-increasing agent, in-vivo highly unsaturated fatty acid-content increasing agent, in-vivo fatty acid composition-modifying agent, or degree-unsaturated fatty acid synthesis gene expression-enhancing agent is liquid, In the total amount of internal fatty acid content increasing agent, in vivo highly unsaturated fatty acid content increasing agent, in vivo fatty acid composition modifying agent, or degree unsaturated fatty acid synthesis gene expression promoter, the content of the active ingredient is 0.00001 in terms of dry matter. It is preferably at least mass%, more preferably at least 0.0001 mass%, even more preferably at least 0.001 mass%. Further, the upper limit value thereof is preferably 50% by mass or less, more preferably 10% by mass or less, further preferably 1% by mass or less, further preferably 0.1% by mass or less, still more preferably 0.01% by mass or less. Furthermore, the numerical range of the content of the active ingredient is preferably 0.00001 to 50% by mass, more preferably 0.0001 to 50% by mass, even more preferably 0.0001 to 10% by mass, and still more preferably 0.001 to 1% by mass. 0.001-0.1 mass% is even more preferable, and 0.001-0.01 mass% is even more preferable.
Further, the form of the in-vivo fatty acid content increasing agent, in-vivo highly unsaturated fatty acid content increasing agent, in-vivo fatty acid composition modifying agent, or degree-unsaturated fatty acid synthesis gene expression-promoting agent of the present invention is a solid, semi-solid or powder. In the case of the state, the content of the active ingredient in the total amount of the in-vivo fatty acid content-increasing agent, in-vivo highly unsaturated fatty acid content-increasing agent, in-vivo fatty acid composition modifying agent, or degree-unsaturated fatty acid synthesis gene expression-promoting agent is dry. In terms of product, it is usually preferably 0.001% by mass or more, more preferably 0.05% by mass or more, even more preferably 0.5% by mass or more, still more preferably 1% by mass or more. The upper limit value is preferably 100% by mass or less, more preferably 50% by mass or less, and further preferably 10% by mass or less. Further, the numerical range of the content of the active ingredient is preferably 0.001 to 100% by mass, more preferably 0.05 to 100% by mass, further preferably 0.5 to 50% by mass, and further preferably 1 to 10% by mass.

The subject of administration or intake of the in-vivo fatty acid content-increasing agent, in-vivo highly unsaturated fatty acid-content increasing agent, in-vivo fatty acid composition-modifying agent, and highly unsaturated fatty acid synthesis gene expression-enhancing agent is preferably warm-blooded vertebrate animal. Or seafood, and more preferably mammals or seafood. In the present specification, mammals include, for example, humans and non-human mammals such as monkeys, mice, rats, rabbits, dogs, cats, cows, horses, and pigs. In addition, as seafood, eel, catfish, carp, crucian carp, dace, smelt, oikawa, thailand, yellowtail, yellowtail, flounder, tiger puffer fish, bonito, tuna, amberjack, salmon, trout, cod, tilapia, turbot, mackerel, saury , Blowfish, sea bass, horse mackerel, ayu, eel, char, yamame trout, shrimp and the like. The in-vivo fatty acid content increasing agent, in-vivo highly unsaturated fatty acid content increasing agent, in-vivo fatty acid composition modifying agent, and highly unsaturated fatty acid synthesis gene expression-promoting agent of the present invention are suitable for administration to humans or seafood. ..
The extract used in the present invention, and the agent for increasing the content of in-vivo fatty acid, the agent for increasing in-vivo highly unsaturated fatty acid content, the agent for modifying in-vivo fatty acid composition, and the highly-unsaturated fatty acid synthesis gene expression promoter of the present invention have thrombotic properties. Diseases, arteriosclerotic diseases, hyperlipidemia, hypertension, atopic dermatitis, senile dementia, anti-allergic action, prevention or improvement of anti-inflammatory action, etc., improvement of learning ability or memory, suppression of deterioration of visual acuity, or It can be applied to a subject who desires improvement in athletic ability. The target is preferably humans, livestock animals and seafood.

In the method for modifying the in-vivo fatty acid composition of the present invention, the method for promoting the production of highly unsaturated fatty acid in vivo, and the method for promoting the expression of highly unsaturated fatty acid synthesis gene in vivo, the dose of the active ingredient to be administered or ingested is Can be appropriately determined depending on the condition, body weight, sex, age, material activity, administration or ingestion route, administration or ingestion schedule, formulation form or other factors. For example, the administration or intake amount of the active ingredient is preferably 1 mg/kg body weight/day or more, more preferably 10 mg/kg body weight/day or more. The upper limit is preferably 5,000 mg/kg body weight/day or less, more preferably 1,000 mg/kg body weight/day or less. Further, the numerical range of administration or intake of the active ingredient is preferably 1 to 5,000 mg/kg body weight/day, more preferably 10 to 1,000 mg/kg body weight/day. In addition, the active ingredient may be ingested/administered once a day to several times a day, or at any time and interval.

