CN115851446A - Method for blocking DHA synthesis in oil-producing microalgae and increasing relative content of EPA and corresponding gene editing strain thereof - Google Patents

Abstract

The invention discloses a method for blocking DHA synthesis and increasing EPA relative content in oil-producing microalgae, which blocks DHA synthesis and increases EPA relative content in oil-producing microalgae by carrying out gene editing on a delta 5 elongase gene for coding C20 fatty acid elongase, and simultaneously obtains an engineering strain which does not produce DHA and is rich in EPA, wherein the nucleotide sequence of the engineering strain is shown as SEQID NO.3. The invention blocks the metabolic pathway of further prolonging and desaturating the EPA to synthesize DHA by carrying out gene editing on the delta 5 elongase (Elo 5) of the oil-producing microalgae, and simultaneously realizes the aim of accumulating higher relative content of EPA.

Description

Method for blocking DHA synthesis in oil-producing microalgae and increasing relative content of EPA and corresponding gene editing strain thereof

Technical Field

The invention relates to the technical field of algae biology, in particular to a method for editing a delta 5 elongase gene of phaeodactylum tricornutum to block the phaeodactylum tricornutum from synthesizing DHA and improve the relative content of EPA.

Background

Omega-3 ultra-long chain polyunsaturated fatty acids (VLC-PUFAs) are receiving increasing attention for their important role in human health. Eicosapentaenoic acid EPA (C20: 5. DELTA.) ^5,8,11,14,17 ) And docosahexaenoic acid DHA (C22: 6. Delta ^{4,7,10,13,16,19} ) Is an important member of omega-3 VLC-PUFAs, and the main source at present is fish oil or algae. The research finds that the fish is not a real producer of VLC-PUFAs, and most of LC-PUFAs are firstly synthesized by marine phytoplankton and then are enriched in marine animals such as fish through food chain transmission. The culture of marine microalgae for producing omega-3 VLC-PUFAs is theoretically a more direct way and has a plurality of advantages. On one hand, the marine microalgae can grow and propagate rapidly, synthesize and enrich high-concentration VLC-PUFAs by itself, the VLC-PUFAs content of some microalgae can reach 5% -6% of the dry weight of cells, and the relative content of the VLC-PUFAs is far higher than that of VLC-PUFAs in fish bodies. On the other hand, compared with fish oil, VLC-PUFAs extracted from the algae is simple in extraction process and has no pungent fishy smell. In addition, the microalgae does not contain cholesterol, so that the defect of intake of a large amount of cholesterol when the fish oil capsules are taken is avoided.

Since the 80 s of the last century, research on EPA has been intensive into various fields. Research shows that the high-purity EPA has obvious effects of reducing blood fat of patients and resisting thrombus. In addition, EPA can be converted into eicosanoids, a group of biologically active chemical substances, including prostaglandins, thromboxanes, and leukotrienes, which play important roles in regulating blood pressure and coagulation processes, and participate in many important physiological processes such as inflammation and immune response. In recent reports, EPA may also play a role in other diseases including rheumatoid arthritis, tumors, colon cancer, alzheimer's disease, parkinson's disease and metabolic syndrome.

At present, EPA is mainly obtained from fish oil, but fish oil also has other VLC-PUFAs with similar structures with EPA, particularly DHA, and the similar structures cause great difficulty in EPA purification. Due to the difference in pharmacological effects between EPA and DHA, more pure EPA must be used for epidemiological and clinical trials. The market demand for high purity EPA is also increasing.

The relative content of EPA in Phaeodactylum tricornutum can account for more than 10% -30% of the total fatty acids, and is one of the model organisms for the research on the synthesis of omega-3 ultralong-chain polyunsaturated fatty acids in marine algae. Phaeodactylum tricornutum is also capable of synthesizing DHA, typically in a relative amount of no more than 5% of the total fatty acids. The phaeodactylum tricornutum has the advantage of high content of EPA, but the requirement on the separation process is higher due to the extremely small amount of DHA, and the production and purification cost is greatly increased.

