JP2020018317A - In vitro production of red blood cells with sortaggable proteins - Google Patents

Abstract

To provide a cell system that can be modified to confer new functions to surfaces.SOLUTION: The present invention provides a genetically engineered enucleated blood cell, which expresses on the surface a first fusion protein comprising a first peptide of interest and a first red blood cell membrane protein.SELECTED DRAWING: Figure 16-1

Description

RELATED APPLICATIONS This application claims priority under 35 USC 119 (e) to US Provisional Patent Application No. 61 / 822,071, filed May 10, 2013. Yes, the entire content of this provisional patent application is incorporated herein by reference.

GOVERNMENT SUPPORT This invention was made with government support under Grant No. HR0011-12-0015 from the Defense Advanced Research Projects Agency (DARPA). The government has certain rights in the invention.

  Cell surfaces can be modified to modulate surface functions or to confer new functions on such surfaces. Surface functionalization includes, for example, the addition of a detectable label, binding moiety, or a therapeutic agent to a surface protein, thereby detecting or isolating surface-modified cells, new non-naturally occurring cells. It allows for the generation of interaction between molecules or the conjugation of therapeutic or diagnostic agents to the cell surface.

  Cell surface modification can be achieved by genetic engineering or by chemical modification of cell surface proteins. However, both approaches, for example in that many surface proteins are inserted beyond a certain size would impair their function or expression, and that many chemical modifications are non-physiological Its ability is limited in that it requires special reaction conditions.

The present disclosure is based on the development of an in vitro multi-step culture process for differentiating human CD34 ⁺ peripheral blood cells into enucleated erythrocytes. This in vitro culture step unexpectedly synchronized erythroid expansion, terminal differentiation, and enucleation of recruited human CD34 ⁺ peripheral blood cells. The present disclosure is also based on the development of a salt tagging system for surface modification of red blood cells, in which a drug of interest is conjugated to the surface of enucleated red blood cells. Enucleated erythrocytes can be produced by the in vitro multi-stage culture system described herein. Such surface-modified enucleated erythrocytes can be used for diagnostic and therapeutic purposes.

Accordingly, one aspect of the present disclosure is a method for generating human enucleated erythrocytes, comprising: (i) providing a population of human CD34 ⁺ progenitor cells (eg, human CD34 ⁺ peripheral blood cells); ii) expanding the population of human CD34 ⁺ progenitor cells in a first medium for 0 to 6 days (eg, 4 days), wherein the first medium comprises Flt-3 ligand, stem cell factor (SCF), And (iii) enriching the expanded human CD34 ⁺ progenitor cells obtained from step (ii) for 4-7 days (eg, 5 days), including interleukin 3 (IL-3) and interleukin 6 (IL-6). ), Differentiating in a second medium, wherein the second medium comprises dexamethasone, β-estradiol, IL-3, SCF, and erythropoietin (EPO). And (iv) differentiating the cells obtained from step (iii) in a third medium for 3-5 days (eg, 4 days), wherein the third medium comprises SCF and EPO And (v) differentiating the cells obtained from step (iv) in a fourth medium for 4 to 12 days (eg, 9 days) to produce human enucleated erythrocytes, wherein the fourth medium Comprises EPO; and (vi) collecting human enucleated erythrocytes obtained from step (v). In some embodiments, the total duration of steps (ii)-(v) of the method ranges from 11-25 days. Step (v) may be performed in a culture vessel coated with an extracellular matrix-derived component such as fibronectin.

  In some embodiments, one or more of the second, third, and fourth media further comprises holo-type human transferrin and insulin. If necessary, the second, third, and fourth media all further contain these two cytokines. In other embodiments, the second, third, and / or fourth media contains certain cytokines, such as thrombopoietin (TPO), granulocyte macrophage colony stimulating factor (GM-CSF), or both. May not include.

  In one example, in any of the in vitro production methods described herein, the second medium used is 250-1500 μg / ml (eg, 500 μg / ml) holo-type human transferrin, 5-20 μg / ml. Insulin (eg, 10 μg / ml), 100 nM to 5 μM (eg, 2 μM) dexamethasone, 0.5-5 μM (eg, 1 μM) β-estradiol, 1-10 ng / ml (eg, 5 ng) IL-3 , 10-500 ng / ml (e.g., 100 ng / ml) SCF, and / or 2-10 U (e.g., 6 U) EPO. The second medium may be free of certain cytokines, for example, Flt-3, IL-6, or both.

  In another example, in any of the in vitro production methods described herein, the third medium used is 250-1500 μg / ml (eg, 500 μg / ml) holo-type human transferrin, 5-20 μg. / Ml (e.g., 10 [mu] g / ml) insulin, 10-100 ng / ml (e.g., 50 ng / ml) SCF, and / or 2-10 U (e.g., 6 U) EPO. The third medium may be free of certain cytokines, for example, Flt-3, IL-6, dexamethasone, β-estradiol, or any combination thereof.

  In yet another example, in any of the in vitro production methods described herein, the fourth medium used is 250-1500 μg / ml (eg, 500 μg / ml) holo-type human transferrin, 5-5 μg / ml. It can include 20 μg / ml (eg, 10 μg / ml) insulin and / or 0.5-3 U (eg, 2 U) EPO. The fourth medium may be free of certain cytokines, for example, Flt-3, IL-6, dexamethasone, β-estradiol, SCF, or any combination thereof.

In any of the in vitro production methods described herein, the human CD34 ⁺ progenitor cells can be any of the genetically engineered enucleated blood cells (not naturally occurring) described herein. For example, it may be human CD34 ⁺ expressing a fusion protein containing an erythrocyte membrane protein and a target peptide. In some embodiments, the fusion protein is a type I erythrocyte transmembrane protein (eg, glycophorin A), the type I erythrocyte membrane fused to an acceptor peptide at the N-terminus of the type I erythrocyte transmembrane protein. Includes penetrating proteins. Examples of the acceptor peptide include an oligoglycine component, for example, a 1-5 glycine fragment component, or an oligoalanine (for example, 1-5 alanine fragment) component. In other embodiments, the fusion protein is a type II erythrocyte transmembrane protein (eg, Kell or CD71) and is recognized by a sortase (eg, sortase A) at the C-terminus of the type II erythrocyte transmembrane protein. Includes a type II erythrocyte transmembrane protein fused to a peptide containing the sequence. The sequence recognizable by the sortase may be LPXTG (SEQ ID NO: 1), where X is any amino acid residue. In yet other embodiments, the membrane protein is a type III erythrocyte transmembrane protein, such as glucose transporter 1 (GLUT1).

  In another aspect, the present disclosure provides a genetically engineered enucleated blood cell that expresses on a surface a first fusion protein comprising a first peptide of interest and a first erythrocyte membrane protein. In some embodiments, the first erythrocyte membrane protein is a type I erythrocyte transmembrane protein (eg, glycophorin A such as human glycophorin A), and the first peptide of interest is a type I erythrocyte transmembrane protein. It is fused to the N-terminus of the protein. In other embodiments, the first erythrocyte membrane protein is a type II transmembrane protein (eg, Kell or CD71) and the first peptide of interest is fused to the C-terminus of the type II transmembrane protein. . The first target peptide can include a sequence recognizable by a sortase such as sortase A. In one example, the sequence recognizable by sortase is LPXTG (SEQ ID NO: 1), where X is any amino acid residue. In yet other embodiments, the first erythrocyte membrane protein is a type III erythrocyte transmembrane protein, such as GLUT1.

  In some embodiments, the first fusion protein further comprises a protein of interest (eg, a cytoplasmic protein that can be a diagnostic or therapeutic agent). The target protein is fused to the end of a first erythrocyte membrane protein, which is exposed to the cytoplasmic space, and the first target peptide is a first erythrocyte membrane protein, which is exposed to the extracellular space or the luminal space. Is fused to the end.

  In some cases, the first erythrocyte membrane protein can be a type I membrane protein (eg, GPA). The protein of interest is fused to the C-terminus of the type I membrane protein, and the first peptide of interest is fused to the N-terminus of the type I membrane protein.

  In another example, the first erythrocyte membrane protein is a type II membrane protein. The protein of interest is fused to the N-terminus of the type II membrane protein, and the first peptide of interest is fused to the C-terminus of the type I membrane protein.

  In yet other embodiments, the engineered enucleated blood cells described herein further express on a surface a second fusion protein comprising a second peptide of interest and a second erythrocyte membrane protein. .

  In some examples, the first peptide of interest in the first fusion protein comprises a recognizable site or an acceptable peptide of the first sortase, and the second peptide of interest in the second fusion protein is It contains a recognizable site or an acceptable peptide for the second sortase. The first and second sortases use different recognizable sites and different accepting peptides. In one example, the first peptide of interest comprises the motif LPXTA (SEQ ID NO: 2) (where X is any amino acid residue) or oligoalanine; and the second peptide of interest is LPXTG (SEQ ID NO: 1). ) Motifs or oligoglycines (eg, consisting of 1-5 glycine residues). In another example, the first fusion protein comprises Kell, its C-terminus is fused to a first peptide of interest comprising the motif LPXTG (SEQ ID NO: 1), and the second fusion protein comprises GPA; Its C-terminus is fused to a second peptide of interest containing oligoalanine (eg, consisting of 1-5 alanine residues).

  In any of the engineered enucleated blood cells described herein that express two fusion proteins on a surface, either or both of the fusion proteins are conjugated to two different functional components. be able to.

  The above enucleated blood cells can be prepared by any of the in vitro culture methods described herein.

  In some instances, the first peptide of interest, the second peptide of interest, or both, fused to the erythrocyte membrane proteins described herein, comprise a proteinaceous drug (eg, an antibody or antigen-binding fragment thereof, May be a single domain antibody), vaccine antigens, fluorescent proteins, streptavidin, biotin, enzymes, or peptides capable of targeting cells (eg, diseased cells). In other instances, the peptide of interest is conjugated to a detectable label or chemotherapeutic agent. For example, the peptide of interest can be conjugated to a lipid, carbohydrate, nucleic acid, binding agent, click chemistry handle, polymer, peptide, protein, metal, chelator, radiolabel, or small molecule.

  In yet another aspect, the present disclosure provides a method of delivering an agent to a subject, comprising administering to the subject any of the enucleated blood cells described herein. In some cases, the enucleated blood cells delivered are from the subject to which the cells are delivered.

  Further, methods for conjugating any of the peptides of interest described herein to the surface of erythrocytes are also within the scope of the present disclosure. The method comprises the steps of: (i) providing erythrocytes expressing a fusion protein comprising a membrane protein and a first peptide; Contacting the peptide of interest under conditions suitable for conjugation to the first peptide in the fusion protein. Either the first peptide or the target peptide in the fusion protein contains a sequence recognized by sortase. In one example, the sequence recognizable by sortase is LPXTG (SEQ ID NO: 1), where X is any amino acid residue.

  In some embodiments, the membrane protein is a type I erythrocyte transmembrane protein (eg, glycophorin A) and the first peptide is an acceptor peptide fused to the N-terminus of the type I erythrocyte transmembrane protein ( For example, oligoglycine fragments such as 1-5 glycine fragments), and the target peptide contains a sequence recognized by sortase. In other embodiments, the membrane protein is a type II erythrocyte transmembrane protein (eg, Kell or CD71), and the first peptide is fused to the C-terminus of the type II erythrocyte transmembrane protein, Contains recognizable sequences. In still other embodiments, the membrane protein is a type III erythrocyte transmembrane protein, such as GLUT.

  In some embodiments, in any of the methods described herein, the first fusion protein can further comprise a protein of interest (eg, a cytoplasmic protein that can be a diagnostic or therapeutic agent). The target protein is fused to the end of the first erythrocyte membrane protein, which is exposed to the cytoplasmic space. The first peptide of interest in the fusion protein is fused to the end of a first erythrocyte membrane protein that is exposed to the extracellular space or luminal space.

  In some cases, the first erythrocyte membrane protein is a type I membrane protein. The first protein of interest is fused to the C-terminus of the type I membrane protein, and the first peptide is fused to the N-terminus of the type I membrane protein. In another example, the first erythrocyte membrane protein is a type II membrane protein. The target protein is fused to the N-terminus of the type II membrane protein, and the first peptide is fused to the C-terminus of the type I membrane protein.

  In still other embodiments, any of the methods described herein, wherein the second fusion protein is such that the second sortase expresses a second peptide of interest on the surface of erythrocytes in the presence of the second sortase. Contacting the erythrocytes under conditions suitable for conjugating the erythrocytes. The second fusion protein includes a second erythrocyte membrane protein and a second peptide to which the second peptide of interest is conjugated. In some examples, either the second peptide or the second peptide of interest in the fusion protein contains a sequence that is recognizable by a second sortase. The sequence recognizable by the first sortase is different from the sequence recognizable by the second sortase.

  In some examples, the first peptide in the first fusion protein comprises a sequence recognizable by the first sortase or an acceptable peptide of the first sortase, and / or The second peptide comprises a sequence recognizable by the second sortase or an acceptable peptide of the second sortase. The acceptor peptide of the first sortase is different from the acceptor peptide of the second sortase. The first sortase can be a sortase A from Staphylococcus arreus. One of the first peptide and the first peptide of interest in the first fusion protein contains the motif LPXTG (SEQ ID NO: 1) (where X is any amino acid residue) and the other is , An acceptable peptide that is an oligoglycine. The first fusion protein can include Kell, the C-terminus of which is fused to a first peptide containing the motif LPXTG (SEQ ID NO: 1), and the first peptide of interest is oligoglycine (eg, 1- 5 glycine residues).

  In some examples, the second sortase is sortase A from Streptococcus pyogenes. One of the second peptide and the second peptide of interest in the second fusion protein can include the motif LPXTA (SEQ ID NO: 2), wherein X is any amino acid residue; And the other can include an acceptable peptide that can be an oligoalanine (eg, consisting of 1-5 alanine residues). The second fusion protein can include GPA, the N-terminus of which is fused to a second peptide that includes oligoglycine. The second peptide of interest can include the motif LPXTG (SEQ ID NO: 1), where X is any amino acid residue.

  In some embodiments, the first and second peptides of interest comprise or are conjugated to two different functional components. Alternatively or additionally, the first peptide of interest, the second peptide of interest, or both, is a proteinaceous drug, vaccine antigen, fluorescent protein, streptavidin, biotin, enzyme, or peptide capable of targeting cells Can be In one example, one of the first and second peptides of interest is a peptide that can target diseased cells.

  Further, the present disclosure relates to (a) a pharmaceutical composition for diagnostic or therapeutic use, comprising any of the enucleated erythrocytes described herein carrying any of the target peptides described herein. , A pharmaceutically acceptable carrier, and (b) use of the pharmaceutical composition for producing a drug for diagnostic or therapeutic purposes.

  The details of one or more embodiments of the invention are set forth in the description below. Other features or advantages of the invention will be apparent from the following drawings and detailed description of particular embodiments, and from the claims.

