JP2020083824A - Mucin production promoter - Google Patents

Abstract

To provide excellent mucin production promoters, internal rough skin improving agents, keratoconjunctival disease improving agents, and dry mouth improving agents.SOLUTION: Due to having an excellent mucin production promoting action, hop can provide a rough skin improving agent for internal use, a keratoconjunctival disease improving agent, and a dry mouth improving agent, and can be used as a food, a quasi-drug, or a drug, having these actions. In addition, since the combination of hop and lactulose significantly enhances the mucin production promoting action, it can provide a further excellent skin roughening agent for internal use, keratoconjunctival disease improving agent, and dry mouth improving agent, and can be used as a food, a quasi-drug, or a drug, having these actions.SELECTED DRAWING: None

Description

TECHNICAL FIELD The present invention relates to a mucin production promoter, a skin roughening improving agent for internal use, a keratoconjunctival disease improving agent, a dry mouth improving agent, which contains hops or contains hops and lactulose.

Mucous membranes are present in various organisms including humans. For example, in mammals including humans, they are present in various organs such as the oral cavity including the mouth, stomach and intestines, digestive organs, nasal cavity, joints and eyes. The surface of the mucous membrane is covered with tissue fluid/secretory fluid called mucus produced by epithelial cells and mucus cells of each tissue or organ. It is also known that the action of mucus is involved in a protective function against the surface of the mucous membrane and a lubricating function as well as a protective function against invasion of foreign microorganisms and foreign substances. The main component of mucus is a glycoprotein called mucin.

In order for mucus to exert its function, it is necessary for epithelial cells and mucus cells to produce a sufficient amount of mucin. However, due to various stimuli in daily life such as cigarettes, alcohol, various drugs, and environmental stress, mucus production becomes insufficient, and mucin decreases, so that the effect of protecting the mucous membrane is reduced and the mucous membrane is damaged. It is known to receive (patent document 1). Therefore, increasing the amount of mucin production is important for maintaining the function of mucus, protecting the mucous membrane, and exerting a biological defense function of protecting the living body from injury.

Mucin is widely distributed in the living world, and in organisms with digestive organs such as the stomach and intestines, in addition to protecting the digestive tract, it enhances the colonization of so-called good bacteria such as bifidobacteria in the intestine, thereby improving intestinal flora. It is known to keep healthy and improve constipation and diarrhea. In addition, by increasing mucin production, it is expected that the intestinal flora will be kept healthy, the organism will be protected from various infectious diseases, and the skin roughening and acne/pimples will be improved.

Mucin is known to be contained in tears and saliva in addition to the digestive tract. Although the surface of the eye is covered with tears, that is, tears, it is said that the mucin contained in the tears retains water and contributes to the stability of the tear film. Qualitative or quantitative abnormalities of the tear fluid or tear film cause dry eye (keratoconjunctival dryness). As subjective symptoms of dry eye (keratoconjunctival dryness), there are dry eyes, eye fatigue, and the like, which is a disease that greatly impairs daily life (Non-patent Document 1). Therefore, promoting the production of mucin contained in tears is effective in ameliorating keratoconjunctival diseases including dry eye.

In the oral cavity, saliva contains mucin. The dry state of the mouth is called dry mouth (dry mouth), and when it deteriorates, it causes problems such as swallowing injury. It is considered that the cause of dry mouth (dry mouth) is mainly a decrease in saliva secretion, but mucin contained in saliva is known to have a role of protecting the mucous membrane in the oral cavity. Therefore, promoting the production of mucin in the oral cavity is useful for improving the disorder associated with dryness in the oral cavity (Non-Patent Document 2).

Furthermore, there is a report that most dry eye patients have symptoms caused by dry mouth (Non-patent Document 2). By orally ingesting a component having a mucin production promoting action, an action of improving the symptoms of dry eye and dry mouth can be expected.

