CN114107336B

CN114107336B - Molecular breeding method for improving content of highly unsaturated fatty acid of Taiwan loaches

Info

Publication number: CN114107336B
Application number: CN202111399612.9A
Authority: CN
Inventors: 高坚; 曹小娟; 任天应; 张倍源
Original assignee: Huazhong Agricultural University
Current assignee: Huazhong Agricultural University
Priority date: 2021-11-19
Filing date: 2021-11-19
Publication date: 2024-05-28
Anticipated expiration: 2041-11-19
Also published as: CN114107336A

Abstract

The invention discloses a Taiwan loach elovl gene, the nucleotide sequence of which is shown as SEQ ID No. 1. The invention also discloses an application of the elovl gene in molecular breeding for improving the content of highly unsaturated fatty acid of Taiwan loach and a molecular breeding method for improving the content of highly unsaturated fatty acid of Taiwan loach, wherein the method uses a CRISPR/Cas9 system to knock out the elovl gene to obtain a Taiwan loach elovl5 gene knockout mutant. Experimental results show that compared with the wild type, the knockout type has obvious difference in EPA and DHA content in the body, compared with the wild type, the knockout type has obviously increased EPA and DHA content, and the total amount of DPA, EPA and DHA is obviously increased.

Description

Molecular breeding method for improving content of highly unsaturated fatty acid of Taiwan loaches

Technical Field

The invention belongs to the field of molecular breeding, relates to a Taiwan loach long-chain fatty acid elongase 5 (elongase of very long CHAIN FATTY ACIDS, elovl 5) gene, and also relates to application of the gene in Taiwan loach molecular breeding, and a molecular breeding method for knocking out the Taiwan loach elovl5 gene by using a CRISPR/Cas9 system so as to improve the content of highly unsaturated fatty acid in the Taiwan loach.

Background

With the development of human society, people have increasingly high requirements for nutrition and health. Highly unsaturated fatty acids (highly unsaturated FATTY ACIDS, HUFA) are essential nutrients in humans and animals, closely related to human health, mainly eicosatetraenoic acid (also known as arachidonic acid, arachidonic acid, AA), eicosapentaenoic acid (eicosapentaenoic acid, EPA), and docosahexaenoic acid (docosahexaenoic acid, DHA), etc. The long-chain unsaturated fatty acid in food, especially DHA, has important effects on liver lipid metabolism and preventing liver steatosis. Since HUFA cannot be synthesized by itself in the human body and must be taken in from food, HUFA is called essential fatty acid. DHA and EPA are important components of a healthy diet for humans, and the intake of humans is severely inadequate. The main source of HUFAs is currently fish oil, marine fish is rich in n-3 HUFAs, but their HUFAs are mainly accumulated through the food chain. Freshwater fish has complete HUFA synthesis capacity, but has limited synthesis amount. If the self-synthesis capability of the freshwater fish n-3HUFA can be regulated and controlled, the yield of the HUFA is greatly increased, and the nutrition quality of the freshwater fish is improved, so that the requirement of human on polyunsaturated fatty acid is met, and the health of human is enhanced.

The CRISPR/Cas9 gene knockout system is a gene editing technology derived from the bacterial acquired immune system developed in the last two years, is widely applied to the research of organisms in various modes at present through artificial transformation, and becomes a powerful research tool.