FIG. 1 shows an exemplary in vitro culture process for generating enucleated erythrocytes from human CD34 ⁺ progenitor cells. FIG. 2 is a photograph showing the morphology of cells at the expansion stage and various differentiation stages in the in vitro culture process described herein. FIG. 3 shows the cell surface markers of glycophorin A (CD235) and c-kit at the expansion and various differentiation stages in the in vitro culture process described herein as determined by FACS analysis. It is a figure which shows an expression. FIG. 4 shows the cell surface markers glycophorin A (CD235) and transferrin receptor (CD235) at the expansion and various differentiation stages of the in vitro culture process described herein as determined by FACS analysis. FIG. 2 shows the expression of CD71). FIG. 5 is a diagram showing enucleation of cells at the expansion stage and various differentiation stages in the in vitro culture process described herein. FIG. 6 is a chart showing cell proliferation at various stages of differentiation. FIG. 7 is a chart showing cell growth in a window of approximately 20 days. FIG. 8 is a chart showing globin gene expression as shown during hCD34 ⁺ cell differentiation. FIG. 9 is a chart showing expression of various genes shown during hCD34 ⁺ cell differentiation. FIG. 10 is a diagram showing the construction of an EF1 expression vector and an MSCV expression vector for producing a 5Gly (SEQ ID NO: 3) -myc-human glycophorin A (hGYPA or hGPA) fusion protein. FIG. 11 shows the surface expression of hGYPA capable of sorting on hCD34 ⁺ erythroid progenitor cells (at various stages of differentiation) using the EF1 expression vector; 5Gly: (SEQ ID NO: 3). FIG. 12 shows surface expression of hGYPA capable of sortagging on hCD34 ⁺ erythroid progenitor cells (at various stages of differentiation) using the MSCV expression vector; 5Gly: (SEQ ID NO: 3). FIG. 13 is a photograph showing the conjugation of biotin to hGYPA on hCD34 ⁺ erythroid progenitor cells by salt tagging, as determined by western blotting; 5G: (SEQ ID NO: 3). FIG. 14 shows the conjugation of biotin to the surface of human CD34 ⁺ cells at the terminal differentiation stage via salt tagging; 5Gly: (SEQ ID NO: 3). FIG. 15 shows the conjugation of biotin to the surface of human CD34 ⁺ cells at the terminal differentiation stage via salt tagging; 5Gly: (SEQ ID NO: 3). FIG. 16 shows glycophorin A expression and sortase-mediated N-terminal labeling on the surface of mature mouse erythrocytes. FIG. 16A is a schematic diagram of N-terminal sortase labeling of glycophorin A. The N-terminus of GPA was extended to include three glycine residues and one myc tag. Preincubation of the sortase with a probe containing the C-terminal sortase recognition motif, LPETG (SEQ ID NO: 44), results in a cleavage between T and G and an acyl enzyme intermediate between Cys on the sortase and Thr on the probe. Is formed. Nucleophilic attack of the N-terminal glycine on GPA degrades the intermediate and links the probe to GPA. The probe can be a peptide, protein, lipid, carbohydrate, small molecule, etc. For conjugation of biotin to GPA, the probes are K (biotin) LPRTGG (SEQ ID NO: 45); LPXTGG: (SEQ ID NO: 46). FIG. 16B stains either control blood or blood from a mouse that has undergone bone marrow transplantation to express 3G-myc-hGPA with α-TER119 and α-myc tag antibodies and analyzes by flow cytometry. FIG. 4 shows the evaluation of mature RBCs for the presence of 3G-myc-hGPA on the cell surface. FIG. 16C shows mature RBCs for sortase labeling by incubating control or 3G-myc-hGPA blood with a probe containing sortase and biotin, staining with α-TER119 and α-biotin antibodies, and analyzing by flow cytometry. It is a figure which shows evaluation. FIG. 16D is a diagram showing evaluation of RBC for sortase labeling by immunoblotting. Control blood or 3G-myc-hGPA blood was incubated with a biotin probe in the presence or absence of sortase, whole cell proteins were separated by SDS-PAGE, and immunoblotted for α-myc tag and α-biotin. The shift in GPA molecular weight by biotin conjugation in an α-myc tag immunoblot indicates nearly complete modification. Biotin-conjugated GPA is indicated by an arrow on an α-biotin immunoblot. FIG. 16E shows a diagram of biotin-conjugated RBCs sorted by flow cytometry. Immunofluorescence images show biotin (labeled in red) at the N-terminus of hGPA (labeled with Ter119 antibody, purple) on mature RBCs. FIG. 16F shows the results of transfecting HEK293T cells with 3A-myc-hGPA, hKell-LPETG (SEQ ID NO: 44), or both. Cells were isolated from Incubate with S. pyogenes sortase and a biotin probe, followed by S. pyogenes sortase. Incubated with probes containing S. aureus sortase and TAMRA. Specific conjugation of biotin to GPA and TAMRA to Kell is shown by immunoblotting and fluorescence imaging. FIG. 17 is a diagram showing that overexpression of modified human GPA containing a myc tag at the N-terminus and mouse GPA does not affect in vitro differentiation of mouse erythroid progenitor cells. FIG. 17A shows in vitro differentiated mouse embryos infected with a retrovirus construct containing a modified human (h) or mouse (m) GPA construct with myc tag extended at the N-terminus: myc-hGPA and myc-mGPA. FIG. 4 is a view showing a flow cytometry analysis on the differentiation ability of liver-derived progenitor cells. The differentiation potential of these cells is assessed based on Ter119 expression and enucleation, ie, nuclear exclusion, resulting in Ter119 ⁺ reticulocytes. The percentage of reticulocytes produced by erythroid progenitor cells infected with myc-hGPA or myc-mGPA (approximately 20%) is comparable to cells infected with empty (control) vector, and these The construct is shown not to interfere with terminal differentiation of the erythroid lineage. Quantification of the enucleation rate is from three independent experiments and is shown as mean +/- standard deviation. FIG. 17B shows the evaluation of mouse terminally differentiated erythroblasts, ie, nucleated erythroblasts and reticulocytes, for myc-hGPA or myc-mGPA surface expression. More than 60% of these terminally differentiated cells expressed the desired modified GPA protein as determined by flow cytometry using an α-myc tag antibody. The percentages of erythroblasts and reticulocytes with myc-tag on the cell surface were determined from three independent experiments and are shown as mean ^+/- standard deviation; ^** indicates p <0.01. FIG. 17C is an immunofluorescence image further confirming the surface expression of the myc tag (labeled in red) and the enucleation ability (blue nuclear staining) of erythroblasts terminally differentiated in vitro. FIG. 18 shows that overexpression of myc-tagged engineered human GPA and mouse GPA with multiple (3 or 5) glycines (SEQ ID NO: 3) at the N-terminus was observed in vitro in mouse erythroid progenitor cells. It is a figure showing that it does not affect differentiation. Only cells expressing an engineered human GPA with a myc-tag and three glycines at the N-terminus can be efficiently biotin-labeled by sorting. Figure 18A shows a retroviral construct containing a modified human (h) or mouse (m) GPA with an extended myc tag and multiple (3 or 5) glycines (SEQ ID NO: 3) (G) at the N-terminus: 5G Flow cytometric analysis of the differentiation capacity of in vitro differentiated mouse fetal liver-derived progenitor cells infected with (SEQ ID NO: 3) -myc-hGPA, 5G (SEQ ID NO: 3) -mycmGPA, and 3G-myc-hGPA was performed. FIG. The differentiation potential of these cells is assessed based on Ter119 expression and enucleation, ie, nuclear exclusion, resulting in Ter119 ⁺ reticulocytes. See top panel. The percentage of reticulocytes (approximately 17.5%) produced by erythroid progenitor cells infected with 5G (SEQ ID NO: 3) -myc-hGPA, 5G-myc-mGPA, and 3G-myc-hGPA is empty ( Control) is comparable to cells infected with the vector, indicating that these constructs do not interfere with terminal differentiation of the erythroid lineage. Quantification of the enucleation rate is from three independent experiments and is shown as mean +/- standard deviation. See bottom panel. FIG. 18B shows mouse terminally differentiated erythroblasts, ie, nucleated erythroblasts, for surface expression of 5G (SEQ ID NO: 3) -myc-hGPA, 5G (SEQ ID NO: 3) -mycmGPA, and 3G-myc-hGPA. It is a figure showing evaluation of reticulocytes. More than 50% of these terminally differentiated cells expressed the desired modified GPA protein as determined by flow cytometry using an α-myc tag antibody. See top panel. The percentages of erythroblasts and reticulocytes with myc-tag on the cell surface were determined from three independent experiments and are shown as mean ^+/- standard deviation; ^** indicates p <0.01. See bottom panel. In FIG. 18C, HEK 293T cells are transfected to express 5G (SEQ ID NO: 3) -myc-hGPA, 5G (SEQ ID NO: 3) -myc-mGPA, 3G-myc-mGPA, and 3G-myc-hGPA. did. These cells were then incubated with a biotin probe in the presence or absence of sortase and whole cell proteins were immunoblotted for myc tag and biotin. Immunoblot staining for biotin shows that only biotin conjugation to the human GPA constructs 3G-myc-hGPA (strong band) and 5G (SEQ ID NO: 3) -myc-hGPA (weak band) was successful. 3Gmyc (strong band) and much higher efficiency for 5G (SEQ ID NO: 3) -myc-hGPA (weak band), 3Gmyc-hGPA. Biotin probe conjugation is further confirmed by α-myc tag immunoblotting, as indicated by a shift in hGPA molecular weight due to biotin conjugation. FIG. 19 shows glycophorin A expression and sortase-mediated N-terminal labeling on the surface of erythroid cells differentiated in vitro. FIG. 19A shows in vitro differentiated red for the presence of 3G-myc-hGPA on the cell surface and for sortase-labeled biotin 3G-myc-hGPA by staining with α-myc and α-biotin tag antibodies. It is a figure which shows the flow cytometry analysis of a blast. See top panel. The percentage of erythroblasts and reticulocytes with the myc tag on the cell surface and the percentage of myc tag positive cells salt-tagged with the biotin probe were determined from three independent experiments and are shown as mean ^+/- standard deviation ^** indicates p <0.01. See bottom panel. FIG. 19B shows in vitro the sortase labeling by incubating control or 3G-myc-hGPA erythroid cells with a sortase and biotin-containing probe by immunoblotting using an α-myc tag and an α-biotin antibody. FIG. 4 is a view showing evaluation of erythroblasts differentiated in the above. Shift of hGPA molecular weight by biotin conjugation in an α-myc blot indicates complete modification of hGPA. GPA conjugated with biotin is indicated by an arrow in the α-biotin immunoblot. FIG. 19C shows immunofluorescence showing biotin (labeled in red) at the N-terminus of hGPA on the surface of differentiated erythroblasts. Nuclei were stained with Hoechst (blue). Arrows indicate reticulocytes, while arrowheads indicate erythroblasts that are enucleated. The scale bar is 10 μm. FIG. 20 is a schematic of engineered RBC generation by mouse bone marrow / fetal liver cell transplantation. Isolated mouse bone marrow cells or fetal liver cells were transduced with a retrovirus carrying hKell-LPETG (SEQ ID NO: 44) -HA or 3G-myc-hGPA. Lethal irradiated mice were reconstituted with transduced bone marrow or fetal hepatocytes. After one month, a significant percentage of mature RBCs are derived from transduced donor progenitor cells. FIG. 21 shows Kell expression and sortase-mediated C-terminal labeling on the surface of mature mouse erythrocytes. FIG. 21A is a schematic diagram of C-terminal sortase labeling of Kell. Kell was C-terminally extended to include the sortase recognition motif LPETG (SEQ ID NO: 44) followed by the HA epitope tag. Incubating the sortase with cells containing Kell-LPETG (SEQ ID NO: 44) causes peptide cleavage between T and G in the recognition motif, resulting in the cleavage between Cys on the sortase and the sortase motif on the Kell. An acyl enzyme intermediate is formed. When a nucleophilic probe having an N-terminal glycine residue (GGG-K (biotin); SEQ ID NO: 47; for biotin conjugation) is added, the intermediate is degraded, and the probe is linked to the C-terminus of Kell. The probe can be a peptide, protein, lipid, carbohydrate, small molecule, etc .; LPXTG (SEQ ID NO: 1). FIG. 21B shows that either control blood or blood from a mouse that had undergone bone marrow transplantation to express Kell-LPETG (SEQ ID NO: 44) was stained with an α-HA tag antibody and flow cytometry (for mature RBCs). FIG. 2 shows the evaluation of mature RBCs for the presence of Kell-LPETG (SEQ ID NO: 44) -HA on the cell surface by analysis by gating). FIG. 21C shows control blood or Kell-LPETG (SEQ ID NO: 44) -HA blood incubated with sortase and biotin containing probes, stained with α-biotin antibody, and analyzed by flow cytometry (gated for mature RBCs). FIG. 4 shows the evaluation of mature RBC for sortase labeling by the following method. FIG. 21D is a diagram showing evaluation of RBC for sortase labeling by immunoblotting. Control blood or Kell-LPETG (SEQ ID NO: 44) -HA blood was incubated with a biotin probe in the presence or absence of sortase. All cellular proteins were separated by SDS-PAGE and immunoblotted for α-HA tag and α-biotin. Loss of the HA tag by sortase labeling indicates complete modification. FIG. 21E is an immunofluorescence image showing biotin conjugated to the C-terminus of hKell on mature RBC (labeled with Ter119 antibody). FIG. 22 shows Kell expression and sortase-mediated C-terminal labeling on the surface of erythroid cells differentiated in vitro. FIG. 22A shows the presence of hKell-LPETG (SEQ ID NO: 44) -HA on the cell surface by staining with α-HA and α-biotin tag antibodies, and also sortase-labeled hKell-LPETG (SEQ ID NO: 44)- FIG. 3 shows flow cytometry of erythroid cells differentiated in vitro for biotin. See top panel. The percentage of erythroblasts and reticulocytes with the HA tag on the cell surface and the percentage of HA-tag positive cells salt-tagged with the biotin probe were determined from three independent experiments and are shown as mean +/- standard deviation ^** indicates p <0.01. See bottom panel. FIG. 22B shows in vitro for sortase labeling by incubating control or hKell-LPETG (SEQ ID NO: 44) -HA erythroid cells with a probe containing sortase and biotin, followed by immunoblotting against biotin and Kell. FIG. 4 is a view showing evaluation of erythroblasts differentiated in the above. FIG. 22C shows immunofluorescence showing biotin (labeled in red) at the C-terminus of hKell on the surface of differentiated erythroblasts. Nuclei were stained with Hoechst (blue). Arrows indicate reticulocytes, while arrowheads indicate erythroblasts that are enucleated. The scale bar is 10 μm. FIG. 23 shows sortase-mediated dual labeling at the N-terminus of hGPA and at the C-terminus of hKell on the surface of mature RBC. Mature RBCs expressing hKell-LPETG (SEQ ID NO: 44) -HA and 3A-myc-hGPA were isolated from N-terminal GPA labeling by incubating with sortase A and K (biotin) LPETAA (SEQ ID NO: 45) probes from S. pyogenes (second panel), or S. pyogenes. Incubation with S. aureus derived sortase A and GGGC (Alexa-647; SEQ ID NO: 48) probes for C-terminal Kell labeling (third panel), or both sortase enzymes and their corresponding Both successive labelings with the probe were performed (fourth panel). Flow cytometric analysis of mature RBCs for the presence of both hKell-LPET (SEQ ID NO: 49) and biotin-myc-hGPA shows successful double labeling. FIG. 24 is some charts showing the survival of engineered red blood cells in vivo. FIG. 24A shows that wild-type RBCs (each group, n = 3) or untreated wild-type RBCs (n = 3) subjected to a mock C-terminal sort tagging reaction in the presence or absence of sortase were reacted with CFSE. 4 is a chart showing the results when transfected into recipient mice by intravenous injection. Their survival in vivo was followed by CFSE fluorescence and flow cytometry. FIG. 24B is a chart showing the results of mKell-LPETG (SEQ ID NO: 44) RBC obtained from mice genetically engineered to have an endogenous Kell with LPETG (SEQ ID NO: 44) extended at the C-terminus. Wild-type RBC (n = 6), mKell-LPETG (SEQ ID NO: 44) RBC (n = 6), and mKell-LPETG (SEQ ID NO: 44) -RBC (n = 6) salt-tagged with biotin were stained with CFSE. Were transferred to recipients and their survival monitored by CFSE fluorescence or anti-biotin staining using flow cytometry. FIG. 24C shows wild-type RBCs stained with CFSE (n = 6) and hKell-LPETG (SEQ ID NO: 44) RBCs isolated from implanted mice (see Example 5) and biotin-sortase labeled (SEQ ID NO: 44) (n = 2). ) Were transferred to recipient mice and their survival in the circulation was determined by CFSE fluorescence (wild-type RBC) or anti-biotin staining (hKell-LPETG (SEQ ID NO: 44) -biotin RBC) using flow cytometry. It is a chart showing the result of tracking. FIG. 24D shows that wild-type RBC (n = 6) and sortase-labeled biotin-3G-myc-hGPA RBC (n = 6) were CFSE-stained, transferred to mice, and analyzed for CFSE fluorescence or flow cytometry using flow cytometry. It is a chart which shows the result traced by anti-biotin staining. The internal standard RBCs are cells derived from 3G-myc-hGPA-transplanted mice and subjected to a salt tagging reaction and CFSE staining, but are wild-type. Error bars represent standard deviation; ^* indicates p <0.01. FIG. 25 shows conjugation of single domain antibodies to engineered erythrocytes and cell type-specific targeting. FIG. 25A shows mouse mature erythrocytes engineered to contain 3G-myc-GPA on the cell surface against sortase, mouse MHC class II molecules in the presence or absence of VHH7-LPETG (SEQ ID NO: 44). FIG. 4 shows the results of incubation with a single domain antibody having specificity and a sortase motif complementary to 3G. Immunoblots against myc epitope tag on glycophorin A show fusion of VHH7 to GPA from increasing GPA molecular weight. FIG. 25B shows that either wild-type mouse B cells (MHC class II) or MHC class II knockout mouse-derived B cells were immobilized on magnetic streptavidin beads via biotinylated α-CD19 antibody, and 3G-myc- FIG. 4 shows the results of incubation and washing of GPA erythrocytes or sortase-labeled VHH7-LPETG (SEQ ID NO: 44) -myc GPA with erythrocytes containing on its surface. Immobilization of B cells in all experimental setups was tested by the presence of CD19 on α-CD19 immunoblot, and binding between B cells and red blood cells was assessed by the presence of hemoglobin on α-hemoglobin immunoblot. FIG. 25C is a schematic of the experiment shown in FIG. 25B; LPETG: (SEQ ID NO: 44). FIG. 26 shows the expression and sortase-mediated labeling of glycophorin A on the surface of human reticulocytes differentiated in vitro. FIG. 26A is a diagram showing the results of viral transduction of a peripheral vector CD34 + stem cell mobilized with human granulocyte colony stimulating factor with an empty vector or a vector containing 3G-myc-GPA-GFP and differentiation for 18 days. It is. Flow cytometric analysis of reticulocytes shows the percentage of transduced cells (GFP ⁺ ) and the percentage of enucleated cells (lower panel, Hoechst stain). Control or 3G-myc-GPA-GFP (3G-myc-hGPA-GFP-IRES-GFP) transduced reticulocytes are incubated with sortase and biotin-containing probes and stained for biotin with α-biotin-PE antibody. And analyzed by flow cytometry and gated on enucleated cells. FIG. 26B shows 3G-myc-GPA-GFP transduced, in vitro differentiated reticulocytes incubated with a biotin probe in the presence or absence of sortase, and whole cell proteins immunoblotted for myc tag and biotin. It is a figure showing a result. Both 3G-myc-GPA-GFP monomer and dimer (higher molecular weight) are visible on both immunoblots. A shift in GPA-GFP molecular weight by biotin conjugation in an α-myc tag immunoblot indicates complete modification.

Erythrocytes are the most abundant cell type in blood and account for one quarter of the total cell number in the human body. RBCs possess unique properties that make them attractive tools in therapy and diagnosis for various purposes, for example, for in vivo delivery of natural or synthetic payloads. Yoo et al. , 2011, Nature Reviews. Drug Delivery 10 (7): 521-535. For example, because mature red blood cells do not have a nucleus (ie, are enucleated), there is no risk of delivering the remnants of the foreign gene into the host. Thus, the potential for tumorigenicity (Gruen et al., 2006 Stem cells 24 (10): 2162-1169), a significant risk of stem cell-based therapy, is thereby eliminated. In addition, red blood cells have a long life span in vivo, for example, about 120 days in the human bloodstream, or about 50 days in mice, and are present throughout the macro and micro blood circulation. Thus, the modification of red blood cells, which carry the therapy available to the organism, may extend efficacy in vivo and cover the entire area perfused by the blood circulation. Further, RBC has a large cell surface area of about 140 μm ² , and its specific surface area is also a preferable value. Red blood cells also show good biocompatibility when used as carriers for delivery of therapeutic or diagnostic agents. Eventually, old or damaged RBCs can be removed by cells of the reticuloendothelial system. Thus, any modifications made to the DNA of the RBC precursor are removed upon enucleation and do not result in abnormal growth or tumorigenicity after transfer to the recipient.

  Therefore, it is of great interest to develop methods for generating enucleated erythrocytes that carry an agent of interest, such as a diagnostic or therapeutic agent. Such enucleated erythrocytes can be used, for example, to deliver a drug of interest to a subject.

  The engineered RBCs were encapsulated using encapsulation (Biagiotti et al., 2011, IUBMB life 63 (8): 621-631; Godfrin et al., 2012, Expert Opinion on Biological Therapy 12 (1): 127-1). And Muzykantov, 2010, Expert Opinion on Drug Delivery 7 (4): 403-427), by non-covalent attachment of foreign peptides, or through placement of the protein by fusion to a monoclonal antibody specific for the surface protein of RBC (Murciano). , 2003, Nature Biotechnology 21 (8): 891-896; and Zaitsev et al., 2010, Bl. wood 115 (25): 5241-5248). Modified RBCs face limitations when intended for in vivo applications. Encapsulation allows for the capture of significantly larger amounts of material, but at the expense of plasma membrane integrity while reducing the circulating half-life of the modified red blood cells. Osmotically driven capture limits the chemical nature of the materials that can be successfully encapsulated, makes it difficult to control the release site, and the encapsulated enzyme functions only at the final destination and can be reused at other sites. Usage is lower. Murciano et al. , 2003 and Zaitsev et al. , 2010. Targeting cargo to RBC by fusion to an RBC-specific antibody (eg, an anti-glycophorin antibody) is limited. This is because this method of attachment to RBC is non-covalent and readily dissociates, thereby reducing the circulating half-life and amount of cargo available for delivery. Murciano et al. , 2003 and Zaitsev et al. , 2010. Other developments utilizing RBCs for targeted delivery include nanoparticles and RBC shaped polymers coated on RBC mimetic membranes. Yoo et al. , 2011 Nature Reviews. Drug Discovery 10 (7): 521-535. These carriers suggested by the RBC may have limited therapeutic usefulness due to their short in vivo survival (up to about 7 days).

Another technical difficulty associated with manipulating RBS is the lack of suitable in vitro systems for culturing and differentiating RBCs. The human CD34 ⁺ cell culture system is described in Miharada et al. , Nat. Biotechnol. , 24 (10): 1255-1256, 2006; Sankaran et al. , Science, 322 (5909): 1839-1842, 2008, and Giarratana et al. , Blood, 118 (19): 5071-5079, 2011. However, mature enucleated erythrocytes obtained from these cell culture systems do not show similar hemoglobin content and / or cell size as compared to normal human reticulocytes or erythrocytes, and synchronize cell surface differentiation markers during the culture process. Showed no expression. Also, Sankaran et. The cell culture system taught by Al did not produce terminally differentiated erythroid cells or enucleated erythrocytes.

  In view of the shortcomings associated with existing technologies, there is a need to develop new methodologies for manipulating RBCs to deliver a wide variety of useful cargo to specific sites within the body.

  In this study, modified erythrocytes have been developed that serve as carriers for systemic delivery of a wide variety of payloads. These RBCs contain a modified protein on their plasma membrane, which can be labeled in a sortase-catalyzed reaction under natural conditions without damaging the target membrane or cells. Sortases accommodate a wide range of natural and synthetic payloads that allow modification of RBCs with substituents that cannot be genetically encoded. This study demonstrates the successful site-specific conjugation of biotin to mouse erythroid and mature mouse RBCs differentiated in vitro. Unexpectedly, these modified red blood cells remain in the bloodstream for up to 28 days, well beyond red blood cells engineered by methods known in the art. Single domain antibodies enzymatically linked to the RBC allow the RBC to specifically bind to target cells expressing the antibody target. This study demonstrates the unexpected and efficient sortase-mediated labeling of human reticulocytes expanded to human erythrocytes and differentiated in vitro.

  The manipulation and labeling methods described herein do not damage cells or affect cell survival in vivo. Most importantly, engineered red blood cells can be labeled with a wide variety of functional probes, including small molecules, peptides, and proteins, and thus become carriers of various therapeutic agents into the bloodstream. there is a possibility. Thus, the methods described herein provide advantages over osmotic driven encapsulation methods known in the art.

  Sortase-mediated cell surface labeling has previously been utilized, for example, to explore transport of influenza glycoproteins. Popp et al. , 2012 PLos Pathogens 8 (3): e1002604; and Sanyal et al. , 2013 Cell Host & Microbe 14 (5): 510-521. This methodology has been modified and applied to primary cells as a platform for diagnostic or therapeutic purposes. S. A sortase A mutant from S. aureus (Chen et al., 2011 PNAS 108 (28): 11399-11404) is active at 0 ° C., reducing the risk of cell damage during labeling. ing.

  Although many other applications are possible for the methods presented herein, a wide variety of possible payloads, from proteins and peptides to synthetic compounds and fluorescent probes, can serve as guidance. For example, such a method would allow the targeting of modified erythrocytes to specific cell types. In addition, the methods described herein can be combined with established protocols for small molecule encapsulation (Godfrin et al., 2012). In this scenario, it is possible to use engineered red blood cells loaded with a therapeutic agent in the cytosol and surface-modified with a cell type-specific recognition module to deliver the payload to the correct tissue / site in the body Would. The binding of two different functional probes to the surface of erythrocytes has been demonstrated herein, utilizing the slightly different recognition specificity of two separate sortases. Thus, it should be possible to attach both the therapeutic component and the targeting module to the red blood cell surface and direct this engineered red blood cell to a tumor or other diseased cell. The conjugation of an imaging probe, ie a radioisotope, together with such a targeting component would also allow its use for diagnostic purposes.

  The in vitro generation of human RBCs and the genetic engineering of their precursors described herein, in combination with, for example, cytosolic modification, provide a robust platform for the application of this surface engineering method to clinical applications. (Liu et al., 2010 Blood 115 (10): 2021-2027; Cong et al., 2013 Science 339 (6121): 819-826; Mari et al., Science 339 (6121): 823- 826; Giarratana et al., 2011 Blood 118 (19): 5071-5079; Douay et al., 2009 Blood 105 (1): 85-94; and Griffiths et al., 2012 Blood. d 119 (26): 6296-6306). Furthermore, the established safety of transfusions provides confidence that these engineered red blood cells will actually be used in humans.

Thus, described herein is an in vitro multi-step culture process for generating enucleated red blood cells from recruited CD34 ⁺ progenitor cells (eg, recruited human CD34 ⁺ peripheral blood cells). Such enucleated erythrocytes can be genetically engineered to express a protein of interest, for example, a surface protein capable of salt tagging. Also, a method for conjugating one or more drugs of interest to the surface of genetically engineered enucleated erythrocytes by a sortase-mediated transpeptide reaction, and a target of interest by sorting a modified membrane protein with a target of interest. Also described herein are methods for producing a cytoplasmic located protein of interest in a mature RBC, such as human RBC, while retaining the ability to selectively target RBCs.

I. In vitro culture system for generating enucleated erythrocytes An in vitro culture process for generating mature enucleated erythrocytes from CD34 ⁺ progenitor cells (eg, from a human subject) is described herein. The culturing step includes a plurality of differentiation stages (eg, two, three, or more stages) and optionally an expansion stage prior to the differentiation stage. The total duration of the in vitro culture steps described herein can range from 11 to 25 days (eg, 15 to 25 days, 15 to 20 days, or 18 to 21 days). In one example, the total period is 21 days.

a. CD34 ⁺ progenitor cells CD34 is a cell surface glycoprotein and functions as an intercellular adhesion factor. Many human progenitor cells express this cell surface marker. Noverstern et al. , Cell 144: 296-309, 2011. Progenitor cells, such as stem cells, tend to differentiate into specific cell types. Progenitor cells are usually more specific than stem cells and are often promoted to differentiate into target cells. Any CD34 + progenitor cell type that has a tendency to differentiate into erythrocytes can be used in the in vitro culture steps described herein. Such progenitor cells are well-known in the art. See, eg, Noverstern et al. , Cell 144: 296-309, 2011. In some cases, the in vitro culture steps described herein utilize recruited CD34 + peripheral blood cells as precursor cells for differentiation into enucleated erythrocytes. CD34 + progenitor cells may be derived from other sources (eg, bone marrow).