The hop is a plant of the family Cannabaceae, which is also called scientific name Humulus lupulus, also known as Hishka (Non-patent Document 3). As the pharmacological action of hops, an elastase inhibitory action (Patent Document 2), an antiallergic action (Patent Document 3) and the like are known. Further, although Patent Document 4 shows the proinflammatory effect of plant-derived proanthocyanidins to prevent inflammatory bowel disease, it is an apple-derived polyphenol and the action of hops is shown in the Examples of Patent Document 4. No mention is made of mucin production promoting action, skin roughening improving action, keratoconjunctival disease improving action, and xerostomia improving action.

Lactulose is a disaccharide in which galactose and fructose are linked by β-1,4-glycoside, and is also referred to as lactulose and 4-o-β-D-galactopyranosyl-D-fructose. As a pharmacological action of lactulose, an intestinal barrier improving action (Patent Document 5) is known. Patent Document 5 shows that lactulose increases the electrical resistance of intestinal cells, but shows no effect on mucin production promoting action, skin roughening improving action, keratoconjunctival disease improving action, and xerostomia improving action. Absent. Further, there is no indication of a mucin production promoting action, skin roughening improving action, keratoconjunctival disease improving action, or xerostomia improving action by combining lactulose and hops.

JP, 2006-169119, A Japanese Patent Laid-Open No. 11-246387 Japanese Patent No. 4709205 JP, 2007-77122, A JP, 2014-193830, A

Masato Nakamura, Journal of Japanese Pharmacology, 135, p. 138-141 (2010) Ichiro Saito, Jaw Occlusion Magazine, 25, p. 215-218 (2005) Adriane Fugh-Berman, Herbal Supplement Encyclopedia, p. 178 (2008)

An object of the present invention is to provide an excellent mucin production promoter, an internal skin roughening improving agent, a keratoconjunctival disease improving agent, and a dry mouth improving agent.

As a result of intensive studies aimed at solving the above-mentioned problems, the present inventors have found an excellent mucin production-promoting effect on hops, and by further using lactulose in combination, the mucin production-promoting effect is significantly increased. Heading out, the present invention has been completed.

The hops (Humulus lupulus) used in the present invention are climbing perennials belonging to the genus Ceratophoriaceae, and the cones (peony flowers) possessed by the female plant are also known as a raw material for beer. The hop site used in the present invention is not particularly limited, but examples thereof include whole plants, flowers, cones, leaves, stems, roots, and the like, and it is particularly preferable to use cones.

The hop used in the present invention can be used as it is, and if necessary, it can be used after being subjected to treatments such as drying, crushing, and finely chopping. Further, an extract obtained by extracting hops as they are or by subjecting them to the above treatments can be used. Examples of the solvent to be extracted include water, lower alcohols (methanol, ethanol, 1-propanol, 2-propanol, 1-butanol, 2-butanol, etc.), liquid polyhydric alcohols (1,3-butylene glycol, propylene). Glycol, glycerin, etc.), ketones (acetone, methyl ethyl ketone, etc.), acetonitrile, esters (ethyl acetate, butyl acetate, etc.), hydrocarbons (hexane, heptane, petroleum ether, etc.), ethers (ethyl ether, tetrahydrofuran, propyl) Ether etc.). These solvents may be used alone or in combination of two or more. In the present invention, the extraction solvent is preferably a polar solvent such as water or lower alcohol, and particularly preferably ethanol.

The above extract may be used as it is as an extracted solution, and if necessary, it may be subjected to treatments such as concentration, dilution, filtration, decolorization with activated carbon, deodorization, ethanol precipitation and the like. Furthermore, the extracted solution may be subjected to a treatment such as concentration to dryness, spray drying, freeze drying, and the like to be used as a dried product.

The intake of hops used in the present invention can be appropriately adjusted depending on the administration form, purpose of use, age, body weight and the like. The daily intake of hops for an adult can be 10 to 5000 mg, preferably 50 to 2000 mg in terms of dried hops, and can be taken orally once to several times a day. In some cases, an amount smaller than the above intake range may be sufficient, and in other cases, it may be necessary to ingest over the range. Further, the method of adding the medicinal component in the formulation may be added in advance or may be added during the production, and may be appropriately selected in consideration of workability.