There have been studies showing that the biosynthesis of freshwater fish HUFAs is mediated by its own long chain fatty acid elongase 2 (elongase of very long CHAIN FATTY ACIDS, elovl 2), long chain fatty acid elongase 5 (elongase of very long CHAIN FATTY ACIDS 5, elovl 5) and long chain fatty acid desaturase 2 (desaturase of very long CHAIN FATTY ACIDS, fads2). Liu et al uses CRISPR/Cas9 gene knockout technology to knock out zebra fish elovl genes, found that the elovl5 expression level in fish body is obviously reduced, the elovl expression level is obviously increased, and the EPA and DHA contents in fish body are not obviously different. The Sun and the like knock out zebra fish elovl genes by using CRISPR/Cas9 gene knockout technology, the elovl5 expression quantity is obviously reduced, the elovl2 expression quantity is obviously increased, the EPA content of fish body is reduced, and the DHA content is increased. According to the invention, after elovl genes are knocked out from Taiwan loaches, the DHA and EPA contents of fish bodies are obviously increased. Zebra fish is used as a model organism, can not produce edible value, and can not achieve the purpose of meeting the nutritional requirements of human HUFAs. The Taiwan loaches are used as farmed fish to produce Taiwan loaches with high HUFA content, and can be applied to production to meet the nutrition requirement of human on HUFA, so that the Taiwan loaches are an invention with great significance.

Disclosure of Invention

The first aim of the invention is to provide a Taiwan loach elovl gene, the second aim of the invention is to provide an application of the elovl gene in molecular breeding for improving the content of highly unsaturated fatty acids of Taiwan loach, and the third aim of the invention is to provide a molecular breeding method for improving the content of highly unsaturated fatty acids of Taiwan loach by using CRISPR/Cas9 gene editing technology.

The invention is realized by the following technical scheme:

1. Determination of Taiwan loach elovl gene sequence information

① First, total liver RNA of Misgurni anguillicaudati was extracted with RNAiso Plus reagent (TaKaRa, japan), and then reverse transcription kit Prime was used1St Strand cDNA Synthesis Kit (TaKaRa, japan) first strand cDNA was synthesized in vitro.

② Obtaining full-length cDNA sequences of zebra fish, grass carp, megalobrama amblycephala and other fish elovl genes from NCBI database, performing multiple comparison, reading the conserved regions of the amino acid sequences of the conserved regions of the fishes, designing and synthesizing 1 pair of degenerate primers for cloning core fragments of the Taiwan loach elovl genes, and sequencing the recovered products to obtain sequence information.

③ The 5', 3' -RACE cDNA first strand was synthesized using SMART RACE CDNA Amplification Kit (Clontech, USA) kit, reference kit recommended method. And designing RACE primers on the core fragment sequence obtained in the ② step, cloning 5 'and 3' terminal fragments of the Taiwan loach elovl gene by taking the first strand of 5', 3' -RACE cDNA as templates respectively, and recovering the products and sending the products to a company for sequencing to obtain sequence information of the products.

④ And splicing to obtain the full-length sequence information of the Taiwan loach elovl genes. The full-length sequence information of the Taiwan loach elovl is shown as SEQ ID NO: 1. The similarity of Taiwan loach and zebra fish genes is 90%, and the comparison result is shown in figure 1.

2. CRISPR/Cas9 target site design and validation:

According to the sequence information of the Taiwan loach elovl gene, the CRISPR/Cas9 target site of the Taiwan loach elovl gene is designed, and the target site knockout specificity of elovl-gRNA-Cas 9 is confirmed.

On the ORF sequence of the Taiwan loach elovl gene, a elovl gene target site is designed according to the CRISPR/Cas knockout principle. The target site of Taiwan loach is: 5'-TCTGATTGTGTGGATGGGAC-3' is designed at the front end of ORF as much as possible. Meanwhile, primers are designed around the target site within the size range of 300-500bp for PCR amplification, and amplified products are directly sent to sequencing. The requirements are: ① The forward and reverse primers are at least 100bp from the target site. ② The PCR band is clear and has no impurity band. ③ The sequencing result is identical to the designed target site sequence, and the sequencing peak pattern shows homozygotes (i.e., no overlapping peaks occur). The sequence information of the target site of the Taiwan loach elovl gene is shown as SEQ ID NO: 2.

