JP2018536022A - Nucleic acid vaccine for varicella-zoster virus (VZV) - Google Patents

Abstract

Aspects of the present disclosure relate to nucleic acid vaccines. The vaccine comprises at least one RNA polynucleotide having an open reading frame encoding at least one varicella-zoster virus (VZV) antigen. Methods for preparing and using such vaccines are also described. The present invention includes, for example, at least one RNA polynucleotide having an open reading frame encoding at least one varicella-zoster virus (VZV) antigenic polypeptide and a pharmaceutically acceptable carrier or excipient. VZV vaccines are provided.
[Selection] Figure 5

Description

CROSS REFERENCE TO RELATED APPLICATIONS This application is based on US Patent Act 119 (e), filed October 22, 2015, US Provisional Application No. 62 / 245,234, October 28, 2015. U.S. Provisional Application No. 62 / 247,697, U.S. Provisional Application No. 62/335348 filed on May 12, 2016, and U.S. Provisional Application No. 62/335348 filed on October 22, 2015. No. 62 / 245,031 are claimed and each application is incorporated herein by reference in its entirety.

  Varicella is an acute infection caused by varicella-zoster virus (VZV). Varicella zoster virus is one of eight herpesviruses known to infect humans and vertebrates. VZV is also known as chicken pox virus, varicella virus, shingles virus and human herpesvirus type 3 (HHV-3). VZV acts only on humans and generally causes chicken pox in children, teens and young adults, and causes herpes zoster in adults (children are rare). Primary infection of VZV leading to chicken pox (varicella) may lead to complications including viral pneumonia or secondary bacterial pneumonia. Even when the clinical symptoms of chicken pox are resolved, VZV continues to lie in the nervous system of the infected trigeminal and dorsal root ganglia (virus latency period). In about 10-20% of cases, VZV activates in later years and returns from the sensory ganglia to the skin, where it causes a disease known as shingles or herpes zoster (rash). VZV can also cause several neurological conditions ranging from aseptic meningitis to encephalitis. Other serious complications of VZV infection include postherpetic neuralgia, molare meningitis, multiple herpes zoster, thrombocytopenia, myocarditis, arthritis, and intracerebral arterial inflammation leading to stroke, myelitis , Ocular herpes zoster, or herpes zoster zoster. In rare cases, VZV acts on the knee ganglia, resulting in lesions that follow specific branches of the facial nerve. Symptoms can include blisters with tongue and ear pain and muscle weakness and hearing loss on one side of the face.

  Minamata cases have decreased by 97% since 1995, mainly due to vaccination. However, an estimated 500,000 to 1 million cases of herpes zoster occur every year in the United States alone. The lifetime risk of herpes zoster is estimated to be at least 32%, with aging and cellular immune suppression being the most important risk factors. In fact, it is estimated that 50% of those who survive to age 85 will develop herpes zoster.

  A live attenuated VZV Oka strain vaccine is available and is marketed in the United States under the trade name VARIVAX® (Merck). A similar but not identical VZV vaccine is marketed worldwide as VARILIX® (GlaxoSmithKline). Since its approval in 1995, it has been added to the recommended immunization schedule for children in Australia, the United States and several other countries. In 2007, the Vaccination Advisory Committee (ACIP) recommended a second pre-school dose of vaccine to ensure a high degree of varicella immunity. In 2001-2005, outbreaks were reported at schools with high varicella vaccination rates, and even in an environment where most children were vaccinated and vaccinations were carried out as expected, It was shown that the outbreak of chickenpox could not be prevented. As a result, although it is a protocol in which two vaccinations have been adopted, the occurrence of breakthrough varicella has been reported even if the vaccine is administered twice. In addition, varicella vaccination may not be life-long immunity induced by vaccines, and adults may become more susceptible to more severe disease as childhood immunization weakens Concern has arisen.

  In 2005, the FDA approved a mixed live attenuated rubella, mumps, rubella, chickenpox (MMRV) combination vaccine PROQUAD ™ (Merck) for use by people aged 12 months to 12 years. The attenuated rubella, mumps and rubella vaccine viruses in MMRV are the same and equivalent titers as the MMR vaccine, but the Oka / Merck VZV titer is the single antigen varicella vaccine Higher than.

  In 2006, the US Food and Drug Administration approved ZOSTAVAX® (Merck) for the prevention of shingles (herpes zoster) in people over the age of 60 (currently approved at the age of 50-59) ). ZOSTAVAX® contains the same Oka / Merck's varicella zoster virus used in varicella and MMRV vaccines, but produces an immune response in older people whose immunity to VZV is weakening with age. Because the concentrate is designed to induce, the titer is much higher than that present in both the varicella vaccine and the MMRV vaccine (more than 10 times the viral load).

  Although varicella vaccine has been shown to be safe in healthy individuals, the immunity to VZV infection conferred by the vaccine has weakened over time, so that vaccinated individuals are more severely ill There is evidence that shingles are more likely to occur. In addition, it has been reported that individuals have developed chicken pox or shingles from chickenpox vaccination. Vaccines can establish latent infections in ganglia and can then be reactivated to cause herpes zoster.

  Furthermore, live attenuated viruses are not suitable for all subjects, including pregnant women and people with moderate or severe acute illness. Varicella is also not suitable or approved for immunocompromised patients, including those who are immunosuppressed by leukemia, lymphoma, systemic malignancy, immunodeficiency disease or immunosuppressive therapy. Similarly, persons with moderate or severe cellular immunodeficiency resulting from human immunodeficiency virus (HIV) infection, including those diagnosed with acquired immune deficiency syndrome (AIDS) should not receive varicella vaccine . Thus, in immunocompromised individuals, the morbidity and mortality associated with herpes zoster is high risk, but this population is not eligible for vaccination with a live attenuated vaccine such as ZOSTAVAX®.

  In the United States, 1 million cases of herpes zoster occur each year. In the United States, an estimated $ 1 billion is spent annually on the direct medical costs of herpes zoster, and the treatment of herpes zoster is not always effective or available.

  Deoxyribonucleic acid (DNA) vaccination is one technique used to stimulate humoral and cellular immune responses against foreign antigens such as VZV antigens. When genetically engineered DNA (eg, naked plasmid DNA) is injected directly into a living host, a small number of host cells directly produce the antigen, resulting in a protective immune response. However, this technique raises potential problems, including the possibility of insertional mutagenesis that can cause activation of oncogenes or suppression of tumor suppressor genes.

  RNA (eg, messenger RNA (mRNA)) that goes safely to the body's cellular machinery, ranging from natural proteins to antibodies and other completely new protein constructs that may have therapeutic activity inside and outside the cell. Provided herein are ribonucleic acid (RNA) vaccines based on the finding that almost any protein can be produced. The varicella-zoster virus (VZV) RNA vaccine of the present disclosure provides a balanced immune response, including both cellular and humoral immunity against VZV, without many of the risks associated with attenuated virus vaccination. Can be used to guide.

  RNA (eg, mRNA) vaccines can be utilized in a variety of environments, depending on the prevalence of infectious diseases or the degree or level of unmet medical needs. RNA (eg, mRNA) vaccines can be utilized to treat and / or prevent VZV of various genotypes, strains and isolates. RNA (eg, mRNA) vaccines have superior properties in that they have higher antibody titers and provide a faster response compared to commonly available antiviral therapies. While not wishing to be bound by theory, RNA vaccines such as mRNA polynucleotides are well suited to produce the proper protein conformation during translation, as RNA vaccines utilize natural cellular machinery. It is thought to be designed. Unlike conventional vaccines that are produced ex vivo and can elicit unwanted cellular responses, RNA (eg, mRNA) vaccines are brought into cell lines in a more natural way.

  Various VZV amino acid sequences encompassed by this disclosure are listed in Tables 1-9. The RNA (eg, mRNA) vaccine provided herein is a VZV glycoprotein or fragment, homologue (eg, at least 80%, 85%, 90%, 95%, 98% or 99) described in Table 1. %)) Or at least one RNA polynucleotide encoding at least one of a variant or derivative.

  Some embodiments of the present disclosure provide a VZV vaccine comprising at least one ribonucleic acid (RNA) polynucleotide having an open reading frame encoding at least one VZV antigenic polypeptide or an immunogenic fragment or epitope thereof. provide. Some embodiments of the present disclosure provide a VZV vaccine comprising at least one RNA polynucleotide having an open reading frame encoding two or more VZV antigenic polypeptides or immunogenic fragments or epitopes thereof. Some embodiments of the present disclosure provide a VZV vaccine comprising two or more RNA polynucleotides having an open reading frame encoding two or more VZV antigenic polypeptides or immunogenic fragments or epitopes thereof. .

  In some embodiments, the antigenic polypeptide is a VZV glycoprotein. For example, the VZV glycoprotein can be VZV gE, gI, gB, gH, gK, gL, gC, gN or gM or an immunogenic fragment or epitope thereof. In some embodiments, the antigenic polypeptide is a VZV gE polypeptide. In some embodiments, the antigenic polypeptide is a VZV gI polypeptide. In some embodiments, the antigenic polypeptide is a VZV gB polypeptide. In some embodiments, the antigenic polypeptide is a VZV gH polypeptide. In some embodiments, the antigenic polypeptide is a VZV gK polypeptide. In some embodiments, the antigenic polypeptide is a VZV gL polypeptide. In some embodiments, the antigenic polypeptide is a VZV gC polypeptide. In some embodiments, the antigenic polypeptide is a VZV gN polypeptide. In some embodiments, the antigenic polypeptide is a VZV gM polypeptide. In some embodiments, the VZV glycoprotein is encoded by the nucleic acid sequence of SEQ ID NO: 1 or SEQ ID NO: 2.

  In some embodiments, the VZV glycoprotein is a variant gE polypeptide. In some embodiments, the variant VZV gE polypeptide is a truncated polypeptide that lacks an anchor domain (ER retention domain). In some embodiments, the truncated VZV gE polypeptide comprises (or consists of, or consists essentially of) amino acids 1-561 of a VZV gE polypeptide. In some embodiments, the truncated VZV gE polypeptide comprises (or consists of, or consists essentially of) amino acids 1-561 of SEQ ID NO: 10. In some embodiments, the truncated VZV gE polypeptide comprises (or consists of, or consists essentially of) amino acids 1-573 of SEQ ID NO: 18. In some embodiments, the truncated VZV gE polypeptide comprises (or consists of, or consists essentially of) amino acids 1-573 of SEQ ID NO: 10. In some embodiments, the variant VZV gE polypeptide is a truncated polypeptide that lacks the carboxy-terminal tail domain. In some embodiments, the truncated VZV gE polypeptide comprises (or consists of, or consists essentially of) amino acids 1-573 of the VZV gE polypeptide. In some embodiments, the truncated VZV gE polypeptide comprises (or consists of, or consists essentially of) amino acids 1-573 of SEQ ID NO: 34.

  In some embodiments, the variant VZV gE polypeptide has at least one mutation in one or more motifs associated with ER retention, wherein the mutation (s) in the one or more motifs are VZV Reduces retention of gE polypeptide in the ER and / or Golgi apparatus. In some embodiments, the variant VZV gE polypeptide has at least one mutation in one or more motifs associated with targeting gE to the Golgi or trans-Golgi network (TGN). Mutation (s) in the above motifs reduce VZV gE polypeptide targeting or localization to the Golgi or TGN. In some embodiments, the variant VZV gE polypeptide has at least one mutation in one or more motifs associated with internalization of VZV gE or endocytosis of gE, and in the one or more motifs The mutation (s) reduce the endocytosis of the VZV gE polypeptide. In some embodiments, the variant VZV gE polypeptide has at least one mutation in one or more phosphorylated acidic motifs, such as SSTT (SEQ ID NO: 122). In some embodiments, the variant VZV gE polypeptide is a full length VZV gE polypeptide having a Y582G mutation. In some embodiments, the variant VZV gE polypeptide is a full length VZV gE polypeptide having a Y569A mutation. In some embodiments, the variant VZV gE polypeptide is a full length VZV gE polypeptide having a Y582G mutation and a Y569A mutation. In some embodiments, the variant VZV gE polypeptide is an antigenic fragment comprising amino acids 1-573 of VZV gE and having a Y569A mutation. In some embodiments, the variant VZV gE polypeptide is an antigenic fragment comprising SEQ ID NO: 38.