As the lactulose used in the present invention, a known method, for example, one produced from lactose as a raw material can be used. It is also possible to use a commercially available product.

The intake of lactulose used in the present invention can be appropriately adjusted depending on the administration form, purpose of use, age, body weight and the like. The daily intake of lactulose for an adult is in the range of 10 to 20000 mg, preferably 100 to 3000 mg, and can be orally ingested once to several times a day.

The mucin production promoter of the present invention can be used as foods, quasi drugs, and pharmaceuticals. As the food, granules, tablets, hard capsules, soft capsules, beverages, jellies and the like can be used. In quasi-drugs and pharmaceuticals, oral powders, granules, tablets, sugar-coated tablets, capsules, syrups, pills, suspensions, liquids, emulsions, parenteral eye drops and injections. , And can be used as a suppository.

The mucin production promoter of the present invention, hops and lactulose may be used as they are, within a range that does not impair the effect, if necessary, an ordinary food, an quasi drug or an excipient used for a drug, It may also contain components such as stabilizers, preservatives, binders, disintegrants, hydrocarbons, fatty acids, alcohols, esters, pH adjusters, preservatives and fragrances. Further, it may contain components such as vitamins, sugars and proteins, and in order to achieve the object of the present invention, components such as bifidobacteria, lactic acid bacteria, oligosaccharides, indigestible dextrin, and lactoferrin may be contained as appropriate. it can.

The mucin production promoter of the present invention can be used for the prevention or amelioration of rough skin, keratoconjunctival disease, xerostomia, etc. caused by a decrease in mucin production.

The mucin production promoter of the present invention has a mucin production promoting action, skin roughening improving action, keratoconjunctival disease improving action, and xerostomia improving action.

Examples are given to explain the present invention in detail, but the present invention is not limited thereto. The percentages of the contents shown in the examples represent% by weight.

Below, the example of manufacture of the solvent extract of hops is shown.

Production Example 1 Hop ethanol extract To 100 g of crushed hop cones, 2000 mL of ethanol was added, and after extraction at room temperature for 7 days, the filtrate was concentrated to dryness to obtain 5.0 g of a hop ethanol extract.

Production Example 2 Hop 30% ethanol extract To 100 g of crushed hop cones, 1400 mL of purified water and 600 mL of ethanol were added, and the mixture was extracted at room temperature for 5 days. The filtrate was concentrated to dryness, and hop 30% ethanol extract 7 was added. 0.1 g was obtained.

Production Example 3 Hop 50% ethanol extract To 100 g of crushed hop cones, 1000 mL of purified water and 1000 mL of ethanol were added, and the mixture was extracted at room temperature for 5 days. The filtrate was concentrated to dryness, and hop 50% ethanol extract 6 was obtained. 0.8 g was obtained.

Production Example 4 Hop hot water extract To 100 g of crushed hop cones, 2000 mL of purified water was added, and the mixture was extracted at 95 to 100° C. for 2 hours, and then the filtrate was concentrated and freeze-dried to obtain a hop hot water extract 9 0.0 g was obtained.

Prescription example 1 Granule prescription Content (%)
1. Hop ethanol extract (Production Example 1) 5.0
2. Lactulose 50.0
3. Maltitol 44.0
4. Pullulan 1.0
[Production method] Granules were obtained by subjecting components 1 to 4 to fluidized bed granulation (spray liquid was prepared by dissolving pullulan in water).
[Usage] Take 1 packet (1.5 g) per day.

Prescription example 2 Granule prescription Content (%)
1. Hop hot water extract (Production Example 4) 10.0
2. Sucrose 40.0
3. Corn starch 50.0
[Production method] The ingredients 1 to 3 were granulated by fluidized bed granulation (spray liquid was water).
[Usage] Take 1 packet (1.5 g) per day.