3. Preparation of Cas9mRNA and gRNA:

And (3) taking the purified linearization Cas9 plasmid (pSP 6-2sNLS-SpCas9 vector) as a template, performing in vitro transcription to obtain Cas9mRNA, purifying and then preserving at-80 ℃. The storage concentration was 830 ng/. Mu.l. Designing an upstream primer containing elovl gene target site sequences and a downstream primer matched with the upstream primer, carrying out PCR amplification by taking a gRNA skeleton plasmid as a template, carrying out in vitro transcription by taking a purified product as the template to obtain gRNA, purifying the gRNA, and preserving the gRNA at-80 ℃ with a preservation concentration of 1210 ng/. Mu.L. The upstream primer containing the target site sequence of the Taiwan loach elovl gene is shown as SEQ ID NO:3, and the matched downstream primer is shown as SEQ ID NO: 4.

4. In vitro microinjection:

2 pairs of Taiwan loaches with better development are selected to artificially hasten parturition at night before injection, the dosage of the artificial hastening parturition medicine is that LRH-A ₂ ug and DOM 4mg are injected into each kilogram of female parent fish, and the male fish is halved. The parent was then kept in a dark environment with a water temperature of 27 ℃. The artificial insemination can be carried out in the morning the next time, fertilized eggs are obtained and then placed on a special microinjection culture dish, and microinjection is carried out on the fertilized eggs reaching the 1 cell stage by using a microinjection instrument. And then placing the fertilized eggs after injection in a constant temperature box at 28 ℃ for hatching and culturing. The final concentration of Cas9mRNA was 500 ng/. Mu.l, the final concentration of gRNA was 30 ng/. Mu.l, the amount injected per injection was 2nL, and the injection site was animal pole.

5. Elovl5 screening of knockout fish:

The elovl gene mutant of the F0-generation Taiwan loach is utilized to reproduce with the wild Taiwan loach to obtain an F1 generation, the F1 generation of the same mutation type is selected to carry out selfing to obtain an F2 generation, and then the homozygous mutant of the F2 generation is subjected to selfing to obtain the elovl gene knocked-out Taiwan loach homozygote.

6. Determination of fatty acid content of fish body

Wild type homozygotes and knockout homozygotes propagated in the same batch are bred to 2 months old, fatty acid is extracted, and the content of the fatty acid is detected by a gas chromatography. Experimental results show that compared with the wild type, the knockout type has obvious difference in EPA and DHA content in the body, compared with the wild type, the knockout type has obviously increased EPA and DHA content, and the total amount of DPA, EPA and DHA is obviously increased.

The beneficial effects of the invention are as follows:

1. the method is characterized in that a homozygous mutant of elovl gene knockout is obtained in Taiwan loach for the first time by using a CRISPR/Cas9 technology.

2. The PUFA synthesis capacity in the Taiwan loach is regulated and controlled by knocking out elovl genes, so that the PUFA content in the fish is improved.

3. The method is different from a transgenic method, does not introduce exogenous genes, does not worry about the influence of transgenic foods on human health, and is easy to popularize in production.

Drawings

FIG. 1 Taiwan loach was aligned with zebra fish elovl protein sequences.

FIG. 2 sequence alignment of Taiwan loach-2 bp knockout model.

FIG. 3 sequence alignment of Taiwan loach-4 bp knockout model.

FIG. 4 shows comparison of EPA+DPA+DHA content of Taiwan loach wild type with elovl gene knockout type.

FIG. 5 variation of fatty acid content of wild type and elovl gene knockout of loach in Taiwan.

Detailed Description

The present invention will be described in detail with reference to specific examples.