Regarding the embodiments described above, the present invention further discloses the following agents, manufacturing methods, methods and uses.

<1> In-vivo fatty acid content increasing agent, in-vivo highly unsaturated fatty acid content-increasing agent, in-vivo fatty acid composition, containing at least one extract selected from the group consisting of pear extract and prune extract Modifier or highly unsaturated fatty acid synthesis gene expression promoter.

<2> The polyunsaturated fatty acid is ω-6, ω-3 or ω-9 fatty acid, preferably ω-6 or ω-3 fatty acid having 18 or more carbon atoms, and more preferably ω having 18 or more carbon atoms. -3 fatty acid, specifically, at least one selected from the group consisting of ALA, STD, ETE, ETA, EPA, DPA, DHA, tetracosapentaenoic acid, tetracosahexaenoic acid, and more preferably carbon number Of 20 or more ω-3 fatty acids, specifically, at least one selected from the group consisting of ETE, ETA, EPA, DPA, DHA, tetracosapentaenoic acid, and tetracosahexaenoic acid, and even more preferably Ω-3 fatty acids having 20 or more carbon atoms and 4 or more double bonds, specifically selected from the group consisting of ETA, EPA, DPA, DHA, tetracosapentaenoic acid, and tetracosahexaenoic acid. Ω-3 fatty acid having at least one type, more preferably having 20 or more carbon atoms and having 5 or 6 double bonds, specifically, EPA, DPA, DHA, tetracosapentaenoic acid, tetracosahexaenoic acid The agent according to the item <1>, which is at least one selected from the group consisting of, and more preferably at least one selected from the group consisting of EPA and DHA.
<3> The polyunsaturated fatty acid synthesis gene is at least one selected from the group consisting of a fatty acid elongation gene and a fatty acid desaturation gene, preferably at least one selected from the group consisting of elovl5 gene, elovl2 gene, and fads2 gene. The agent according to the item <1> or <2>, which is a seed.
<4> The agent according to any one of <1> to <3>, wherein the pear extract is an extract of a pear fruit.
<5> The agent according to the item <4>, wherein the pear extract is an extract with water, ethanol, or an aqueous ethanol solution, preferably an extract with water or ethanol, more preferably water. ..
<6> The agent according to any one of <1> to <3>, wherein the prune extract is a prune fruit extract.
<7> The agent according to the item <6>, wherein the prune extract is an extract with water, ethanol, or an aqueous solution of ethanol, preferably ethanol or an extract with an aqueous solution of ethanol, more preferably an aqueous solution of ethanol.
<8> The agent according to any one of <1> to <7>, wherein the agent has a liquid form.
<9> In the total amount of the agent, the content of the active ingredient is 0.00001% by mass or more, preferably 0.0001% by mass or more, more preferably 0.001% by mass or more, and 50% by mass or less, in terms of dry matter. Is 10% by mass or less, more preferably 1% by mass or less, more preferably 0.1% by mass or less, more preferably 0.01% by mass or less, according to the item <8>.
<10> The agent according to any one of <1> to <7>, wherein the agent has a solid form, a semi-solid form, or a powder form.
<11> In the total amount of the agent, the content of the active ingredient is 0.001% by mass or more, preferably 0.05% by mass or more, more preferably 0.5% by mass or more, still more preferably 1% by mass or more, in terms of dry matter. And 100% by mass or less, preferably 50% by mass or less, more preferably 10% by mass or less, according to the item <10>.