  In some embodiments, the variant VZV gE polypeptide is a full length VZV gE polypeptide having an Igκ sequence. In some embodiments, the variant VZV gE polypeptide is SEQ ID NO: 14. In some embodiments, the variant VZV gE polypeptide is a full-length VZV gE polypeptide having an AEADADA sequence (SEQ ID NO: 58) that replaces SESTDT (SEQ ID NO: 59). This replaces the Ser / Thr rich “SSTT” (SEQ ID NO: 122) acidic cluster with an Ala rich sequence. In some embodiments, the variant VZV gE polypeptide is SEQ ID NO: 26. In some embodiments, where the VZV gE polypeptide has an AEAAADA sequence (SEQ ID NO: 58), the variant VZV gE polypeptide also has ER / Golgi retention, TGN localization or Having at least one mutation in one or more motifs associated with endocytosis (eg, having Y582G mutation, Y569A mutation or both Y582G mutation and Y569A mutation) and / or SSTT (SEQ ID NO: 122) motif Have at least one mutation in one or more phosphorylated acidic motifs. In some embodiments, the variant VZV gE polypeptide is or comprises the amino acid sequence of SEQ ID NO: 30.

  In some embodiments, the variant VZV gE polypeptide is a full-length VZV gE polypeptide with an additional sequence at the C-terminus that facilitates secretion of the polypeptide or its localization to the cell membrane. In some embodiments, the variant VZV gE polypeptide is a full length VZV gE polypeptide having an Igκ sequence at the C-terminus. In some embodiments, the VZV gE polypeptide has an additional sequence at the C-terminus that promotes secretion (eg, has an Igκ sequence at the C-terminus) and is prone to ER retention, TGN localization or endocytosis. One such as having at least one mutation in one or more related motifs (eg, having a Y582G mutation, a Y569A mutation, or both a Y582G mutation and a Y569A mutation) and / or an SSTT (SEQ ID NO: 122) motif It has at least one mutation in the above phosphorylated acidic motif. In some embodiments, the variant VZV gE polypeptide lacks an anchor domain (ER retention domain) and has an additional sequence at the C-terminus that facilitates secretion of the polypeptide (eg, has an Igκ sequence at the C-terminus). A truncated polypeptide. In some embodiments, the truncated VZV gE polypeptide comprises amino acids 1-561 and has an Igκ sequence at the C-terminus. In some embodiments, the variant polypeptide is SEQ ID NO: 22. In some embodiments, the variant VZV gE polypeptide lacks a carboxy-terminal tail domain and has an additional sequence at the C-terminus that facilitates secretion of the polypeptide (eg, has an Igκ sequence at the C-terminus) and is cleaved. Type polypeptide. In some embodiments, the truncated VZV gE polypeptide comprises amino acids 1-573 and has an Igκ sequence at the C-terminus.

  In some embodiments, the antigenic polypeptide comprises more than one glycoprotein. In some embodiments, more than one glycoprotein is encoded by a single RNA polynucleotide. In some embodiments, two or more glycoproteins are encoded by two or more RNA polynucleotides, eg, each glycoprotein is encoded by a separate RNA polynucleotide. In some embodiments, the two or more glycoproteins are VZV gE, gI, gB, gH, gK, gL, gC, gN and gM polypeptides or any combination of immunogenic fragments or epitopes thereof. possible. In some embodiments, the two or more glycoproteins are VZV gE and at least one of gI, gB, gH, gK, gL, gC, gN, and gM polypeptides or immunogenic fragments or epitopes thereof. Any combination of the two. In some embodiments, the two or more glycoproteins are at least one of VZV gI and gE, gB, gH, gK, gL, gC, gN, and gM polypeptides or immunogenic fragments or epitopes thereof. Any combination of the two. In some embodiments, the two or more glycoproteins are VZV gE, gI, gB, gH, gK, gL, gC, gN and gM polypeptides or at least immunogenic fragments or epitopes thereof. It can be any combination with one.

  In some embodiments, the two or more VZV glycoproteins are gE and gI. In some embodiments, the two or more VZV glycoproteins are gE and gB. In some embodiments, the two or more VZV glycoproteins are gI and gB. In some embodiments, the two or more VZV glycoproteins are gE, gI and gB. In some embodiments, the two or more VZV glycoproteins are gE and gH. In some embodiments, the two or more VZV glycoproteins are gI and gH. In some embodiments, the two or more VZV glycoproteins are gE, gI and gH. In some embodiments, the two or more VZV glycoproteins are gE and gK. In some embodiments, the two or more VZV glycoproteins are gI and gK. In some embodiments, the two or more VZV glycoproteins are gE, gI and gK. In some embodiments, the two or more VZV glycoproteins are gE and gL. In some embodiments, the two or more VZV glycoproteins are gI and gL. In some embodiments, the two or more VZV glycoproteins are gE, gI and gL. In some embodiments, the two or more VZV glycoproteins are gE and gC. In some embodiments, the two or more VZV glycoproteins are gI and gC. In some embodiments, the two or more VZV glycoproteins are gE, gI and gC. In some embodiments, the two or more VZV glycoproteins are gE and gN. In some embodiments, the two or more VZV glycoproteins are gI and gN. In some embodiments, the two or more VZV glycoproteins are gE, gI and gN. In some embodiments, the two or more VZV glycoproteins are gE and gM. In some embodiments, the two or more VZV glycoproteins are gI and gM. In some embodiments, the two or more VZV glycoproteins are gE, gI and gM.

  In some embodiments, the vaccine comprises any two or more VZV glycoproteins (eg, any of the variant VZV gEs disclosed in the preceding paragraphs and the examples and drawings), wherein the VZV gE is Any of the variant VZV gE glycoproteins disclosed herein, for example, variant gE, such as any of the variant VZV gE disclosed in the preceding paragraphs and in the examples and figures.

  In some embodiments, a VZV vaccine comprises two or more RNA polynucleotides having an open reading frame encoding two or more VZV antigenic polypeptides or immunogenic fragments or epitopes thereof (a single RNA Two or more VZV glycoproteins are encoded by variant gE (encoded by a polynucleotide or encoded by two or more RNA polynucleotides (eg, each glycoprotein is encoded by a separate RNA polynucleotide)). For example, any of the variant gE polypeptides disclosed in the preceding paragraphs herein) and gI, gB, gH, gK, gL, gC, gN and gM polypeptides or immunogenic fragments thereof. Or a VZV glycoprotein selected from epitopes That. In some embodiments, the two or more VZV glycoproteins are variant gE (eg, any of the variant gE polypeptides disclosed in the preceding paragraphs of the specification) and gI. In some embodiments, the glycoprotein is VZV gI and variant VZV gE, and the variant VZV gE polypeptide is a truncated polypeptide lacking an anchor domain (ER retention domain) (eg, amino acids 1 to 1 of SEQ ID NO: 10). A truncated VZV gE polypeptide). In some embodiments, the glycoprotein is VZV gI and variant VZV gE, and the variant VZV gE polypeptide is a truncated polypeptide lacking the carboxy-terminal tail domain (eg, amino acids 1 to 573 of SEQ ID NO: 18). A truncated VZV gE polypeptide). In some embodiments, the glycoprotein is VZV gI and variant VZV gE, and the variant VZV gE polypeptide is in one or more motifs associated with ER retention, TGN localization and / or endocytosis. One or more phosphorylation, such as having at least one mutation (eg, variant VZV gE has Y582G mutation, Y569A mutation or both Y582G mutation and Y569A mutation) and / or SSTT (SEQ ID NO: 122) motif Has at least one mutation in the acidic motif. In some embodiments, the glycoprotein is VZV gI and variant VZV gE, and the variant VZV gE polypeptide is an antigenic fragment comprising amino acids 1-573 of VZV gE and having a Y569A mutation. In some embodiments, the glycoprotein is VZV gI and variant VZV gE, and the variant VZV gE polypeptide is a full-length VZV gE having an AEAADADA (SEQ ID NO: 58) sequence. It is a polypeptide. In some embodiments, the glycoprotein is VZV gI and variant VZV gE, and the VZV gE polypeptide comprises an AEAADAA (SEQ ID NO: 58) sequence and a Y582G mutation, a Y569A mutation or It has both Y582G mutation and Y569A mutation. In some embodiments, the glycoprotein is VZV gI and variant VZV gE, and the VZV gE polypeptide is a full-length VZV gE having an additional sequence at the C-terminus that facilitates secretion of the polypeptide (eg, an Igκ sequence). It is a polypeptide. In some embodiments, the glycoprotein is VZV gI and variant VZV gE, and the VZV gE polypeptide is an Igκ sequence and a full-length VZV gE polypeptide having a Y582G mutation, a Y569A mutation, or both a Y582G mutation and a Y569A mutation. It is. In some embodiments, the glycoprotein is VZV gI and variant VZV gE, and the VZV gE polypeptide is a truncated VZV gE polypeptide lacking an anchor domain (ER retention domain) and having an Igκ sequence. In some embodiments, the variant VZV gE polypeptide is a truncated polypeptide comprising amino acids 1-561 or amino acids 1-573 and having an Igκ sequence at the C-terminus.

  In any of the above embodiments, the VZV vaccine may further comprise live attenuated VZV, fully inactivated VZV or VZV virus-like particles (VLP). In some embodiments, live attenuated VZV, fully inactivated VZV or VZV VLP is selected from or derived from the following strains and genotypes: VZV E1 strain, genotype E1_32_5, E1_Kel, E1_Dumas, E1_Russia 1999, E1_SD, E1_MSP, E1_36, E1_49, E1_BC, E1_NH29; VZV E2 strain, genotype E2_03-500, E2_2, E2_11, E2_HJ; VZV J strain, VZVJ strain, VZV1 strain; Genotypes M2_8 and M2_DR; and VZV M4 strain, genotype Spain 4242, France 4415 and Italy 4053.

  Other RNA vaccines comprising RNA polynucleotides that encode other viral protein components of VZV (eg, tegument proteins) are also encompassed by the present disclosure. Accordingly, some embodiments of the present disclosure provide a VZV vaccine comprising at least one ribonucleic acid (RNA) polynucleotide having an open reading frame encoding at least one VZV tegument protein or antigenic fragment or epitope thereof. provide. Some embodiments of the present disclosure have an open reading frame encoding at least one VZV tegument protein or immunogenic fragment or epitope thereof and at least one VZV glycoprotein or immunogenic fragment or epitope thereof. VZV vaccines comprising at least one RNA polynucleotide are provided. Some embodiments of the present disclosure include at least one RNA polynucleotide having an open reading frame encoding at least one VZV tegument protein or immunogenic fragment or epitope thereof and at least one VZV glycoprotein or immunity thereof. VZV vaccines comprising at least one RNA polynucleotide having an open reading frame encoding an original fragment or epitope are provided. In some embodiments, the RNA vaccine comprises one or more VZV tegument proteins and VZV gE, gI, gB, gH, gK, gL, gC, gN, and gM polypeptides or immunogenic fragments or epitopes thereof. RNA (eg, mRNA) polynucleotide (s) encoding one or more VZV glycoproteins selected from In some embodiments, the VZV glycoprotein is a VZV gE polypeptide or an epigenetic fragment or epitope thereof. In some embodiments, the VZV glycoprotein is a VZV gI polypeptide or an epigenetic fragment or epitope thereof. In some embodiments, the VZV glycoprotein is a variant VZV gE polypeptide, such as any of the variant VZV gE polypeptides disclosed herein. In some embodiments, the VZV glycoprotein is a VZV gE glycoprotein and a VZV gI glycoprotein or an immunogenic fragment or epitope thereof.