Disclosure of Invention

The technical problem to be solved by the present invention is to provide a method for blocking DHA synthesis in oleaginous microalgae and increasing the relative content of EPA, and a corresponding gene-editing algal strain thereof, in view of the above-mentioned deficiencies of the prior art. The invention blocks the metabolic pathway of further prolonging and desaturating the EPA to synthesize DHA by carrying out gene editing on the delta 5 elongase (Elo 5) of the oil-producing microalgae, and simultaneously realizes the aim of accumulating higher relative content of EPA.

The technical scheme adopted by the invention for solving the problems is as follows:

a method for blocking DHA synthesis and increasing the relative content of EPA in oil-producing microalgae is characterized in that the synthesis of DHA and the relative content of EPA in oil-producing microalgae are blocked by carrying out gene editing on a delta 5 elongase (Elo 5) gene encoding C20 fatty acid elongase.

Further, in the method for blocking DHA synthesis and increasing the relative content of EPA in the oil-producing microalgae, elo5 gene can be subjected to gene knockout, and the nucleotide sequence of the knocked-out gene fragment is shown as SEQ ID No. 4.

Further, the Elo5 gene is a specific gene of a type of oil-producing diatom, and phaeodactylum tricornutum is generally used as a model organism for researching the type of oil-producing diatom.

Further, the method for blocking DHA synthesis and increasing relative content of EPA in the oil-producing microalgae comprises the following specific processes: aiming at the characteristic analysis of an Elo5 gene sequence, one or more sgRNAs and a Cas9 protein are designed to be introduced into cells of oil-producing microalgae (such as Phaeodactylum tricornutum) by a particle bombardment method, the sgRNAs guide the Cas9 protein to cut a part of nucleotide fragments of an Elo5 gene DNA fragment, and the nucleotide sequence of the cut gene fragment is shown as SEQ ID No.4, so that the DHA synthesis in the oil-producing microalgae is blocked, the relative content of EPA is increased, and an engineering strain which does not produce DHA and is rich in EPA is obtained.

The delta 5 elongase gene of the engineering strain obtained by the method for blocking DHA synthesis and improving EPA relative content is subjected to gene editing, and the nucleotide sequence is shown as SEQ ID NO.3.

Compared with the prior art, the invention has the beneficial effects that:

firstly, the invention carries out gene editing on the phaeodactylum tricornutum Elo5, breaks out the gene, blocks the extended metabolic pathway of EPA to DHA, simultaneously realizes the effect of accumulating higher content of EPA, and provides a solution with prospect for accelerating the extraction of high-purity EPA from marine algae.

Secondly, compared with the wild type phaeodactylum tricornutum, the phaeodactylum tricornutum engineering strain without DHA production provided by the invention has the advantages that the relative content of EPA in the logarithmic phase and the plateau phase of the culture is respectively increased by 12.3% and 37.0%.

Drawings

FIG. 1 shows the comparison of the partial sequences of the Elo5 gene after editing with the wild type (a) and the PCR verification after editing (b);

FIG. 2 is a gas chromatogram for fatty acid determination;

FIG. 3 is the content of each fatty acid per g dry weight of algal powder;

FIG. 4 is a compositional analysis of the relative amounts of fatty acids of the Elo5 knockout strain.

Detailed Description

In order to better understand the present invention, the following examples are further provided to illustrate the content of the present invention, but the present invention is not limited to the following examples.

Examples

(1) Acquisition of Elo5 Gene

A Phaeodactylum tricornutum Elo5 gene is screened by a public database of microbial genomes (http:// promoters. Ensemblel. Org/index. Html), the length of the nucleotide sequence of a full-length coding frame of the gene is 1110bp, translated protein consists of 369 amino acids, the nucleotide sequence is shown as SEQ ID NO.1, and the protein sequence is shown as SEQ ID NO. 2.