Example 1 determination of Gene sequence information of Taiwan loach elovl5

1. Extraction of Total RNA

The extraction of the total RNA of Taiwan loaches is carried out by using TaKaRa RNAiso Plus reagent, and the specific steps are as follows:

1) Extracting RNA: the vessel, the surgical scissors and the forceps are treated with DEPC overnight; the water used is RNase-FREE WATER purchased by TaKaRa company; the EP tube was centrifuged and the tips of each type were either dedicated to extracting RNA or were immersed overnight in DEPC water and autoclaved. Note that: in the process of extracting total RNA, the mask is worn in time, and the glove is replaced, so that speaking is avoided. Pre-cooling the sampling device on ice before an experiment;

2) Taiwan loach was sacrificed, liver tissue was rapidly isolated, and 30mg-50mg tissue samples were taken in a 2mL centrifuge tube, placed in an ice bath, 1.5mL RNAiso Plus reagents were added in advance, and 3 glass beads were immersed in DEPC water overnight and autoclaved. Crushing the mixture by using a tissue crusher until the mixture is transparent without particles;

3) Taking out the centrifuge tube, and standing for 5min at room temperature;

4) Transferring the centrifuge tube to a low-temperature high-speed centrifuge, and centrifuging at the temperature of 12000r/min and the temperature of 4 ℃ for 5min;

5) Taking out after centrifugation, and transferring the supernatant to a new 1.5mL centrifuge tube;

6) Adding chloroform into the homogenate lysate, wherein the dosage is 1/5 of the volume of RNAiso Plus reagent, covering a centrifugal cover, shaking vigorously by hand for 15s, and standing for 5min at room temperature after full emulsification;

7) Transferring the centrifuge tube to a low-temperature high-speed centrifuge, and centrifuging at 12000r/min and 4 ℃ for 15min;

8) Taking out the centrifuge tube carefully by a centrifuge, wherein the homogenate is divided into three layers, namely a colorless supernatant, an intermediate white protein layer and a lower organic layer with bright red color, and sucking the supernatant into another new centrifuge tube;

9) Adding isopropyl alcohol with equal volume into the supernatant, fully and uniformly mixing, and standing for 10min at room temperature;

10 In a low-temperature centrifuge, 12000r/min for centrifugation, and precipitation occurs at the bottom of the test tube;

11 Washing of RNA precipitate: carefully discarding the supernatant, slowly adding 1mL of 75% ethanol solution along the tube wall, gently reversing, mixing, washing the tube wall, centrifuging at 12000r/min and 4deg.C for 5min, and carefully discarding ethanol;

12 Drying the precipitate at room temperature in an ultra-clean workbench for 2-5min, and adding 10-20 mu L of RNase-FREE WATER to dissolve the precipitate;

13 1-2 mu L of the fully dissolved RNA sample is taken, and 1-2% agarose gel electrophoresis is used for detecting the extraction result of RNA;

14 1-2. Mu.L of the well-dissolved RNA sample was taken and the concentration and purity of RNA was measured by an ultraviolet spectrophotometer.

2. Synthesis of first strand cDNA

1) The synthesis of the first strand of the liver cDNA of loach in Taiwan uses a reverse transcription kit PRIMESCRIPT ^TM II 1st Strand cDNA Synthesis Kit (TaKaRa, japan); the concentration of the RNA sample measured by the ultraviolet spectrophotometer was recorded.

2) The following reaction system is prepared in a centrifuge tube special for extracting RNA:

3) The reaction system was placed on a PCR apparatus at 42℃for 2min, and quenched on ice.

4) Preparing 10 μl of the following reaction system in a special centrifuge tube for extracting RNA:

5) Mixing uniformly, and placing in a PCR instrument operation program: 15min at 37 ℃; the reaction was terminated at 85℃for 15 s. The reaction solution is placed on ice for subsequent operation or kept at-20 ℃ for standby.

3. CDNA gene core region sequence primer design

Obtaining full-length cDNA sequences of fish elovl genes such as zebra fish from NCBI database, performing multiple comparison, and reading the conserved regions of the amino acid sequences of the conserved regions of the fish to design and synthesize 1 pair of degenerate primers:

F:CTGTGGTGGTATTACTTCTCC

R:ACTTTTTCCACCACAGATATG

The expected PCR product fragment size is around 150 bp. The synthesized primer 12000r is fully centrifuged, and then deionized double distilled water (ddH ₂ O) is used for dissolving the primer to the concentration of 20 mu mol/L, and the primer is preserved at the temperature of minus 20 ℃ for standby.