  In some embodiments, the at least one RNA polynucleotide is SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 41. And at least one nucleic acid selected from homologs having at least 80% (eg, 85%, 90%, 95%, 98%, 99%) identity with a nucleic acid sequence selected from SEQ ID NOs: 1-8 and 41 Encoded by an array. In some embodiments, the at least one RNA polynucleotide is SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 41. And at least 90% (eg, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%) with a nucleic acid sequence selected from SEQ ID NOs: 1-8 and 41 , 99.8% or 99.9%) of at least one nucleic acid sequence selected from homologs having identity. In some embodiments, the at least one RNA polynucleotide is SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 41. And at least a nucleic acid sequence selected from homologs having at least 80% (eg, 85%, 90%, 95%, 98%, 99%) identity with a nucleic acid sequence selected from SEQ ID NOs: 1-8 and 41 It is encoded by one fragment (eg, a fragment having an antigenic sequence or at least one epitope). In some embodiments, the at least one RNA polynucleotide comprises SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8 and SEQ ID NO: 41. Is encoded by at least one epitope of a nucleic acid sequence selected from

  In some embodiments, at least one RNA polynucleotide is the gE polypeptide encoded by SEQ ID NO: 1. In some embodiments, at least one RNA polynucleotide is the gI polypeptide encoded by SEQ ID NO: 2. In some embodiments, at least one RNA polynucleotide is a truncated gE polypeptide encoded by SEQ ID NO: 3. In some embodiments, at least one RNA polynucleotide is a truncated gE polypeptide encoded by SEQ ID NO: 5. In some embodiments, at least one RNA polynucleotide is a truncated gE polypeptide having a Y569A mutation, encoded by SEQ ID NO: 6. In some embodiments, the at least one RNA polynucleotide is a gE polypeptide having the AEAADA sequence of SEQ ID NO: 58, encoded by SEQ ID NO: 7. In some embodiments, the at least one RNA polynucleotide is a gE polypeptide having the Y582G mutation and the AEAADA sequence (SEQ ID NO: 58) encoded by SEQ ID NO: 8. In some embodiments, at least one RNA polynucleotide is the gE polypeptide encoded by SEQ ID NO: 41.

  In some embodiments, the at least one RNA (eg, mRNA) polynucleotide is an amino acid of any of SEQ ID NOs: 10, 14, 18, 22, 26, 30, 34, 38, 42, and 45-55. It encodes an antigenic polypeptide having at least 90% identity to the sequence. In some embodiments, the at least one RNA (eg, mRNA) polynucleotide is an amino acid of any of SEQ ID NOs: 10, 14, 18, 22, 26, 30, 34, 38, 42, and 45-55. It encodes an antigenic polypeptide having at least 95% identity to the sequence. In some embodiments, at least one RNA polynucleotide is at least relative to the amino acid sequence of any of SEQ ID NOs: 10, 14, 18, 22, 26, 30, 34, 38, 42, and 45-55. It encodes an antigenic polypeptide with 96% identity. In some embodiments, the at least one RNA (eg, mRNA) polynucleotide is at least against the amino acid sequence of SEQ ID NOs: 10, 14, 18, 22, 26, 30, 34, 38, 42, and 45-55. It encodes an antigenic polypeptide with 97% identity. In some embodiments, the at least one RNA (eg, mRNA) polynucleotide is an amino acid of any of SEQ ID NOs: 10, 14, 18, 22, 26, 30, 34, 38, 42, and 45-55. It encodes an antigenic polypeptide having at least 98% identity to the sequence. In some embodiments, the at least one RNA (eg, mRNA) polynucleotide is an amino acid of any of SEQ ID NOs: 10, 14, 18, 22, 26, 30, 34, 38, 42, and 45-55. It encodes an antigenic polypeptide having at least 99% identity to the sequence.

  In some embodiments, the open reading frame in which the VZV polypeptide is encoded is codon optimized. In some embodiments, the at least one RNA polynucleotide encodes an antigenic protein of any of SEQ ID NOs: 10, 14, 18, 22, 26, 30, 34, 38, 42, and 45-55. The RNA polynucleotide is a codon optimized mRNA. In some embodiments, the at least one RNA polynucleotide comprises an mRNA sequence identified by any one of SEQ ID NOs: 92-108. In some embodiments, the mRNA sequence identified by any one of SEQ ID NOs: 92-108 is the same as the antigenic VZV polypeptide encoded by any one of SEQ ID NOs: 92-108. Codon-optimized to encode an antigenic VZV polypeptide that is to the extent of immunogenicity or is more immunogenic.

  In some embodiments, the at least one RNA (eg, mRNA) polynucleotide encodes the antigenic protein of SEQ ID NO: 10, and the RNA (eg, mRNA) polynucleotide is 80 relative to the wild-type mRNA sequence. Have less than% identity. In some embodiments, the at least one RNA polynucleotide encodes the antigenic protein of SEQ ID NO: 10, and the RNA (eg, mRNA) polynucleotide is greater than 80% identity to the wild-type mRNA sequence. But does not contain wild-type mRNA sequences. In some embodiments, the at least one RNA (eg, mRNA) polynucleotide encodes the antigenic protein of SEQ ID NO: 42, wherein the RNA (eg, mRNA) polynucleotide is 80 relative to the wild-type mRNA sequence. Have less than% identity. In some embodiments, the at least one RNA (eg, mRNA) polynucleotide encodes the antigenic protein of SEQ ID NO: 42, wherein the RNA polynucleotide is greater than 80% identity to the wild-type mRNA sequence. But does not contain wild-type mRNA sequences. In some embodiments, the at least one RNA (eg, mRNA) polynucleotide encodes the antigenic protein of SEQ ID NO: 14, and the RNA (eg, mRNA) polynucleotide is 80 relative to the wild-type mRNA sequence. Have less than% identity. In some embodiments, the at least one RNA (eg, mRNA) polynucleotide encodes the antigenic protein of SEQ ID NO: 14, and the RNA (eg, mRNA) polynucleotide is 80 relative to the wild-type mRNA sequence. % Identity but does not include wild-type mRNA sequences. In some embodiments, the at least one RNA (eg, mRNA) polynucleotide encodes the antigenic protein of SEQ ID NO: 26, wherein the RNA polynucleotide is less than 80% identical to the wild-type mRNA sequence. Have In some embodiments, the at least one RNA (eg, mRNA) polynucleotide encodes the antigenic protein of SEQ ID NO: 26, wherein the RNA (eg, mRNA) polynucleotide is 80 relative to the wild-type mRNA sequence. % Identity but does not include wild-type mRNA sequences. In some embodiments, the at least one RNA (eg, mRNA) polynucleotide encodes the antigenic protein of SEQ ID NO: 30, wherein the RNA polynucleotide is less than 80% identical to the wild-type mRNA sequence. Have In some embodiments, the at least one RNA polynucleotide encodes the antigenic protein of SEQ ID NO: 30, and the RNA (eg, mRNA) polynucleotide is greater than 80% identity to the wild-type mRNA sequence. But does not contain wild-type mRNA sequences. In some embodiments, the at least one RNA (eg, mRNA) polynucleotide is encoded by a sequence selected from any of SEQ ID NOs: 1-8 and SEQ ID NO: 41 and includes at least one chemical modification. .

  In some embodiments, the VZV vaccine is multivalent. In some embodiments, the RNA polynucleotide comprises a VZV E1 strain comprising, for example, any one or more of the genotypes E1_32_5, E1_Kel, E1_Dumas, E1_Russia1999, E1_SD, E1_MSP, E1_36, E1_49, E1_BC, and E1_NH29. Contains the derived polynucleotide sequence. In some embodiments, the RNA (eg, mRNA) polynucleotide is a polynucleotide sequence derived from a VZV E2 strain, including, for example, any one or more of genotypes E2 — 03-500, E2 — 2, E2 — 11, and E2 — HJO. including. In some embodiments, the RNA (eg, mRNA) polynucleotide comprises a polynucleotide sequence derived from the VZV J strain, including, for example, genotype pOka. In some embodiments, the RNA (eg, mRNA) polynucleotide comprises a polynucleotide sequence derived from the VZV M1 strain, including, for example, genotype M1_CA123. In some embodiments, the RNA (eg, mRNA) polynucleotide comprises a polynucleotide sequence derived from the VZV M2 strain, including, for example, genotypes M2_8 and M2_DR. In some embodiments, the RNA (eg, mRNA) polynucleotide comprises a polynucleotide sequence derived from the VZV M4 strain, including, for example, any one or more of the genotypes Spain 4242, France 4415, and Italy 4053.

  Some embodiments of the present disclosure provide at least one ribonucleic acid (RNA) polynucleotide having an open reading frame encoding at least one VZV antigenic polypeptide or immunogenic fragment thereof and at least one 5 ′ end cap. A VZV vaccine is provided. In some embodiments, the 5 'end cap is 7mG (5') ppp (5 ') NlpNp. Some embodiments of the present disclosure include at least one RNA (eg, mRNA) polynucleotide having an open reading frame encoding at least one VZV antigenic polypeptide or immunogenic fragment thereof, wherein the at least one RNA (eg, mRNA) polynucleotides provide VZV vaccines having at least one chemical modification. In some embodiments, the at least one RNA (eg, mRNA) polynucleotide further comprises a second chemical modification. In some embodiments, at least one RNA (eg, mRNA) polynucleotide having at least one chemical modification has a 5 'end cap. In some embodiments, the at least one chemical modification is pseudouridine, N1-methyl pseudouridine, N1-ethyl pseudouridine, 2-thiouridine, 4′-thiouridine, 5-methylcytosine, 2-thio-1- Methyl-1-deaza-pseudouridine, 2-thio-1-methyl-pseudouridine, 2-thio-5-aza-uridine, 2-thio-dihydropseudouridine, 2-thio-dihydrouridine, 2-thio-pseudouridine, 4-methoxy-2-thio-pseudouridine, 4-methoxy-pseudouridine, 4-thio-1-methyl-pseudouridine, 4-thio-pseudouridine, 5-aza-uridine, dihydropseudouridine, 5-methoxyuridine and 2 ′ Selected from -O-methyluridine. In some embodiments, all (100%) of the uridine of at least one RNA polynucleotide comprises a chemical modification, such as an N1-methyl pseudouridine modification or an N1-ethyl pseudouridine modification.

  Some embodiments of the present disclosure are VZV vaccines comprising at least one ribonucleic acid (RNA) polynucleotide having an open reading frame encoding at least one VZV antigenic polypeptide or immunogenic fragment thereof, At least 80% (eg, 85%, 90%, 95%, 98%, 99%, 100%) of uracil in the open reading frame has chemical modifications, and optionally, the vaccine is contained within lipid nanoparticles. A VZV vaccine is provided which is formulated in In some embodiments, 100% of uracil in the open reading frame has a chemical modification. In some embodiments, the chemical modification is at position 5 of uracil. In some embodiments, the chemical modification is N1-methyl pseudouridine. In some embodiments, 100% of the uracils in the open reading frame are modified to include N1-methyl pseudouridine.

  Some embodiments of the present disclosure provide a VZV vaccine formulated in cationic lipid nanoparticles. In some embodiments, the cationic lipid nanoparticles comprise a cationic lipid, a PEG-modified lipid, a sterol, and a non-cationic lipid. In some embodiments, the cationic lipid is an ionic cationic lipid, the non-cationic lipid is a neutral lipid, and the sterol is cholesterol. In some embodiments, the cationic lipid is 2,2-dilinoleyl-4-dimethylaminoethyl- [1,3] -dioxolane (DLin-KC2-DMA), dilinoleyl-methyl-4-dimethylaminobutyrate ( DLin-MC3-DMA), di ((Z) -non-2-en-1-yl) 9-((4- (dimethylamino) butanoyl) oxy) heptadecandioate (L319), (12Z, 15Z) -N, N-dimethyl-2-nonylhenicosa-12,15-dien-1-amine (L608) and N, N-dimethyl-1-[(1S, 2R) -2-octylcyclopropyl] heptadecan-8-amine (L530).

In some embodiments, the lipid is
It is.

In some embodiments, the lipid is
It is.