<12> A pear extract and a prune extract as a fatty acid content increasing agent in vivo, a highly unsaturated fatty acid content increasing agent in vivo, a fatty acid composition modifying agent in vivo, or a highly unsaturated fatty acid synthesis gene expression promoter Use of at least one extract selected from the group.
<13> Pear extract and prune extract for producing a fatty acid content increasing agent in vivo, a highly unsaturated fatty acid content increasing agent in vivo, a fatty acid composition modifying agent in vivo, or a highly unsaturated fatty acid synthesis gene expression promoter Use of at least one extract selected from the group consisting of:
<14> At least one extract selected from the group consisting of a pear extract and a prune extract is used as a fatty acid content-increasing agent in vivo, a highly unsaturated fatty acid-increasing agent in vivo, a fatty acid composition-modifying agent in vivo, or A method of using as a polyunsaturated fatty acid synthesis gene expression promoter.
<15> Method for increasing fatty acid content in fish body, application of at least one extract selected from the group consisting of pear extract and prune extract, and increasing polyunsaturated fatty acid content in fish body A method, a method for modifying a fatty acid composition in a living body of a fish, or a method for promoting expression of a polyunsaturated fatty acid synthesis gene in a living body of a fish.
<16> A method for increasing the fatty acid content in vivo, a method for increasing the polyunsaturated fatty acid content in vivo, which comprises applying at least one extract selected from the group consisting of pear extract and prune extract, A method for modifying a fatty acid composition in a living body, or a method for promoting expression of a polyunsaturated fatty acid synthesis gene in a living body.
<17> Prevention or improvement of thrombotic diseases, arteriosclerotic diseases, hyperlipidemia, hypertension, atopic dermatitis, senile dementia, anti-allergic action, anti-inflammatory action and the like, learning ability or memory ability The method according to any one of <12> to <16>, wherein the method is applied to a subject who desires improvement in eyelidness, suppression of reduction in visual acuity, or improvement in exercise capacity.
<18> The highly unsaturated fatty acid is ω-6, ω-3 or ω-9 fatty acid, preferably ω-6 or ω-3 fatty acid having 18 or more carbon atoms, and more preferably ω having 18 or more carbon atoms. -3 fatty acid, specifically, at least one selected from the group consisting of ALA, STD, ETE, ETA, EPA, DPA, DHA, tetracosapentaenoic acid, tetracosahexaenoic acid, and more preferably carbon number Of 20 or more ω-3 fatty acids, specifically, at least one selected from the group consisting of ETE, ETA, EPA, DPA, DHA, tetracosapentaenoic acid, and tetracosahexaenoic acid, and even more preferably Ω-3 fatty acids having 20 or more carbon atoms and 4 or more double bonds, specifically selected from the group consisting of ETA, EPA, DPA, DHA, tetracosapentaenoic acid, and tetracosahexaenoic acid. Ω-3 fatty acid having at least one type, more preferably having 20 or more carbon atoms and having 5 or 6 double bonds, specifically, EPA, DPA, DHA, tetracosapentaenoic acid, tetracosahexaenoic acid The use or method according to any one of <12> to <17>, which is at least one selected from the group consisting of, and more preferably at least one selected from the group consisting of EPA and DHA.
<19> The polyunsaturated fatty acid synthesis gene is at least one selected from the group consisting of a fatty acid elongation gene and a fatty acid desaturation gene, preferably at least one selected from the group consisting of elovl5 gene, elovl2 gene, and fads2 gene. The use or method according to any one of <12> to <18>, which is a seed.
<20> The use or method according to any one of <12> to <19>, wherein the pear extract is a pear fruit extract.
<21> The use according to <20>, wherein the pear extract is an extract with water, ethanol, or an aqueous ethanol solution, preferably an extract with water or ethanol, more preferably water. Or method.
<22> The use or method according to any one of <12> to <19>, wherein the prune extract is a prune fruit extract.
<23> The use or method according to the above item <22>, wherein the prune extract is an extract with water, ethanol, or an ethanol aqueous solution, preferably ethanol or an extract with an ethanol aqueous solution, more preferably an ethanol aqueous solution. ..
<24> The use or method according to any one of <12> to <23>, wherein the extract or agent has a liquid form.
<25> In the total amount of the agent, the content of the active ingredient is 0.00001 mass% or more, preferably 0.0001 mass% or more, more preferably 0.001 mass% or more, and 50 mass% or less, preferably in terms of a dry matter. Is 10% by mass or less, more preferably 1% by mass or less, more preferably 0.1% by mass or less, more preferably 0.01% by mass or less, according to the item <24>.
<26> The use or method according to any one of <12> to <23>, wherein the extract or agent is in the form of solid, semisolid or powder.
<27> In the total amount of the agent, the content of the active ingredient is 0.001% by mass or more, preferably 0.05% by mass or more, more preferably 0.5% by mass or more, still more preferably 1% by mass or more, in terms of dry matter. And 100% by mass or less, preferably 50% by mass or less, more preferably 10% by mass or less, the use or method according to the item <26>.