4. PCR amplification of elovl Gene core fragment

1) The following 60. Mu.l PCR reaction was prepared:

2) And (3) uniformly mixing the reaction system, centrifuging, and placing the mixture on a PCR instrument for PCR reaction. PCR amplification conditions of core fragment of Taiwan loach elovl gene are as follows: pre-denaturation at 94℃for 5min; denaturation at 94℃for 30s, annealing at 55℃for 15s, elongation at 72℃for 1min, and 35 cycles; finally, the extension is carried out for 10min at 72 ℃. Note that: the preparation of the reaction system must be carried out on ice.

3) Ligation of PCR purified product with pMD-19T vector 5. Mu.l reaction system in a small centrifuge tube was as follows:

purification of PCR product 2.2. Mu.l

PMD19-T vector 0.3 μl

SolutionⅠ 2.5μl

4) Uniformly mixing the 5 mu L system, placing on a PCR instrument, setting a program for 40min at 16 ℃, taking all reaction products to be transformed into DH5 alpha (50 mu L) competent cells, standing for 20min on ice, cooling for 90s in a water area at 42 ℃, cooling for 2-3min on ice, adding 890ul of LB culture medium, culturing on a shaking table at a constant temperature of 37 ℃ for 1h, culturing on an agar plate containing Amp, and culturing overnight at 37 ℃ in an inverted manner; and (5) selecting single bacteria for PCR detection. Placing the bacterial colony in 5ml LB/Amp liquid culture medium, and culturing at 37 ℃/180rpm for 10-12h until bacterial liquid is turbid; and (3) taking 500 mu l of bacterial liquid, sending the bacterial liquid to a Wohangaceae biological company for sequencing, wherein the sequencing requirement is bidirectional sequencing, and performing proofreading and splicing to obtain the core sequence of the Taiwan loach elovl genes.

5. Synthesis of elovl Gene 5', 3' -RACE cDNA

1) Design of 5' -RACE primer

Based on the cDNA core sequence of the Taiwan loach elovl gene cloned in step 4, the 5' -RACE upstream primer was designed using SMART RACE CDNA Amplification Kit (Clontech, USA) kit according to the kit instructions as follows:

Expanding the 5' end:

OUTER1：GGCGGATCCCTGCACTGAAGACAT

INER1：CTCATACTCTGTCAGTCTGAGCACCGA

the downstream primers UPM (universal mixed primer Universal Primer Mix), NUP (nested primer NestedUniversal Primer of UPM) are provided by the kit.

2) Elovl5 Gene cDNA 5' terminal

Using SMART RACE CDNA Amplification Kit (Clontech, USA) kit, 5' -RACEPCR amplification (amplification using nested primers) was performed, and the 1st PCR reaction system (10. Mu.l system) was as follows:

ddH2O 6.3μl

10X LA PCR Buffer(Mg²⁺plus) 1μl

dNTPs 1μl

UPM(20μmol/L) 0.8μl

Taiwan loach skin 5' -RACE cDNA first Strand 0.5. Mu.l

OUTER1 0.3μl

LA Taq enzyme 0.1. Mu.l

The PCR amplification reaction conditions are 94 ℃ for 5min of pre-denaturation; denaturation at 94℃for 30s, annealing at 62℃for 30s, elongation at 72℃for 1min,30 cycles; finally, the extension is carried out at 72 ℃ for 10min.

Nested PCR reaction (60 μl) system:

The PCR amplification reaction conditions are 94 ℃ for 5min of pre-denaturation; denaturation at 94℃for 30s, annealing at 65℃for 30s, elongation at 72℃for 1min,30 cycles; finally, the extension is carried out at 72 ℃ for 10min.

3) PMD-19T vector clone of 5' -RACE PCR product

And (3) cloning a pMD-19T vector of the 5'-RACE PCR product according to the operation step in the step (4), and finally, sequencing the positive clone to a company to obtain the sequence information of the 5' -end of cDNA of the loach elovl gene in Taiwan.