  In some embodiments, the cationic lipid nanoparticles comprise about 20-60% cationic lipid, about 5-25% non-cationic lipid, about 25-55% sterol and about 0.5-15% PEG-modified lipid. Having a molar ratio of In some embodiments, the nanoparticles have a polydispersity value less than 0.4. In some embodiments, the nanoparticles have a neutral net charge at a neutral pH value. In some embodiments, the nanoparticles have an average diameter of 50-200 nm.

  Some embodiments of the present disclosure induce an antigen-specific immune response in a subject comprising administering to the subject a VZV RNA (eg, mRNA) vaccine in an amount effective to produce an antigen-specific immune response. Provide a method. In some embodiments, the antigen-specific immune response comprises a T cell response or a B cell response. In some embodiments, the antigen-specific immune response comprises a T cell response and a B cell response. In some embodiments, the method of producing an antigen-specific immune response involves a single administration of the vaccine. In some embodiments, the method further comprises administering a booster dose of the vaccine to the subject. In some embodiments, the vaccine is administered to the subject by intradermal or intramuscular injection.

  Also provided herein is a VZV RNA (eg, mRNA) vaccine for use in a method for inducing an antigen-specific immune response in a subject, which method is effective to produce an antigen-specific immune response. Including administering the vaccine to the subject in an amount.

  Further provided herein is the use of a VZV RNA (eg, mRNA) vaccine in the manufacture of a medicament for use in a method for inducing an antigen-specific immune response in a subject, the method comprising an antigen-specific immune response. Administration of the vaccine to the subject in an amount effective to provide.

  Some aspects of the present disclosure provide a method of preventing or treating a VZV infection comprising administering to a subject a VZV RNA (eg, mRNA) vaccine of the present disclosure. In some embodiments, the VZV RNA (eg, mRNA) vaccine is formulated in an amount effective to produce an antigen-specific immune response in the subject.

  Some embodiments of the present disclosure provide a method of inducing an antigen-specific immune response in a subject, the method being described herein in an amount effective to produce an antigen-specific immune response in the subject. Administering a VZV RNA (eg, mRNA) vaccine to the subject.

  In some embodiments, the titer of the anti-VZV antigenic polypeptide antibody produced in the subject is increased by at least 1 log relative to the control. In some embodiments, the titer of anti-VZV antigenic polypeptide antibody produced in the subject is increased by 1 to 3 logs relative to the control.

  In some embodiments, the titer of anti-VZV antigenic polypeptide antibody produced in the subject is increased by at least 2-fold compared to the control. In some embodiments, the titer of anti-VZV antigenic polypeptide antibody produced in the subject is increased by at least 5-fold compared to the control. In some embodiments, the titer of the anti-VZV antigenic polypeptide antibody produced in the subject is increased by at least 10-fold compared to the control. In some embodiments, the titer of the anti-VZV antigenic polypeptide antibody produced in the subject is increased by 2-10 fold compared to the control.

  In some embodiments, the control is the titer of anti-VZV antigenic polypeptide antibody produced in a subject who has never received a VZV vaccine. In some embodiments, the control is the titer of anti-VZV antigenic polypeptide antibody produced in a subject who has been administered a live attenuated or inactivated VZV vaccine. In some embodiments, the control is the titer of anti-VZV antigenic polypeptide antibody produced in a subject who has been administered a recombinant or purified VZV protein vaccine. In some embodiments, the control is the titer of anti-VZV antigenic polypeptide antibody produced in a subject who has been administered a VZV virus-like particle (VLP) vaccine.

  In some embodiments, the effective amount is a dose equivalent to a dose that reduces the standard therapeutic dose of the recombinant VZV protein vaccine by at least 1/2, and the titer of anti-VZV antigenic polypeptide antibody produced in the subject. The potency of anti-VZV antigenic polypeptide antibodies produced in control subjects administered a recombinant or purified VZV protein vaccine, or a live attenuated or inactivated VZV vaccine, or a standard therapeutic dose of a VZV VLP vaccine. It is equivalent to the price.

  In some embodiments, the effective amount is a dose equivalent to a dose that reduces the standard therapeutic dose of the recombinant VZV protein vaccine by at least 1/4, and the titer of anti-VZV antigenic polypeptide antibody produced in the subject. The potency of anti-VZV antigenic polypeptide antibodies produced in control subjects administered a recombinant or purified VZV protein vaccine, or a live attenuated or inactivated VZV vaccine, or a standard therapeutic dose of a VZV VLP vaccine. It is equivalent to the price.

  In some embodiments, the effective amount is a dose equivalent to a dose obtained by reducing the standard therapeutic dose of a recombinant VZV protein vaccine by at least 1/10, and the titer of anti-VZV antigenic polypeptide antibody produced in the subject. The potency of anti-VZV antigenic polypeptide antibodies produced in control subjects administered a recombinant or purified VZV protein vaccine, or a live attenuated or inactivated VZV vaccine, or a standard therapeutic dose of a VZV VLP vaccine. It is equivalent to the price.

  In some embodiments, the effective amount is a dose equivalent to a dose obtained by reducing the standard therapeutic dose of a recombinant VZV protein vaccine by at least 1/100, and the titer of anti-VZV antigenic polypeptide antibody produced in the subject. The potency of anti-VZV antigenic polypeptide antibodies produced in control subjects administered a recombinant or purified VZV protein vaccine, or a live attenuated or inactivated VZV vaccine, or a standard therapeutic dose of a VZV VLP vaccine. It is equivalent to the price.

  In some embodiments, the effective amount is a dose equivalent to a dose obtained by reducing the standard therapeutic dose of a recombinant VZV protein vaccine by at least 1/1000, and the titer of anti-VZV antigenic polypeptide antibody produced in the subject. The potency of anti-VZV antigenic polypeptide antibodies produced in control subjects administered a recombinant or purified VZV protein vaccine, or a live attenuated or inactivated VZV vaccine, or a standard therapeutic dose of a VZV VLP vaccine. It is equivalent to the price.

  In some embodiments, the effective amount is a dose equivalent to a dose that reduces the standard therapeutic dose of a recombinant VZV protein vaccine by 1/2 to 1/1000 and is produced in a subject with an anti-VZV antigenic polypeptide antibody. The anti-VZV antigenic polypeptide produced in a control subject administered a recombinant or purified VZV protein vaccine, or a live attenuated or inactivated VZV vaccine, or a standard therapeutic dose of a VZV VLP vaccine. Equivalent to antibody titer.

  In some embodiments, the effective amount is a total dose of 25 μg to 1000 μg, or 50 μg to 1000 μg, or 25 to 200 μg. In some embodiments, the effective amount is a total dose of 50 μg, 100 μg, 200 μg, 400 μg, 800 μg or 1000 μg. In some embodiments, the effective amount is a total dose of 200 μg. In some embodiments, the effective amount is a total dose of 50 μg to 400 μg. In some embodiments, the effective amount is a total dose of 50 μg, 100 μg, 150 μg, 200 μg, 250 μg, 300 μg, 350 μg or 400 μg. In some embodiments, the effective amount is a 25 μg dose administered to the subject a total of two times. In some embodiments, the effective amount is a 50 μg dose administered to the subject a total of two times. In some embodiments, an effective amount is a 100 μg dose administered to a subject a total of two times. In some embodiments, the effective amount is a 200 μg dose administered to the subject a total of two times. In some embodiments, the effective amount is a 400 μg dose administered to the subject a total of two times. In some embodiments, the effective amount is a 500 μg dose administered to the subject a total of two times.

  In some embodiments, the efficacy (or efficacy rate) of a VZV RNA (eg, mRNA) vaccine against VZV is greater than 60%.

Vaccine efficacy can be assessed using standard assays (see, eg, Weinberg et al., J Infect Dis. 2010 Jun 1; 201 (11): 1607-10). For example, vaccine efficacy can be determined by a double-blind randomized controlled clinical trial. Vaccine efficacy can be expressed as a proportional reduction in morbidity (AR) between non-vaccinated (ARU) and vaccinated (ARV) test cohorts, using the following formula: It can be calculated from the relative risk (RR).
Effectiveness = (ARU-ARV) / ARU × 100 and Effectiveness = (1−RR) × 100

Similarly, vaccine efficacy rates can be assessed using standard analyzes (see, eg, Weinberg et al., J Infect Dis. 2010 Jun 1; 201 (11): 1607-10). Vaccine efficacy rate is an assessment of how much a vaccine (which may already prove the effectiveness of the vaccine) reduces disease in the population. This scale can assess not only the vaccine itself, but also the net balance between the benefits and adverse effects of the vaccination program under more natural conditions than comparative clinical trials. Vaccine efficiency is proportional to vaccine efficacy (efficacy), but is influenced by how well the target group in the population is immunized, and is also “real” in hospitalization, outpatient consultation or cost It is also influenced by other non-vaccine related factors that affect the outcome. For example, a retrospective case control analysis that compares the inoculation rate between a series of infected cases and appropriate controls can be used. Vaccine efficacy can be expressed as the rate difference using the odds ratio (OR) that developed an infection despite being vaccinated.
Effective rate = (1-OR) × 100

  In some embodiments, the efficacy (or efficacy rate) of a VZV RNA (eg, mRNA) vaccine against VZV is greater than 65%. In some embodiments, the effectiveness (or efficacy rate) of the vaccine against VZV is greater than 70%. In some embodiments, the effectiveness (or efficacy rate) of the vaccine against VZV is greater than 75%. In some embodiments, the effectiveness (or efficacy rate) of the vaccine against VZV is greater than 80%. In some embodiments, the effectiveness (or efficacy rate) of the vaccine against VZV is greater than 85%. In some embodiments, the effectiveness (or efficacy rate) of the vaccine against VZV is greater than 90%.

  In some embodiments, the vaccine immunizes a subject against VZV for up to 1 year (eg, during a single VZV season). In some embodiments, the vaccine immunizes the subject against VZV for up to 2 years. In some embodiments, the vaccine immunizes the subject against VZV for more than 2 years. In some embodiments, the vaccine immunizes the subject against VZV for more than 3 years. In some embodiments, the vaccine immunizes the subject against VZV for more than 4 years. In some embodiments, the vaccine immunizes the subject against VZV for 5-10 years.

  In some embodiments, a subject receiving a VZV RNA (eg, mRNA) vaccine has an age between about 12 months and about 10 years (eg, about 1, 2, 3, 4, 5, 6, 7 , 8, 9 or 10 years old). In some embodiments, a subject receiving a VZV RNA (eg, mRNA) vaccine has an age between about 12 months to about 15 months (eg, about 12, 12.5, 13, 13.5, 14 14.5 or 15 months). In some embodiments, a subject receiving a VZV RNA (eg, mRNA) vaccine has an age between about 4 years and about 6 years (eg, about 4, 4.5, 5, 5.6 or 6). Years old).

  In some embodiments, the subject is a young adult between about 20 years old and about 50 years old (eg, about 20, 25, 30, 35, 40, 45, or 50 years old).

  In some embodiments, the subject is an elderly subject of about 60 years old, about 70 years old or older (eg, about 60, 65, 70, 75, 80, 85 or 90 years old).

  In some embodiments, the subject has been exposed to VZV, is infected with VZV, or is at risk of infection with VZV.

  In some embodiments, the subject is immunocompromised (has an immune system disorder, such as an immune system disease or an autoimmune disease).

  Some aspects of the present disclosure provide a VZV RNA (eg, mRNA) vaccine containing a signal peptide linked to a varicella-zoster virus (VZV) antigenic polypeptide. Thus, in some embodiments, a VZV RNA (eg, mRNA) vaccine contains at least one ribonucleic acid (RNA) polynucleotide having an open reading frame encoding a signal peptide linked to a VZV antigenic peptide. . Also provided herein are nucleic acids encoding the VZV RNA (eg, mRNA) vaccines disclosed herein.

  Another aspect of the disclosure provides a VZV vaccine containing a signal peptide linked to a varicella-zoster virus (VZV) antigenic polypeptide. In some embodiments, the VZV antigenic polypeptide is a VZV glycoprotein. In some embodiments, the VZV glycoprotein is selected from VZV gE, gI, gB, gH, gK, gL, gC, gN and gM. In some embodiments, the VZV glycoprotein is a VZV gE or variant VZV gE polypeptide.