Various techniques can be used to separate or isolate the CD34 ⁺ cell population from a suitable source, such as peripheral blood cells. For example, antibodies, such as a monoclonal antibody that binds to CD34, can be used to enrich or isolate CD34 ⁺ cells. The ability to bind an anti-CD34 antibody to a solid support allows cells expressing the surface marker to be immobilized and CD34 ⁺ cells to be separated from cells that do not express the surface marker. The separation technique used should maximize retention of recovered live cells. Such a separation technique can result in a cell subpopulation that expresses up to 10% of the selected cells, usually no more than about 5%, and preferably no more than about 1%. The particular technique used will depend on the efficiency of separation, the associated cytotoxicity, ease and speed of implementation, and the need for sophisticated equipment and / or technical skill.

The “isolated” or “purified” CD34 ⁺ cell population used in the in vitro culturing processes described herein may comprise cells and materials that naturally accompany it, in particular, Substantially free of cells that lack the phenotype, eg, expression of CD34. Substantially free or substantially purified comprises at least 50% CD34 ⁺ cells, preferably at least 70%, more preferably at least 80%, even more preferably at least 90% CD34 ⁺ cells.

Techniques for separating a CD34 ⁺ cell population include, but are not limited to, physical separation, magnetic separation, antibody-coated magnetic beads, affinity chromatography, linked to or combined with a monoclonal antibody. Cytotoxic agents, including, but not limited to, complement and cytotoxins, as well as solid phase matrices, such as "panning" with antibodies bound to a plate, elutriation, or any other convenient technique. Is mentioned.

  The use of physical separation techniques also includes physical properties (density gradient centrifugation and countercurrent centrifugation elutriation), cell surface properties (lectin and antibody affinity), and vital staining properties (mitochondrial binding dye rho123 and DNA binding). Pigment Hoechst 33342). These procedures are well known to those skilled in the art.

Techniques for providing accurate separation of CD34 ⁺ cells further include flow cytometry, which provides various degrees of precision, such as multiple color channels, low and obtuse light scatter detection channels, impedance channels, and the like. Can have. CD34 ⁺ cells can also be selected by flow cytometry based on light scattering properties, where target cells are selected based on a low side scatter profile and a low to medium forward scatter profile.

b. Expansion Step In some cases, the in vitro culturing step described herein comprises an expansion step of expanding CD34 ⁺ progenitor cells. As used herein, expansion or proliferation includes any increase in cell number. Expansion includes, for example, increasing the number of CD34 + cells beyond the number of CD34 + cells present in the cell population used to start the culture. Expansion also includes increasing the survival of existing CD34 + cells. The term survival refers to the ability of a cell to maintain life or function.

A population of CD34 ⁺ progenitor cells (eg, recruited CD34 ⁺ peripheral blood cells) can be placed in a container suitable for expanding CD34 + cells. For example, suitable containers for culturing a cell population include flasks, tubes, or plates. In one embodiment, the flask can be a T-flask, such as a 12.5 cm ² or 75 cm ² T-flask. The plate can be a 10 cm plate, a 3.5 cm plate, or a multi-well plate, such as a 12, 24, or 96 well plate. The well may be a flat bottom well, a v bottom well, or a u bottom well. The container can be subjected to any treatment suitable for tissue culture to promote cell adhesion or prevent cell adhesion to the surface of the container. Such containers are commercially available from Falcon, Corning, and Costar. As used herein, "expansion container" is also intended to include any chamber or container for expanding cells, whether independent or incorporated into an expansion device.

The cell density of the CD34 ⁺ cell population to be cultured can be at least about 1 × 10 ² cells to about 1 × 10 ⁷ cells / mL. Preferably, the cell density can be from about 1 × 10 ⁵ to about 1 × 10 ⁶ cells / mL. Cells can be cultured at about 2-20% oxygen concentration.

Using a variety of media to expand the population of CD34 ⁺ progenitor cells, including but not limited to Dulbecco's MEM, IMDM, X-Vivo 15 (serum depleted), and RPMI-1640 Can be. Such a medium can be serum-free. In one embodiment, the medium is serum-free StemSpan (Stem Cell Technologies), to which 10 μg / ml heparin can be added.

  The medium used for the expansion step can contain one or more cytokines. As used herein, cytokines are factors that promote various effects on cells, such as growth or proliferation. Non-limiting examples of cytokines that can be used in one or more stages of the in vitro culture process (eg, any of the expansion stages or the differentiation stages described below) include interleukin 2 (IL-2), Interleukin 3 (IL-3), interleukin 6 (IL-6) containing soluble IL-6 receptor, interleukin 12 (IL12), G-CSF, granulocyte macrophage colony stimulating factor (GM-CSF), interleukin 3 Leukin 1 alpha (IL-1α), interleukin 11 (IL-11), MIP-1α, leukemia inhibitory factor (LIF), c-kit ligand, and flt3 ligand. In some cases, the in vitro culturing steps described herein, or any stage thereof, may include culturing conditions in which one or more cytokines are specifically excluded from the medium. Cytokines are commercially available from several vendors such as, for example, Amgen (Thousand Oaks, Calif.) And R & D Systems and Immunex (Seattle, Wash.). Cytokines also include fibroblast growth factor (FGF) (eg, FGF-1 or FGF-2), insulin-like growth factor (eg, IGF-2 or IGF-1), thrombopoietin (TPO), and stem cells. Factors (SCF), or analogs and equivalents thereof, may be included. Their equivalents include molecules that have the same biological activity as these factors (eg, FGF, TPO, IGF, and SCF) in wild-type or purified form (eg, recombinantly produced). Analogs include fragments and related molecules that retain the desired activity. For example, TPO is a ligand for the mp1 receptor, so that molecules that can bind to the mp1 receptor and elicit one or more biological effects associated with TPO binding to mp1 are also within the scope of the invention. It is. One example of a TPO mimetic is Cwirl et. al. (1997) Science 276: 1696.

In one example, the expansion step of the in vitro culture process described herein can be performed as follows. The recruited population of human CD34 ⁺ peripheral blood cells is placed in an expansion vessel at a cell density of 10 × 10 ⁴ to 10 × 10 ⁶ (eg, 1 × 10 ⁵ ) cells / mL. CD34 ⁺ cells were grown in expansion medium (eg, StemSpan serum-free medium) supplemented with a cytokine mixture of Flt-3 ligand, SCF, IL-3, and IL-6, and 2% penicillin and streptomycin, under appropriate conditions. (For example, 37 ° C) for 1 to 6 days (for example, 2 to 5 days, 3 to 4 days, or 4 days). The expanded CD34 + cells can be collected and subjected to further in vitro culture under conditions that allow differentiation into mature enucleated erythrocytes.

C. Multiple Differentiation Stages The in vitro culture process described herein includes multiple differentiation stages (2, 3, 4, or more) in which CD34 + progenitor cells differentiate into mature enucleated erythrocytes. At each differentiation stage, CD34 + progenitor cells (either obtained from the expansion stage or collected from the original source) or cells from the previous differentiation stage are transformed under appropriate conditions for an appropriate period of time, The cells can be cultured in a medium containing the species or appropriate cytokines (eg, those described herein). To assess the state of erythropoiesis, during or at the end of each differentiation stage, the biological properties of the cells, such as cell size and expression of surface markers, can be monitored. Whenever necessary, cytokines can be supplied or removed at each differentiation stage in a timely manner to achieve optimal erythroid differentiation and / or synchronization of the cell population in culture.

  At each of the differentiation stages, CD34 + progenitor cells obtained from the expansion stage described herein or isolated from the original source (eg, human peripheral blood) or cells obtained from a previous differentiation stage are The cells can be cultured in a suitable medium, such as those described herein, under suitable culture conditions and for a suitable period of time, supplemented with one or more suitable cytokines. In one example, an appropriate concentration of holo-type human transferrin and insulin is added to a medium (eg, IMDM). For example, the concentration of holo-type human transferrin ranges from 250 to 1,500 μg / ml (eg, 250 to 1,000 μg / ml; 300 to 800 μg / ml, or 400 to 600 μg / ml); , 5 to 20 μg / ml (eg, 5 to 15 μg / ml, 5 to 10 μg / ml, or 10 to 20 μg / ml). The medium may also contain other components commonly used in cell culture, such as fetal calf serum, glutamine, bovine serum albumin, one or more antibiotics (eg, penicillin and streptomycin), or any combination thereof. Can be added.

  In some embodiments, the in vitro culture process described herein comprises three differentiation stages, differentiation stage I (“differentiation I”), differentiation stage II (“differentiation II”), and differentiation stage III (“differentiation II”). Differentiation III ").

  In differentiation I, cells are treated with glucocorticoids (eg, dexamethasone), β-estradiol, IL-3, SCF, and EPO (human EPO, EPO from other species, or epoetin alfa, epoetin beta, or darbepoetin alfa). Culturing in the presence of an appropriate concentration of a mixture of cytokines (including EPO analogs) for an appropriate period of time (eg, 4-7 days, 4-6 days, 5-7 days, or 5-6 days) Can be. In some examples, the concentration of dexamethasone can range from 100 nM to 5 μM (eg, 100 nM to 2 μM, 500 nM to 5 μM, 1 μM to 3 μM, 1 μM to 2 μM, or 2 μM to 5 μM). The concentration of β-estradiol is 0.5-5 μM (for example, 0.5-4 μM, 1-5 μM, 0.5-3 μM, 0.5-2 μM, 0.5-1 μM, 1-2 μM, 1-3 μM). , Or 3-5 μM). The concentration of IL-3 ranges from 1 to 10 ng / ml (eg, 1 to 8 ng / ml, 1 to 5 ng / ml, 3 to 6 ng / ml, 4 to 8 ng / ml, or 5 to 10 ng / ml). be able to. The concentration of SCF is 10 to 500 ng / ml (for example, 10 to 300 ng / ml, 50 to 500 ng / ml, 50 to 200 ng / ml, 50 to 100 ng / ml, 100 to 200 ng / ml, or 100 to 400 ng / ml). In the range. Alternatively or additionally, the amount of EPO can range from 2 to 10 U (eg, 2 to 8 U, 2 to 6 U, 5 to 10 U, or 6 to 10 U). As is well known in the art, one EPO unit elicits the same red blood cell stimulatory response as 5 micromolar cobalt chloride in rodents (historically fasted rats). See, for example, Jelkmann, Nephrol Dial. See Transplant, 2009. In some cases, the media used in Differentiation I contains holo-type human transferrin, insulin, dexamethasone, β-estradiol, IL-3, SCF, and EPO. The medium may be substantially free of certain other cytokines, such as Flt-3 ligand or IL-6, or may be substantially free of other cytokines.

  In differentiation II, cells obtained from differentiation I are subjected to a suitable period of time (eg, 3-5 days, 3-4 days, or 4-5 days) in the presence of a mixture of cytokines at appropriate concentrations, including SCF and EPO. Days). In some examples, the concentration of SCF is between 10 and 100 ng / ml (e.g., between 10 and 80 ng / ml, between 20 and 80 ng / ml, between 20 and 50 ng / ml, between 30 and 50 ng / ml, between 40 and 50 ng / ml, and between 50 and 50 ng / ml. ８０80 ng / ml, or 50-60 ng / ml). Alternatively or additionally, the amount of EPO can range from 2 to 10 U (eg, 2 to 8 U, 2 to 6 U, 5 to 10 U, or 6 to 10 U). In some cases, the media used in Differentiation II contains holo-type human transferrin, insulin, SCF, and EPO. The medium is substantially free of certain cytokines, such as Flt-3, IL-6, dexamethasone, β-estradiol, IL-3, or any combination thereof, or substantially free of other cytokines. There may not be.

  In differentiation III, the cells obtained from differentiation II are cultured in the presence of an appropriate concentration of EPO for an appropriate period (eg, 4-12 days, 5-10 days, 8-12 days, or 8-10 days). can do. In some examples, the amount of EPO can range from 0.5-3U (e.g., 1-3U, 0.5-2U, 1-2U, or 2-3U). In some cases, the medium used in differentiation III contains holo-type human transferrin, insulin, and EPO. The medium is substantially free of certain cytokines, such as Flt-3, IL-6, dexamethasone, β-estradiol, IL-3, SCF, or any combination thereof, or substantially free of other cytokines. May not be included.

  In some embodiments, the in vitro culturing step described herein comprises one or any combination of the stages of differentiation described herein, eg, differentiation I and differentiation III, differentiation II and differentiation III, or Differentiation I and differentiation II can be included.

Prior to the differentiation stage, the CD34 ⁺ progenitor cells can be genetically modified to express a surface protein of interest, eg, a salt-taggable surface protein, which is described in detail below.

II. Preparation of Erythrocytes Expressing a Surface Protein of Interest Expressing a surface protein of interest, such as a salt-taggable surface protein, a fluorescent protein such as green fluorescent protein (GFP), or a proteinaceous drug (eg, an antibody or antigen-binding fragment thereof) Also described herein are methods of preparing genetically engineered red blood cells that can be used.

(A) Genetic modification of progenitor cells An expression vector for producing a surface protein of interest can be introduced into CD34 ⁺ progenitor cells, which can be isolated from their original source, or It can also be obtained from the above expansion steps by routine recombinant techniques. In some instances, the expression vector can be designed to allow integration into the cell genome by homologous or heterologous recombination by methods known in the art. Methods for introducing an expression vector into a CD34 ⁺ progenitor cell include, but are not limited to, virus-mediated gene transfer, liposome-mediated transfer, transformation, transfection, and transduction, eg, adenovirus, Virus-mediated gene transfer such as the use of vectors based on adeno-associated virus, and DNA viruses such as herpes virus and retrovirus-based vectors. Examples of gene transfer methods include, for example, naked DNA, CaPO ₄ precipitation, DEAE dextran, electroporation, protoplast fusion, lipofection, cell microinjection, and viral vectors, adjuvant-assisted DNA, gene guns, and catheters. In one example, a viral vector is used. To enhance delivery of the non-viral vector to the cell, the nucleic acid or protein can be conjugated to a cell surface antigen, eg, an antibody or binding fragment thereof that binds CD34. Liposomes further comprising a targeting antibody or fragment thereof can be used in the methods described herein.

  A “viral vector” as described herein refers to a recombinantly produced virus or virus particle that contains a polynucleotide that is delivered to a host cell in vivo, ex vivo, or in vitro. Examples of viral vectors include lentivirus vectors, adenovirus vectors, retrovirus vectors such as adeno-associated virus vectors, and the like. In embodiments in which gene transfer is mediated by a retroviral vector, vector construct refers to a polynucleotide comprising the retroviral genome or a portion thereof and a therapeutic gene.

The gene encoding the surface protein of interest can be inserted into a suitable vector (eg, a retroviral vector) using methods well known in the art. Sambrook et al. ^{, Molecular Cloning, A Laboratory Mannual,} 3 rd Ed. , Cold Spring Harbor Laboratory Press. For example, the gene and vector can be contacted with a restriction enzyme under appropriate conditions to form complementary ends on each molecule that can pair with each other and be ligated together with a ligase. Alternatively, a synthetic nucleic acid linker can be linked to the end of the gene. These synthetic linkers contain a nucleic acid sequence corresponding to a particular restriction site in the vector. In addition, the vector may, for example, contain some or all of the following: a selectable marker gene, for example, for selecting stable or transient transfectants in mammalian cells. Neomycin gene; enhancer / promoter sequence from the immediate early gene of human CMV for high level transcription; transcription termination and RNA processing signals from SV40 for stability of mRNA; SV40 polyoma origin of replication and appropriate ColE1 for episomal replication; a versatile multiple cloning site; and T7 and SP6 RNA promoters for in vitro transcription of sense and antisense RNA. Vectors and methods suitable for producing vectors containing a transgene are well known and available in the art. Sambrook et al. ^{, Molecular Cloning, A Laboratory Mannual,} 3 rd Ed. , Cold Spring Harbor Laboratory Press.

Modification of CD34 ⁺ progenitor cells can include the use of an expression cassette made for constitutive or inducible expression of the introduced gene. Such an expression cassette can include regulatory elements such as a promoter, start codon, stop codon, and a polyadenylation signal. These elements are preferably operable on the progenitor cells or cells derived from the progenitor cells (eg, enucleated erythrocytes) after administration (eg, infusion) to the individual. In addition, these elements can be operably linked to a gene encoding a surface protein of interest, whereby the gene is operative (eg, expressed) in progenitor cells or erythrocytes derived therefrom.

  Various promoters can be used for expression of the surface protein of interest. Promoters that can be used to express the protein are well known in the art. Examples of the promoter include cytomegalovirus (CMV) early promoter, Rous sarcoma virus LTR, HIV-LTR, virus LTR such as HTLV-1 LTR, simian virus 40 (SV40) early promoter, and E. coli lac UV5 promoter. , And the herpes simplex tk virus promoter.

  A regulatable promoter can also be used. Such regulatable promoters include those which use a lac repressor from E. coli as a transcription modulator for regulating transcription from a mammalian cell promoter carrying a lac operator [Brown, M .; et al. , Cell, 49: 603-612 (1987)], using a tetracycline repressor (tetR) [Gossen, M .; , And Bujard, H .; Proc. Natl. Acad. Sci. ScL USA 89: 5547-5551 (1992); et al. , Human Gene Therapy, 9: 1939-1950 (1998); Shockelt, P .; , Et al. Proc. Natl. Acad. Sci. USA, 92: 6522-6526 (1995)]. Other systems include FK506 dimer, VP16 or p65 using astradiol, RU486, diphenol murislerone, or rapamycin. Inducible systems are available from Invitrogen, Clontech, and Ariad.

  A regulatable promoter that includes a repressor with the operon can be used. In one embodiment, a lac repressor from E. coli can function as a transcription modulator to regulate transcription from a mammalian cell promoter carrying a lac operator [M. Brown et al. , Cell, 49: 603-612 (1987)]; Gossen and Bujard (1992); Gossen et al. Natl. Acad. Sci. USA, 89: 5547-5551 (1992)] combines a tetracycline repressor (tetR) with a transcriptional activator (VP16) to create a tetR-mammalian cell transcriptional activator fusion protein, tTa (tetR-VP16); In combination with a minimal promoter carrying tetO, derived from the human cytomegalovirus (hCMV) major immediate-early promoter, a tetR-tet operator system for controlling gene expression in mammalian cells was created. In one embodiment, a tetracycline inducible switch is used. When the tetracycline operator is properly positioned downstream of the TATA element of the CMVIE promoter, the tetracycline repressor alone (tetR), rather than the tetR-mammalian cell transcription factor fusion derivative, functions as a potent transmodulator in mammalian cells, Can regulate gene expression [F. Yao et al. , Human Gene Therapy, supra]. One particular advantage of this tetracycline-inducible switch is the use of a tetracycline repressor-mammalian cell transactivator or repressor fusion protein, which can be potentially toxic to cells, to achieve its regulatable effect. Is not required [M. Gossen et al. Natl. Acad. Sci. USA, 89: 5547-5551 (1992); Shockett et al. Proc. Natl. Acad. Sci. ScL USA, 92: 6522-6526 (1995)].

The effectiveness of some inducible promoters may increase over time. In such cases, the effectiveness of such a system can be enhanced by inserting multiple repressors in tandem, eg, linking TetR to TetR by an internal ribosome entry site (IRES). . Alternatively, one may wait at least three days before screening for the desired function. Some silencing may occur, but this may be due to a suitable cell number, preferably at least 1 × 10 ⁴ , more preferably at least 1 × 10 ⁵ , even more preferably at least 1 × 10 ⁶ , even more preferably It can be minimized by using 1 × 10 ⁷ . The expression of the desired protein can be enhanced by known means of enhancing the effectiveness of the system. For example, the Woodchuck hepatitis virus post-transcriptional regulatory element (WPRE) is used. Loeb, V .; E. FIG. , Et al. , Human Gene Therapy 10: 2295-2305 (1999); Zufferey, R .; , Et al. , J. et al. of Virol. 73: 2886-2892 (1999); Donello, J .; E. FIG. , Et al. , J. et al. of Virol. 72: 5085-5092 (1998).

  Examples of polyadenylation signals useful for performing the methods described herein include, but are not limited to, human collagen I polyadenylation signal, human collagen II polyadenylation signal, and SV40 polyadenylation signal. Signal.

  Exogenous genetic material, including surface protein-encoding genes operably linked to regulatory elements, can continue to exist in cells as functional cytoplasmic molecules, functional episomal molecules, or become integrated into the chromosomal DNA of the cell. Is also good. Exogenous genetic material may be introduced into the cell and remain as separate genetic material in the form of a plasmid. Alternatively, linear DNA that can be integrated into a chromosome can be introduced into cells. When introducing DNA into cells, a reagent that promotes DNA integration into chromosomes may be added. DNA sequences useful for facilitating integration can also be included in the DNA molecule. Alternatively, RNA can be introduced into cells.

  Selectable markers can be used to monitor the incorporation of the desired transgene into the progenitor cells described herein. These marker genes can be under the control of any promoter or inducible promoter. These are known in the art and include genes that alter the sensitivity of cells to stimuli such as nutrients, antibiotics, and the like. Genes include those for neo, puro, tk, multidrug resistance (MDR), and the like. Other genes express readily screenable proteins such as green fluorescent protein (GFP), blue fluorescent protein (BFP), luciferase, and LacZ.

(B) Genetic modification to express a salt-taggable surface protein In some embodiments, the CD34 ⁺ progenitor cells include a fusion protein comprising an erythrocyte membrane protein and a peptide (eg, a peptide heterologous to the membrane protein). Gene modification can be performed using any of the methods described herein or known in the art to enable expression of a surface protein capable of being sorted. The sortable surface protein can be conjugated to another peptide by a sortase-mediated transpeptidation reaction. Strijbis et al. , Traffic 13 (6): 780-789, 2012. Preferably, transduction of CD34 ⁺ progenitor cells with a gene encoding a salt-taggable surface protein is via a viral vector such as a retroviral vector (eg, WO 94/29438, WO 97/97). / 21824, and WO 97/21825).