4) Then, the 3' -end sequence information of elovl gene cDNA was obtained according to the above-mentioned method. Wherein, the 3' -RACE upstream primer is as follows:

Expanding 3' end:

OUTER2：CTTCACCATCCCGTACTGGGACTGGC

INER2：TCAGTCCATCCTCTGTATTCTCCTCGT

The 1st PCR reaction condition is 94 ℃ pre-denaturation for 5min; denaturation at 94℃for 30s, annealing at 60℃for 30s, elongation at 72℃for 1min,30 cycles; finally, the extension is carried out at 72 ℃ for 10min. Nested PCR pre-denaturation at 94℃for 5min; denaturation at 94℃for 30s, annealing at 65℃for 30s, elongation at 72℃for 1min,30 cycles; finally, the extension is carried out at 72 ℃ for 10min.

6. Determination of Taiwan loach elovl gene sequence information

And (3) splicing the sequences obtained in the step (4) and the step (5) to obtain the full-length sequence information of the Taiwan loach elovl genes. The full-length sequence of the gene is shown in SEQ ID NO: 1.

Example 2elovl knockout of Gene and breeding of Taiwan loach

1. CRISPR/Cas9 target site design and validation

According to the general formula of the target site: 5'-NNNNNNNNNNNNNNNNNNNN-NGG-3' (N is any base) and target site basic design principle, and a elovl gene target site is designed on the ORF sequence of the Taiwan loach elovl5 gene. Designing target site sequence information as SEQ ID NO: 2. Meanwhile, the following forward and reverse primers are designed around the target site for PCR amplification,

F:CTTAGGGTTCAAGGATGGC

R:ATAACCTTGGACTGACGCTT

The system is as follows:

The PCR amplification reaction conditions are 94 ℃ for 5min of pre-denaturation; denaturation at 94℃for 30s, annealing at 64℃for 30s, elongation at 72℃for 1min,30 cycles; finally, the extension is carried out at 72 ℃ for 10min.

The amplification product sequence information was obtained according to the method described in step 4 of example 1, and then compared with the target site sequence, the same result was found, indicating that the target site was available, and the next step was performed.

2. Preparation of gRNA

First, a gRNA upstream primer (SEQ ID NO. 3) containing elovl gene target site sequence and a downstream primer (SEQ ID NO. 4) matching the same were designed:

The following reaction system was formulated in a sterilized PCR tube, wherein the template DNA: the p-T7-gRNA plasmid (from http:// www.biovector.net/product/99362. Html):

The PCR amplification reaction conditions are 94 ℃ for 5min of pre-denaturation; denaturation at 94℃for 30s, annealing at 58℃for 30s, elongation at 72℃for 1min,30 cycles; finally, the extension is carried out at 72 ℃ for 10min.

And then the product is cleaned and recovered by utilizing AxyPrep PCR cleaning kit of AXYGEN company, and the main steps are as follows:

1) Add 150. Mu.l Buffer PCR-A to the PCR product;

2) After mixing, transferring to a preparation tube, placing the preparation tube into a 2ml centrifuge tube (provided in a kit), centrifuging at 12000 Xg for 1min, and discarding the filtrate;

3) The preparation tube was placed back into a 2ml centrifuge tube, 700. Mu.l Buffer W2 was added, and the mixture was centrifuged at 12,000Xg for 1min, and the filtrate was discarded;

4) The preparation tube was placed in a clean 1.5ml centrifuge tube (provided in the kit), 25. Mu. l Eluent was added to the center of the preparation tube membrane, and the tube was allowed to stand at room temperature for 1min. The DNA was eluted and recovered by centrifugation at 000 Xg for 1min.