  In some embodiments, the signal peptide is an IgE signal peptide. In some embodiments, the signal peptide is an IgE HC (Ig heavy chain ε-1) signal peptide. In some embodiments, the signal peptide has the sequence MDWTWILFLVAAAATRVHS (SEQ ID NO: 56). In some embodiments, the signal peptide is an IgGκ signal peptide. In some embodiments, the signal peptide has the sequence METPAQLLFLLLLLWLPDTTG (SEQ ID NO: 57). In some embodiments, the signal peptide is selected from Japanese encephalitis PRM signal sequence (MLGSSNSGQRVVFTILLLLVAPAYS, SEQ ID NO: 109), VSVg protein signal sequence (MKCLLYLAFLFIGVNCA, SEQ ID NO: 110) and Japanese encephalitis JEV signal sequence (MWLVSLAIVTACAGA, SEQ ID NO: 111). Is done.

  In addition, nucleic acids encoding the VZV vaccines disclosed herein are also provided herein. Such VZV vaccines include at least one ribonucleic acid (RNA) (eg, mRNA) polynucleotide having an open reading frame encoding a signal peptide linked to a VZV antigenic polypeptide. In some embodiments, the VZV antigenic peptide is a VZV glycoprotein. In some embodiments, the VZV glycoprotein is selected from VZV gE, gI, gB, gH, gK, gL, gC, gN and gM. In some embodiments, the VZV antigenic peptide is a variant of a VZV gE or gE polypeptide.

  In some embodiments, an effective amount of a VZV RNA (eg, mRNA) vaccine (eg, a single dose of a VZV vaccine) is 2-fold to 200-fold (eg, about 2, 3, 4) compared to a control. 5, 6, 7, 8, 9, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190 or 200 Resulting in an increase in serum neutralizing antibodies to VZV. In some embodiments, a single dose of VZV RNA (eg, mRNA) vaccine results in an approximately 5-fold, 50-fold, or 150-fold increase in serum neutralizing antibodies to VZV compared to controls. In some embodiments, a single dose of VZV RNA (eg, mRNA) vaccine results in an increase in serum neutralizing antibodies to VZV of about 2-fold to 10-fold or about 40-60-fold compared to control. .

  In some embodiments, the effectiveness of the RNA vaccine RNA (eg, mRNA) is particularly in combination with mRNA encoding one or more antigens combined with mRNA encoding flagellin when combined with a flagellin adjuvant. Sometimes it can improve significantly.

  RNA (eg, mRNA) vaccines combined with flagellin adjuvants (eg, mRNA-encoded flagellin adjuvants) are superior in that they have higher antibody titers and can provide a faster response compared to commercial vaccine formulations. Has characteristics. While not wishing to be bound by theory, RNA vaccines, such as mRNA polynucleotides, can be used for translation of antigens and adjuvants during translation because RNA (eg, mRNA) vaccines utilize natural cellular machinery. It would be well designed to produce a protein conformation that is appropriate for both. Unlike conventional vaccines that are produced ex vivo and can elicit unwanted cellular responses, RNA (eg, mRNA) vaccines are brought into cell lines in a more natural way.

  Some embodiments of the present disclosure provide an open reading frame encoding at least one antigenic polypeptide or an immunogenic fragment thereof (eg, an immunogenic fragment capable of inducing an immune response against the antigenic polypeptide). Provided is an RNA (eg, mRNA) vaccine comprising at least one RNA (eg, mRNA) polynucleotide having an at least one RNA (eg, mRNA polynucleotide) having an open reading frame encoding a flagellin adjuvant. .

  In some embodiments, at least one flagellin polypeptide (eg, encoded flagellin polypeptide) is a flagellin protein. In some embodiments, at least one flagellin polypeptide (eg, encoded flagellin polypeptide) is an immunogenic flagellin fragment. In some embodiments, at least one flagellin polypeptide and at least one antigenic polypeptide are encoded by a single RNA (eg, mRNA) polynucleotide. In other embodiments, at least one flagellin polypeptide and at least one antigenic polypeptide are each encoded by a different RNA polynucleotide.

  In some embodiments, at least one flagellin polypeptide is at least 80%, at least 85%, at least 90%, or at least 95 relative to a flagellin polypeptide having any of SEQ ID NOs: 115-117. % Identity.

  In some embodiments, the nucleic acid vaccines described herein are chemically modified. In other embodiments, the nucleic acid vaccine is not modified.

  Yet another aspect includes administering to a subject a nucleic acid vaccine comprising one or more RNA polynucleotides having an open reading frame encoding a first antigenic VZV polypeptide, wherein the RNA polynucleotide is stabilized. Provided are compositions and methods for vaccinating a subject that are free of components and do not co-formulate or co-administer an adjuvant with the vaccine.

  In another aspect, the invention comprises administering to a subject a nucleic acid vaccine comprising one or more RNA polynucleotides having an open reading frame encoding a first viral antigenic polypeptide, from 10 μg / kg to 400 μg. A composition and method for vaccination of a subject, wherein a nucleic acid vaccine at a dose of / kg is administered to the subject. In some embodiments, the dosage of RNA polynucleotide is 1-5 μg, 5-10 μg, 10-15 μg, 15-20 μg, 10-25 μg, 20-25 μg, 20-50 μg, 30-50 μg, 40-50 μg, 40-60 μg, 60-80 μg, 60-100 μg, 50-100 μg, 80-120 μg, 40-120 μg, 40-150 μg, 50-150 μg, 50-200 μg, 80-200 μg, 100-200 μg, 120-250 μg, 150- 250 μg, 180-280 μg, 200-300 μg, 50-300 μg, 80-300 μg, 100-300 μg, 40-300 μg, 50-350 μg, 100-350 μg, 200-350 μg, 300-350 μg, 320-400 μg, 40-380 μg, 40-100 μg, 100- 400 μg, 200-400 μg or 300-400 μg / dose. In some embodiments, the nucleic acid vaccine is administered to the subject by intradermal or intramuscular injection. In some embodiments, the nucleic acid vaccine is administered to the subject on day 0. In some embodiments, a second dose of the nucleic acid vaccine is administered to the subject on day 21.

  In some embodiments, the nucleic acid vaccine administered to the subject includes a 25 μg dose of RNA polynucleotide. In some embodiments, a nucleic acid vaccine administered to a subject includes a 100 μg dose of RNA polynucleotide. In some embodiments, the nucleic acid vaccine administered to the subject includes a 50 μg dose of RNA polynucleotide. In some embodiments, the nucleic acid vaccine administered to a subject includes a 75 μg dose of RNA polynucleotide. In some embodiments, the nucleic acid vaccine administered to the subject includes a 150 μg dose of RNA polynucleotide. In some embodiments, the nucleic acid vaccine administered to a subject includes a 400 μg dose of RNA polynucleotide. In some embodiments, the nucleic acid vaccine administered to a subject includes a 200 μg dose of RNA polynucleotide. In some embodiments, the RNA polynucleotide accumulates at a 100-fold higher level in local lymph nodes as compared to distal lymph nodes. In other embodiments, the nucleic acid vaccine is chemically modified, and in other embodiments, the nucleic acid vaccine is not chemically modified.

  An aspect of the invention is a nucleic acid vaccine comprising one or more RNA polynucleotides having an open reading frame encoding a first antigenic polypeptide, the RNA polynucleotide comprising a stabilizing element and a pharmaceutically acceptable Nucleic acid vaccines are provided that are free of carriers or excipients that are used and adjuvants are not included in the vaccine. In some embodiments, the stabilizing element is a histone stem loop. In some embodiments, the stabilizing element is a nucleic acid sequence that is rich in GC compared to the wild-type sequence.

  An aspect of the invention is a nucleic acid vaccine comprising one or more RNA polynucleotides having an open reading frame encoding a first antigenic polypeptide, wherein the RNA polynucleotide is in a percentage acceptable to a human subject. Nucleic acid vaccines are provided that are present in a formulation for in vivo administration to a host that confers antibody titers that exceed antibody retention standards for a first antigen. In some embodiments, the titer of the antibody produced by the mRNA vaccine of the invention is that of a neutralizing antibody. In some embodiments, the neutralizing antibody titer is greater than the protein vaccine. In other embodiments, the titer of neutralizing antibodies produced by the mRNA vaccines of the invention is greater than adjuvanted protein vaccines. In still other embodiments, the titer of the neutralizing antibody produced by the mRNA vaccine of the present invention is 1,000-10,000, 1,200-10,000, 1,400-10,000, 1, 500 to 10,000, 1,000 to 5,000, 1,000 to 4,000, 1,800 to 10,000, 2000 to 10,000, 2,000 to 5,000, 2,000 to 3, 000, 2,000 to 4,000, 3,000 to 5,000, 3,000 to 4,000, or 2,000 to 2,500. Neutralizing titers are typically expressed as the maximum serum dilution required to achieve a 50% reduction in plaque number.

  A nucleic acid vaccine comprising one or more RNA polynucleotides having an open reading frame encoding a first antigenic polypeptide, wherein the RNA polynucleotide has a stabilizing element or is formulated with an adjuvant. A nucleic acid vaccine present in a formulation for in vivo administration to a host that elicits a high antibody titer that persists longer than that induced by an mRNA vaccine encoding the first antigenic polypeptide. Provided. In some embodiments, the RNA polynucleotide is formulated to produce neutralizing antibodies within one week after a single dose. In some embodiments, the adjuvant is selected from a cationic peptide and an immunostimulatory nucleic acid. In some embodiments, the cationic peptide is protamine.

  Some embodiments have an open reading frame that includes at least one chemical modification, or optionally no chemical modification, wherein the open reading frame encodes a first antigenic polypeptide. A nucleic acid vaccine comprising an RNA polynucleotide, wherein the RNA polynucleotide encodes a first antigenic polypeptide whose host antigen expression level has a stabilizing element or is formulated with an adjuvant A nucleic acid vaccine is provided that is present in a formulation for in vivo administration to a host so as to significantly exceed the antigen expression level provided by.

  Other embodiments have an open reading frame that includes at least one chemical modification, or optionally no chemical modification, wherein the open reading frame encodes a first antigenic polypeptide. Nucleic acid vaccines comprising polynucleotides, wherein the unmodified mRNA vaccine is at least 1/10 fewer RNA polynucleotides than the RNA polynucleotides required to provide comparable antibody titers. In some embodiments, the RNA polynucleotide is present at a dose of 25-100 μg.

  Aspects of the invention also have an open reading frame that includes at least one chemical modification, or optionally no chemical modification, wherein the open reading frame encodes one or more of the first antigenic polypeptides. A unit-of-use vaccine is provided comprising 10 μg-400 μg of an RNA polynucleotide of and a pharmaceutically acceptable carrier or excipient, formulated for delivery to a human subject. In some embodiments, the vaccine further comprises cationic lipid nanoparticles.

  Aspects of the invention provide a method of forming, maintaining or repairing antigenic memory for a VZV strain in an individual or population of individuals, the method comprising administering to the individual or population an antigen memory booster nucleic acid vaccine, The nucleic acid vaccine comprises (a) at least one RNA polynucleotide, comprising at least one chemical modification, optionally no chemical modification, and comprising two or more codon optimized open reading frames, An open reading frame comprises a polynucleotide encoding a series of reference antigenic polypeptides and (b) optionally a pharmaceutically acceptable carrier or excipient. In some embodiments, the vaccine is administered to the individual via a route selected from the group consisting of intramuscular, intradermal, and subcutaneous administration. In some embodiments, the administering step comprises contacting a device suitable for injection of the composition with the subject's muscle tissue. In some embodiments, the administering step comprises contacting the subject's muscle tissue with a device suitable for injection of the composition in combination with electroporation.

  Aspects of the invention provide a method of vaccinating a subject, the method comprising a nucleic acid vaccine comprising one or more RNA polynucleotides having an open reading frame encoding the first antigenic polypeptide in an effective amount. Administration of a single dose of 25 μg / kg to 400 μg / kg to the subject and vaccination of the subject.