<28> Method of increasing fatty acid content in vivo, method of increasing polyunsaturated fatty acid content in vivo, method of modifying fatty acid composition in vivo, or method of promoting expression of highly unsaturated fatty acid synthesis gene in vivo At least one extract selected from the group consisting of a pear extract and a prune extract used for.
<29> Agent for increasing fatty acid content in vivo, agent for increasing polyunsaturated fatty acid content in vivo, agent for modifying fatty acid composition in vivo, or agent for promoting expression of highly unsaturated fatty acid synthesis gene in vivo Use of at least one extract selected from the group consisting of pear extract and prune extract for the manufacture of
<30> Non-therapeutic increase of fatty acid content in vivo, increase of highly unsaturated fatty acid content in vivo, modification of fatty acid composition in vivo, or promotion of highly unsaturated fatty acid synthesis gene expression in vivo Of at least one extract selected from the group consisting of pear extract and prune extract for use in various treatment methods.
<31> The extract or use according to any one of <28> to <30>, wherein the extract is applied in the form of a pharmaceutical composition.
<32> The extract or use according to any one of <28> to <30>, wherein the extract is applied in the form of an oral composition.
<33> The extract or use according to any one of <28> to <30>, wherein the extract is applied in the form of food, beverage, or feed.
<34> Prevention or improvement of thrombotic disease, arteriosclerotic disease, hyperlipidemia, hypertension, atopic dermatitis, senile dementia, anti-allergic action, anti-inflammatory action, etc., learning ability or memory ability The extract or use according to any one of the above <28> to <33>, which is applied to a subject who desires to improve the above, suppress visual loss, or improve athletic ability.
<35> The highly unsaturated fatty acid is ω-6, ω-3 or ω-9 fatty acid, preferably ω-6 or ω-3 fatty acid having 18 or more carbon atoms, and more preferably ω having 18 or more carbon atoms. -3 fatty acid, specifically, at least one selected from the group consisting of ALA, STD, ETE, ETA, EPA, DPA, DHA, tetracosapentaenoic acid, tetracosahexaenoic acid, and more preferably carbon number Of 20 or more ω-3 fatty acids, specifically, at least one selected from the group consisting of ETE, ETA, EPA, DPA, DHA, tetracosapentaenoic acid, and tetracosahexaenoic acid, and even more preferably Ω-3 fatty acids having 20 or more carbon atoms and 4 or more double bonds, specifically selected from the group consisting of ETA, EPA, DPA, DHA, tetracosapentaenoic acid, and tetracosahexaenoic acid. Ω-3 fatty acid having at least one type, more preferably having 20 or more carbon atoms and having 5 or 6 double bonds, specifically, EPA, DPA, DHA, tetracosapentaenoic acid, tetracosahexaenoic acid The extract or use according to any one of <28> to <34>, which is at least one selected from the group consisting of, and more preferably at least one selected from the group consisting of EPA and DHA. ..
<36> The polyunsaturated fatty acid synthesis gene is at least one selected from the group consisting of a fatty acid elongation gene and a fatty acid desaturation gene, preferably at least one selected from the group consisting of elovl5 gene, elovl2 gene, and fads2 gene. The extract or use according to any one of <28> to <35>, which is a seed.
<37> The extract or use according to any one of <28> to <36>, wherein the pear extract is a pear fruit extract.
<38> The use according to the item <37>, wherein the pear extract is an extract with water, ethanol, or an aqueous ethanol solution, preferably an extract with water or ethanol, more preferably water. Or method.
<39> The extract or use according to any one of <28> to <36>, wherein the prune extract is an extract of fruit of prune.
<40> The use or method according to the item <39>, wherein the prune extract is an extract with water, ethanol, or an aqueous ethanol solution, preferably ethanol or an extract with an aqueous ethanol solution, more preferably an aqueous ethanol solution. ..
<41> The extract or use according to any one of <28> to <40>, wherein the extract has a liquid form.
<42> The content of the extract is, in terms of dry matter, 0.00001 mass% or more, preferably 0.0001 mass% or more, more preferably 0.001 mass% or more, 50 mass% or less, preferably 10 mass% or less, The extract or use according to the item <41>, which is more preferably 1% by mass or less, more preferably 0.1% by mass or less, more preferably 0.01% by mass or less.
<43> The extract or use according to any one of <28> to <40>, wherein the form of the extract is solid, semi-solid, or powder.
<44> The content of the extract is 0.001% by mass or more, preferably 0.05% by mass or more, more preferably 0.5% by mass or more, still more preferably 1% by mass or more, and 100% by mass in terms of dry matter. The extract or use according to the item <43>, which is preferably 50% by mass or less, more preferably 10% by mass or less.