  The sortable surface protein can be a fusion protein comprising a membrane protein and at least one heterologous protein. In some embodiments, the membrane proteins used in the methods described herein, which may be present on mature RBCs, inhibit erythroid differentiation, as well as a broad spectrum that occurs at the enucleation and late reticulocyte stages. It is not targeted for degradation during membrane remodeling. Such membrane proteins are known in the art. See, for example, Liu et al. , 2010, Blood, 115 (10): 2021-2027. For example, erythroid precursors express high levels of transferrin receptor (Tfr), a type II membrane protein, but since Tfr is no longer present on mature RBCs, it is suitable for use in preparing salt-taggable surface proteins. Can not be a great target. Any membrane protein present in mature RBCs can be used to construct the salt-taggable surface proteins described herein. Membrane proteins can be fused to heterologous peptides at the ends exposed in the extracellular or luminal space. In some cases, the end of the membrane protein that is exposed in the cytoplasm can also be fused to a second heterologous protein of interest, which can be a cytoplasmic protein.

  When the N-terminus of a membrane protein is exposed to the extracellular or luminal space (eg, type I membrane protein), the heterologous protein is an acceptor peptide that can be conjugated to another peptide by a sortase-catalyzed transpeptidation reaction May be included. Typically, the acceptor peptide is an oligoglycine or oligoalanine, such as a 1-5 glycine fragment or a 1-5 alanine fragment. In some cases, the oligoglycine consists of three or five glycine (SEQ ID NO: 3) residues. In another example, the oligoalanine consists of 3 or 5 alanine residues (SEQ ID NO: 79).

  In one example, the salt-taggable surface protein is a peptide comprising glycophorin A, intercellular adhesion molecule 4 (ICAM-4), Lutheran glycoprotein (CD329), baicidin (CD147), and an acceptor peptide (eg, A fusion protein containing a type I erythrocyte transmembrane protein such as a peptide containing an oligoglycine component such as a 1-5 glycine fragment. These membrane proteins can be human proteins. The acceptor peptide is fused to the N-terminus of the type I transmembrane protein. Type I transmembrane proteins are single transmembrane proteins with an N-terminus exposed to the extracellular or luminal space.

  In another example, the sortable surface protein is a type II erythrocyte transmembrane protein, such as a fusion protein comprising Kell or CD71 and a peptide comprising a sequence recognizable by sortase (eg, sortase A). Type II transmembrane proteins are single transmembrane proteins with a C-terminus exposed to the extracellular or luminal space.

  Motif recognizable by sortase is well known in the art. One exemplary motif recognizable by sortase, particularly sortase A, is LPXTG (SEQ ID NO: 1), where X is any amino acid residue (natural or unnatural), for example, in a protein found in an organism. It can be any of the 20 most commonly found standard amino acids. In some examples, the recognition motif is LPXTG (SEQ ID NO: 1) or LPXT (SEQ ID NO: 50), where X is D, E, A, N, Q, K, or R. In another example, X in the LPXTG (SEQ ID NO: 1) or LPXT (SEQ ID NO: 50) motif recognizable by sortase A is selected from K, E, N, Q, A. In yet another example, X in the LPXTG (SEQ ID NO: 1) or LPXT (SEQ ID NO: 50) motif recognizable by a class C sortase is selected from K, S, E, L, A, N. Exemplary sortase recognition motifs include, but are not limited to, LPKTG (SEQ ID NO: 51), LPITG (SEQ ID NO: 52), LPDTA (SEQ ID NO: 53), SPKTG (SEQ ID NO: 54), LAETG (SEQ ID NO: 54) No. 55), LAATG (SEQ ID NO: 56), LAHTG (SEQ ID NO: 57), LASTG (SEQ ID NO: 58), LPLTG (SEQ ID NO: 59), LSRTG (SEQ ID NO: 60), LPETG (SEQ ID NO: 44), VPDTG (SEQ ID NO: 61), IPQTG (SEQ ID NO: 62), YPRRG (SEQ ID NO: 63), LPMTG (SEQ ID NO: 64), LAFTG (SEQ ID NO: 65), LPQTS (SEQ ID NO: 66), LPXT (SEQ ID NO: 50), LAXT (SEQ ID NO: 67) ), LPXA (SEQ ID NO: 68), LGXT (SEQ ID NO: 69), IPXT (SEQ ID NO: 69) No. 70), NPXT (SEQ ID NO: 71), NPQS (SEQ ID NO: 72), LPST (SEQ ID NO: 73), NSKT (SEQ ID NO: 74), NPQT (SEQ ID NO: 75), NAKT (SEQ ID NO: 76), LPIT (SEQ ID NO: 77), or LAET (SEQ ID NO: 78).

  The salt-taggable surface proteins described herein may also be fusion proteins comprising a type III erythrocyte transmembrane protein and a heterologous peptide. Type III membrane proteins are multi-passaged and usually have an N-terminus exposed to the extracellular or luminal space. Examples of the type III erythrocyte transmembrane protein include GLUT1, aquaporin 1, and band 3. In one example, a type III transmembrane protein can be fused to an acceptor peptide at the N-terminus of the transmembrane protein.

  In some embodiments, a sortase recognition sequence as described above can further include one or more amino acids, for example, at the N-terminus or C-terminus. For example, one or more amino acids (eg, within 5 amino acids) that are identical to amino acids immediately found N- or C-terminal to the 5-amino acid recognition sequence in a natural sortase substrate can be incorporated. Such additional amino acids may provide a situation that improves recognition of the recognition motif.

  In some embodiments, the sortase recognition motif may be masked. In contrast to unmasked sortase recognition motifs, which can be recognized by sortase, masked sortase recognition motifs are not recognized by sortase, but can be easily modified (unmasked) and the resulting The motif becomes a motif recognized by sortase. For example, in some embodiments, at least one amino acid of the masked sortase recognition motif comprises a side chain that includes a component that inhibits, eg, prevents, sequence recognition by a sortase of interest, eg, SrtA aureus. Thus, removal of the inhibitory component enables the recognition of the motif by sortase. In certain embodiments, masking reduces recognition, for example, by at least 80%, 90%, 95%, or more (eg, to an undetectable level). By way of example, in certain embodiments, a threonine residue in a sortase recognition motif such as LPXTG (SEQ ID NO: 1) is phosphorylated, rendering the motif resistant to recognition and cleavage by SrtA. The masked recognition sequence can be unmasked by treatment with phosphatase, which allows it to be used in SrtA-catalyzed transamidation reactions.

  Where necessary, the genetically modified membrane protein of the CD34 + progenitor cell may comprise additional suitable, including, but not limited to, amino acids, nucleic acids, polynucleotides, sugars, carbohydrates, polymers, lipids, fatty acids, and small molecules. Additional tags. Other suitable tags will be apparent to those skilled in the art, and the invention is not limited in this regard.

  In some embodiments, such tags include sequences useful for purifying, expressing, solubilizing, and / or detecting the polypeptide. In some embodiments, a tag can serve more than one function. In some embodiments, the tags are relatively small, for example, ranging from a few amino acids to about 100 amino acids in length. In some embodiments, the tag is greater than about 100 amino acids in length, for example, up to about 500 amino acids in length or more. In some embodiments, the tag comprises an HA, TAP, Myc, 6xHis, Flag, streptavidin, biotin, or GST tag, to name a few. In some embodiments, the tag comprises a solubility-enhancing tag (eg, a SUMO tag, a NUSA tag, a SNUT tag, or a monomeric mutant of the Ocr protein of bacteriophage T7). For example, Esposite D and Chatterjee DK. Curr Opin Biotechnol. 17 (4): 353-8 (2006). In some embodiments, the tag is cleavable, such as by a protease, and can therefore be removed. In some embodiments, this is achieved by including a protease cleavage site in the tag, eg, adjacent to or linked to a functional portion of the tag. Exemplary proteases include, for example, thrombin, TEV protease, Factor Xa, PreScission protease, and the like. In some embodiments, a "self-disconnect" tag is used. See, for example, Wood et al. See International PCT Application No. PCT / US2005 / 05763, filed on February 24, 2005 and published as WO 2005/086654 on September 22, 2005.

  In some embodiments, the genetically modified erythrocyte comprises a erythrocyte membrane protein described herein, a first heterologous peptide fused to a membrane protein end exposed in the extracellular or luminal space, and a cytoplasmic space. A fusion protein comprising a second heterologous protein fused to the exposed membrane protein end can be expressed on the surface. The first heterologous peptide, when fused to the N-terminus of a membrane protein (eg, a type I membrane protein), can include a sortase acceptor peptide (any of the acceptor peptides described herein). Alternatively, when the first heterologous peptide is fused to the C-terminus of a membrane protein (eg, a type II membrane protein), a sequence recognizable by a sortase (eg, LPXTG (SEQ ID NO: 1) or LPXT (SEQ ID NO: 50)) ) Can be included.

  If the membrane protein is a type I (eg, GPA) or type III membrane protein, the second heterologous protein is fused to the C-terminus of the membrane protein. An expression cassette for generating such a fusion protein can contain two copies of a sequence encoding a second heterologous protein, one fused in frame to the membrane protein while the other is between two copies. Is located 3 ′ downstream from the IRES site. This design would allow for the production of a second heterologous protein in free form and in fusion with the membrane protein. For example, see the following example. Alternatively, if the membrane protein is a type II membrane protein (eg, Kell), the second heterologous protein is fused to the N-terminus of the membrane protein. An expression cassette for generating such a fusion protein can contain two copies of a sequence encoding a second heterologous protein, which produces the second heterologous protein in both free and fused forms. As such, they are separated by IRES sites.

  The second heterologous protein may be a cytoplasmic protein. In some cases, the heterologous protein is a diagnostic protein, eg, a protein such as a fluorescent protein (eg, GFP) that can emit a detectable signal under appropriate conditions. In another example, the heterologous protein is a therapeutic protein, eg, a proteinaceous drug.

  If necessary, the targeting agent can be conjugated to the first heterologous peptide by a sortase reaction. Such targeting agents (eg, antibodies such as single domain antibodies) can specifically bind to a particular cell type (eg, a disease cell such as a cancer cell). The resulting genetically modified erythrocytes are useful for delivering a target protein (a second heterologous protein) located in the cytoplasm to target cells recognizable by a target agent.

Alternatively or additionally, the present disclosure provides genetically engineered erythrocytes that express two sort-taggable surface proteins that can be conjugated to different functional components by catalysis by sortase enzymes with different substrate specificities. provide. See the discussion below. In one example, the two sortagable surface proteins both include a type I membrane protein (eg, GPA). In one Sorutagingu possible surface proteins, N-terminal of type I membrane proteins, oligo glycine (e.g., G ₃ or G _{5 (SEQ} ID NO: 3)) fused to; in other Sorutagingu possible surface proteins, type I membrane N-terminus of the protein, oligo alanine (e.g., _{a 3} or _{a 5} (SEQ ID NO: 79)) fused to. In another example, both sortable surface proteins include a type II membrane protein (eg, Kell or CD71). In one sortable surface protein, the C-terminus of the type II membrane protein is fused to the motif LPXTG (SEQ ID NO: 1); SEQ ID NO: 2). In yet another example, one of the sortable surface proteins comprises a type I membrane protein (eg, GPA), the N-terminus of which is fused to an acceptor peptide, and the other sortable surface protein is a type II membrane protein. It contains a protein (eg, Kell or CD71) whose C-terminus is fused to a sequence recognizable by sortase. If the acceptor peptide is oligoglycine (e.g., _{G 3} or _{G 5} (SEQ ID NO: 3)), recognizable sequence by sortase may be a motif LPXTA (SEQ ID NO: 2). If the acceptor peptide is oligo alanine (e.g., _{A 3} or _{A 5} (SEQ ID NO: 79)), recognizable sequence by sortase may be a motif LPXTG (SEQ ID NO: 1).

Any of the genetically modified CD34 ⁺ progenitor cells described herein can be cultured under suitable conditions that allow them to differentiate into mature enucleated erythrocytes, for example, in the in vitro culture process described herein. The resulting enucleated erythrocytes can express a surface protein of interest, such as the salt-taggable surface proteins described herein, which are assessed by routine methodology (eg, western blotting or FACS analysis). And can be confirmed.

III. Conjugation of drugs to cell-expressed salt-taggable surface proteins by salt-tagging Any genetically modified cells that express a salt-taggable surface protein (eg, CD34 + progenitor cells or mature enucleated erythrocytes) are modified in the presence of sortase Thus, the desired drug can be conjugated to the cell surface. This is a process known as salt tagging. As used herein, the term “sort tagging” refers to the use of a tag, eg, a component or molecule (eg, a protein, polypeptide, detectable) by a sortase-mediated transpeptidation reaction to a target molecule, eg, a target protein on the surface of erythrocytes. (A label, binding agent, or click chemistry handle).

(A) Sortase Sortase is a family of enzymes that can perform a transpeptidation reaction that conjugates the C-terminus of a protein to the N-terminus of another protein via transamidation. Sortases, also called transamidases, typically exhibit both protease and transpeptidation activity. Various sortases from prokaryotes have been identified. For example, some sortases from Gram-positive bacteria cleave proteins and translocate them to the proteoglycan component of the intact cell wall. Among the sortases isolated from Staphylococcus aureus are sortase A (Srt A) and sortase B (Srt B). Thus, in certain embodiments, the transamidase used according to the conjugation methods described herein is, for example, S. aureus. A sortase A, derived from S. _aureus , also referred to herein as SrtA _aureus . In other embodiments, the transamidase is, for example, S. aureus. Sortase B, derived from S. _aureus and also referred to herein as SrtB _aureus .

  Sortases were identified as A, B, C, and D (ie, sortase A, sortase B, sortase C, and sortase D, respectively) based on sequence alignment and phylogenetic analysis of 61 sortases from the Gram-positive bacterial genome. (Dramsi et al., Res Microbiol. 156 (3): 289-97, 2005; the entire contents of this document are incorporated herein by reference). Sortases are further divided into subfamilies by Comfort and Clubb, which correspond to the following subfamilies (Comfort et al., Infect Immun., 72 (5): 2710-22, 2004). The entire contents of this document are incorporated herein by reference): Class A (subfamily 1), class B (subfamily 2), class C (subfamily 3), class D (subfamily 4 and 5) ). The aforementioned references disclose a number of sortases and their recognition motifs. Pallen et al. , TRENDS in Microbiology, 2001, 9 (3), 97-101; the entire contents of this document are incorporated herein by reference). Those skilled in the art will be familiar with Drami, et al. Sortases can be readily assigned to the correct class based on the sequence and / or other properties of the sortase, such as those described above.

  The term "sortase A" is used herein to refer to class A sortase and is usually SrtA of any particular bacterial species, e.g. It is named SrtA from S. aureus. Similarly, "Sortase B" is used herein to refer to Class B sortase and is usually SrtB of any particular bacterial species, e.g. It is named SrtB from S. aureus. The present disclosure encompasses embodiments related to any of the sortase classes known in the art (eg, sortase A from any bacterial species or strain, sortase B from any bacterial species or strain, Class C sortase from any bacterial species or strain, and Class D sortase from any bacterial species or strain).

  The amino acid sequences of SrtA and SrtB, and the nucleotide sequences encoding them, are known to those of skill in the art and are disclosed in several references cited herein, the entire contents of which are incorporated herein by reference. ing. S. The amino acid sequences of S. aureus SrtA and SrtB are homologous, for example, sharing 22% sequence identity and 37% sequence similarity. The amino acid sequence of the sortase-transamidase from Staphylococcus aureus also has substantial homology to the sequences of enzymes from other Gram-positive bacteria, and such transamidases are described herein. Can be used in the consolidation process. For example, in the case of SrtA, The best alignment across the sequencing region of the S. pyogenes translation region has about 31% sequence identity (and about 44% sequence similarity). A. The best alignment over the entire sequencing region of the S. naeslundii translation region has about 28% sequence identity. It will be appreciated that different bacterial strains may show differences in the sequence of a particular polypeptide, and the sequences herein are exemplary.

  In certain embodiments, the S. cerevisiae encoding S. S. pyogenes, A. S. naeslundii; S. mutans, E.M. E. faecalis, or B. faecalis. Transamidases having 18% or more sequence identity, 20% or more sequence identity, or 30% or more sequence identity with the translation region of B. subtilis can be screened; Enzymes having transamidase activity comparable to SrtA or SrtB from S. aureas can be utilized (eg, comparable activity is in some cases 10% or more of SrtA or SrtB activity).

  In some embodiments, the conjugation methods described herein use sortase A (SrtA). SrtA recognizes the motif LPXTX (SEQ ID NO: 80; each occurrence of X independently represents any amino acid residue), and common recognition motifs include, for example, LPKTG (SEQ ID NO: 81), LPTAG (SEQ ID NO: 82) ), LPNTG (SEQ ID NO: 83). In some embodiments, LPETG (SEQ ID NO: 44) is used as a sortase recognition motif. However, motifs that deviate from this consensus may be recognized. For example, in some embodiments, the motif comprises "A" instead of "T" at position 4, for example, LPXAG (SEQ ID NO: 84), for example, LPNAG (SEQ ID NO: 85). In some embodiments, the motif comprises an "A" instead of a "G" at position 5, for example, LPXTA (SEQ ID NO: 2), such as LPNTA (SEQ ID NO: 86). In some embodiments, the motif comprises a "G" instead of a "P" at position 2, for example, LGXTG (SEQ ID NO: 87), for example, LGATG (SEQ ID NO: 88). In some embodiments, the motif comprises an "I" instead of an "L" at position 1, for example, IPXTG (SEQ ID NO: 89), for example, IPETG (SEQ ID NO: 91). Further suitable sortase recognition motifs will be apparent to those skilled in the art, and the invention is not limited in this regard. It will be appreciated that the terms "recognition motif" and "recognition sequence" with respect to sequences recognized by transamidase or sortase are used interchangeably. Such sortase recognition motifs can be used to construct the sortable surface proteins described herein.

  In some embodiments of the invention, the sortase is a sortase B (SrtB), S. aureus, B.A. B. anthracis, or L. anthracis. Monocytogenes (L. monocytogenes) sortase B. The motif recognized by the class B sortase (SrtB) often falls within the consensus sequence NPXTX (SEQ ID NO: 92), for example, an NP such as NPQTN (SEQ ID NO: 94) or NPKTG (SEQ ID NO: 95). [Q / K]-[T / s]-[N / G / s] (SEQ ID NO: 93). For example, Aureus or B. aureus. B. anthracis sortase B cleaves the NPQTN (SEQ ID NO: 94) or NPKTG (SEQ ID NO: 95) motif of the respective bacterial IsdC (eg, Maraffini et al., Journal of Bacteriology, 189 (17)). : 6425-6436, 2007). Other recognition motifs found on putative substrates of class B sortases are NSKTA (SEQ ID NO: 96), NPQTG (SEQ ID NO: 97), NAKTN (SEQ ID NO: 98), and NPQSS (SEQ ID NO: 99). For example, L. SrtB from L. monocytogenes has specific motifs lacking P at position 2 and / or lacking Q or K at position 3, such as NAKTN (SEQ ID NO: 98) and NPQSS (SEQ ID NO: 99). Recognition (Mariscotti et al., J Biol Chem. 2009 Jan 7). Such sortase recognition motifs can also be used to construct the sortable surface proteins described herein.

  Combining N-terminal and C-terminal labeling strategies using sortases with different substrate specificities (Antos et al., 2009, J. Am. Chem. Soc., 131 (31): 10800-10801), it is possible to generate multi-labeled RBCs. For example, unlike sortase A derived from Staphylococcus aureus, sortase A derived from Streptococcus pyogenes recognizes the LPXTA (SEQ ID NO: 2) motif and uses an oligoalanine probe as a nucleophile. Accept. Therefore, the sortase reaction of both enzymes can be performed as an orthogonal reaction. The use of such sortase reactions by suitable sortases is also within the scope of the present disclosure.

  In some embodiments, the sortase is sortase C (SrtC). Sortase C can utilize LPXTX (SEQ ID NO: 80) as a recognition motif, and each occurrence of X independently represents any amino acid residue. This recognition motif can be used to construct the salt-taggable surface proteins described herein.

  In yet other embodiments, the sortase is sortase D (SrtD). This class of sortases is predicted to recognize a motif having the consensus sequence NA- [E / A / S / H] -TG (SEQ ID NO: 100; Comfort D, supra). Sortase D can be, for example, Streptomyces sp., Corynebacterium sp., Tropheryma whipplei, Thermobifida humb. Has been issued. LPXTA (SEQ ID NO: 2) or LAXTG, for example, can function as a recognition sequence for subfamily 4 and 5 class D sortases, respectively, and subfamily-4 and subfamily-5 enzymes each have the motif LPXTA (SEQ ID NO: 2) and LAXTG (SEQ ID NO: 101) are processed. For example, B. Sortase C from B. anthracis is B. anthracis. It has been shown to specifically cleave the LPNTA (SEQ ID NO: 102) motif in B. anthracis BasI and BasH (Marrafini, supra).

  Additional sortases, including but not limited to those that recognize additional sortase recognition motifs, are also suitable for use in some embodiments of the present invention. See, for example, Chen et al. , Proc Natl Acad Sci USA. 2011 Jul 12; 108 (28): 11399; and Barnett et al., Which is incorporated herein by reference in its entirety. , Journal of Bacteriology, Vol. 184, no. 8, p. 2181-2191, 2002, a sortase that recognizes the QVPTGV (SEQ ID NO: 103) motif).