  Another aspect is a nucleic acid vaccine comprising an open reading frame comprising at least one chemical modification, the open reading frame comprising one or more RNA polynucleotides encoding a first antigenic polypeptide. A nucleic acid vaccine is provided wherein the RNA polynucleotide is at least 1/10 less than the RNA polynucleotide required for the unmodified mRNA vaccine to provide comparable antibody titers. In some embodiments, the RNA polynucleotide is present at a dose of 25-100 μg.

  Another aspect is a nucleic acid vaccine comprising an LNP formulated RNA polynucleotide having an open reading frame that does not include a modified nucleotide (unmodified), wherein the open reading frame encodes a first antigenic polypeptide. An unmodified mRNA vaccine not formulated with LNP provides a nucleic acid vaccine with at least 1/10 fewer RNA polynucleotides than the RNA polynucleotides required to provide comparable antibody titers. In some embodiments, the RNA polynucleotide is present at a dose of 25-100 μg.

  The data presented in the examples show that the immune response is significantly improved using the formulations of the present invention. The data demonstrated the effectiveness of both chemically and unmodified RNA vaccines of the present disclosure. Surprisingly, in contrast to the prior art direction where it is preferable to formulate in a carrier using unchemically modified mRNA for the production of vaccines, chemically modified mRNA-LNP vaccines It has been discovered herein that the effective mRNA dose required is significantly lower than unmodified mRNA, ie, 1/10 less than unmodified mRNA formulated in a carrier other than LNP. The RNA vaccines of the present invention, both chemically modified and unmodified, provide a better immune response than mRNA vaccines formulated in different lipid carriers.

  In other embodiments, the present invention administers to a subject an effective amount of a nucleic acid vaccine comprising one or more RNA polynucleotides having an open reading frame encoding a VZV antigenic polypeptide to vaccinate the subject. A method of treating an elderly subject 60 years of age or older.

  In other embodiments, the present invention administers to a subject an effective amount of a nucleic acid vaccine comprising one or more RNA polynucleotides having an open reading frame encoding a VZV antigenic polypeptide to vaccinate the subject. A method of treating a young subject who is 17 years of age or younger.

  In other embodiments, the present invention administers to a subject an effective amount of a nucleic acid vaccine comprising one or more RNA polynucleotides having an open reading frame encoding a VZV antigenic polypeptide to vaccinate the subject. A method of treating an adult subject.

  The RNA polynucleotide is one of SEQ ID NOs: 1-8 and 41 and includes at least one chemical modification. In other embodiments, the RNA polynucleotide is one of SEQ ID NOs: 1-8 and 41 and does not contain any nucleotide modifications or is unmodified. In still other embodiments, the at least one RNA polynucleotide encodes an antigenic protein of any of SEQ ID NOs: 10, 14, 18, 22, 26, 30, 34, 38, 42, and 45-55. , Including at least one chemical modification. In other embodiments, the RNA polynucleotide encodes an antigenic protein of any of SEQ ID NOs: 10, 14, 18, 22, 26, 30, 34, 38, 42, and 45-55, and any nucleotide modification Is not included or unmodified.

  In preferred embodiments, the vaccines of the invention (eg, LNP-encapsulated mRNA vaccines) have prophylactically and / or therapeutically effective levels, concentrations and / or levels of antigen-specific antibodies in the blood or serum of the vaccinated subject. Or bring the titer. As defined herein, the term antibody titer refers to the amount of antigen-specific antibody produced in a subject, eg, a human subject. In an exemplary embodiment, antibody titer is expressed as the reciprocal of the highest dilution (serial dilution) that still yields a positive result. In an exemplary embodiment, antibody titer is determined or measured by enzyme linked immunosorbent assay (ELISA). In an exemplary embodiment, antibody titer is determined or measured by a neutralization assay, eg, a microneutralization assay. In certain embodiments, antibody titer measurements are expressed in ratios of 1:40, 1: 100, and the like.

  In an exemplary embodiment of the invention, an effective vaccine is greater than 1:40, greater than 1: 100, greater than 1: 400, greater than 1: 1000, greater than 1: 2000, greater than 1: 3000, greater than 1: 4000, It results in antibody titers greater than 1: 500, 1: 6000, 1: 7500, 1: 10000. In an exemplary embodiment, is the antibody titer provided by 10 days after vaccination, 20 days after vaccination, 30 days after vaccination, 40 days after vaccination or after 50 days after vaccination? Achieved. In exemplary embodiments, the titer is provided or achieved after administering a single dose of vaccine to the subject. In other embodiments, the titer is effected or achieved after multiple administrations, eg, after a first dose and a second dose (eg, a booster dose).

  In exemplary embodiments of the invention, antigen-specific antibodies are measured in μg / ml or measured in IU / L (international units / liter) or mIU / ml (milli international units / ml). . In an exemplary embodiment of the invention, an effective vaccine is> 0.5 μg / ml,> 0.1 μg / ml,> 0.2 μg / ml,> 0.35 μg / ml,> 0.5 μg / ml, This results in> 1 μg / ml,> 2 μg / ml,> 5 μg / ml or> 10 μg / ml. In exemplary embodiments of the invention, effective vaccines are> 10 mIU / ml,> 20 mIU / ml,> 50 mIU / ml,> 100 mIU / ml,> 200 mIU / ml,> 500 mIU / ml or> 1000 mIU / ml. Bring. In exemplary embodiments, the level or concentration of the antibody is provided 10 days after vaccination, 20 days after vaccination, 30 days after vaccination, 40 days after vaccination, or more than 50 days after vaccination. Or achieved. In an exemplary embodiment, the level or concentration is provided or achieved after administering a single dose of vaccine to the subject. In other embodiments, the level or concentration is provided or achieved after multiple administrations, eg, after a first dose and a second dose (eg, a booster dose). In exemplary embodiments, antibody levels or concentrations are determined or measured by enzyme linked immunosorbent assay (ELISA). In exemplary embodiments, antibody levels or concentrations are determined or measured by neutralization assays, eg, microneutralization assays.

  Each of the limitations of the invention can encompass various embodiments of the invention. Thus, it is envisioned that each of the limitations of the invention involving any one element or combination of elements can be included in each aspect of the invention. The invention is not limited in its application to the details of construction and the arrangement of components set forth in the following description or illustrated in the drawings. The invention is capable of other embodiments and of being practiced or carried out in various ways.

  The accompanying drawings are not intended to be drawn to scale. In the drawings, each identical or nearly identical component that is illustrated in various figures is represented by a like numeral. For clarity, names may not be assigned to all components in the drawings.

It is a schematic diagram which shows the viral pathway of the varicella zoster which has been proposed. It is a schematic diagram of a construct encoding VZV gE (Oka strain). 2 shows the study design and injection schedule for immunization of BALB / C mice with VZV gE antigen encoded by MC3 formulated mRNA. It is a schematic diagram which shows various variant VZV gE antigens. The figure shows SEQ ID NOS 120, 132 and 58 from top to bottom, respectively. FIG. 5 is a graph representing the results of an ELISA assay showing anti-VZV gE IgG levels in the serum of mice vaccinated with various VZV gE mRNAs compared to VARIVAX® vaccines. FIG. 5 is a graph representing the results of an ELISA assay showing anti-VZV gE IgG levels in the serum of mice vaccinated with various VZV gE mRNAs compared to VARIVAX® vaccines. FIG. 5 is a graph representing the results of an ELISA assay showing anti-VZV gE IgG levels in the serum of mice vaccinated with various VZV gE mRNAs compared to VARIVAX® vaccines. 8A and 8B show confocal microscopic images of human melanoma (MeWo) cells stained with an antibody representing the Golgi apparatus. FIGS. 9A-9C show confocal microscopic images of MeWo cells stained with antibodies against VZV gE to show VZV gE expression and transport. The sequence AEAADA shown in FIG. 9C is SEQ ID NO: 58. 10A and 10B are phylogeny diagrams representing various VZV wild type genotypes. FIGS. 11A and 11B are graphs representing the results of an ELISA assay showing the anti-VZV gE IgG levels in the serum of mice vaccinated with VZV gE variant mRNA compared to the ZOSTAVAX® vaccine. The sequence AEAADA shown in FIGS. 11A and 11B is SEQ ID NO: 58. FIGS. 11A and 11B are graphs representing the results of an ELISA assay showing the anti-VZV gE IgG levels in the serum of mice vaccinated with VZV gE variant mRNA compared to the ZOSTAVAX® vaccine. The sequence AEAADA shown in FIGS. 11A and 11B is SEQ ID NO: 58. FIGS. 12A and 12B are graphs showing the results of an ELISA assay showing anti-VZV gE IgG levels in the serum of mice vaccinated with VZV gE variant mRNA compared to the ZOSTAVAX® vaccine. The sequence AEAADA shown in FIGS. 12A and 12B is SEQ ID NO: 58. It is a graph showing the result of the ELISA assay which measured the antibody titer in the serum of the mouse | mouth immunized with the VZV gE variant mRNA vaccine. The anti-VZV gE response in mice induced by VZV gE variant mRNA is greater than the response by ZOSTAVAX®. Deletion from GE-574-gE variant mRNA of Y569A induced an immune response that was 1 log greater than ZOSTAVAX®. The sequence AEAADA shown in FIG. 13 is SEQ ID NO: 58. FIG. 14A shows mice vaccinated with VZV gE variant mRNA (Group 1-5) after primary exposure with ZOSTAVAX® vaccine, or mice vaccinated with VZV-gE-deficient 574_Y569A (Group 6). FIG. 6 is a graph representing the results of an ELISA assay showing anti-VZV gE IgG levels in serum. The sequence AEAADA shown in FIG. 14A is SEQ ID NO: 58. FIG. 14B is a graph showing determination of EC50. 15A and 15B show mice vaccinated with VZV gE variant mRNA after primary exposure with ZOSTAVAX® vaccine (Groups 1-5) or mice vaccinated with VZV-gE-deficient 574_Y569A (Group 6). It is a graph showing the result of T cell analysis of). The sequence AEAADA shown in FIGS. 15A and 15B is SEQ ID NO: 58. FIGS. 16A and 16B show anti-VZV gE IgG levels in rhesus monkey sera vaccinated with either ZOSTAVAX® or ZOSTAVAX after primary exposure with VZV-gE-deleted 574_Y569A or VZV-gE-deleted 574_Y569A. Is a graph showing the results of an ELISA assay. FIG. 16C is a graph showing the determination of EC50 and EC10. Figures 16D, 16E and 16F show rhesus monkey T cells vaccinated with either ZOSTAVAX® or ZOSTAVAX® after primary exposure with VZV-gE-deleted 574_Y569A or VZV-gE-deleted 574_Y569A. It is a graph showing the result of an analysis. FIGS. 16A and 16B show anti-VZV gE IgG levels in rhesus monkey sera vaccinated with either ZOSTAVAX® or ZOSTAVAX after primary exposure with VZV-gE-deleted 574_Y569A or VZV-gE-deleted 574_Y569A. Is a graph showing the results of an ELISA assay. FIG. 16C is a graph showing the determination of EC50 and EC10. Figures 16D, 16E and 16F show rhesus monkey T cells vaccinated with either ZOSTAVAX® or ZOSTAVAX® after primary exposure with VZV-gE-deleted 574_Y569A or VZV-gE-deleted 574_Y569A. It is a graph showing the result of an analysis. FIGS. 16A and 16B show anti-VZV gE IgG levels in rhesus monkey sera vaccinated with either ZOSTAVAX® or ZOSTAVAX after primary exposure with VZV-gE-deleted 574_Y569A or VZV-gE-deleted 574_Y569A. Is a graph showing the results of an ELISA assay. FIG. 16C is a graph showing the determination of EC50 and EC10. Figures 16D, 16E and 16F show rhesus monkey T cells vaccinated with either ZOSTAVAX® or ZOSTAVAX® after primary exposure with VZV-gE-deleted 574_Y569A or VZV-gE-deleted 574_Y569A. It is a graph showing the result of an analysis.