<45> Method for increasing fatty acid content in fish body, administering or ingesting at least one extract selected from the group consisting of pear extract and prune extract, highly unsaturated fatty acid content in fish body Method, modification of fatty acid composition in fish organisms, promotion of polyunsaturated fatty acid synthesis gene expression in fish organisms, non-therapeutic increase in fatty acid content in vivo, non-therapeutic in vivo A method for increasing the content of polyunsaturated fatty acids, a non-therapeutic method for modifying fatty acid composition in vivo, or a non-therapeutic method for promoting polyunsaturated fatty acid synthesis gene expression in vivo.
<46> The polyunsaturated fatty acid is ω-6, ω-3 or ω-9 fatty acid, preferably ω-6 or ω-3 fatty acid having 18 or more carbon atoms, and more preferably ω having 18 or more carbon atoms. -3 fatty acid, specifically, at least one selected from the group consisting of ALA, STD, ETE, ETA, EPA, DPA, DHA, tetracosapentaenoic acid, tetracosahexaenoic acid, and more preferably carbon number Of 20 or more ω-3 fatty acids, specifically, at least one selected from the group consisting of ETE, ETA, EPA, DPA, DHA, tetracosapentaenoic acid, and tetracosahexaenoic acid, and even more preferably Ω-3 fatty acids having 20 or more carbon atoms and 4 or more double bonds, specifically selected from the group consisting of ETA, EPA, DPA, DHA, tetracosapentaenoic acid, and tetracosahexaenoic acid. Ω-3 fatty acid having at least one type, more preferably having 20 or more carbon atoms and having 5 or 6 double bonds, specifically, EPA, DPA, DHA, tetracosapentaenoic acid, tetracosahexaenoic acid The method according to the item <45>, which is at least one selected from the group consisting of, and more preferably at least one selected from the group consisting of EPA and DHA.
<47> The polyunsaturated fatty acid synthesis gene is at least one selected from the group consisting of a fatty acid elongation gene and a fatty acid desaturation gene, preferably at least one selected from the group consisting of elovl5 gene, elovl2 gene, and fads2 gene. The method according to the item <45> or <46>, which is a seed.
<48> The method according to any one of <45> to <47>, wherein the pear extract is a pear fruit extract.
<49> The method according to <48>, wherein the pear extract is an extract with water, ethanol, or an aqueous ethanol solution, preferably an extract with water or ethanol, more preferably water. ..
<50> The method according to any one of <45> to <47>, wherein the prune extract is a prune fruit extract.
<51> The method according to <50>, wherein the prune extract is an extract with water, ethanol, or an aqueous ethanol solution, preferably ethanol or an extract with an aqueous ethanol solution, more preferably an aqueous ethanol solution.
<52> Administration or intake of the extract is 1 mg/kg body weight/day or more, preferably 10 mg/kg body weight/day or more, and 5,000 mg/kg body weight/day or less, preferably 1,000 mg/kg body weight The method according to any one of <45> to <51>, which is equal to or less than /day.
<53> prevention or improvement of thrombotic disease, arteriosclerotic disease, hyperlipidemia, hypertension, atopic dermatitis, senile dementia, antiallergic action, antiinflammatory action, learning ability or memory ability The method according to any one of the items <45> to <52>, which is applied to a subject who desires to improve the image quality, suppress visual loss, or improve the exercise capacity.

Hereinafter, the present invention will be described in more detail based on examples, but the present invention is not limited thereto.

Preparation Example 1-1 Preparation of 50% Ethanol Water Extract of Pear Pear ( Pyrus communis L.) Fresh fruits (Yamagata Prefecture) were peeled, lyophilized and dried after removing the skin, seeds and core. The product was obtained (14 g of dried product was obtained from 100 g of fresh fruit).
Using the dried product as a raw material, 10 g was weighed, 100 mL of 50% (v/v) ethanol water was added, and the mixture was immersed at room temperature for 7 to 30 days under static conditions. After the extract was filtered, it was concentrated under reduced pressure and freeze-dried to obtain a 50% ethanol aqueous extract of pear (solid yield: 4.96 g).

Preparation Example 1-2 Preparation of 99.5% ethanol extract of pear Peel, seed and core of fresh pear fruits (produced in Yamagata Prefecture) were cut off and lyophilized to obtain dried products (fresh fruits 14 g of dried product was obtained from 100 g).
Using the dried product as a raw material, 10 g was weighed, 100 mL of 99.5% (v/v) ethanol was added, and the mixture was immersed at room temperature for 7 to 30 days under static conditions. The extract was filtered, concentrated under reduced pressure and lyophilized to give a 99.5% ethanol extract of pear (solid yield: 2.86 g).