  The use of sortases found in any Gram-positive bacteria, such as those described herein and / or in the references (including databases) cited herein, may be relevant in some embodiments of the present invention. Is contemplated. Gram-negative bacteria, such as Colwellia psychrerythraea, Microbulbifer degradans, Bradyrhizobium japonikumen (Bradyrhizobium enwas neywas, and Bradyrhizobium japonica e) (Shewanella putrefaciens) is also contemplated for use of the sortase found. Such sortases recognize sequence motifs that exceed the LPXTX (SEQ ID NO: 80) consensus, such as LP [Q / K] T [A / S] T (SEQ ID NO: 104). Using the sequence motif LPXT [A / S] (SEQ ID NO: 105), eg, LPXTA (SEQ ID NO: 2) or LPSTS (SEQ ID NO: 106), consistent with the mutation allowed at position 3 in the sortase from Gram-positive bacteria can do.

(B) Drug for Conjugation to Cell Surface Drugs that can be conjugated to the cell surface by salt tagging (directly or indirectly) include, but are not limited to, proteins, amino acids, peptides, Any, including chemicals such as polynucleotides, carbohydrates, detectable labels, binding agents, tags, metal atoms, imaging agents, catalysts, non-polypeptide polymers, synthetic polymers, recognition elements, lipids, linkers, or small molecules. It can be a molecule, entity, or component. In some embodiments, the agent is a binding agent, eg, a ligand or a ligand binding molecule such as streptavidin / biotin and an antibody or antibody fragment.

  When the agent is a polypeptide, it can be conjugated directly to a cell that expresses a salt-taggable surface protein in the presence of sortase. The terms "protein," "peptide," and "polypeptide" are used interchangeably herein and refer to a polymer of amino acid residues interconnected by peptide (amide) bonds. The term refers to a protein, peptide, or polypeptide of any size, structure, or function. Typically, a protein, peptide, or polypeptide is at least 3 amino acids in length. A protein, peptide, or polypeptide may refer to an individual protein or a collection of proteins. One or more amino acids in a protein, peptide, or polypeptide can be, for example, a carbohydrate, hydroxyl, phosphate, farnesyl, isoform, for conjugation, functionalization, or other modification, and the like. It may be modified by adding a chemical entity such as a farnesyl group, a fatty acid group, or a linker. A protein, peptide, or polypeptide can also be a single molecule or a multimolecular complex. A protein, peptide, or polypeptide may simply be a fragment of a native protein or peptide. A protein, peptide, or polypeptide may be natural, recombinant, or synthetic, or any combination thereof.

  The protein conjugated to the cell surface by the conjugation methods described herein can be any protein having a desired biological activity, for example, diagnostic or therapeutic. In some examples, the protein is a proteinaceous drug (eg, an antibody or fragment thereof), a peptide capable of targeting a particular cell type (eg, a disease cell such as a cancer cell), or a desired immune response (eg, , B cell response or T cell response). Such a protein may also be a protein-based binding agent (eg, streptavidin).

  Without limiting the present disclosure in any way, this section discusses specific target proteins. In general, any protein or polypeptide can be modified to carry a click chemistry handle and / or be conjugated to another molecule by click chemistry according to the methods provided herein. In some embodiments, the target protein is at least 80% or at least 90%, eg, at least 95%, 86%, 97%, 98%, 99%, 99.5, relative to the native protein or polypeptide. % Or 100% identical or consisting of polypeptides. In some embodiments, the target protein has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 amino acid differences from the native sequence. In some embodiments, the native protein is a mammalian protein, eg, of human origin.

  As used herein, the term “antibody” refers to a protein belonging to the immunoglobulin superfamily. The terms antibody and immunoglobulin are used interchangeably. With few exceptions, mammalian antibodies typically consist of a basic structural unit having two large heavy chains and two small light chains. There are several different types of antibody heavy chains, and several different types of antibodies that fall into different isotypes based on the heavy chains they carry. Five different antibody isotypes are known in mammals, IgG, IgA, IgE, IgD, and IgM, which play different roles and help elicit an appropriate immune response against each of the different types of foreign bodies encountered. . In some embodiments, the antibody is an IgG antibody, for example, an antibody of the IgG1, 2, 3, or 4 human subclass. Antibodies from mammalian species (eg, human, mouse, rat, goat, pig, horse, cow, camel) are within the scope of this term and are derived from species other than mammals (eg, birds, reptiles, Antibodies (derived from amphibians), for example, IgY antibodies, are also within the term.

  Only a portion of the antibodies are involved in binding the antigen, and antigen-binding antibody fragments, their preparation and use are well known to those skilled in the art. As is well known in the art, only a small part of the antibody molecule, the paratope, is involved in the binding of the antibody to the epitope (generally, Clark, WR (1986) The Experimental Fundamentals of Modern Immunology Wiley & Sons). Roitt, I. (1991) Essential Immunology, 7th Ed., Blackwell Scientific Publications, Oxford), Inc., Inc., New York; Suitable antibodies and antibody fragments used in connection with some embodiments of the present invention include, for example, human antibodies, humanized antibodies, domain antibodies, F (ab '), F (ab') 2, Fab , Fv, Fc, and Fd fragments, antibodies in which the Fc and / or FR and / or CDR1 and / or CDR2 and / or light chain CDR3 regions have been replaced by homologous human or non-human sequences; FR and / or CDR1 and An antibody in which the CDR2 and / or light chain antibody CDR3 regions have been replaced by homologous human or non-human sequences; human and non-human in which the FR and / or CDR1 and / or CDR2 and / or light chain antibody CDR3 regions are homologous An antibody that has been replaced with a sequence; and FR and / or CDR1 and / or Others include antibodies CDR2 regions have been replaced with homologous human or nonhuman sequences. In some embodiments, so-called single chain antibodies (eg, ScFv), (single) domain antibodies, and other intracellular antibodies can be used in connection with the present invention. The term antibody also includes domain antibodies (single domain antibodies), camel antibodies and camelized antibodies, and fragments thereof, for example, VHH domains or Nanobodies, such as those described in the patents and patent applications of Ablynx NV and Domantis. Is done. Single domain antibodies can consist of a single monomeric variable antibody domain and can specifically bind to an antigen. In addition, chimeric antibodies, eg, antibodies that contain two antigen binding domains that bind different antigens, are also suitable for use in connection with some embodiments of the present invention.

  As used herein, the term "antigen-binding antibody fragment" refers to a fragment of an antibody that contains a paratope or a fragment of an antibody that binds to the antigen to which the antibody binds with similar specificity and affinity as an intact antibody. Antibodies, eg, fully human monoclonal antibodies, can be identified using phage display (or other display methods, such as yeast display, ribosome display, bacterial display). Display libraries, eg, phage display libraries, are available (and / or can be generated by one of skill in the art) and are screened, eg, using panning, to identify antibodies that bind to the antigen of interest. be able to. See, for example, Sidhu, S .; (. Ed)... Phage Display in Biotechnology and Drug Discovery (Drug Discovery Series; CRC Press; 1st ed, 2005; Aitken, R (ed) Antibody Phage Display: Methods and Protocols (Methods in Molecular Biology) Humana Press; 2nd ed., 2009.

  Exemplary antibodies include, but are not limited to, abciximab (glycoprotein IIb / IIIa; cardiovascular disease), adalimumab (TNF-α, various autoimmune diseases such as rheumatoid arthritis), alemtuzumab ( CD52; chronic lymphocytic leukemia), basiliximab (IL-2Rα receptor (CD25); transplant rejection), bevacizumab (vascular endothelial growth factor A; various cancers such as colorectal cancer, non-small cell lung cancer, and glia Blastoma, kidney cancer; wet age-related macular degeneration), katumaxomab, cetuximab (EGF receptor, various cancers such as colorectal cancer, head and neck cancer), certolizumab (for example, certolizumab pegol) (TNFalpha) ; Crohn's disease, rheumatoid arthritis), daclizumab (IL-2Rα receptor (CD25); transplant rejection), eculizuma (Complement protein C5; paroxysmal nocturnal hemoglobinuria), efalizumab (CD11a; psoriasis), gemtuzumab (CD33; acute myeloid leukemia (for example, in combination with calicheamicin)), ibritumomab tiuxetan (CD20; non-Hodgkin's lymphoma) For example, in combination with yttrium 90 or indium 111)), infliximab (TNFalpha; various autoimmune diseases such as rheumatoid arthritis), muromonab-CD3 (T cell CD3 receptor; transplant rejection), natalizumab (alpha-4) (Α4) integrin; multiple sclerosis, Crohn's disease), omalizumab (IgE; allergy-related asthma), palivizumab (RSV F protein epitope; respiratory inclusion virus infection), panitumumab (EGF receptor; cancer, eg, Colorectal cancer), LA Bizumab (vascular endothelial growth factor A; wet age-related macular degeneration), rituximab (CD20; non-Hodgkin's lymphoma), tositumomab (CD20; non-Hodgkin's lymphoma), trastuzumab (ErbB2; breast cancer), and any antigen-binding fragment thereof Is mentioned.

  As used herein, the term "binding agent" refers to any molecule that binds another molecule with high affinity. In some embodiments, the binding agent binds with high specificity to its binding partner. Examples of binding agents include, but are not limited to, antibodies, antibody fragments, receptors, ligands, aptamers, and Adnectins.

  In some embodiments, the protein of interest conjugated to red blood cells is a cytokine, eg, a type I cytokine. In some embodiments of particular interest, the target protein is a four helix bundle protein, for example, a four helix bundle cytokine. Exemplary 4-helix bundle cytokines include, for example, certain interferons (eg, type I interferons, such as IFN-α), interleukins (eg, IL-2, IL-3, IL-4, IL-5, IL-). 6, IL-7, IL-12), and colony stimulating factors (eg, G-CSF, GM-CSF, M-CSF). The IFN can be, for example, interferon alpha-2a or interferon alpha-2b. For example, Mott HR and Campbell ID. "Four-helix bundle growth factors and the air receptors: protein-protein interactions." Curr Opin Struct Biol. 1995 Feb; 5 (1): 114-21; Chaiken IM, Williams WV. "Identifying structure-function relations in four-helix bundle bundles: towards de novo mimetics design." Trends Biotechnol. 1996 Oct; 14 (10): 369-75; Klaus W, et al. , "The three-dimensional high resolution structure of human interferon alpha-2a determined by heteronuclear NMR spectroscopy in resolution." For a further discussion on the specifics of these cytokines, see J.M. Mol Biol. , 274 (4): 661-75, 1997.

  The target protein may also be a cytokine protein having a structure similar to one or more of the aforementioned cytokines. For example, the cytokine can be an IL-6 class cytokine such as leukemia inhibitory factor (LIF) or oncostatin M. In some embodiments, the cytokine is a cytokine that naturally binds to a receptor comprising the GP130 signaling subunit. Other Objective 4 helix bundle proteins include growth hormone (GH), prolactin (PRL), and placental lactogen. In some embodiments, the target protein is an erythropoiesis stimulating agent, such as (EPO), which is also a four helix bundle cytokine. In some embodiments, the erythropoiesis stimulating agent is an EPO variant, eg, darbepoetin alfa, also known as a novel erythropoiesis stimulating protein (NESP), which has been engineered to contain five N-linked carbohydrate chains. Yes (three or more recombinant HuEPO). In some embodiments, the protein comprises 5 helices. For example, the protein can be interferon beta, eg, interferon beta 1a, interferon beta 1b, which is often classified (as will be recognized) as a four helix bundle cytokine. In some embodiments, the target protein is IL-9, IL-10, IL-11, IL-13, or IL-15. For a discussion of specific cytokines, see, for example, Hunter, CA, Nature Reviews Immunology 5,521-531,2005. Paul, WE (ed.), Fundamental Immunology, Lippincott Williams &Wilkins; 6th ed. , 2008. Any of the proteins described in the references cited herein, all of which are incorporated herein by reference, can be used as target proteins.

  In addition, the protein of interest is approved by the US Food & Drug Administration (or equivalent regulatory authority such as the European Medicines Evaluation Agency) for use in treating human diseases or disorders. The protein may be Such proteins may or may not be proteins for which the PEGylated version has been determined in clinical trials and / or are commercially approved.

  The protein of interest may also be a neurotrophic factor, ie, a neural lineage cell (as used herein, neural progenitor cells, neural cells, and glial cells such as astrocytes, oligodendrocytes, microglia). And / or factors that promote the survival, development, and / or function of an animal. For example, in some embodiments, the target protein is a factor that promotes neurite outgrowth. In some embodiments, the protein is ciliary neurotrophic factor (CNTF; 4-helix bundle protein) or an analog thereof, such as oxokine, wherein the oxokine has a C-terminal 15 amino acid truncation and two amino acid substitutions. A modified version of human ciliary neurotrophic factor that is 3-5 fold more potent than CNTF in in vitro and in vivo assays and has improved stability.

  In another example, the protein of interest is a protein that forms a homodimer or heterodimer (or a homo- or hetero-oligomer containing three or more subunits, eg, a tetramer). In certain embodiments, the structure of the homodimer, heterodimer, or oligomer is such that the end of the first subunit is close to the end of the second subunit. For example, the N-terminus of the first subunit is close to the C-terminus of the second subunit. In certain embodiments, the structure of the homodimer, heterodimer, or oligomer is such that the ends of the first subunit and the ends of the second subunit do not participate in interaction with the receptor. Structure, so that the ends can be linked via non-genetically encoded peptide elements without significantly affecting biological activity. In some embodiments, the termini of the two subunits of a homodimer, heterodimer, or oligomer are conjugated by click chemistry using the methods described herein, whereby: A dimer (or oligomer) is formed in which at least two subunits are covalently linked. For example, neurotrophin nerve growth factor (NGF); brain-derived neurotrophic factor (BDNF); neurotrophin 3 (NT3); and neurotrophin 4 (NT4) share about 50% sequence identity; Dimeric molecules that exist in a dimeric form. See, for example, Robinson RC, et al. , “Structure of the brain-derived neurotrophic factor / neurotropin 3 heterodimer.”, Biochemistry. 34 (13): 4139-46, 1995; Robinson RC, et al. , "The structures of the neurotrophin 4 homodimer and the brain-derived neurotrophic factor / neurotropin 4 heterodimer remembroid.com. 8 (12): 2589-97, 1999, and references therein. In some embodiments, the dimeric protein is a cytokine, eg, an interleukin.

  Alternatively, the protein of interest is an enzyme, for example, an enzyme that is important in metabolism or other physiological processes. As is known in the art, deficiency of enzymes or other proteins can lead to various diseases. Such diseases include those associated with defects such as carbohydrate metabolism, amino acid metabolism, organic acid metabolism, porphyrin metabolism, purine or pyrimidine metabolism, lysosomal storage disease, blood coagulation and the like. Examples include Fabry disease, Gaucher disease, Pompe disease, adenosine deaminase deficiency, asparaginase deficiency, porphyria, hemophilia, and hereditary angioedema. In some embodiments, the protein is a clotting or coagulation factor (eg, factor VII, factor VIIa, factor VIII, or factor IX). In other embodiments, the protein is an enzyme that plays a role in carbohydrate metabolism, amino acid metabolism, organic acid metabolism, porphyrin metabolism, purine or pyrimidine metabolism, and / or lysosomal accumulation, and external administration of the enzyme may cause disease. Relax at least partially.

  Further, the protein of interest may be a receptor or a receptor fragment (eg, an extracellular domain). In some embodiments, the receptor is a TNFα receptor. In certain embodiments, the target protein comprises urate oxidase.

  In some embodiments, the protein of interest is an antigenic protein that can be derived from a pathogen (eg, a virus or a bacterium). An antigenic protein can, in various embodiments, be natural or synthetic. Antigenic proteins include those that can be naturally produced by a pathogen, infected cell, or neoplastic cell (eg, a cancer cell) and / or are genetically encoded by them. In some cases, the antigenic protein is an autoantigen ("self antigen") and has the ability to elicit or enhance an autoimmune response. In other examples, the antigenic protein is produced or genetically encoded by a virus, bacterium, fungus, or, in some embodiments, a pathogenic parasite. In some embodiments, the pathogen (eg, virus, bacterium, fungus, parasite) is infected, and in some embodiments, at least one species of mammal or bird, eg, human, non-human primate, bovine Causes disease in sheep, horse, goat, and / or pig species. In some embodiments, the pathogen is intracellular, at least for part of its life cycle. In some embodiments, the pathogen is extracellular. Antigens from a particular source may, in various embodiments, be isolated from that source, e.g., for the purpose of using the antigen, e.g., to identify, generate, test, or use an antibody against the antigen. It will be appreciated that they can be isolated or produced using any suitable means (eg, recombinant, synthetic, etc.). An antigen can be modified, for example, by conjugation to another molecule or entity (eg, an adjuvant), chemical or physical denaturation, and the like. In some embodiments, the antigen is an envelope protein, capsid protein, secretory protein, structural protein, cell wall protein or polysaccharide, capsule protein or polysaccharide, or an enzyme. In some embodiments, the antigen is a toxin, eg, a bacterial toxin.

  Exemplary viruses include, for example, Retroviridae (eg, a human immunodeficiency virus, eg, a lentivirus such as HIV-I); Caliciviridae (eg, a strain that causes gastroenteritis); Viridae (eg, equine encephalitis virus, rubella virus); Flaviridae (eg, dengue virus, encephalitis virus, yellow fever virus, hepatitis C virus); Coronaviridae (eg, Coronaviridae) Coronavirus); Rhabdoviridae (eg vesicular stomatitis virus, rabies virus); Filoviridae (eg Ebola virus) Paramyxoviridae (e.g., parainfluenza virus, mumps virus, measles virus, respiratory syncytial virus); Orthomyxoviridae (e.g., influenza virus); Bunyaviridae (e.g., Bunyaviridae) Hantatan virus, Bungavirus, Phlebovirus, and Nirovirus); Arena viridae (hemorrhagic fever virus); Reoviridae (eg, reovirus, orbivirus, and rotavirus); Naviridae (Birnaviridae); Hepadnaviridae (Hepatitis B virus); Parbow Parvoviridae (Parvovirus); Papovaviridae (Papillomavirus, Polyomavirus); Adenoviridae (Adenoviridae); Herpesviridae (Herpesviridae) (Herpes simplex virus (HSVpox2 and HSVpox2) Shingles virus, cytomegalovirus (CMV), EBV, KSV); Poxviridae (poxvirus, vaccinia virus, poxvirus); and Picornaviridae (eg, poliovirus, hepatitis A) Viruses; enteroviruses, human coxsackieviruses, rhinoviruses, and echoviruses).

  Exemplary bacteria include, for example, Helicobacter pylori, Borrelia burgdorferi, Legionella pneumophilia, Mycobacterium (M. tuberculosis, M. ulc. M. avium, M. intracellulare, M. kansasii, M. gordonae, Staphylococcus aureus, Naphius Gonolea (Neisseria gonorrhoeae), Neisseria meningitidis (Neiss) eria meningitidis, Listeria monocytogenes, Streptococcus pyogenes (Group A Streptococcus), Streptococcus agalactiae (Streptococcus group), Streptococcus staphylococci Streptococcus faecalis, Streptococcus bovis, Streptococcus (anaerobic), Streptococcus pneumoniae, Campylobacter sp. (E. sp.), Campylobacter sp. Species (Chlamydia), Haemophilus influenzae, Bacillus anthracis, Corynebacterium diphtheriae, Eryperiosipericus, Eryziperipirus pieris Clostridium perfringens, Clostridium tetani, Enterobacter aerogenes, Klebsiella pneumoniae, Pastes La multocida (Pasturella multocida), Bacteroides (Bacteroides) species, Fusobacterium nucleatum (Fusobacterium nucleatum), Streptomyces Bacillus-Morinifuorumisu (Streptobacillus moniliformis), Treponema pallidum (Treponema pallidum), Treponema Perunyu (Treponema pertenue), Leptospira (Leptospira ), Actinomyces israelii, and Francisella tularensis.

  Exemplary fungi include, for example, Aspergillus, such as Aspergillus flavus, Aspergillus fumigatus, Aspergillus niger, Aspergillus niger, Aspergillus niger, Aspergillus niger Blasttomyces dermatitidis, Candida, for example, Candida albicans, Candida glabrata, Candida ilida gandida gandida gandida gandida gidaida, and Candida glaida. Candida krusei, Candida parapsilosis, Candida tropicalis, Coccidioides, e.g., Coccidoides ciscoidoids, for example, Coccidioides cismids -Neoformans (Cryptococcus neoformans), Epidermophyton (Epidermophyton), Fusarium (Fusarium), Histoplasma (Histoplasma), for example, Histoplasma capsulatum, Malassezia, for example, Malassezia furfur, Microsporum, Mucor, Paracoccidioides idesibrides, for example, Paracoccidiensis radiscoides radish ), Penicillium, for example, Penicillium marneffei, Pichia, for example, Pichia anomala, Pichia guisulumiis, Pichia guisulumiis, ), For example, Pneumocystis carinii, Pseudolescheria, for example, Pseudolescheria boidii, Rhizopus, Rhizopus, Rhizopus, Rhizopus, Rhizopus, Rhizopus, Rhizopus, Rhizopus, etc. Rhodotorula, for example, Rhodotorula rubra, Shedosporium, for example, Shedosporium aphiosum, for example, Schosporium aphisperm, Schizo, sophyllum, Schisophyllum, Sphysophyllum, Schisophyllum lum commune, Sporothrix, for example, Sporothrix schenckii, Trichophyton, for example, Trichophyton menthatrophy, Trichophyton menthatrophy, Trichophyton menthatrophy rubrum, Trichophyton verrucosum, Trichophyton violaceum, Trichosporon, for example, Trichosporon Asahi, Trichosporon richosporon cutaneum), Trichosporon jock itch (Trichosporon inkin), and Trichosporon Mukoidesu (Trichosporon mucoides) and the like.