(2) Assembly of the Elo5 Gene-edited Ribonucleoprotein (RNP)

The algal CRISPR design website (https:// www. Phytocrispex. Bio. En. Psl. Eu/CRISP-Ex /) was used to select targeting sequences (sgrnas) edited for the Elo5 gene, forward and reverse primers were designed for each of the 6 selected sgrnas, a total of 12 (table 1) were designed, and double-stranded DNA containing blunt ends was obtained as sgrnas after annealing. The resulting sgRNA targeting the Elo5 gene and sgRNA targeting adenine phosphoribosyltransferase (ptAPT) were shaken well as a DNA fragment mixture with a commercial human Cas9 protein in PBS buffer at a molar ratio of 1.

Table 1 elo5 sgRNA primers

(3) Transformation of Phaeodactylum tricornp and acquisition of Elo5_ KO knock-out strain

mu.L of the assembled RNP complex was mixed with 3mg of gold powder (0.6 μ M), washed 2 times with 100% ethanol, then bombarded with microparticles of the mixture using Bio-Rad PDS-1000/He system into Phaeodactylum tricornutum cells on f/2 solid medium, cultured overnight, scraped of the cells, and plated on f/2 medium plates containing 20 μ M2-fluoroadenine and 5mg/L adenine.

Three weeks later, single clones were picked and resuspended in 96-well plates with f/2 liquid medium containing 20. Mu.M 2-fluoroadenine and 5mg/L adenine. After one week, genomic DNA of the corresponding monoclonals was extracted, and the Elo5 gene was amplified and sequenced, all using Elo5_ colony-F/R (Table 2) as primers. The sequencing results are compared by using an online tool (https:// ice. Synthego. Com/# /), and the knockout strain to be screened is determined according to the sequence comparison results. Designing a forward primer Elo5-q-F and a reverse primer Elo5-q-R at a deletion sequence and at the end of a first intron of a knockout strain to be screened, carrying out fragment amplification on genomic DNA of the knockout strain to be screened and wild type Phaeodactylum tricornutum, and confirming the knockout result for the second time so as to finally determine an Elo5 gene knockout algal strain, namely the Phaeodactylum tricornutum engineering algal strain (hereinafter referred to as Elo5 knockout strain for short) of the invention.

Table 2 Elo5 knockout detection primers

The PCR products of the obtained multiple phaeodactylum tricornutum strains were sequenced, and strain ptElo5_ KO-5,11,15 (FIG. 1 a) which had been subjected to Elo5 knock-out was selected by comparing the sequences with the wild type Elo5 gene. Primers were designed at the knockout sequence for PCR amplification, and the results showed that PCR products of the same size as the wild type could not be amplified in the knockout strain (FIG. 1 b). And determining the DNA sequence of the Elo5 gene in the Elo5 knockout strain at a molecular level to complete gene editing, wherein the nucleotide sequence is SEQ ID NO.3. The Elo5 gene sequence in the phaeodactylum tricornutum engineering strain is deleted by 35 base pairs, and the deletion of a DNA fragment causes the change of a coding protein sequence, so that the Elo5 protein cannot be synthesized.

(4) Fatty acid composition determination

The wild type Phaeodactylum tricornutum and Elo5 knockout strain cultured to logarithmic phase were inoculated into 1L Erlenmeyer flask containing 600mL of f/2 medium containing 5mg/L adenine (final density of algal cells is 10) ⁴ /mL). Incubation temperature at 22 ℃,12h/12h light dark cycle, 75. Mu. Mol photons m ^-2 s ^-1 Culturing with aeration under the condition of illumination intensity. The algal cells in the logarithmic phase (sixth day) and the plateau phase (ninth day) were collected, centrifuged to remove the medium, and freeze-dried.