  Embodiments of the present disclosure provide an RNA (eg, mRNA) vaccine comprising at least one RNA (eg, mRNA) polynucleotide encoding a varicella-zoster virus (VZV) antigen. There are at least five clades in varicella-zoster virus (VZV). Clades 1 and 3 include European / North American strains, Clade 2 includes particularly Asian strains from Japan, and Clade 5 appears to be centered in India. Clade 4 includes several strains from Europe, but its geographical origin needs to be further clarified. According to the phylogenetic analysis of the VZV genomic sequence, the wild-type strain has been divided into nine genotypes (E1, E2, J, M1, M2, M3, M4, VIII and IX). Sequence analysis of 342 clinical samples of chickenpox and shingles from 18 European countries identified the following VZV genotype distribution: E1 221 (65%), E2 87 (25%), M1 20 (6%), M2 3 (1%), M4 11 (3%). M3 or J strains were not observed. Of the 165 clinical isolates of chickenpox and shingles from Australia and New Zealand, 127 of the eastern Australian isolates were E1, 30 were E2, 16 were J, 10 were M1, and 4 were Of the 38 New Zealand isolates, 25 were E1, 8 were E2, and 5 were M1.

  VZV is an alphaherpesvirus and exists as a spherical multilayer structure with a diameter of approximately 200 nm. The viral genome is surrounded by a capsid protein structure covered by an amorphous layer of tegument protein. These two structures are surrounded by a lipid envelope interspersed with a plurality of viral glycoproteins each about 8 nm in length that are presented outside the virion, and there are 162 lipid envelopes arranged in an icosahedral manner. 100 nm nucleocapsid composed of hexamer and pentamer capsomeres. A segment consisting of virally encoded proteins and enzymes is located in the space between the nucleocapsid and the viral envelope. The viral envelope is obtained from the host cell membrane and contains the virally encoded glycoprotein.

  The VZV genome is a single linear double-stranded DNA molecule of base pairs 124,884 with at least 70 open reading frames. The genome has two main isomers, P (basic type) and IS (reverse direction S), depending on the orientation of the S segment, and is present at an equal frequency with a total frequency of 90-95%. The L segment can also be reversed, resulting in a total of four linear isomers (IL and ILS).

  VZV is closely related to herpes simplex virus (HSV) and shares considerable homology. The VZV genome is the smallest of the human herpesviruses and has at least 71 unique proteins (ORF0 to ORF0) having three additional open reading frames (ORF69 to ORF71, respectively) that repeat the previous open reading frames (ORF64 to 62). ORF68). Only a portion of the encoded protein forms the structure of a viral particle. These proteins include nine glycoproteins: ORF5 (gK), ORF9A (gN), ORF14 (gC), ORF31 (gB), ORF37 (gH), ORF50 (gM), ORF60 (gL), ORF67 ( gI) and ORF68 (gE). Known envelope glycoproteins (gB, gC, gE, gH, gI, gK, gL, gN, and gM) correspond to HSV envelope glycoproteins, but none to HSV gD. VZV also does not produce LAT (latency-related transcript) that plays an important role in establishing HSV latency (herpes simplex virus). The encoded glycoproteins gE, gI, gB, gH, gK, gL, gC, gN and gM function at different stages of the viral replication cycle. The most abundant glycoprotein present in infected cells and mature virions is glycoprotein E (gE, ORF68). This is a major component of the virion envelope and is essential for virus replication. Glycoprotein I (gI, ORG67) forms a complex with gE in infected cells. This complex promotes endocytosis of both glycoproteins and induces both glycoproteins in the trans-Golgi network (TGN), the place where the final viral envelope is acquired. Glycoprotein I (gI) is required within TGN for efficient membrane fusion during VZV envelopement and VZV replication. VZV gE and gI have been confirmed to complex on the infected host cell surface. Glycoprotein B (ORF31), the second most protein and thought to be involved in virus entry, binds to neutralizing antibodies. Glycoprotein H is believed to have a fusion function that promotes viral intercellular spreading. It has been shown that antibodies against gE, gB and gH increase after natural infection and after vaccination, neutralizing viral activity in vitro.

  Embodiments of the present disclosure provide an RNA (eg, mRNA) vaccine comprising at least one polynucleotide encoding at least one VZV antigenic polypeptide. The VZV RNA vaccine provided herein induces a balanced immune response that includes both cellular and humoral immunity without many of the risks associated with DNA vaccines and live attenuated vaccines Can be used for. Various RNA (eg, mRNA) vaccines disclosed herein have elicited an immune response in BALB / C mice, the results of which are discussed in detail in the Examples section. Specifically, RNA (eg, mRNA) polynucleotide vaccines having an open reading frame encoding one or more of various VZV antigens are compared to conventional VZV vaccines (eg, attenuated VZV viruses). Resulted in a significant immune response. A VZV RNA (eg, mRNA) polynucleotide vaccine encoding any of the VZV gE or variant VZV gE disclosed herein is administered in two doses when administered intramuscularly (IM) or intradermally (ID). A significant immune response was shown after administration. VZV glycoproteins and tegument proteins are known to be antigenic. VZV glycoproteins, fragments thereof and epitopes thereof are encompassed by the present disclosure.

  The entire contents of International Application No. PCT / US2015 / 02740 are incorporated herein by reference.

  The mRNA vaccine described herein has been found to be superior in some respects to current vaccines. First, lipid nanoparticle (LNP) delivery is superior to other formulations containing protamine-based means described in the literature and does not require additional adjuvants. The use of LNP allows for effective delivery of chemically modified or unmodified mRNA vaccines. Furthermore, it has been shown herein that LNP formulated mRNA vaccines are significantly superior to conventional vaccines, both modified and unmodified. In some embodiments, the mRNA vaccines of the present invention are at least 10, 20, 40, 50, 100, 500, or 1,000 times better than conventional vaccines.

  Although functional RNA vaccines including mRNA vaccines and self-replicating RNA vaccines have been attempted, the therapeutic efficacy of these RNA vaccines has not yet been fully established. Indeed, surprisingly, the inventors have found that immune responses that are significantly enhanced and synergistic in many ways, including increased production of functional antibodies with antigen production and neutralization capabilities, in accordance with aspects of the present invention. A formulation class has been found for in vivo delivery of mRNA vaccines that results in These results can be achieved even when very low doses of mRNA are administered compared to the dose of mRNA used in other types of lipid-based formulations. The formulations of the present invention showed an unexpectedly significant in vivo immune response sufficient to establish the effectiveness of a functional mRNA vaccine as a prophylactic and therapeutic agent. Furthermore, self-replicating RNA vaccines rely on viral replication pathways to deliver enough RNA to cells to produce an immunogenic response. The formulations of the present invention do not require viral replication to produce sufficient protein to produce a strong immune response. Accordingly, the mRNA of the present invention is not a self-replicating RNA and does not contain components necessary for viral replication.

  The present invention relates in some aspects to the surprising discovery that lipid nanoparticle (LNP) formulations significantly enhance the effectiveness of mRNA vaccines, including chemically modified and unmodified mRNA vaccines. The effectiveness of the LNP formulated mRNA vaccine was tested in vivo using several different antigens. The results presented herein show the effectiveness of LNP formulated mRNA vaccines unexpectedly superior to other commercially available vaccines.

  In addition to providing an enhanced immune response, the formulations of the present invention provide a more rapid immune response at lower doses than other vaccines tested. The mRNA-LNP formulations of the present invention also provide a better quantitative and qualitative immune response compared to vaccines formulated with different carriers.

  The data described herein indicate that the formulations of the present invention have provided unexpected and significant improvements over existing VZV antigen vaccines, including the mRNA chemistry formulated in LNP. It includes that the level of IgG production by modified and unmodified VZV vaccines is significantly higher compared to VARIVAX and ZOSTAVAX. The onset of IgG production was significantly faster with the chemically modified LNP mRNA vaccine than with the unmodified vaccine or the commercial vaccine tested.

  Furthermore, the mRNA-LNP formulation of the present invention is superior to other vaccines even when the mRNA dose is lower than other vaccines. The data show that all gE variant LNP mRNA vaccines induced a much stronger immune response than ZOSTAVAX® after two 10 μg doses and two 2 μg doses. When the serum was diluted more than 100-fold, the antibody titer was higher in the serum of the VZV gE LNP mRNA inoculated mice than in the serum of the ZOSTAVAX® inoculated mice, and the VZV gE LNP mRNA vaccine was This suggests that it induced a much stronger immune response than (registered trademark).

  Results in mice were consistent with the immunogenicity observed in non-human primates. Rhesus monkeys were initially dosed with a chemically modified VZV LNP mRNA vaccine or ZOSTAVAX®. The mRNA vaccine exhibits a higher anti-gE titer than ZOSTAVAX® and, unlike the ZOSTAVAX® group, CD4 T cells producing IFNγ, IL-2 or TNFα cells are produced at a reasonable frequency. It was. The data also showed that a single dose of mRNA vaccine after Zostavax exposure was equivalent to a double dose of mRNA vaccine in inducing a similar T cell response.

  Some of the LNPs used in the studies described herein are those previously used in various animal models and humans to deliver siRNA. Given the observations made regarding siRNA delivery of LNP formulations, the fact that LNP is useful for vaccines is indeed surprising. It has been observed that therapeutic delivery of LNP formulated siRNA causes an undesirable inflammatory response associated with a transient IgM response, typically leading to reduced antigen production and a reduced immune response. In contrast to the observations observed for siRNA, the LNP-mRNA formulations of the present invention herein provide an increase in IgG levels sufficient for prophylaxis and therapy rather than a transient IgM response. Indicated.

Nucleic Acid / Polynucleotide A varicella-zoster virus (VZV) vaccine provided herein comprises at least one (one or more) ribonucleic acid (RNA) having an open reading frame encoding at least one VZV antigenic polypeptide. For example, mRNA) polynucleotides. The term “nucleic acid” in its broadest sense includes any compound and / or substance comprising a polymer of nucleotides. These polymers are called polynucleotides.

  In some embodiments, at least one RNA polynucleotide of the VZV vaccine is SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8 and Encoded by at least one nucleic acid sequence selected from SEQ ID NO: 41.

  In some embodiments, at least one RNA (eg, mRNA) polynucleotide of the VZV vaccine is SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7. , Encoded by at least one fragment of a nucleic acid sequence selected from SEQ ID NO: 8 and SEQ ID NO: 41 (eg, a fragment having an antigenic sequence or at least one epitope).

  Nucleic acids (also referred to as polynucleotides) include, for example, ribonucleic acid (RNA), deoxyribonucleic acid (DNA), threose nucleic acid (TNA), glycol nucleic acid (GNA), peptide nucleic acid (PNA), locked nucleic acid (LNA, such as β- LNA with D-ribo configuration, α-LNA with α-L-ribo configuration (diastereomers of LNA), 2′-amino-LNA with 2′-amino functionality, and 2′-amino functionality Having 2′-amino-α-LNA), ethylene nucleic acid (ENA), cyclohexenyl nucleic acid (CeNA) or chimeras or combinations thereof, or may include these.

  In some embodiments, the polynucleotides of the present disclosure function as messenger RNA (mRNA). “Messenger RNA” (mRNA) is any polynucleotide that encodes (at least one) polypeptide (natural, non-natural or modified amino acid polymer), which is translated into in vitro, in vivo. , Refers to any polynucleotide capable of producing the encoded polypeptide in situ or ex vivo. A person skilled in the art, unless otherwise stated, uses “T” when referring to a DNA sequence in the present application when representing a DNA sequence, and when the sequence represents RNA (eg, mRNA). Will understand that “T” is replaced by “U”. Accordingly, any RNA polynucleotide encoded by a DNA identified by a particular sequence identifier number can include a corresponding RNA (eg, mRNA) sequence encoded by the DNA, wherein the RNA sequence includes each of the DNA sequences. “T” is replaced by “U”.

  The basic components of an mRNA molecule typically include at least one coding region, 5 'untranslated region (UTR), 3' UTR, 5 'cap and a poly A tail. The polynucleotides of the present disclosure can function as mRNA, but can be distinguished from wild-type mRNA by their functional and / or structural characteristics in design, and this characteristic is effective for using nucleic acid therapy. It helps to solve existing problems related to the expression of various polypeptides.