Preparation Example 1-3 Preparation of hot water extract of pear Pear Fresh fruit of pear (Yamagata prefecture) is cut into pieces, 74 g of the cut fruits are weighed, 120 mL of ion-exchanged water is added, and the temperature is 95 to 100°C. Extracted at temperature with stirring for 60 minutes. The extract was filtered and then freeze-dried to obtain a hot water extract of pear (solid yield: 5.83 g).

Preparation Example 2-1 Preparation of 50% Ethanol Aqueous Extract of Prunes 10 g of dried prunes ( Prunus domestica ) fruit (American) was weighed, 100 mL of 50% (v/v) ethanol water was added, and room temperature was added. It was immersed for 7 to 30 days under static conditions. After the extract was filtered, it was concentrated under reduced pressure and freeze-dried to obtain a 50% ethanol water extract of prunes (solid yield: 4.35 g).

Preparation Example 2-2 Preparation of 99.5% ethanol extract of prunes 10 g of dried prunes fruit products (American) were weighed, 100 mL of 99.5% (v/v) ethanol was added, and the mixture was allowed to stand at room temperature under the following conditions. Soaked for 7-30 days. The extract was filtered, concentrated under reduced pressure and lyophilized to obtain a 99.5% ethanol extract of prunes (solid yield: 0.78 g).

Preparation Example 2-3 Preparation of hot water extract of prunes 10 g of dried prunes fruit products (made in USA) are weighed, 120 mL of ion-exchanged water is added, and the mixture is stirred at a temperature of 95 to 100°C for 60 minutes. Extracted. The extract was filtered and then lyophilized to obtain a hot water extract of prunes (solid yield: 4.96 g).

Test Example 1 Analysis of Expression Level of Polyunsaturated Fatty Acid Synthetic Gene 15 to 18 zebrafish ( Danio rerio ) larvae on the 3rd day after fertilization confirmed to be normally fertilized and hatched on a surface-untreated 6-well plate/ Wells were transferred together with larval breeding water. Then, the larval breeding water in each well was replaced with each sample prepared in the above Preparation Example, and the larvae were further bred for 1.25 days.
In each sample prepared in the above Preparation Example, each extract was redissolved in various solvents so that the concentration was 1% (w/v). The solvent used for re-dissolution was 50% ethanol water extract 50% (v/v) ethanol water, 99.5% ethanol extract 99.5% (v/v) ethanol, hot water extract 10% (v/v). v) Ethanol water was used. Then, the concentration of each sample was appropriately adjusted so that the final concentration thereof would be 0.001%, and used as a test sample. The solvent (water) was used for control.

After the rearing, the larvae in each well were transferred to a 1.5 mL tube and the larvae were euthanized. The solution in the tube was removed as much as possible, 1 mL of RNA later (trade name, manufactured by Qiagen) was added, and the mixture was stored at 4°C. In addition, these operations were carried out promptly and with great care so as not to damage the larvae.

Using 4 samples of each stored sample as 1 sample, total RNA was extracted according to the attached protocol using RNeasy Lipid Tissue Mini Kit (trade name, manufactured by Qiagen). The obtained RNA sample was stored at -80°C.
The total RNA concentration of each extracted sample was adjusted, and after heat treatment at 65° C. for 10 minutes, cDNA was synthesized using High Capacity RNA-to-cDNA (trade name, manufactured by Applied Biosystems) according to the attached protocol. .. The obtained cDNA sample was stored at -20°C.

Using the synthesized cDNA as a template, ABI PRISM 7500 (manufactured by Applied Biosystems) using TaqMan Fast Universal PCR Master Mix (trade name, manufactured by Applied Biosystems) or Fast SYBR (registered trademark) Green Master Mix (manufactured by Applied Biosystems) ), quantitative PCR was performed for fads2 gene, elovl5 gene and elovl2 gene. In addition, the PCR reaction of each gene used the primer probe set shown below.

・Ef1α (elongation factor 1-alpha) Taqman primer probe set (Dr03432748_m1, manufactured by Applied Biosystems)
・Fads2 taqman primer probe set (Dr03099351_m1, manufactured by Applied Biosystems)
・Elovl5 taqman primer probe set (Dr03094288_m1, manufactured by Applied Biosystems)
・Elovl2 primer set (Forward primer: CACTGGACGAAGTTGGTGAA (SEQ ID NO: 1), Reverse primer: GTTGAGGACACACCACCAGA (SEQ ID NO: 2))

The obtained analysis results were corrected with the expression level of Ef1α as a reference and shown as the relative mRNA expression level of each gene. In addition, the case where zebrafish was not raised without using each sample was used as a control. The results are shown in Tables 1 and 2.