  In some embodiments, the antigen is a tumor antigen (TA). Generally, a tumor antigen is any antigenicity produced by a tumor cell (eg, a tumorigenic cell, or, in some embodiments, a tumor stromal cell, eg, a tumor-associated fibroblast, etc.). It can be a substance. In many embodiments, a tumor antigen is a molecule (or a portion thereof) that is differentially expressed by tumor cells as compared to non-tumor cells. Tumor antigens include, for example, proteins that are normally produced in very small amounts but are expressed in large amounts by tumor cells, usually proteins that are only produced at specific developmental stages, and whose structure (eg, , Sequences or post-translational modifications), or (under normal conditions) normal proteins that are sequestered from the immune system. Tumor antigens are used, for example, in the identification or detection of tumor cells (eg, for diagnostic purposes and / or for monitoring subjects who have been treated for a tumor, eg, to test for recurrence), and / or Alternatively, it may be useful for targeting various agents (eg, therapeutic agents) to tumor cells. For example, in some embodiments, a chimeric antibody is provided that comprises an antibody of an antibody fragment that binds to a tumor antigen and is conjugated to a therapeutic agent, eg, a cytotoxic agent, by click chemistry. In some embodiments, the TA is a mutated gene, eg, an expression product of an oncogene or a mutated tumor suppressor gene, an overexpressed or aberrantly expressed cellular protein, a cancer virus (eg, HBV; HCV; EBV, KSV, etc.). Herpesvirus family members; papilloma virus, etc.), or oncofetal antigens. Oncofetal antigens are usually produced early in embryonic development and are largely or completely eliminated by the time the immune system is fully developed. Examples are alpha-fetoprotein (AFP, for example found in germ cell and hepatocellular carcinomas) and carcinoembryonic antigen (CEA, for example found in intestinal and sometimes lung or breast cancers). Tyrosinase is an example of a protein that is normally produced in very small amounts, but whose production is greatly increased in certain tumor cells (eg, melanoma cells). Other exemplary TAs include, for example, CA125 (eg, found in ovarian cancer); MUC-1 (eg, found in breast cancer); epithelial tumor antigen (eg, found in breast cancer); melanoma-associated antigen (MAGE; For example, malignant melanoma); prostate acid phosphatase (PAP, found in prostate cancer). In some embodiments, the TA is at least partially exposed to the cell surface of a tumor cell. In some embodiments, the tumor antigen comprises an abnormally modified polypeptide or lipid, eg, an abnormally modified cell surface glycolipid, glycoprotein. It will be appreciated that TA may be expressed by certain types of tumor subsets and / or cell subsets in the tumor.

Table 1 below lists exemplary proteins of interest and their amino acid sequences.

  Any of the proteins of interest described herein can be modified, including (i) one or more nucleophilic residues (eg, between 1-10 residues) such as glycine at the N-terminus and Some may include a cleavage recognition sequence, for example, a protease cleavage recognition sequence that masks nucleophilic residues; or (ii) a C-terminal or near C-terminal sortase recognition motif. In some embodiments, the target protein comprises both (i) and (ii). Such modified proteins can be used in the protein conjugation methods described herein.

  One skilled in the art will appreciate that certain proteins, eg, secreted eukaryotic (eg, mammalian) proteins, are often required for intracellular processing (eg, cleavage of secretory signals prior to secretion and / or biological activity). And removal of other portions that do not) produce a mature form. Such a mature biologically active version of the target protein is used in certain embodiments of the present disclosure.

  Other proteins of interest include, for example, U.S. Patent Application Nos. 10 / 773,530; 11 / 531,531; U.S. Patent Application Nos. 11 / 707,014; 11/429. 276, No. 11 / 365,008. All of these patent applications are incorporated herein by reference. The invention encompasses applying the methods of the invention to any of the proteins described herein and to any of the proteins known to those of skill in the art.

  If the agent is not a protein, such an agent can be conjugated to a protein backbone and linked to a surface-taggable protein in the presence of a sortase. Non-proteinaceous agents include, but are not limited to, lipids, carbohydrates, small molecules such as click chemistry handles or chemotherapeutic agents, detectable labels (eg, imaging agents), or chemotherapeutic agents. be able to. Additional agents suitable for use in embodiments of the present disclosure will be apparent to those of skill in the art.

  In some cases, the non-proteinaceous agent is antigenic such that it can elicit an immune response. Such antigenic agents can include, for example, polysaccharides, carbohydrates, lipids, nucleic acids, or combinations thereof, even if they are derived from a pathogen, such as those described herein. Good.

  The term "conjugated" or "conjugate" refers to two molecules, such as two proteins or proteins, linked by direct or indirect covalent or non-covalent interactions. And a drug, for example, a small molecule. In certain embodiments, the linkage is covalent and the entities are said to be "conjugated" to each other. In some embodiments, the protein is formed by forming a covalent bond between the protein and another molecule after the protein is formed, and in some embodiments, after the protein is isolated. Post-translationally conjugated to another molecule, eg, a second protein, small molecule, detectable label, click chemistry handle, binding agent. In some embodiments, two molecules are conjugated via a linker connecting both molecules. For example, in some embodiments where two proteins are conjugated to each other to form a protein fusion, the two proteins are linked by a polypeptide linker, eg, the C-terminus of one protein to the N-terminus of the other protein. Can be conjugated through the amino acid sequence. In some embodiments, two proteins are conjugated at each C-terminus to produce a CC conjugated chimeric protein. In some embodiments, two proteins are conjugated at each N-terminus to produce an NN-conjugated chimeric protein. In some embodiments, conjugation of the protein to the peptide is achieved by transpeptidation using sortase. For example, for exemplary sortases, proteins, recognition motifs, reagents, and methods for sortase-mediated transpeptidation, Ploeg et al, February 1, 2010, the entire contents of each of which are incorporated herein by reference. International PCT Patent Application No. PCT / US2010 / 000274, filed on Aug. 5, 2010 and published as WO 2010/087994, and Ploeh et al, filed on Apr. 20, 2011 See International Patent Application No. PCT / US2011 / 033303, published October 27, 2011 as WO 2011/133704 pamphlet.

  Click chemistry is described in K.K. of The Scripts Research Institute. A chemical principle introduced by Barry Sharpless, which describes the chemistry suitable for the purpose of quickly and reliably forming covalent bonds by interconnecting small units containing reactive groups (H.C. See Kolb, MG Finn and KB Sharpless (2001). Click chemistry refers to concepts that include, but are not limited to, reactions that mimic reactions found in nature, including but not limited to specific reactions. In some embodiments, the click chemistry reaction is modular, provides a wide range, provides high chemical yields, produces harmless by-products, is stereospecific, and provides a reaction with a single reaction product. It exhibits a large thermodynamic driving force of over 84 kJ / mol to facilitate and / or can be performed under physiological conditions. In some embodiments, the click chemistry reaction exhibits high atom economy, can be performed under simple reaction conditions, uses readily available starting materials and reagents, and does not use toxic solvents. Or use a solvent (preferably water) that is harmless or easy to remove and / or provides simple product isolation by non-chromatographic methods (crystallization or distillation).

The click chemistry handle can be a reactant or a reactive group capable of participating in a click chemistry reaction. For example, a strained alkyne, such as cyclooctyne, is a click chemistry handle because it can participate in strain-promoting cycloadditions. Generally, a click chemistry reaction requires at least two molecules, including click chemistry handles, that can react with each other. Such click chemistry handle pairs that interact with each other are sometimes referred to herein as partner click chemistry handles. For example, azide is a partner click chemistry handle for cyclooctyne or any other alkyne. Exemplary click chemistry handles suitable for use according to some aspects of the present invention are described herein, for example, in Tables A and B. Other suitable click chemistry handles are known to those skilled in the art. In the case of two molecules conjugated by click chemistry, for example, in that one reactive component of the click chemistry handle reacts with a reactive component of the other click chemistry handle to form a covalent bond. The click chemistry handles of the molecule must react with each other. Such reaction pairs of click chemistry handles are well known to those of skill in the art and include, but are not limited to, those described in Table 2:

  Table 2 provides examples of click chemistry handles and reactions. R, R1, and R2 can represent any molecule containing a sortase recognition motif. In some embodiments, each occurrence of R, R1 and R2 is independently RR-LPXT (SEQ ID NO: 50)-[X] y- or-[X] y-LPXT (SEQ ID NO: 50) -RR Wherein each occurrence of X independently represents any amino acid residue, and each occurrence of y is an integer between 0 and 10, including 0 and 10, and each occurrence of RR is Independently represents a protein or agent (eg, a protein, peptide, detectable label, binding agent, small molecule, etc.) and optionally a linker.

In some embodiments, a click chemistry handle that can react in the absence of a metal catalyst to form a covalent bond is used. Such click chemistry handles are well known to those skilled in the art, and include Becer, Hoogenboom, and Schubert, Click Chemistry beyond Metal-Catalyzed Cyclodition, Angewand Chemistry, Inc. . See Table 3 below.

  A detectable label is a moiety that has at least one element, isotope, or functional group incorporated into the moiety that allows for detection of the molecule that binds the label, for example, a protein or peptide or other entity. The label can be directly attached (ie, through the bond) or a linker (eg, a linker can be constructed, optionally substituted alkylene; optionally substituted alkenylene; optionally substituted alkynylene An optionally substituted heteroalkylene; an optionally substituted heteroalkenylene, an optionally substituted heteroalkynylene, an optionally substituted arylene, an optionally substituted heteroarylene, or a substituted Acetylene, or any combination thereof). It will be appreciated that the label can be attached or incorporated into the molecule, eg, a protein, polypeptide, or other entity, at any location. In general, detectable labels can be classified into any one (or more) of the following five classes: a) labels containing isotope components, which may be radioactive isotopes but not heavy. It may be an isotope and is not limited to the following, but 2H, 3H, 13C, 14C, 15N, 18F, 31P, 32P, 35S, 67Ga, 76Br, 99mTc (Tc-99m), 111In, 123I , 125I, 131I, 153Gd, 169Yb, and 186Re; b) a label containing an immune component, which may be an antibody or an antigen, and which binds to an enzyme (eg, horseradish peroxidase, etc.). C) a coloring, luminescent, phosphorescent, or fluorescent component (eg, a fluorescently labeled fluorescein isothiocyanate). D) a label having one or more photoaffinity components; and e) a ligand for one or more known binding partners (eg, biotin streptavidin, FK506-FKBP). Signs. In certain embodiments, the label comprises a radioisotope, preferably one that emits a detectable particle, such as a β-particle. In certain embodiments, the label comprises a fluorescent moiety. In certain embodiments, the label is a fluorescently labeled fluorescein isothiocyanate (FITC). In certain embodiments, the label comprises a ligand component having one or more known binding partners. In certain embodiments, the label comprises biotin. In some embodiments, the label is a fluorescent polypeptide (eg, GFP or a derivative thereof, such as modified GFP (EGFP)) or a luciferase (eg, firefly, Renilla, or Gaussia luciferase). In certain embodiments, it will be appreciated that the label may react with a suitable substrate (eg, luciferin) to produce a detectable signal. Non-limiting examples of fluorescent proteins include proteins containing fluorophores that emit different colors of light, such as GFP and its derivatives, red, yellow, and cyan fluorescent proteins. Exemplary fluorescent proteins include, for example, Sirius, Azurite, EBFP2, TagBFP, mTurquoise, ECFP, Cerulean, TagCFP, mTFP1, mUkG1, mAG1, AcGFP1, TagGFP2, EGFP, mWASApi, EmGFPA, EGFPY, EGFPY, EGFPY, EGFPY, EGFPYP, EmGFPY, EGFPYP Venus, Citrin, mKO, mKO2, mOrange, mOrange2, TagRFP, TagRFP-T, mStrawberry, mRuby, mCherry, mRaspberry, mRaspry, mKate2, mPem, mNepAmp, mNepAmp, mNepAmp, mNepAmp, mNepAmp, mNepAmp, mNepAmp, mNepAmp, mNepAmp, mNemTampe, mNemTampe, mNemTampe, mNeptom, mNemAmPeun For example, for a discussion of GFP and many other fluorescent or luminescent proteins, see Chalfie, M .; and Kain, SR (eds.) Green fluorescent protein: properties, applications, and protocols Methods of biochemical analysis, v. 47 Wiley-Interscience, Hoboken, N .; J. , 2006; and Chudakov, DM, et al. Physiol Rev. 90 (3): 1103-63, 2010. In some embodiments, the label comprises a dark quencher, eg, a substance that absorbs excitation energy from the fluorophore and dissipates this energy as heat.

  “Small molecule” refers to a molecule having a relatively low molecular weight, whether naturally occurring or artificially created (eg, by chemical synthesis). Typically, a small molecule is an organic compound (ie, it contains carbon). Small molecules can contain multiple carbon-carbon bonds, stereocenters, and other functional groups (eg, amines, hydroxyls, carbonyls, heterocycles, etc.). In some embodiments, the small molecule is a monomer and has a molecular weight of less than about 1500 g / mol. In certain embodiments, the small molecule has a molecular weight of less than about 1000 g / mol or less than about 500 g / mol. In certain embodiments, the small molecule is a drug, eg, a drug that has been previously approved by a suitable governmental agency or regulatory body to be safe and effective for use in humans or animals.

  Any of the non-proteinaceous agents described herein can be conjugated to the protein backbone by methods known to those skilled in the art.

(C) Sortase-catalyzed transpeptidation reactions Sortase-catalyzed transacylation reactions and their use in transpeptidation (sometimes also referred to as transacylation) for protein engineering are well known to those skilled in the art (eg, the entire contents thereof). See, Ploeg et al., WO 2010/087994 and Ploeh et al., WO 2011/133704, which is incorporated herein by reference). Generally, a first protein containing a C-terminal sortase recognition motif, such as LPXTX (SEQ ID NO: 80; each occurrence of X independently represents any amino acid residue), is generated by a sortase-catalyzed transpeptidation reaction. An N-terminal sortase acceptor peptide, for example, is conjugated to a second protein containing one or more N-terminal glycine residues. In some embodiments, the sortase recognition motif is a sortase recognition motif described herein. In certain embodiments, the sortase recognition motif is an LPXT (SEQ ID NO: 50) motif or LPXTG (SEQ ID NO: 1).

  Sortase acyl transfer reactions provide a means to efficiently link an acyl donor with a nucleophilic acyl acceptor. This principle is widely applicable to many acyl donors and many different acyl acceptors. Heretofore, the sortase reaction has been used to link proteins and / or peptides to one another, to link synthetic peptides to recombinant proteins, to link reporting molecules to proteins or peptides, to link nucleic acids to proteins or peptides. Used to link, conjugate proteins or peptides to solid supports or polymers, and link proteins or peptides to labels. Such products and processes save the cost and time associated with the synthesis of ligation products and are useful for conveniently linking an acyl donor to an acyl acceptor. However, the modification and functionalization of proteins on the surface of virus particles by salt tagging provided herein has not been described previously.

  The sortase-mediated transpeptidation reaction (sometimes also referred to as an acyl transfer reaction) is catalyzed by the transamidase activity of the sortase and forms a peptide bond between the acyl donor compound and a nucleophilic acyl acceptor containing an NH2-CH2 moiety ( Amide bond) is formed. In some embodiments, the sortase used to perform the sortase-mediated transpeptidation reaction is sortase A (SrtA). However, it is noted that any sortase or transamidase that catalyzes a transacylation reaction can be used in some embodiments of the present invention, as the present invention is not limited to the use of sortase A. Should.

  Typically, a drug of interest (eg, a non-proteinaceous drug that is conjugated to a protein or protein scaffold) allows the proteinaceous drug or protein scaffold to which the drug of interest is conjugated to generate a transpeptidation reaction. By contacting the cells under appropriate conditions, the cells can be ligated to the surface of cells expressing a surface protein capable of sorting. In some cases, the agent of interest can be first incubated with sortase under appropriate conditions for an appropriate time to allow cleavage at the sortase recognition site. The mixture is then contacted with the cells under appropriate conditions such that the agent of interest is conjugated to the surface of the cell on a cell capable of tagging.

  In some instances, cells such as CD4 + progenitor cells or enucleated erythrocytes express a fusion protein containing a sortase recognition motif at the C-terminus (eg, a type II erythrocyte transmembrane protein fused to the C-terminus with a sortase recognition motif). I do. The protein backbone to which the target protein or the target agent is conjugated can be conjugated to the C-terminal of the fusion protein in the presence of sortase. In another example, the cell expresses a fusion protein comprising a membrane protein and an acceptor peptide (eg, a glycine polymer) fused to the N-terminus of the membrane protein (eg, a type I or type III transmembrane protein). I do. The protein conjugated to the cell surface fusion protein contains the above sortase recognition motif at the C-terminus, and can be conjugated to the N-terminus of the surface fusion protein.

  The use of a particular sortase in the conjugation methods described herein will depend on the sortase recognition motif contained in either the surface sortable protein on the cell or the protein conjugated to the surface protein. This is well within the knowledge of those skilled in the art. For example, see the description above for recognition sites for various sortases.

In some embodiments, CD34 + cells or enucleated erythrocytes derived therefrom can express a plurality of different surface sortable proteins (eg, two, three, or more). In some embodiments, one or more specific modifications of the plurality of surface taggable proteins each specifically recognize different sortase recognition motifs contained in the one or more taggable proteins. Includes the use of different sortases. For example, a first sortable protein can be modified with a SrtA _aureus recognizing a C-terminal sortase recognition motif LPETGG (SEQ ID NO: 107) and an N-terminal sortase recognition motif (G) _n, and a second sortable protein The protein can be modified with a SrtA _pyogenes that recognizes the C-terminal sortase recognition motif LPETAA (SEQ ID NO: 108) and the N-terminal sortase recognition motif (A) _n . The sortases in this example recognize each recognition motif, but do not recognize the recognition motifs of the other sortases to a significant extent, and thus "specifically" recognize each recognition motif. In some embodiments, the sortase is at least 5, 10, 20, 50, 100, 200, 500, 1000, or more than 1000-fold more affinity binding to different motifs. Specifically binds to the sortase recognition motif when it binds with high affinity to the sortase recognition motif. Combinations of such orthogonal sortases and their respective recognition motifs, such as the combination of the orthogonal sortase A enzymes SrtA _aureus and SrtA _pyogenes , provide two site-specific components on two different surface sortable proteins. Can be used to conjugate

  In another embodiment, the salting of a plurality of different proteins comprises the step of sorting cells comprising different sortable surface proteins into a first sortase that recognizes a sortase recognition motif of the first sortable protein and a suitable first object. This is achieved by sequentially contacting the protein and then a second sortase that recognizes the sortase recognition motif of the second sortable protein and the second protein of interest, and so on. Alternatively, for example, a first sortase that recognizes a sortase recognition motif of a first sortable protein and a suitable first target protein, and a second sortase that recognizes a sortase recognition motif of a second sortable protein The cell may be contacted with a plurality of sortases in parallel, such as with a second protein of interest.

For example, in some embodiments, the first Sorutagingu possible protein, e.g., I-type transmembrane protein oligoglycine is fusion, Staphylococcus aureus (Staphylococcus aureus) from sortase A a (SrtA _aureus) is modified using the second Sorutagingu possible protein, for example, suitable sortase recognition motif is fused type II transmembrane proteins, using the S. pyogenes (Streptococcus pyogenes) from sortase a (SrtA _pyogenes) Is qualified. SrtA _aureus recognizes the motif LPXTG (SEQ ID NO: 1) (X is any amino acid residue) and uses oligoglycine as the acceptor peptide. In contrast, SrtA pyogenes _recognizes the motif LPXTA (SEQ ID NO: 2) (X is any amino acid residue) and uses _oligoalanine as the acceptor peptide.

  Any sortase that recognizes sufficiently different sortase recognition motifs with sufficient specificity is suitable for sorting several sortable proteins expressed on erythrocytes. Each sortase recognition motif can be inserted into a sortable protein or a protein conjugated to a sortable protein using recombinant techniques known to those of skill in the art. In some embodiments, a suitable sortase recognition motif may be present on a wild-type membrane protein. One skilled in the art will appreciate, for example, that a conjugation of a given protein, whether or not the salt-taggable protein contains, at its C-terminus or N-terminus, a sequence that can be recognized as a substrate by any known sortase It will be appreciated that the selection of a suitable sortase for a protein can depend on the sequence of the protein capable of tagging. In some embodiments, the use of a sortase that recognizes a natural C-terminal or N-terminal recognition motif is preferred, as further manipulation of the target protein can be avoided.

IV. Use of Erythrocytes as a Carrier for In Vivo Delivery of Drugs of Interest Genetically modified CD34 + progenitor cells, and enucleated erythrocytes that can also be genetically modified as described (from the in vitro culture process described herein) (Including those obtained) are within the scope of the present disclosure.

  As described herein, enucleated erythrocytes having a surface modification of a target agent can be used to target the target agent for various purposes, for example, to treat a specific disease when the target agent is a therapeutic agent. A subject in need thereof to detect the presence of a particular cell type if the cells can be recognized, and to elicit a desired immune response if the drug of interest is immunogenic ( (For example, human patients). Any suitable delivery route, such as a cell infusion, can be used in the methods described herein.

  In some cases, the red blood cells are delivered to a subject from which the cells are derived. For example, peripheral blood cells are obtained from a subject, such as a human patient, expanded in vitro, genetically modified to express a salt-taggable surface protein, differentiated into enucleated erythrocytes, and conjugated to a drug of interest. be able to. The modified enucleated red blood cells can then be administered to the same subject.

In another example, CD34 ⁺ progenitor cells are obtained from a suitable subject, and after differentiation and genetic modification as described herein, the resulting enucleated erythrocytes are rendered immunocompatible with a donor, preferably a donor. Administer to certain different subjects (eg, administration of enucleated blood cells will not elicit an unwanted immune response).

  Enucleated red blood cells can be administered to a subject having or suspected of having symptoms associated with red blood cell deficiency, for example, blood loss due to anemia, surgery or trauma. The enucleated erythrocytes can also be administered to a subject in need of treatment or diagnosis, which can be achieved by a drug of interest conjugated to the surface of the enucleated erythrocytes. For example, enucleated erythrocytes can be conjugated to cancer antigens or antigens derived from pathogens. Such cells can be delivered to a subject in need of prophylactic or therapeutic treatment (eg, a human subject who is suffering from or at risk for a cancer or infection by a pathogen).