Then utilize Ambion companyThe T7 Kit carries out in vitro transcription on the eluted and recovered DNA, and the main steps are as follows:

adding the above reagents into sterilized EP tube, water-bathing at 37deg.C for 1 hr, and adding TURBO DNase was removed from the DNA template by a water bath at 37℃for 15min, and finally recovered with MIRVANATMMIRNA ISOLATION KIT from Ambion, inc., as follows:

diluting the gRNA transcription system to 300. Mu.l by RNase-FREE WATER, and adding 330. Mu.l of absolute ethyl alcohol;

2) Adding the solution into a recovery column, and centrifuging 10000g for 15s;

3) 700 μl of MIRNA WASH Solution I was added and centrifuged for 10s;

4) Adding 500 μl of Wash Solution II, and centrifuging for 10s; repeating the process once;

5) Discarding the liquid in the collecting pipe, centrifuging for 1min, and removing residual liquid;

6) Adding a proper amount of RNase-FREE WATER preheated at 95 ℃, centrifuging at the maximum rotation speed for 30s, collecting the obtained gRNA solution, measuring the concentration to be 1210 ng/. Mu.l, and preserving at 80 ℃ below zero.

3. Preparation of Cas9mRNA

The pSP6-2sNLS-spCas9 vector was linearized by single digestion with XbaI (37℃water bath, 4h above), and after a few runs confirmed to be complete, the linearized product was recovered directly. And (3) taking the purified linearization Cas9 plasmid as a template, carrying out in vitro transcription to obtain Cas9mRNA, purifying and then preserving at-80 ℃. The storage concentration was 830 ng/. Mu.l.

4. In vitro microinjection

2 Pairs of Taiwan loaches with better development are selected at night before injection, artificial spawning is carried out, the dosage of the artificial spawning medicament is that LRH-A ₂ ug and DOM 4mg are injected into each kilogram of female parent fish, and the male fish is halved. The parent was then kept in a dark environment with a water temperature of 27 ℃. The artificial insemination can be carried out in the morning the next time, fertilized eggs are obtained and then placed on a special microinjection culture dish, and microinjection is carried out on the fertilized eggs reaching the 1 cell stage by using a microinjection instrument. And then placing the fertilized eggs after injection in a constant temperature box at 28 ℃ for hatching and culturing. The final concentration of Cas9mRNA was 500 ng/. Mu.l, the final concentration of gRNA was 30 ng/. Mu.l, the amount of Taiwan loach injection was 2nL, and the injection site was animal pole.

5. Elovl5 screening of knockout fish:

The elovl gene mutant of the F0-generation Taiwan loach is utilized to reproduce with the wild Taiwan loach to obtain an F1 generation, the F1 generation of the same mutation type is selected to carry out selfing to obtain an F2 generation, and then the homozygous mutant of the F2 generation is subjected to selfing to obtain the elovl gene knocked-out Taiwan loach homozygote (figures 2 and 3).

6. Determination of fatty acid content of fish body

Wild type homozygotes and knockout homozygotes propagated in the same batch are bred to 2 months old, taiwan loaches with different genotypes are fished out, body surface moisture is wiped, body weight is recorded, tissues are taken for weighing, body fat rate and total lipid content of the tissues are calculated in the later period. Then placing in a 2ml centrifuge tube, adding 1ml lipid extraction reagent, sterilizing for two hours, cleaning steel balls, crushing for 1min with a vibration crusher (Ningbo Xinzhi biotechnology Co., ltd.), transferring the crushed sample into a 10ml glass tube, adding 1.5ml methyl esterification reagent for methyl esterification, extracting fatty acid, detecting fatty acid content by gas chromatography, and setting 3 groups in parallel.

Experimental results show that compared with the wild type, the knockout type has obvious difference in EPA and DHA content in the body, compared with the wild type, the knockout type has obviously increased EPA and DHA content, and the total amount of DPA, EPA and DHA is obviously increased. See fig. 4 and 5 for detailed data.

In conclusion, the invention is a simple, efficient, short-period and easy-to-implement molecular breeding technology, and the technology only destroys the gene function, does not involve foreign genes, does not have the transgenic problem, and is convenient to popularize and apply.