As is clear from Tables 1 and 2, it was confirmed that the expression level of the polyunsaturated fatty acid synthesis gene was enhanced in each of the pear extract group and each of the prune extract group.
Particularly, in the pear extract group, the expression of polyunsaturated fatty acid synthesis gene was remarkably enhanced in the hot water extract group and the 99.5% ethanol extract group. In the prune extract group, the expression of polyunsaturated fatty acid synthesis gene was remarkably enhanced in the 50% ethanol extract group. Therefore, in the following Test Example 2, it was decided to use a hot water extract of pear and a 50% ethanol extract of prunes.

Test Example 2 Analysis of Composition Ratio and Content of Polyunsaturated Fatty Acids A cycle of 14 hours of light period and 10 hours of dark period was set as a cycle, the water temperature was set to 26 to 28° C., and a circulation type water purification system was used to Adult zebrafish were bred until they were about 5 months old. Eight animals were set as one group (1 cage) so that the average body weights were equal, and three groups (control group, pear extract group, prune extract group) of zebrafish were prepared.
As the feed, a zebrafish feed containing each test sample prepared in the above preparation example (the test sample 5% (w/w), a zebrafish standard feed (trade name: Otohime B2, Nisshin Marubeni Feed Company) 35% (w/w), gluten 40% (w/w), linseed oil 20% (w/w)) were used. As a control, a standard feed was used instead of the test sample. The feed intake was 5 mg/animal/dose, and the zebrafish were fed twice a day (morning/evening).
A 1.7 L cage was used for breeding zebrafish. Zebrafish were raised for 3 weeks. On the last day of rearing, the animals were fed with morning food (8:30) and then euthanized in the afternoon (13:00) under excessive anesthesia, and the dorsal muscles were frozen and stored at -80°C.

The collected muscle sample was freeze-dried for about 15 hours and weighed (dry weight). After adding glass beads thereto, 0.4 mL of methanol containing 0.05% dibutylhydroxytoluene and 0.4 mL of deionized water were added, and pulverization treatment (2 min, 30 times/s) was performed. Chloroform (0.8 mL) was added to the obtained suspension, the mixture was pulverized again, and centrifuged at 20° C. at 10,000 rpm for 2 minutes. The lower chloroform layer was collected in a 10 mL glass centrifuge tube, 0.8 mL of chloroform was added again to the precipitate remaining in the 2 mL tube, and after centrifugation, the chloroform layer was collected in the same centrifuge tube.
A funnel was placed on a 10-mL glass centrifuge tube, a 2S filter paper (funnel) was laid, and 0.8 mL of chloroform was added to a filter paper containing NaSO ₄ in an amount sufficient for dehydration treatment. After confirming the filtration, the recovered chloroform layer was added little by little onto NaSO ₄ and filtered. Then, the glass centrifuge tube was washed with 0.8 mL chloroform together, the solution was filtered, and then the filter paper was washed twice with 0.8 mL chloroform for washing. The recovered chloroform layer was stored at -20°C.

Next, to perform hydrolysis and methylation of each sample, 100 μL of a chloroform solution of heneicosanoic acid (C:21:0) (concentration 1 mg/mL) was added to each tube as an internal standard. The sample was dried in a nitrogen stream, 0.4 mL of 0.5 N sodium hydroxide/methanol solution was added, and ultrasonic dispersion and heating at 80° C. were repeated for about 5 minutes. At that time, it was confirmed that the precipitate disappeared or completely dispersed after the treatment.
Further, 0.4 mL of a boron trifluoride/methanol solution was added to this solution, and the mixture was reacted at 80° C. for 2 minutes, and after confirming that the solution became transparent, 2 mL of hexane was added and mixed vigorously. Then, the mixture was reacted at 80° C. for 1 minute, 0.4 mL of saturated saline was added and mixed vigorously, and then allowed to stand. Again, 2 mL of hexane was added and mixed vigorously, and after reacting at 80° C. for 1 minute, 0.4 mL of saturated saline was added and mixed vigorously.
Finally, centrifugation at 1,000 rpm at 20° C. was performed for 0.5 minutes to dehydrate and filter the hexane layer. At this time, a funnel was set up in a new glass tube, 2S filter paper was put, and NaSO ₄ was put on it. First, the filter paper was immersed in 0.8 mL of hexane, and then the hexane layer was slowly added using a pipette. Then, the column was washed together with about 1.5 mL of hexane, the collected solution was dried in a nitrogen stream, and redissolved with 1,000 μL of chloroform.