Accurately weigh 4mg of freeze-dried algae powder, respectively add 20 μ L of internal standard (C21: 0, 1mg/mL) and 750 μ L of methanol sulfate (v: v = 5), then perform a 90 ℃ metal bath for 90min. Naturally cooling to room temperature, sequentially adding 500 μ L of 0.9% NaCl and 200 μ L of n-hexane, vortex, mixing, and centrifuging at 4000rpm for 10min. The fatty acid composition was determined by gas chromatography using 100. Mu.L of the upper organic phase in a gas bottle. Wherein, the instrument and the parameters thereof are as follows: 7890 model a gas chromatograph (Agilent), hydrogen flame ionization detector; and (3) chromatographic column: HP-5 elastic quartz, length 30m, internal diameter 0.32mm; temperature programming: initial temperatureAt 210 deg.C, maintaining for 9min, raising the temperature to 230 deg.C at 20 deg.C/min, and maintaining for 8min. The temperature of the injection port is 250 ℃, the temperature of the detector is 280 ℃, and the carrier gas is high-purity N ₂ The flow rate is 20mL/min, and the constant flow control is carried out. H ₂ The flow rate is 30mL/min, the air flow rate is 400mL/min, and the tail blowing is 20mL/min. Sample introduction amount: 1 μ L. Shunting mode: the split ratio is 30.

The DHA peak-off time was 20.3min. As shown by the gas chromatography results of fig. 2: the Elo5 knockout strain has no peak at 20.3min, while the wild type has obvious peaks, and the DHA content of the wild type in the logarithmic phase and the plateau phase is determined to be 2.62 and 1.44mg/g respectively through calculation. And the DHA content in the fatty acid composition of the Elo5 knockout strain is 0, namely the Phaeodactylum tricornutum engineering strain does not contain DHA.

Further analysis of fatty acid content of wild-type and Elo5 knockout strains showed that the levels of C16:0 and C16:1 were significantly lower in the Elo5 knockout strain at the plateau phase than in the wild-type, which may be associated with metabolic flux of the Elo5 knockout strain towards accumulation of EPA, with more C16 fatty acids desaturated and prolonged. It is worth noting that: the dry weight of EPA in the Elo5 knockout strain was increased by 14.5% and 20.0% compared to wild type in log and plateau phase, respectively (as shown in fig. 3). At logarithmic phase, the EPA content of the Elo5 knockout strain can account for 4.15% of dry weight, which also exceeds the EPA content of one nannochloropsis strain (only EPA is produced naturally, no DHA is produced; EPA accounts for less than 4% of dry weight) reported in the prior art.

The fatty acid composition results show that: the mole percent EPA of the Elo5 knockout strain increased 12.3% and 37.0% over wild type both in the log phase and the plateau phase (as shown in fig. 4). The EPA content of the log-phase Elo5 knockout strain can account for 29.7% of the total fatty acid content, which also far exceeds the EPA content in several common fish oils: 8 to 10 percent of sardine oil, 1 to 4 percent of whale oil, 8 to 10 percent of mackerel oil, 17.2 percent of sturgeon oil and 16 to 19 percent of antarctic krill oil.

The above description is only a preferred embodiment of the present invention, and it should be noted that those skilled in the art can make various modifications and changes without departing from the inventive concept, and these modifications and changes are all within the scope of the present invention.