  In another example, nucleated red blood cells are used in diseases or disorders associated with enzyme deficiencies, such as Fabry disease, Gaucher disease, Pompe disease, adenosine deaminase deficiency, asparaginase deficiency, porphyria, hemophilia, and hereditary vascular disease. It can be conjugated to an enzyme that is effective in treating edema.

  In other examples, the enucleated erythrocytes carry a clotting or coagulation factor (eg, factor VII, VIIa, VIII, or IX) and produce abnormal blood clotting or coagulation. Can be delivered to a human subject having or suspected of having symptoms associated with.

V. Kits Some aspects of the present disclosure provide kits useful for genetic modification of red blood cells and surface modification by salt tagging. Such kits include one or more expression vectors encoding one or more fusion proteins, each comprising an erythrocyte membrane protein and a peptide described herein. If the kit includes multiple expression vectors as described, the expression vectors can include sequences encoding different sortase recognition motifs. In some embodiments, different sortase recognition motifs are recognized by orthogonal sortases, for example, one motif by SrtA _{aureus and} another motif by SrtA _pyogenes .

  Alternatively or additionally, the kit described herein may comprise one or more of the media components used in the in vitro culture process to generate enucleated erythrocytes, eg, one of the cytokines used therein. Or, more than one, and one or more of the media used therein, and / or other components of the cell culture.

Additionally, the kit can include one or more suitable sortases. Typically, the sortase included in the kit recognizes a sortase recognition motif encoded by the nucleic acid included in the kit. In some embodiments, the sortase is provided in a storage solution under conditions that retain the structural integrity and / or activity of the sortase. In some embodiments, where two or more orthogonal sortase recognition motifs are encoded by the nucleic acids included in the kit, a plurality of sortases are provided, each of which recognizes a different sortase recognition motif encoded by the nucleic acids. In some embodiments, the kit comprises SrtA _aureus and / or SrtA _pyogenes .

In some embodiments, the kit further comprises a protein scaffold conjugated to the drug of interest, eg, a protein of interest or a non-proteinaceous drug. In some embodiments, the protein of interest or protein backbone comprises a sortase recognition motif, and the nucleic acid in the kit, in that both motifs can participate in a sortase-mediated transpeptidation reaction catalyzed by the same sortase. Compatible with the peptides in the encoded fusion protein. For example, if the kit includes a nucleic acid encoding a fusion membrane protein that includes a SrtA _aureus N-terminal recognition sequence, the kit can also include a SrtA _aureus and a protein or protein backbone of interest that includes a C-terminal sortase recognition motif.

  In some embodiments, the kit further comprises buffers or reagents useful for performing a sortase-mediated transpeptidation reaction, for example, the buffers or reagents described in the Examples section.

  Without further elaboration, it is believed that one skilled in the art can, based on the above description, utilize the present invention to its fullest extent. Accordingly, the following specific embodiments are to be construed as illustrative only and in no way limit other parts of the present disclosure. All publications cited herein are hereby incorporated by reference for the purposes or objects mentioned herein.

Example 1 In Vitro Generation of Human Mature Enucleated Erythrocytes Human peripheral blood G-CSF mobilized hematopoietic stem / progenitor cells enriched for CD34 + are purchased from Fred Hutchinson Cancer Research Center (FHCRC), Seattle. Thaw cells according to the FHCRC protocol. Human ^{CD34 +} (hCD34 ⁺ ) blood cells were ^identified during 21 days in four stages, shown in Figure 1 and described below: (a) expansion, (b) differentiation I ("differentiation I"), c) Differentiated into mature enucleated erythrocytes by a method composed of differentiation II ("differentiation II") and differentiation III ("differentiation III").

In the expansion phase, human ^{CD34 +} blood cells were cultured in expansion medium (StemspanSFEM, Flt-3 ligant, CC100 cytokine mixture including SCF, IL-3 and IL-6, and 2% penicillin-streptomycin). Cultured at ⁵ cells / mL for 1-4 days. After expansion, cells are subsequently cultured in IMDM-based erythroid differentiation media supplemented with various cytokines during differentiation I, II, and III. The basal medium for all three differentiation stages contains IMDM, 15% FBS, 2 mM glutamine, 1% BSA, 500 μg / mL holo-type human transferrin, 10 μg / mL recombinant human insulin, and 2% penicillin-streptomycin. On days 5-9, cells are cultured in differentiated I medium containing erythroid basal medium, 2 μM dexamethasone, 1 μM b-estradiol, 5 ng / mL IL-3, 100 ng / mL SCF, and 6U Epo. On days 10-13, cells are grown in differentiation II medium containing erythroid basal medium, 50 ng / mL SCF, and 6U Epo. On days 14-21, cells were cultured on fibronectin-coated plates in differentiation III medium, which is an erythroid basal medium supplemented with 2U Epo. Initially replated cell numbers for differentiation I, II, and III were 10 ⁵ , 2 × 10 ⁵ , and 3 × 10 ⁵ / mL, respectively.

Erythrocytes at various times during the above four-step process were subjected to benzidine-Giemsa staining and their cell morphology was observed under a microscope. As shown in FIG. 2, a decrease in cell size was observed with erythroid maturation, and enucleated erythrocytes were observed on day 8 of differentiation III. The size of the enucleated erythrocytes obtained from the four-step method described herein was found to be similar to that of normal human reticulocytes or erythrocytes. Table 4 below.

  The hemoglobin content of erythrocytes at differentiation I, differentiation II, and differentiation III was measured by Drabkin reagent. The results show that the enucleated blood cells obtained at the end of the differentiation step are about 30 pg / cell.

  The expression levels of various erythrocyte surface proteins including CD235a (glycophorin A), c-Kit, and CD71 were examined. FACS analysis showed that CD235a expression increased during erythropoiesis (erythroid differentiation). The expression levels of CD235a versus c-kit or CD71 (transferrin) at various stages of the differentiation process are shown in FIGS. Hoechst and glycophorin A staining indicated that about 40-50% of the red blood cells had undergone enucleation at the end of the differentiation process. FIG. % Enucleation = 32.5 / (37.8 + 32.5) = 46.2%.

The number of cells during the differentiation process was counted, and the results showed that the number of cells doubled almost every day during differentiation I to III. Figures 6 and 7. The expression ^levels of the globin gene and other genes (hc-kit, hGATA2, hGATA1, hGYPA, hALAS2, and hSLCA1) in hCD34 ⁺ cell differentiation were also examined by FACS analysis. The results are shown in FIGS.

In summary, the above studies indicate the successful development of a four-step hCD34 ⁺ cell culture and differentiation process. This step results in approximately 17,000-32,000 fold cell expansion (14-15 doublings) after 21 days of culture and approximately 40-50% of the cells are found to undergo enucleation. Was. The enucleated erythrocytes obtained from this culture step are similar to normal human reticulocytes or normal erythrocytes in cell size, hemoglobin content (about 30 pg / cell), and expression of cell surface markers.

Example 2: Conjugation of a functional probe to engineered erythrocytes by a sortase reaction RBC lacks nucleus and cannot be genetically modified at its maturation stage. Thus, erythroid precursors were genetically engineered to express a sortase-modifiable protein retained on the plasma membrane of mature RBCs. In this test, two sortase-modifiable membrane proteins, Kell and glycophorin A (GPA), were expressed in erythroid progenitor cells:
(1) The blood group antigen Kell is a type II membrane protein having a C-terminal exposed outside the cell, and was selected as a target for C-terminal labeling.
(2) GPA, a type I membrane protein with an N-terminal located extracellularly, is the most abundant protein on the RBC surface and was selected for N-terminal modification.

Materials and Methods (i) Plasmids The coding sequences for human and mouse glycophorin A (GPA) and Kell were obtained from the NCBI reference sequences NM_002099.6, NM_010369.3, and NM_000420.2, respectively. To detect cell surface expression, a Myc tag coding sequence (GAGCAGAAACTCATCTCAGAAGAGGATCTG; SEQ ID NO: 109) was inserted between the signal peptide and mature GPA. In order to attach a sortase tag to the N-terminus of GPA, 5 glycines (SEQ ID NO: 3) or 3 glycine tag coding sequences (GGTGGGCGGAGGTGGA; SEQ ID NO: 110 or GGTGGCGGA) were inserted immediately after the signal peptide. Full-length engineered human and mouse GPA were synthesized by Genscript and then cloned into an MSCV retroviral vector. Human Kell has Myc tag (GAACAAAAACTTTATTTCTGAAGAAGATCTG; SEQ ID NO: 112), LPETGG (SEQ ID NO: 107) (CTGCCAGAAAACTGGTGGA; SEQ ID NO: 113), and then extends the HA epitope tag (TACCCATACGACGTCCCCAGCACTACCT; It was cloned into an MSCV retroviral vector.

(Ii) Protein Expression and Purification Improvement of Kcat in pET30 (1) (P94R, D160N, D165A, K190E, K196T) and Ca ²⁺ -independent activity (Hiragawa et al., Biotechnol. Bioeng 109 (12): 2955) -2961) Sortase A from Staphylococcus aureus Δ59 mutated for (E105K, E108Q) and Sortase A from Streptococcus pyogenes, both as previously described. And purified. Guimaraes et al. , (2013) Nat Protocol 8 (9): 1787-1799. VHH7 in which LPETGGHHHHHH (SEQ ID NO: 115) was extended to the C-terminus in pHEN was also expressed and purified as previously described (4). The design and synthesis of sortase probes has also been described previously. Guimaraes et al. , 2013; and Theile et al. , (2013) Nat. Protoc. 8 (9): 1800-1807.

(Iii) Sortase labeling reaction To label the N-terminus of GPA with biotin, 500 μM S.D. in 83 mM Tris-HCl pH 7.5, 250 mM NaCl buffer was used. 30 μl of S. aureus sortase and 1 mM K (biotin) LPRTGG (SEQ ID NO: 116) peptide were preincubated on ice for 15 minutes and approximately 1 × 10 ⁶ cultured cells in DMEM (pre-washed with DMEM) (Reticulocytes or HEK293T cells) or up to 5 × 10 ⁷ erythrocytes (10 μl of whole blood) to ⁷⁰ μl. To label the N-terminus of GPA with VHH7, 100 μM S.D. in 50 mM Tris-HCl pH 7.5, 150 mM NaCl buffer. 50 μl of S. aureus sortase, 100 μM VHH-LPETG-His6 (SEQ ID NO: 126) was pre-incubated on ice for 15 minutes and added to 50 μl of up to 5 × 10 ⁷ red blood cells in DMEM. To label the C-terminus of Kell with biotin, 500 μM S.D. in 83 mM Tris-HCl pH 7.5, 250 mM NaCl buffer. 30 μl of S. aureus sortase, 1.4 mM GGGK (biotin) (SEQ ID NO: 47) peptide was added to about 1 × 10 6 cultured cells (reticulocytes or HEK293T cells) in DMEM (pre-washed with DMEM) or A maximum of 5 x 107 red blood cells were added. All sortase and cell mixtures were incubated on ice for 30 minutes with occasional gentle mixing. These mixtures were centrifuged at 2000 RPM for 2 minutes at 4 ° C. to remove buffer / DMEM and washed three times with 1 ml of ice-cold PBS. For sequential dual labeling of GPA and Kell, 333 μM S.D. in 83 mM TrisHCl, 250 mM NaCl, 16.7 mM CaCl 2 buffer. 30 μl of S. pyogenes sortase, 1.33 mM K (biotin) LPETAA (SEQ ID NO: 45) peptide were preincubated for 15 minutes at 37 ° C. and 1 × 10 ^{6 in} DMEM (pre-washed with DMEM) Of HEK293T cells, and incubated at 37 ° C. for 25 minutes with occasional gentle mixing. The cells were centrifuged at 2000 RPM for 2 minutes at 4 ° C., washed twice with 1 ml of ice-cold PBS, and finally resuspended in 70 μl of ice-cold DMEM. 333 μM S.D. in 83 mM Tris-HCl pH 7.5, 250 mM NaCl. 30 μl of S. aureus sortase, 1.67 mM GGGK (Alexa647; SEQ ID NO: 117) peptide was added to the cells and incubated on ice for 30 minutes with occasional gentle mixing. The cells were washed three times with 1 ml of ice-cold PBS.

(Iv) Western blotting When whole blood is to be labeled with sortase, erythrocytes were first lysed with 500 μl of ammonium chloride solution (Stemcell Technologies) by incubation for 5 minutes on ice and spun down at 14000 RPM for 10 minutes at 4 ° C. . The membrane was washed once with 500 μl of PBS. Cells were solubilized in 25 mM Tris-HCl pH 7.5, 0.5% NP40, 5 mM MgCl ₂ , 150 mM NaCl supplemented with Complete Mini Protease Inhibitor Cocktail Tablet (Roche), agitated and incubated on ice for 10 minutes. Centrifuged at 14,000 RPM for 10 minutes at 4 ° C. The supernatant was incubated with SDS sample buffer and boiled for 8 minutes. After SDS-PAGE, the protein is transferred onto a PVDF membrane, and biotin (using streptavidin-HRP (GE Healthcare)), myc tag (Cell Signaling # 2040), HA tag (Rash 3F10), hemoglobin, or CD19 (Cell). Signaling # 3574).

(V) Transfection Virus production: 6 million 293T cells were isolated and Dulbecco's modified Eagle's medium without antibiotics (DMEM) supplemented with 15% fetal bovine serum (FBS) and 2 mM L-glutamine (DMEM) (Invitrogen) Medium, seeded on 10 cm plates one day before transfection. On day 0, 10 ug of plasmid along with 5 ug of packaging vector was added to a 293T 10 cm plate containing Fugene 6 (Promega). After 68 hours, the old medium was replaced with fresh DMEM supplemented with 15% FBS, 2 mM L-glutamine, and 1 × Pen Strep (Invitrogen). On day 1, the supernatant containing the fresh virus was collected, filtered through a 0.45 μm filter (Millipore), and used immediately thereafter to infect mouse erythroid progenitor cells. GPA and Kell expression: HEK293T cells were seeded on 10 cm dishes and 15 μg of Gn-myc-h / mGPA construct in retroviral vector or retrograde using the TransIT transfection reagent according to the manufacturer's recommendations (Mirus). Transfections were performed with either 7.5 μg of hKell-LPETG (SEQ ID NO: 44) -HA and 7.5 μg of 3G-myc-hGPA (for continuous double sortase labeling) in a viral vector. Cells were analyzed for protein expression and sortase labeled 24 hours after cell transfection.

(Vi) Isolation of Erythroid Progenitor Cells from Mouse E14.5 Fetal Hepatocytes After anesthesia with carbon dioxide, 14.5 days-old pregnant C57BL / 6J mice were dissected to isolate fetuses. Whole fetal liver was carefully separated and placed in phosphate buffered saline (PBS) containing 2% fetal bovine serum (FBS) and 100 uM EDTA. After crushing and filtering through a 70 μm filter (BD), a single fetal hepatocyte suspension was obtained. Mature red blood cells in fetal hepatocyte suspension were lysed after 10 minutes incubation with ammonium chloride solution (Stemcell). Nucleated cells were collected by centrifugation at 1500 RPM for 5 minutes and resuspended in PBS. Lineage-negative fetal hepatocytes were purified using BD Biotin Mouse Lineage Panel (5599971) and BD Streptavidin Particles Plus DM (557812), which were enriched for erythroid progenitors (> 90%).

(Viii) Virus infection and culture of mouse erythroid progenitor cells After purification, lineage-negative fetal hepatocytes were prepared at a cell concentration of 10 million cells / ml. 10 μl of cells were seeded in each well of a 24-well plate with 1 ml of virus-containing supernatant containing 5 ug / ml polybrene. The plate was centrifuged at 2000 RPM for 90 minutes at 37 ° C. Immediately after spin infection, virus-containing supernatant was aspirated and recombinant mouse stem cell factor (100 ng / ml SCF, R & D), recombinant mouse IGF-1 (40 ng / ml, R & D), dexamethasone (100 nM, Sigma), and The erythropoietin (2 u / ml, Amgen) was replaced with an erythroid maintenance medium (StemSpan-SFEM (StemCell Technologies)). The next morning, the infection rate was determined by examining the population of GFP positive cells by flow cytometry. Infection rates were typically greater than 95%. The cells were then transferred to 15% FBS (Stemcell), 1% detoxified bovine serum albumin (BSA) (Stemcell), 500 μg / mL holo-type transferrin (Sigma-Aldrich), 0.5 U / mL Epo (Amgen), 10 μg / ml. Epo-only erythroid differentiation medium (Iskoff modified Dulbecco's medium (IMDM)) containing mL recombinant human insulin (Sigma-Aldrich), 2 mM L-glutamine (Invitrogen), and 1 × Pen Strep (Invitrogen). Cultured for hours.

(Ix) Flow cytometry For FACS sorting or analysis, the desired cells were washed once with PBS and resuspended in PBS containing 1 μg / ml PI at a density of 5-10 M / ml. In the enucleation assay, cells were first stained with anti-mouse TER-119 antibody (eBioscience, 14-5921) and Hoechst (Sigma) for 15 minutes at room temperature. To detect surface expression or labeling of Myc tag, HA tag, or biotin labeling, anti-Myc antibody (Cell signaling, 3739), anti-HA antibody (Thermo Fisher Scientific, NC9843881), or anti-biotin antibody (eBioscience, 12-9895-82) for 30 minutes at room temperature.

(X) Virus infection of bone marrow cells Bone marrow in femur and tibia from C57BL / 6J mice was isolated using a 23G needle, 15% fetal calf serum, 2 mM L-glutamine (Invitrogen), 1 × Pen. 18 h, 2 × 10 6 cells / ml in DMEM supplemented with / Strep (Invitrogen), 20 ng / ml IL-3 (Peprotech), 50 ng / ml SCF (Peprotech), and 50 ng / ml IL-6 (Peprotech). The cells were cultured at a density of 6 well plates. Incubate 4 × 10 6 cells in 500 μl of retrovirus-containing medium, 500 μl of DMEM, 5 μg / ml polybrene, centrifuge the cells at 2500 RPM for 1.5 hours at room temperature and further incubate the cells for 5 hours in a CO ₂ incubator This infected the cells. The cells were returned to the above IL-3 / SCF / IL-6 supplemented medium and incubated for a further 16 hours.

(Xi) Irradiation procedure and mouse fetal liver transplantation B6. SJL-Ptprca Pep3b / BoyJ mice (The Jackson Lab) were subjected to 1050 cGy whole body irradiation in a Gammacell 40 irradiator chamber one day prior to implantation. Mouse fetal hepatocytes were harvested and prepared as described above. After retrovirus infection, cells were cultured in erythroid maintenance medium for 18 hours. Alternatively, mouse bone marrow cells were harvested and retrovirally transduced as described above. The infected cells were then washed twice with sterile PBS and resuspended in sterile PBS at 2-5 million cells / mL. 100 μl of these mouse stem and progenitor cells were then retro-orbitally injected into lethally irradiated mice. Beginning at week 4, mature red blood cells were drawn from irradiated mice for analysis and salt tagging.

(Xii) Cytospin preparation and immunofluorescence Mature erythrocytes and reticulocytes differentiated in vitro were salt-tagged with biotin and then washed twice with cold 1 × PBS. 50,000 sorted biotinylated mature or unsorted in vitro differentiated reticulocytes were centrifuged at 400 rpm for 5 minutes on poly-L-lysine coated slides (Cytospin 3, Thermo). Shandon). Samples were air dried, fixed with 4% paraformaldehyde for 30 minutes at room temperature, and blocked for 1 hour in blocking buffer (2% BSA in PBS + 2% donkey serum). The cells were then combined with the primary antibody: PE conjugated anti-biotin (1: 1000, eBioscience, 12-9895-82) and APC conjugated anti-Ter119 (1: 100, eBioscience, 14-5921) in blocking buffer. After incubating overnight at 4 ° C., it was washed three times with cold 1 × PBS. Finally, in all immunostaining experiments, cells were mounted in mounting medium containing DAPI (Prolong Gold Antifade, Invitrogen) to visualize nuclei. Visualization was performed using a Zeiss LSM 700 laser scan confocal microscope.

(Xiii) Transfer and Survival of eRBC Mature RBC were washed twice with 1 × PBS after salt tagging and resuspended in RPMI medium. These salt-tagged RBCs were collected by centrifugation at 1500 rpm for 5 minutes and labeled with 5 μM CFSE in Hank's balanced salt solution (HBSS) for 8 minutes (Life Technologies). The reaction was then quenched by adding an equal volume of 10% FBS in HBSS. RBCs were washed, counted, and resuspended in sterile HBSS for injection. Next, 2.5 billion CFSE-labeled RBCs (± 300 μl mouse blood) were injected intravenously into recipient CD ^45.1+ mice. Normal RBC was used as a control. Since only 20-50% of the RBCs expressed engineered hGPA or hKell, the rest of the RBCs were normal and were used as an internal standard by monitoring the CFSE signal. One hour after transfer, an initial blood sample (20 μl) was taken from the retro-orbital space and marked as day 0. Thereafter, the same amount of blood samples were collected on days 1, 4, and 7, etc., until day 28. During flow cytometry analysis, blood samples were stained with a PE-conjugated anti-biotin antibody (ebioscience) such that biotin-linked eRBCs showed a strong PE signal. However, RBCs with hKell-biotin showed only very low red fluorescence intensity after staining with PE-conjugated anti-biotin antibody. It was difficult to detect the red fluorescence in the presence of a strong green fluorescence signal from CFSE. hKell-RBCs were salt tagged with biotin and transferred to mice without CFSE staining. hKell-RBC was monitored by its unique GFP signal and weak PE signal from a PE-conjugated anti-biotin antibody. Control RBC and hGPA-RBC were transferred to a total of six mice at two separate times. hKell-RBC was transferred to a total of three mice, one of which died for unknown reasons.