Of the GC samples prepared as described above, 100 μL was used for GC analysis under the following conditions.

(GC Condition)
Gas Chromatography: Shimadzu GC-17 ^a (trade name)
Column: HR-SS-10 (trade name) 25m×0.25mm
Column temp: 150-220℃
Program rate: 3℃/min
Injection: 250℃(sprit ratio: 47:1)
Detector: FID (trade name), 250°C
Carrier gas: He (1.81mL/min)
Sample volume: 1 μL

The area of the peak derived from each fatty acid was calculated from the spectrum obtained by the GC analysis. Then, from the calculated peak area, the total fatty acid amount, the n3-type highly unsaturated fatty acid amount (α-linolenic acid amount, stearidonic acid amount, EPA amount, DPA amount, and DHA amount), and the total amount of DHA and EPA, Calculated (weight per muscle dry weight). Student t-test was used for the test.
The results are shown in Table 3.

As is clear from Tables 3 and 4, the total fatty acid content and the n3 polyunsaturated fatty acid content per muscle dry weight were significantly increased in both the pear extract group and the prune extract group. In addition, the total amount of DHA and EPA, which have high health value, increased significantly in the pear extract group and increased significantly in the prune extract group (p=0.062).

As described above, the pear extract and the prune extract each have the action of promoting the expression of the polyunsaturated fatty acid synthesis gene and enhancing the expression level of the gene. Therefore, each of the pear extract and the prune extract can be used as an active ingredient of the polyunsaturated fatty acid synthesis gene expression promoter.
In addition, the pear extract and the prune extract each have the action of promoting the production of highly unsaturated fatty acids in vivo and increasing the total amount of fatty acids and the amount of highly unsaturated fatty acids in vivo. Therefore, the pear extract and the prune extract can be used as the active ingredients of the in-vivo fatty acid content increasing agent or the in-vivo highly unsaturated fatty acid content increasing agent, respectively. Furthermore, the pear extract and the prune extract each have an action of increasing the content of unsaturated fatty acid in the living body. Therefore, each of the pear extract and the prune extract is an active ingredient of an in-vivo fatty acid composition-modifying agent that increases the ratio of the amount of unsaturated fatty acid to the amount of total fatty acid in vivo and modifies the fatty acid composition in vivo. You can
Furthermore, the in-vivo fatty acid content increasing agent, the in-vivo highly unsaturated fatty acid content increasing agent, the in-vivo fatty acid composition modifying agent, and the highly unsaturated fatty acid synthesis gene expression-promoting agent each have a fatty acid amount, particularly a highly unsaturated fatty acid amount. It can be suitably used for a method of breeding a variety of fish.

Claims (12)

An agent for increasing a fatty acid content in a living body, which comprises a pear ( Pyrus communis L.) extract as an active ingredient. An agent for increasing the content of polyunsaturated fatty acids in vivo, which contains an extract of pear ( Pyrus communis L.) as an active ingredient. An agent for modifying a fatty acid composition in a living body, which comprises a pear ( Pyrus communis L.) extract as an active ingredient. A highly unsaturated fatty acid synthesis gene expression-promoting agent comprising a pear ( Pyrus communis L.) extract as an active ingredient. A method for increasing fatty acid content in a living body of a fish, comprising administering or ingesting a pear ( Pyrus communis L.) extract to the fish. A method for increasing the content of polyunsaturated fatty acids in a living body of a fish, which comprises administering or ingesting a pear ( Pyrus communis L.) extract to the fish. A method for modifying fatty acid composition in a living body of a fish, which comprises administering to or ingesting a pear ( Pyrus communis L.) extract. A method for accelerating the expression of a polyunsaturated fatty acid synthesis gene in a fish body, which comprises administering or ingesting a pear ( Pyrus communis L.) extract to the fish. A food composition for increasing the in-vivo fatty acid content or a feed composition for increasing in-vivo fatty acid content, comprising a pear ( Pyrus communis L.) extract as an active ingredient. A food composition for increasing in vivo highly unsaturated fatty acid content or a feed composition for increasing in vivo highly unsaturated fatty acid content, comprising a pear ( Pyrus communis L.) extract as an active ingredient. A food composition for modifying a fatty acid composition in vivo or a feed composition for modifying a fatty acid composition in vivo, which contains a pear ( Pyrus communis L.) extract as an active ingredient. A food composition for promoting the expression of polyunsaturated fatty acid synthesis gene or a feed composition for promoting the expression of polyunsaturated fatty acid synthesis gene, which contains a pear ( Pyrus communis L.) extract as an active ingredient.