Prescription example 3 Tablet prescription Content (%)
1. Hop 30% ethanol extract (Production Example 2) 7.0
2. Lactic acid bacteria powder 2.0
3. Lactulose 30.0
4. Corn starch 49.0
5. Crystalline cellulose 10.0
6. Glycerin fatty acid ester 2.0
[Production method] Components 1 to 5 are mixed, 10% of water is added as a binder, and the mixture is extruded and granulated, and then dried. Ingredient 6 is added to the molded granules, mixed and compressed into tablets. One tablet is 0.5g.
[Usage] Take 4 tablets per day.

Prescription example 4 Powder prescription Content (%)
1. Hop 50% ethanol extract (Production Example 3) 5.0
2. Bifidobacterium powder 10.0
3. Cornstarch 25.0
4. Crystalline cellulose 60.0
[Production method] Components 1 to 4 are mixed to form a powder.
[Usage] Take 1 packet (3 g) per day.

Prescription example 5 Jelly prescription Content (%)
1. Hop ethanol extract (Production Example 1) 0.1
2. Lactulose 1.0
3. Carrageenan 2.0
4. Gelatin 1.0
5. Sucrose 25.0
6. Purified water 70.9
[Production Method] Components 1 to 6 are mixed, boiled while heating, poured into a jelly mold, and cooled.
[Usage] Take one (100 g) per day.

Prescription example 6 Beverage prescription Content (%)
1. Hop hot water extract (Production Example 4) 0.1
2. Maltitol 5.0
3. Citric acid 1.0
4. Fragrance 0.5
5. Purified water 93.4
[Production method] Components 1 to 4 are dissolved in a part of component 5 with stirring. Add the rest of ingredient 5 and mix, heat to 90° C. and fill a 30 mL glass bottle.
[Usage] Take 1 bottle (30 mL) per day.

Comparative Example 1 Conventional Granules The conventional granules obtained by replacing the hop ethanol extract and lactulose with sucrose in the conventional granules of Formulation Example 1 were used.

Test Example 1 Mucin production promoting action of hop After intestinal epithelial cell Caco-2 was cultured in DMEM containing 1% non-essential amino acid and 10% FBS, 300 μg/mL of hop ethanol extract (Production Example 1) was added. A cDNA solution was prepared from the RNA extracted after addition of the sample, and gene expression analysis was performed on mucin (MUC2) by the real-time PCR method using SYBR Green. At that time, the expression level was calculated from the ratio of the target gene and GAPDH using GAPDH (Glyceraldehyde-3-Phosphate Dehydrogenase) as an internal standard. The primers used for gene expression analysis are as follows.

Primer set for MUC2 (SEQ ID NO: 1) CAATACCTGCACCTGCAAGAG
(SEQ ID NO: 2) CCGTCAAAGTCGTAGTACTTCC
GAPDH primer set (SEQ ID NO: 3) TGCACCACCAACTGCTTAGC
(SEQ ID NO: 4) TCTTCTGGGTGGCAGTGATG

The results of gene expression analysis of Test Example 1 are shown in Table 1. The hop ethanol extract increased the gene expression level of MUC2.

Test Example 2 Mucin production promoting effect by combined use of hops and oligosaccharides Intestinal epithelial cells Caco-2 were cultured in DMEM containing 1% nonessential amino acid and 10% FBS, and then hop ethanol extract (Production Example 1) 100 μg/mL As oligosaccharides, lactulose (lactulose), isomaltooligosaccharide, fructooligosaccharide, galactooligosaccharide, raffinose, and 500 μg/mL were added. As various oligosaccharides, Fuji Film Wako Pure Chemical Industries, Ltd. was used. A cDNA solution was prepared from the RNA extracted after addition of the sample, and gene expression analysis was performed on mucin (MUC2) by a real-time PCR method using SYBR Green. At that time, the expression level was calculated from the ratio of the target gene and GAPDH using GAPDH (Glyceraldehyde-3-Phosphate Dehydrogenase) as an internal standard. The same primers used in Test Example 1 were used for gene expression analysis.