SEQ ID NO.1

ATGTGTGGTCCCACAGATACAGTGGTCGTTCGTGTAGAAGAGCGTGGCGCTCAAGCACCGTCGGCGGCCGACTCCGTGAACAAACCGGCTATGGCACACAATTTATCCGAGGCCGATGCCAACGGCATTTTAAGCAAATCGATGGATCCACCCGTGCCCTCTCTTGCAGCTCGCTACACTTGTGCATCAATCTTAGTAGGTGTCTTCGCAGTGTGGGGAAAATACACTTTTGTGGACGAAGCAAAGGTCCCTGGAGGTGGCAGGGTCGAGTTGCACAACTGGAAGGTTCCCGCAGCGTTGACTACCTTTTATCTGGTGAGTTTGCCCTTGCTTCGATGGTTTTCCAACAAGTTTTTACTTCCAAATGTGGATGTGAAAATTTTACTACGGGAGGCTATGATTCTCTACAATGCGGGACAAGTTGTGTTGAACGCATGGATGGTATACCGCTTCGTGGATGCGGTCATGTTTCGTGGACATCCCTTTGTCGGCGGACCGGTTGATTTGGTGGATACGGGAGCGACTTTTGCAATATGGGTGCACTACTGCGACAAGTACTTAGAGTTTCTCGATACGTACTTTATGGTTCTGCGGGGAAAGATGGATCAGGTCTCATTTCTGCACGTCTATCATCATACGTCGATATCTTGGGCCTGGTGGTTTGGGTTGAAGCTCCATCCCGGCGGTGATGGGTACTTTGGCGCTTTGCTCAACTCATGGATTCATGTCATGATGTATTCATACTACACGTTCAGTCTGCTGAAAGTTCACTGCCCTTGGAAGCGGTACTTAACGCAGGCACAGCTGCTACAATTTACTACGGTTCTTCTGTATTCCTTCTGGAGTATGAATCGAATGCCCCCCGGCAGCAATTGGGGCCATTACGCGGCGCATTGCATCCAAGACTTTGAAATGATTAGCCTCTTTTTACTGTTTCTGCACTTTTACCGTAAAGCCTACAGTCAGAAGCAGAAGGATGCGGCCCTGAAGAAGCAAGCATTGCTGAAAGCTTTGGAACCAGAGACAGACTCCAGCGCGGACGCCGTCGCTGAACAAGCTTCGATTTCCTCGATCAGCTCGGACGAGGATCGGGATGACCGGTCTTCGTAG

SEQ ID NO.2

GlyGlyArgValGluLeuHisAsnTrpLysValProAlaAlaLeuThrThrPheTyrLeuValSerLeuProLeuLeuArgTrpPheSerAsnLysPheLeuLeuProAsnValAspValLysIleLeuLeuArgGluAlaMetIleLeuTyrAsnAlaGlyGlnValValLeuAsnAlaTrpMetValTyrArgPheValAspAlaValMetPheArgGlyHisProPheValGlyGlyProValAspLeuValAspThrGlyAlaThrPheAlaIleTrpValHisTyrCysAspLysTyrLeuGluPheLeuAspThrTyrPheMetValLeuArgGlyLysMetAspGlnValSerPheLeuHisValTyrHisHisThrSerIleSerTrpAlaTrpTrpPheGlyLeuLysLeuHisProGlyGlyAspGlyTyrPheGlyAlaLeuLeuAsnSerTrpIleHisValMetMetTyrSerTyrTyrThrPheSerLeuLeuLysValHisCysProTrpLysArgTyrLeuThrGlnAlaGlnLeuLeuGlnPheThrThrValLeuLeuTyrSerPheTrpSerMetAsnArgMetProProGlySerAsnTrpGlyHisTyrAlaAlaHisCysIleGlnAspPheGluMetIleSerLeuPheLeuLeuPheLeuHisPheTyrArgLysAlaTyrSerGlnLysGlnLysAspAlaAlaLeuLysLysGlnAlaLeuLeuLysAlaLeuGluProGluThrAspSerSerAlaAspAlaValAlaGluGlnAlaSerIleSerSerIleSerSerAspGluAspArgAspAspArgSerSer