Sequence listing

<110> University of agriculture in China

<120> Molecular breeding method for increasing content of highly unsaturated fatty acid of Taiwan loach

<160> 4

<170> SIPOSequenceListing 1.0

<210> 1

<211> 543

<212> DNA

<213> Taiwan loach (Paramisgurnus dabryanus)

<400> 1

gactgactca atacattaaa acatatacga ttgaaggaca cagatcagaa gataaagggt 60

tgaagatgga cacctttaat cacagagtaa acacgtatat tgactcctgg atgggaccca 120

gagatcttag ggttcaagga tggcttctac tggatgacta catccccact tttatcttta 180

ctattatgta ccttctgatt gtgtggatgg gaccaaaata tatgaagaat agaccgccat 240

attcctgcag agccctgcta gtgctgtata accttggact gacgcttctg tcactctaca 300

tgttctatga gcttgtgatg tcagcgtatc agggcaggta caacttcctc tgccaaaata 360

cccacagtgg aggcgaggcg gacaatagga tgataaatgt cctgtggtgg tattacttct 420

ccaaacttat tgagtttatg gacacgttct tcttcatctt gaggaaaaac agccatcaga 480

tcacctacct gcatgtttat catcacgcca ccatgctcaa catctggtgg tttgtcttga 540

act 543

<210> 2

<211> 20

<212> DNA

<213> Artificial sequence (ARTIFICIAL SEQUENCE)

<400> 2

tctgattgtg tggatgggac 20

<210> 3

<211> 18

<212> DNA

<213> Artificial sequence (ARTIFICIAL SEQUENCE)

<400> 3

cttagggttc aaggatgg 18

<210> 4

<211> 20

<212> DNA

<213> Artificial sequence (ARTIFICIAL SEQUENCE)

<400> 4

ataaccttgg actgacgctt 20

Claims

1. A molecular breeding method for improving the content of highly unsaturated fatty acid of Taiwan loaches is characterized by comprising the following steps: and using a CRISPR/Cas9 system to knock out elovl genes with nucleotide sequences shown as SEQ ID No.1 to obtain taiwan loach elovl gene knockout mutants, wherein the highly unsaturated fatty acids are DPA and DHA.

2. The molecular breeding method for increasing the content of highly unsaturated fatty acids of taiwan loaches according to claim 1, wherein the elovl gene knockout method comprises the following steps:

1) According to CRISPR/Cas knockout principle, designing knockout target sites on elovl gene ORF sequences;

2) Designing an upstream primer and a downstream primer containing a knocked-out target site sequence on elovl gene sequences, performing PCR (polymerase chain reaction) amplification by taking Taiwan loach cDNA as a template, and performing in vitro transcription and purification to obtain gRNA;

3) Taking the linearization Cas9 plasmid as a template, and obtaining Cas9mRNA after in vitro transcription and purification;

4) Microinjection of gRNA and Cas9mRNA into fertilized eggs of Taiwan loaches, and hatching and culturing the fertilized eggs; obtaining the Taiwan loach elovl gene knockout mutant.

3. The molecular breeding method for increasing the content of highly unsaturated fatty acids of taiwan loaches according to claim 2, which is characterized in that: the sequence of the knocking-out target site is shown as SEQ ID NO: 2.

4. The molecular breeding method for increasing the content of highly unsaturated fatty acids of taiwan loaches according to claim 2, which is characterized in that: the upstream primer sequence is shown as SEQ ID NO:3, the sequence of the downstream primer is shown as SEQ ID NO: 4.

5. The molecular breeding method for increasing the content of highly unsaturated fatty acids of taiwan loaches according to claim 2, which is characterized in that: the injection concentration of the gRNA is 30 ng/mu L, the injection concentration of the Cas9mRNA is 500 ng/mu L, the injection doses are 2 nL, and the injection site is an animal pole.