The results of gene expression analysis of Test Example 2 are shown in Table 2. The hop ethanol extract increased the gene expression level of MUC2. Furthermore, when the hop ethanol extract and lactulose were added at the same time, the gene expression level of MUC2 remarkably increased as compared with the case where hops were added alone. However, even if the hop ethanol extract and another oligosaccharide were added at the same time, the effect was not increased. From the above, it was shown that the hop ethanol extract has a mucin production promoting action, and that the co-use of lactulose further enhances the mucin production promoting action.

Test Example 3 Rough skin improving effect 24 men and women suffering from rough skin (35 to 47 years old) were divided into 2 groups of 12 people, each of which contains the hop ethanol extract of Formulation Example 1 and lactulose, and Comparative Example 1 The conventional granules were taken for 3 months. After 3 months of drinking, a questionnaire survey was conducted on the rough skin improving effect, and any of the five items of “improved”, “slightly improved”, “no change”, “slightly deteriorated”, and “worse” were given to the subjects. Let me choose. Calculate the average score for each group with 5 points for "improved", 4 points for "improved", 3 points for "no change", 2 points for "slightly deteriorated", and 1 point for "worse" did.

Table 3 shows the results of the questionnaire regarding skin roughness in Test Example 3. Compared to the group that ingested conventional granules, the group that ingested hops and lactulose had a large number of respondents who answered “improved” or “slightly improved”. Was shown.

Test Example 4 Dry eye improving action 24 men and women suffering from dry eye and dry eyes (20 to 48 years old) were divided into 2 groups, 12 each, and granules containing the hop ethanol extract and lactulose of the formulation example 1 respectively. , The conventional granules of Comparative Example 1 were ingested for 3 months. One month after drinking, a questionnaire survey was conducted on the dry eye improving effect, and one of the five items of “improved”, “slightly improved”, “no change”, “slightly deteriorated”, and “worse” was used as a subject. Let me choose. Calculate the average score for each group with 5 points for "improved", 4 points for "improved", 3 points for "no change", 2 points for "slightly deteriorated", and 1 point for "worse" did.

Table 4 shows the results of the questionnaire regarding the dry eye of Test Example 4. Compared to the group that ingested conventional granules, the group that ingested hops and lactulose had a large number of respondents who answered “improved” or “slightly improved”. Was done.

Test Example 5 Dry Mouse Improving Action Dry mice, 20 men and women suffering from thirst (45 to 65 years old) were divided into 2 groups, 10 each, and a granule containing the hop ethanol extract and lactulose of Formulation Example 1 , The conventional granules of Comparative Example 1 were ingested for 3 months. One month after drinking, a questionnaire survey was conducted on the improving effect on dry mouth, and subjects were selected from the five items of "improved", "slightly improved", "no change", "slightly deteriorated", and "worse". Let me choose. Calculate the average score for each group with 5 points for "improved", 4 points for "improved", 3 points for "no change", 2 points for "slightly deteriorated", and 1 point for "worse" did.

Table 5 shows the results of the questionnaire regarding the dry mouth of Test Example 5. Compared with the group that took conventional granules, the group that took hops and lactulose had more people who answered “improved” or “slightly improved”, showing that the intake of hops and lactulose improved dry mouth. Was done.

INDUSTRIAL APPLICABILITY The present invention can provide a skin roughness improving agent for oral administration, a keratoconjunctival disease improving agent, and a dry mouth improving agent, which contain hops or contain hops and lactulose and have a mucin production promoting action. Further, it can be used for foods, quasi drugs, and pharmaceuticals having these actions.

Claims (6)

A mucin production promoter characterized by containing hops. A mucin production promoter characterized by containing hops and lactulose. A rough skin improving agent for internal use, which comprises the mucin production promoter according to claim 1 or 2. An agent for improving a keratoconjunctival disease, which comprises the mucin production promoter according to claim 1 or 2. A dry mouth dryness improving agent comprising the mucin production promoter according to claim 1. The food composition according to any one of claims 1 to 5.