SEQ ID NO.3

ATGTGTGGTCCCACAGATACAGTGGTCGTTCGTGTAGAAGAGCGTGGCGCTCAAGCACCGTCGGCGGCCGACTCCGTGAACAAACCGGCTATGGCACACAATTTATCCGAGGCCGATGCCAACGGCATTTTAAGCTCGCTACACTTGTGCATCAATCTTAGTAGGTGTCTTCGCAGTGTGGGGAAAATACACTTTTGTGGACGAAGCAAAGGTCCCTGGAGGTGGCAGGGTCGAGTTGCACAACTGGAAGGTTCCCGCAGCGTTGACTACCTTTTATCTGGTGAGTTTGCCCTTGCTTCGATGGTTTTCCAACAAGTTTTTACTTCCAAATGTGGATGTGAAAATTTTACTACGGGAGGCTATGATTCTCTACAATGCGGGACAAGTTGTGTTGAACGCATGGATGGTATACCGCTTCGTGGATGCGGTCATGTTTCGTGGACATCCCTTTGTCGGCGGACCGGTTGATTTGGTGGATACGGGAGCGACTTTTGCAATATGGGTGCACTACTGCGACAAGTACTTAGAGTTTCTCGATACGTACTTTATGGTTCTGCGGGGAAAGATGGATCAGGTCTCATTTCTGCACGTCTATCATCATACGTCGATATCTTGGGCCTGGTGGTTTGGGTTGAAGCTCCATCCCGGCGGTGATGGGTACTTTGGCGCTTTGCTCAACTCATGGATTCATGTCATGATGTATTCATACTACACGTTCAGTCTGCTGAAAGTTCACTGCCCTTGGAAGCGGTACTTAACGCAGGCACAGCTGCTACAATTTACTACGGTTCTTCTGTATTCCTTCTGGAGTATGAATCGAATGCCCCCCGGCAGCAATTGGGGCCATTACGCGGCGCATTGCATCCAAGACTTTGAAATGATTAGCCTCTTTTTACTGTTTCTGCACTTTTACCGTAAAGCCTACAGTCAGAAGCAGAAGGATGCGGCCCTGAAGAAGCAAGCATTGCTGAAAGCTTTGGAACCAGAGACAGACTCCAGCGCGGACGCCGTCGCTGAACAAGCTTCGATTTCCTCGATCAGCTCGGACGAGGATCGGGATGACCGGTCTTCGTAG

SEQ ID NO.4

AGCAAATCGATGGATCCACCCGTGCCCTCTCTTGC

Claims (5)

1. An engineering strain for blocking DHA synthesis and improving EPA relative content is characterized in that the engineering strain is an oil-producing microalgae containing a delta 5 elongase gene, wherein the delta 5 elongase gene is subjected to gene editing, and the nucleotide sequence is shown as SEQ ID No.3.

2. A method for blocking DHA synthesis and increasing the relative content of EPA in oil-producing microalgae is characterized in that the synthesis of DHA in the oil-producing microalgae is blocked and the relative content of EPA is increased by carrying out gene editing on a delta 5 elongase gene for coding C20 fatty acid elongase.

3. The method for blocking DHA synthesis and increasing the relative content of EPA in the oleaginous microalgae according to claim 1, wherein the Δ 5 elongase gene is subjected to gene knockout, and the nucleotide sequence of the knocked-out gene fragment is shown in SEQ ID No. 4.

4. The method for blocking DHA synthesis and increasing EPA relative content in oil-producing microalgae according to claim 1, wherein the oil-producing microalgae is Phaeodactylum tricornutum.

5. The method for blocking DHA synthesis and increasing EPA relative content in oleaginous microalgae according to claim 1, is characterized by the following steps: aiming at characteristic analysis of an Elo5 gene sequence, one or more sgRNAs and Cas9 protein are designed and are introduced into an oleaginous microalgae cell through a particle bombardment method after being assembled, and the sgRNAs guide the Cas9 protein to cut partial sequences of an Elo5 gene DNA fragment, so that DHA synthesis in oleaginous microalgae is blocked, the relative content of EPA is increased, and an engineering strain which does not produce DHA and is rich in EPA is obtained.

Images