Results (I) The genetically modified type I membrane protein human glycophorin A (GPA) was expressed on the RBC surface and labeled with sortase.
(A) Expression of human glycophorin (hGPA) capable of tagging on RBCs The expression cassettes of the fusion proteins 5Gly (SEQ ID NO: 3) -myc-hGYPA and 3Gly-myc-hGYPA are composed of two wrenches as shown in FIG. It was inserted into the viral vectors EF1 and MSCV (System Biosciences, Inc.). Both vectors carry GFP as the report gene. The resulting lentiviral vector expressing the fusion protein was transduced into human CD34 ⁺ cells at the start of differentiation I.

FIG. 11 shows the expression of the fusion protein in human CD34 ⁺ cells and erythrocytes obtained at the end of differentiation I and II, as described in Example I above. Expression of the 5Gly (SEQ ID NO: 3) -myc-hGYPA fusion protein on the surface of erythrocytes transduced with the EF1 vector was observed at least at the end of differentiation II.

  Similar results were observed with red blood cells transduced with the MSCV expression vector. As shown in FIG. 12, expression of MSCV-5Gly (SEQ ID NO: 3) -myc-hGYPA on the surface of erythrocytes was observed at the end of differentiation III.

  Lentiviral vectors for expressing 5Gly (SEQ ID NO: 3) -myc-hGYPA and 3Gly-myc-hGYPA fusion proteins have also been transduced into K562 cells, and expression of both fusion proteins has been demonstrated on the surface of K562 cells. Was observed.

  Briefly, expression of hGYPA capable of tagging was detected in 50-70% of cells at the end of differentiation I by flow cytometry and western blotting. hGYPA expression remained constant until the end of differentiation III.

(B) Conjugating the target agent to the surface of erythrocytes in the presence of sortase To sort hGYPA, 300 μM sortase A and 500 μM biotin-LPRTGG (Seq. Preincubated in sortase buffer for 30 minutes at 37 ° C. One million erythrocytes expressing hGYPA capable of tagging (5Gly (SEQ ID NO: 3) -myc-hGYPA or 3Gly-myc-hGYPA) were then incubated with the sortase-substrate mixture at 37 ° C. for 1 hour. After washing the cells 3-4 times with PBS, biotin conjugation was detected by flow cytometry or Western blotting. The labeling rate is usually 80 to 100%.

  As shown in FIG. 13, the results of Western blotting indicate the expression of 5Gly (SEQ ID NO: 3) -myc-hGYPA on erythrocytes and the conjugation of biotin to hGYPA. FACS analysis indicated that biotin was conjugated to the surface of erythrocytes on day 8 of differentiation III. Figures 14 and 15. This result indicates that the surface of mature enucleated erythrocytes can be modified by a sortase-catalyzed reaction.

  Similarly, saltable hGYPA expressed on K562 cells was also successfully modified with biotin in the presence of sortase.

  In another experiment, a PE-conjugated peptide containing the LPXTG (SEQ ID NO: 1) motif was combined with sortase A at 37 ° C for 45 minutes. The mixture was then incubated with erythrocytes expressing a 3Gly-GYPA or 5Gly (SEQ ID NO: 3) -GYPA sortable surface protein at 37 ° C. for 30 minutes. The cells were then subjected to FACS analysis. The results thus obtained indicate that the PE-conjugated peptide was conjugated to both 3Gly-GYPA and 5Gly (SEQ ID NO: 3) -GYPA on the surface of erythrocytes.

(C) As the genetically modified hGPA is sortase labeled, extension of the N-terminus of GPA (GPA) by glycine residues expressed on mouse RBCs renders GPA an appropriate sortase substrate. Was the minimum modification required. In the modified version, the N-terminal signal sequence was retained, followed by a glycine residue and a myc epitope tag. Cleavage of the signal peptide will result in (Gly) n-myc tag-GPA. When cells bearing the modified GPA are incubated with a sortase A from Staphylococcus aureus and a probe based on LPETG (SEQ ID NO: 44), the probe is conjugated to the N-terminus of GPA.

  Four retroviral constructs for GPA, encoding a product with three or five N-terminal glycine residues (SEQ ID NO: 3) extended at its N-terminus, were used to generate a mouse or mouse as in Kell below. Prepared to test GPA expression and modification by sortase using human GPA and the in vitro erythroid differentiation system (Zhang et al., 203, Blood 102 (12): 3938-3946). We obtained a normal number of enucleated Ter119-positive erythroblasts expressing modified GPA on their surface. As in each case, during retroviral transduction of progenitor cells, four were obtained. None of the GPA constructs affected the differentiation process (FIGS. 17 and 18A, B).

  These GPA constructs were confirmed to be sortase-modifiable by their expression in HEK293T cells and by subsequent salting with a biotin-containing probe (FIG. 18C). High levels of expression of the mouse construct were observed, but no biotinylation of the encoded product was detected. In contrast, human 3G-myc-GPA (3G-myc-hGPA) was easily salt-tagged and used in subsequent experiments. When 3Gmyc-hGPA is expressed in erythroid progenitors, about 36% of nucleated erythroblasts and about 67% of enucleated reticulocytes have modified GPA on the surface during differentiation in vitro. Obtained. Nearly all of the modified GPA on both nucleated and enucleated cells was salt tagged with a biotin-containing probe when monitored by flow cytometry, immunoblotting, and immunofluorescence (FIG. 19).

  As in the case of Kell (see description below), mouse fetal liver lineage negative cells were infected with a retroviral vector expressing 3G-myc-hGPA and transplanted into lethally irradiated mice. (FIG. 20). Four weeks later, these transplanted mice contain 20-50% of Ter119-positive, disc-shaped mature RBCs expressing modified GPA, which have 85% + / − 5% as determined by flow cytometry. Sorting can be performed with a biotin-containing probe at high efficiency (FIG. 16C). The observation that the gel mobility of 3Gmyc-hGPA is reduced when salt tagging with biotin can be used as a readout of the reaction efficiency, indicating that the majority of GPA is modified by sortase. Immunofluorescence microscopy (FIG. 16E) confirmed that all of these modified erythrocytes did in fact have conjugated biotin on their surface. These results indicate that the salt-taggable GPA was retained on the surface of mature RBC and was efficiently labeled in a sortase-catalyzed reaction.

(D) Type II membrane protein Kell is expressed on the RBC surface and sorted by a sortase-labeled routine recombination technique using the surface fusion proteins hsCD71-LPETG (SEQ ID NO: 44) -HA and hsKell-LPETG (SEQ ID NO: 44). )-HEK293T cells were transfected with an expression vector to produce -HA. A stable cell line expressing the fusion protein has been established. Cells were incubated with 200 μM sortase, 0.5 mM or 1 mM GGG-biotin and subjected to Western blot analysis. This result indicates that the conjugation of biotin to the fusion protein was successful.

  Extension of the C-terminus of Kell by the sortase recognition motif LPXTG (SEQ ID NO: 1) was the minimal modification required to enable sortase modification. A retroviral construct encoding human Kell modified at the C-terminus by extension with LPETG (SEQ ID NO: 44) was constructed as described herein and subsequently extended with a hemagglutinin (HA) epitope tag. Using a glycine-based probe, a sortase reaction performed on the thus-modified Kell, as described herein, results in the loss of the HA tag and the conjugation of the probe on the C-terminus of the Kell. Gated (FIG. 21A).

  The previously described in vitro erythroid differentiation system was used to test Kell expression and modification by sortase. Zhang et al. , 2003. In vitro culture of mouse fetal liver-derived progenitor cells for about 48 hours allows about four final cell divisions and the formation of hemoglobin-containing erythroid cells, of which about 30-50% undergo enucleation. , Reticulocytes are obtained. Expression of hKell-LPETG (SEQ ID NO: 44) -HA did not inhibit the in vitro differentiation process. Both nucleated erythroblasts and enucleated reticulocytes show approximately half of their modified Kells on the cell surface, a large proportion of which as shown by flow cytometry, immunoblotting, and immunofluorescence. In addition, it was possible to perform salt tagging with a biotin-containing probe (FIG. 22).

  Reticulocytes obtained by in vitro differentiation must not only undergo elimination of residual organelles, but also must undergo membrane rearrangement, which results in bi-concave disc-shaped mature RBCs. To ensure that this maturation step does not result in the loss of the modified Kell, mouse fetal liver lineage-negative cells are infected with a retroviral vector expressing engineered hKell-LPETG (SEQ ID NO: 44) -HA and killed. Implantation was carried out in mice that had been subjected to the objective irradiation (FIG. 20). Four weeks later, mature red blood cells were harvested from the transplanted mice and analyzed for the presence of sortase-modifiable Kell on their surface. Approximately 20-50% of mature RBCs in these chimeric mice contain salt-taggable human Kell on their surface (FIG. 21B), and these cells are 81% + as determined by flow cytometry. It was routinely found that sortase could be used to covalently modify with biotin with an efficiency of-/ 28% (Figure 21C). High levels of conjugation of the biotin probe to the C-terminus of Kell were observed by salt tagging, as evidenced by complete loss of HA on the immunoblot (FIG. 21D). Immunofluorescence microscopy (FIG. 21E) confirms the presence of biotin conjugated to the surface of erythrocytes. These data demonstrate that Kell, whose C-terminus has been extended with a sortase recognition motif, does not inhibit erythroid differentiation, is retained on the plasma membrane of mature erythrocytes, and can be labeled in a salt tagging reaction.

(E) Dual labeling of RBCs It is possible to generate multi-labeled RBCs using sortases with different substrate specificities and combining N-terminal and C-terminal labeling strategies (Antos et al., 2009, J. Ameri. Chem. Soc., 131 (31): 10800-10801). Unlike sortase A from Staphylococcus aureus, sortase A from Streptococcus pyogenes recognizes the LPXTA (SEQ ID NO: 2) motif and accepts an oligoalanine probe as a nucleophile. . Therefore, the sortase reaction of both enzymes can be performed as an orthogonal reaction.

  HEK293T cells were infected with two constructs: AAA-myc-hGPA and hKell-LPETG (SEQ ID NO: 44) -HA. In the presence of either biotin-LPETA (SEQ ID NO: 119; GPA salt tagging with S. pyogenes sortase) or GGG-TAMRA (for Kell salt tagging with S. aureus sortase), 2 The cells are sequentially incubated with two different types of sortase A to generate HEK293T cells containing both biotinylated GPA and TAMRA modified Kell (FIG. 16F). In addition, both 3A-myc-hGPA and hKell-LPETG (SEQ ID NO: 44) -HA produced mature RBCs expressed on the cell surface. Despite the fact that the expression levels of hKell and hGPA on individual RBCs fluctuated somewhat, salting of hGPA with biotin and hKell with Alexa-647 was successful on the RBC surface (FIG. 23). Thus, dual labeling can be used to attach two different functional components on the surface of the RBC.

(F) Survival of Engineered RBCs in Blood Circulation Evaluate whether the step of salt-tagging RBCs, including incubation with sortase, centrifugation, and washing, affects the survival of RBCs in vivo. Therefore, in the presence or absence (without probe conjugation) of wild-type RBC and sortase (without probe conjugation), wild-type RBC that has undergone a mock C-terminal sort tagging reaction is fluorescently stained stably in the cytosol of live cells. Labeled with the dye CFSE. The RBCs were then transferred to normal recipient mice, and cell survival in the circulation was assessed periodically using CFSE fluorescence. No differences between the experimental groups were observed in the RBC in vivo survival (FIG. 24A), indicating that the salt tagging procedure did not cause significant damage to the cells that would result in premature removal of the cells. .

Example 3 Conjugation of Antibodies to Engineered Erythrocytes for Cell Type-Specific Targeting One promising use of modified RBCs is a targeting moiety that allows their delivery to specific tissue or cell types (And a combined or embedded payload). Such targeting can be achieved by the placement of proteins or other entities, such as ligands for particular receptors, that can participate in specific recognition of the target of interest.

  To test the conjugation of functional proteins on the surface of RBCs, a single domain antibody derived from alpaca capable of salt tagging was used. This antibody was specific for the mouse MHC class II molecule, VHH7-LPETG (SEQ ID NO: 44), and was covalently bound to erythrocytes with 3G-myc-hGPA on its surface. The salt tagging reaction is stoichiometric, as indicated by a shift in the gel mobility of 3G-myc-hGPA (FIG. 25A).

  B cell-erythrocyte binding assays were performed as follows. B cells were isolated from either wild-type C57BL / 6 mice or mice knocked out for MHC class II using Dynabeads Mouse CD43 (Untouched B cells) (Life Technologies) according to the manufacturer's recommendations. Cells from 1-1.5 spleens were incubated with 5 μg of biotin-labeled anti-mouse CD19 antibody (BD Pharmigen) on ice for 30 minutes and washed once with 500 μl of ice-cold PBS. Cells were resuspended in 500 μl of PBS with 70 μl of pre-washed magnetic Dynabeads Myone Streptavidin T1 (Life Technologies), incubated on a rotating platform at 4 ° C. for 1 hour, and washed with 500 μl of ice-cold PBS. The resuspended cells (500 μl of PBS) were further incubated for 1 hour at 4 ° C. with approximately 2 × 10 7 erythrocytes expressing 3G-myc-hGPA and labeled with sortase, washed 4 times with 1 ml of ice-cold PBS, Finally, it was incubated with SDS sample buffer and boiled for subsequent SDS-PAGE analysis.

  Incubation of these modified RBCs with MHC class II positive B cells immobilized on beads results in binding of RBCs to B cells. Specific binding was deduced from the presence of hemoglobin co-purified with B cells after washing. Neither incubation of unmodified erythrocytes with wild-type B cells nor of modified erythrocytes with B cells from MHC class II knockout animals resulted in binding of the two cell types (FIGS. 25B, C).

Example 4: Sorting and cytosolic modification of terminally differentiated human erythrocytes To extend the utility of the methods described herein, modification of erythroid progenitor cells and subsequent sortase-mediated cell surface labeling of human cells We examined whether it was feasible.

The terminally differentiated human erythrocytes were genetically manipulated as follows. Plasmids used to engineer human RBCs differentiated in vitro include GGG-containing human GPA and HIV / MSCV lentivirus with improved GFP added to its C-terminus to produce 3G-myc-hGPA-EGFP. It was prepared by cloning into a vector. Lentivirus was generated by co-infection of 293T cells with pVSV-G envelope plasmid and pDelta 8.9 packaging vector. G-CSF (granulocyte colony stimulating factor) mobilized CD34 + peripheral blood stem cells were isolated on day 18 using the method described previously (Zaitsev et al., 2010, Blood 115 (25): 5241-5248). In the meantime, hemoglobin-containing reticulocytes were differentiated in vitro. On day 3 of culture, the differentiating cells were infected by incubating 5 × 10 ⁵ cells in 2 ml of lentivirus-containing medium in the presence of polybrene and centrifuged at 2500 RPM for 1.5 hours at room temperature. Later, it was further incubated overnight in a CO2 incubator. The next day, the infected cells were washed twice and placed in fresh differentiation medium. On day 18, enucleated reticulocytes were collected and subjected to sortase labeling with a biotin-containing probe as described herein. Data analysis of the resulting engineered human reticulocytes revealed the following antibodies: PE-conjugated anti-biotin (1: 1000, eBioscience, 12-9895-82), Hoechst (Sigma), and APC conjugate (1: 100). , EBioscience, 17-0087-42) using flow cytometry.

  The experiments described in this example are the previously described in vitro human erythroid differentiation lines. For example, Hu et al. , 2013. G-CSF (granulocyte colony stimulating factor) mobilized CD34 + peripheral blood stem cells were differentiated in vitro into hemoglobin-containing reticulocytes during 18 days with an enucleation efficiency of about 50%. A lentiviral vector encoding a version of 3G-myc-hGPA fused at its C-terminus to improved GFP (3G-myc-GPA-GFP) was constructed. This provides an example of a cytoplasmically expressed protein domain designed to be retained in mature RBC through its genetic fusion to GPA. Both the empty (control) vector and the 3G-myc-hGPA-GFP vector encoded a GFP component 3 'to the IRES sequence (3G-myc-hGPA-GFP-IRES-GFP). If the cells were successfully transduced with 3G-myc-hGPA-GFP containing additional improved GFP linked to the cytoplasmic domain of GPA, these cells would be as shown by flow cytometry (FIG. 26A, The first panel) will express significantly higher levels (about twice) of the GFP signal. Since the molecular weights of GFP and hGPA are 32.7 kDa and 37 kDa, respectively, the mobility of 3G-myc-hGPA-GFP on SDS-PAGE indicates that the modified GPA protein is expressed in monomeric and dimeric forms. (FIG. 26B). Viral transduction of human CD34 + cells with 3G-myc-hGPA-GFP resulted in the formation of a similar number of enucleated reticulocytes (50-60%) in cultures infected with empty (control) vector (FIG. 26A, (Middle panel), did not affect the differentiation of human CD34 + cells.

  All enucleated reticulocytes containing modified GPA on their surface could be sortase labeled with a biotin-containing probe as monitored by flow cytometry (FIG. 26A). In addition, all 3G-myc-hGPA-GFP present on the reticulocyte surface was modified by biotin sorting as evidenced by a shift in the gel mobility of 3G-mychGPA-GFP (FIG. 26B). Thus, in this experiment, mature human RBCs are provided with a protein of interest located in the cytoplasm while retaining the ability to selectively target RBCs to the target of interest by salt-tagging the modified GPA with the targeting component of interest. Technology has been established.

Example 5: Generation of mKell-LPETG (SEQ ID NO: 44) mice using CRISPR / Cas9 technology. The sgRNA sequences for CRISPR / Cas9-dependent double-strand breaks that stimulate homologous recombination repair (HDR) As in Table 5, oligo DNA was designed on the last exon of the mKel locus and as a template for introducing LPETG (SEQ ID NO: 44) into the C-terminus of mKel, as shown in Table 6.

Potential off-target effects of the target sequence were searched using the NCBI mouse nucleotide BLAST. Wang et al. , 2013, the Cas9 mRNA was prepared. As shown in Table 7 below, mKel-CT targeting sgRNA coding sequence without T7 promoter and PAM motif by PCR amplification using pX330 vector as template and primers, mKel T7-sgRNA Fw and common Rv of sgRNA. Was added just before the general tail of the sgRNA (from the hairpin region to the terminal motif).

  The T7-sgRNA template PCR product for in vitro transcription (IVT) was gel purified by column (Promega) and the purified PCR product was used as a template for IVT using the MEGAshortscript T7 kit (Life Technologies). . Both Cas9 mRNA and sgRNA were purified using the MEGAclear kit (Life Technologies) and eluted with RNase-free water. Fertilized zygotes were collected from the oviducts of superovulated females, and Cas9 mRNA, sgRNA, and template oligo DNA were injected into the pronuclear stage cytoplasm. The injected conjugates were transferred into the oviducts of pseudopregnant females at a two-cell stage. To identify mouse genotypes: Mouse tails were lysed using tail lysis buffer at 55 ° C. for 12 hours and genomic DNA was purified from the lysate by isopropanol precipitation. The genomic DNA in the vicinity of the sgRNA target was analyzed using primers Fw for mKel sequencing and Rv for mKel sequencing as shown in Table 3 [KOD Xtreme (VWR), conditions: 95 ° C. for 2 minutes; 35 × ( 98 ° C. for 10 seconds, 50 ° C. for 30 seconds, 68 ° C. for 30 seconds); 68 ° C. for 2 minutes; hold at 4 ° C.], amplified by PCR and then gel purified. The purified PCR product was sequenced using the same Fw primer.

  CRISPR / Cas-9 genome editing technology (Jinek et al., 2012, Science 337 (6096): 816-821; and Wang et al., 2013, Cell 153 (4): 910-918). RBC survival in vivo was studied using the transgenic mice obtained. Such transgenic mice contain LPETG (SEQ ID NO: 44) inserted at the C-terminus of the mouse endogenous Kell gene (mKell-LPETG; SEQ ID NO: 44). These mice look normal and breed normally. MKell-LPETG (SEQ ID NO: 44) RBC derived from these mice can be labeled with a probe in a sortase-mediated reaction as efficiently as hKell-LPETG (SEQ ID NO: 44) -HA RBC.

  CFSE staining was performed on control RBC, mKell-LPETG (SEQ ID NO: 44) RBC, and biotagged mKell-LPETG (SEQ ID NO: 44) RBC, and they were transferred to wild-type recipient mice and expressed in blood circulation. Their survival was monitored. Modification of mKell with LPETG (SEQ ID NO: 44) at its C-terminus did not affect the survival of the modified RBC in vivo (FIG. 24B). A small but significant difference was observed in the survival of mKell-LPETG (SEQ ID NO: 44) RBCs salttagged with a biotin probe. hKell-LPETG (SEQ ID NO: 44) RBC was also collected from the transplanted mouse, salt-tagged with biotin, and transferred to the recipient. Similarly, the engineered biotin-labeled Kell-LPETG (SEQ ID NO: 44) RBC persists in the circulation for more than 28 days, although with slightly reduced survival compared to wild-type RBC (FIG. 24C). These results suggest similar experiments comparing the in vivo survival of normal RBCs to sortase-labeled biotin-3G-myc-hGPA RBCs. The results (FIG. 24D) replicated the trend seen with the Kell-LPETG (SEQ ID NO: 44) RBC; there was a slight but significant reduction in survival for the salt-tagged RBC. Nevertheless, importantly, the half-life of engineered RBCs in normal mice, including those conjugated with biotin, is at least 28 days, and thus other previously designed Significantly longer than RBC based carriers.

Other Embodiments All of the features disclosed herein can be combined in any combination. Each feature disclosed herein may be replaced by another feature that serves the same, equivalent, or similar purpose. Thus, unless expressly stated otherwise, each feature disclosed is only an example of a generic series of equivalent or similar features.

  From the above description, those skilled in the art will readily be able to ascertain the essential characteristics of the invention and to adapt the invention to various uses and conditions without departing from the spirit and scope of the invention. Various changes and modifications of the present invention can be made. Thus, other embodiments are also within the claims.

Claims (1)

  A genetically engineered enucleated blood cell, which expresses on a surface a first fusion protein comprising a first target peptide and a first erythrocyte membrane protein.

Images