  In some embodiments, the VZV vaccine RNA polynucleotide (eg, mRNA) is 2-10, 2-9, 2-8, 2-7, 2-6, 2-5, 2-4, 2- 3, 3 to 10, 3 to 9, 3 to 8, 3 to 7, 3 to 6, 3 to 5, 3 to 4, 4 to 10, 4 to 9, 4 to 8, 4 to 7, 4 to 6, 4 to 5, 5 to 10, 5 to 9, 5 to 8, 5 to 7, 5 to 6, 6 to 10, 6 to 9, 6 to 8, 6 to 7, 7 to 10, 7 to 9, 7 to It encodes 8, 8-10, 8-9 or 9-10 antigenic polypeptides. In some embodiments, the RNA polynucleotide (eg, mRNA) of the VZV RNA (eg, mRNA) vaccine is at least 10, 20, 30, 40, 50, 60, 70, 80, 90 or 100 antigenicity. Encodes a polypeptide. In some embodiments, the VZV vaccine RNA polynucleotide (eg, mRNA) encodes at least 100 antigenic polypeptides or at least 200 antigenic polypeptides. In some embodiments, the VZV vaccine RNA polynucleotide (eg, mRNA) is 1-10, 5-15, 10-20, 15-25, 20-30, 25-35, 30-40, 35-35. It encodes 45, 40-50, 1-50, 1-100, 2-50 or 2-100 antigenic polypeptides.

  A polynucleotide (eg, mRNA) of the present disclosure is codon optimized in some embodiments. Codon optimization methods are known in the art and can be used as described herein. For example, any one or more of the sequences of SEQ ID NOs: 11, 15, 19, 23, 27, 31, 35, 39, 62, 66, 70, 74, 78, 82, 86, 90, or SEQ ID NOs: 92 to Any one or more of the 108 sequences can be codon optimized. Using codon optimization, in some embodiments, matching codon frequencies in the target and host organisms to ensure proper folding, biasing GC content and improving mRNA stability, or Reducing secondary structure, minimizing tandem repeat codons or base runs that may impair gene construction or expression, customizing transcriptional and translational control regions, inserting protein transport sequences or Removing / adding post-translational modification sites (eg, glycosylation sites) to the encoded protein, adding, removing or shuffling protein domains, inserting or deleting restriction sites, ribosome binding sites and Alter mRNA degradation site and adjust translation rate Allowing appropriate folding of the various domains of the protein, or secondary structure that is in question in a polynucleotide can be reduced or eliminated Te. Codon optimization tools, algorithms and services are known in the art, non-limiting examples include services by GeneArt (Life Technologies), DNA2.0 (Menlo Park CA) and / or proprietary methods. Is mentioned. In some embodiments, an open reading frame (ORF) sequence is optimized using an optimization algorithm.

  In some embodiments, the codon optimized sequence (eg, the codon optimized sequence of SEQ ID NOs: 92-108) is a native or wild type sequence (eg, a polypeptide or protein of interest (eg, an antigenic protein or polypeptide). Share less than 95% sequence identity with the native or wild-type mRNA sequence). In some embodiments, the codon optimized sequence is relative to a natural or wild type sequence (eg, a natural or wild type mRNA sequence encoding a polypeptide or protein of interest (eg, an antigenic protein or polypeptide)). Share less than 90% sequence identity. In some embodiments, the codon optimized sequence is relative to a natural or wild type sequence (eg, a natural or wild type mRNA sequence encoding a polypeptide or protein of interest (eg, an antigenic protein or polypeptide)). Share less than 85% sequence identity. In some embodiments, the codon optimized sequence is relative to a natural or wild type sequence (eg, a natural or wild type mRNA sequence encoding a polypeptide or protein of interest (eg, an antigenic protein or polypeptide)). Share less than 80% sequence identity. In some embodiments, the codon optimized sequence is relative to a natural or wild type sequence (eg, a natural or wild type mRNA sequence encoding a polypeptide or protein of interest (eg, an antigenic protein or polypeptide)). Share less than 75% sequence identity.

  In some embodiments, the codon optimized sequence is relative to a natural or wild type sequence (eg, a natural or wild type mRNA sequence encoding a polypeptide or protein of interest (eg, an antigenic protein or polypeptide)). Shares 65% to 85% sequence identity (eg, about 67% to about 85% or about 67% to about 80%). In some embodiments, the codon optimized sequence is relative to a natural or wild type sequence (eg, a natural or wild type mRNA sequence encoding a polypeptide or protein of interest (eg, an antigenic protein or polypeptide)). It shares 65% to 75% or about 80% sequence identity.

  In some embodiments, the codon optimized sequence (eg, the codon optimized sequence of SEQ ID NOs: 92-108) is the same as the antigenic polypeptide encoded by the (noncodon optimized) sequences of SEQ ID NOs: 92-108. Degree of immunogenicity or higher immunogenicity (eg, at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 100%, or at least 200% higher) Encodes an antigenic polypeptide.

  In some embodiments, the VZV vaccine comprises an open reading frame encoding at least one VZV antigenic polypeptide having at least one modification, at least one RNA polynucleotide having at least one 5 ′ end cap; And formulated into lipid nanoparticles. Polynucleotide 5 'capping can be accomplished simultaneously during an in vitro transcription reaction by generating the 5'-guanosine cap structure using the following chemical RNA cap analog according to the manufacturer's protocol: 3' -O-Me-m7G (5 ') ppp (5') G [ARCA cap]; G (5 ') ppp (5') A; G (5 ') ppp (5') G; m7G (5 ') ppp (5 ′) A; m7G (5 ′) ppp (5 ′) G (New England BioLabs (Ipswich, Mass.)). 5 ′ capping of the modified RNA is post-transcriptional by using a vaccinia virus capping enzyme to generate a “cap 0” structure: m7G (5 ′) ppp (5 ′) G (New England BioLabs (Ipswich, Mass.)). Can be achieved. The cap 1 structure can be generated by using both vaccinia virus capping enzyme and 2′-O methyltransferase to generate m7G (5 ′) ppp (5 ′) G-2′-O-methyl. . A cap 2 structure can be generated from the cap 1 structure by 2'-O-methylation of the third 5'-nucleotide using 2'-O methyltransferase. The cap 3 structure can be generated from the cap 2 structure by 2'-O-methylating the fourth 5'-nucleotide using 2'-O methyltransferase. The enzyme may be derived from a recombinant source.

  The modified mRNA, when transfected into mammalian cells, has a stability of 12-18 hours or more than 18 hours, eg, more than 24, 36, 48, 60, 72 or 72 hours.

  In some embodiments, the codon optimized RNA can be one with increased G / C levels. The G / C content of a nucleic acid molecule (eg, mRNA) can affect RNA stability. RNA with an increased amount of guanine (G) and / or cytosine (C) residues is more functionally stable than RNA containing a large amount of adenine (A) and thymine (T) or uracil (U) nucleotides. It can be. As an example, WO 02/098443 discloses a pharmaceutical composition containing mRNA stabilized by sequence modification in the translation region. Due to the degeneracy of the genetic code, this modification is made by replacing existing codons with codons that promote greater RNA stability without changing the resulting amino acids. This approach is limited to the coding region of RNA.

Antigen / antigenic polypeptide In some embodiments, the antigenic polypeptide is a VZV glycoprotein. For example, the VZV glycoprotein can be VZV gE, gI, gB, gH, gK, gL, gC, gN or gM or an immunogenic fragment or epitope thereof. In some embodiments, the antigenic polypeptide is a VZV gE polypeptide. In some embodiments, the antigenic polypeptide is a VZV gI polypeptide. In some embodiments, the antigenic polypeptide is a VZV gB polypeptide. In some embodiments, the antigenic polypeptide is a VZV gH polypeptide. In some embodiments, the antigenic polypeptide is a VZV gK polypeptide. In some embodiments, the antigenic polypeptide is a VZV gL polypeptide. In some embodiments, the antigenic polypeptide is a VZV gC polypeptide. In some embodiments, the antigenic polypeptide is a VZV gN polypeptide. In some embodiments, the antigenic polypeptide is a VZV gM polypeptide.

  In some embodiments, the antigenic polypeptide comprises more than one glycoprotein. Two or more glycoproteins may be encoded by a single RNA polynucleotide, or may be encoded by two or more RNA polynucleotides (eg, each glycoprotein is encoded by a separate RNA polynucleotide). ) In some embodiments, the two or more glycoproteins are VZV gE, gI, gB, gH, gK, gL, gC, gN and gM polypeptides or any combination of immunogenic fragments or epitopes thereof. possible. In some embodiments, the two or more glycoproteins are selected from VZV gE and gI, gB, gH, gK, gL, gC, gN and gM polypeptides or immunogenic fragments or epitopes thereof. It can be any combination with protein. In some embodiments, the two or more glycoproteins are sugars selected from VZV gI and gE, gB, gH, gK, gL, gC, gN and gM polypeptides or immunogenic fragments or epitopes thereof. It can be any combination with protein. In some embodiments, the two or more glycoproteins are selected from VZV gE, gI, gB, gH, gK, gL, gC, gN and gM polypeptides or immunogenic fragments or epitopes thereof. It can be any combination with a glycoprotein. In some embodiments, the two or more VZV glycoproteins are gE and gI. Other RNA vaccines comprising RNA polynucleotides that encode other viral protein components of VZV (eg, tegument proteins) are also encompassed by the present disclosure. Accordingly, some embodiments of the present disclosure provide a VZV vaccine comprising at least one ribonucleic acid (RNA) polynucleotide having an open reading frame encoding at least one VZV tegument protein or antigenic fragment or epitope thereof. provide. In some embodiments, the antigenic polypeptide is a VZV tegument protein or antigenic fragment or epitope thereof. In other embodiments, the antigenic fragment (s) of the VZV vaccine include at least one VZV tegument polypeptide and at least one VZV glycoprotein polypeptide, such as gE, gI, gB, gH, gK, gL. , GC, gN and gM can be any VZV glycoprotein.

  The present disclosure includes variant VZV antigenic polypeptides. In some embodiments, the variant VZV antigenic polypeptide is a variant VZV gE polypeptide. Variant VZV gE polypeptides are designed to avoid ER / Golgi retention of the polypeptide, resulting in increased surface expression of the antigen. In some embodiments, the variant gE polypeptide is cleaved to remove the ER retention portion or cytoplasmic tail of the polypeptide. In some embodiments, the variant VZV gE polypeptide is mutated to reduce localization of the VZV polypeptide to the ER / Golgi / TGN. Such alterations inhibit ER capture and thereby facilitate transport to the cell membrane.

  Thus, in some embodiments, the VZV glycoprotein is a variant gE polypeptide. VZV gE has a targeting sequence for TGN at its C-terminus and is transported from ER to TGN in infected and gE transfected cells. Most gE in TGN appears to be recovered by endocytosis from the plasma membrane, delivered to TGN by endosomes, and subsequently recycled to the plasma membrane. gE accumulates in TGN along with other VZV proteins (eg, tegument proteins) associated with the production of fully enveloped VZV virions. Thus, mutations that reduce TGN localization and endocytosis promote gE transport to the cell membrane.

  The variant VZV gE polypeptide can be any truncated polypeptide lacking an anchor domain (ER retention domain). For example, a variant VZV gE polypeptide has at least amino acids 1-124 (e.g., amino acids 1-124, 1-140, 1-160, 1-200, 1-250, 1-300, 1-350, 1-360, 1 to 400, 1 to 450, 1 to 500, 1 to 511, 1 to 550, and 1 to 561), and a truncated VZV gE polypeptide comprising a polypeptide fragment having a fragment size within the listed size range It can be. In one embodiment, the truncated VZV gE polypeptide comprises amino acids 1-561 of SEQ ID NO: 10. In some embodiments, the variant VZV gE polypeptide is a truncated polypeptide that lacks the carboxy-terminal tail domain. Accordingly, in some embodiments, the truncated VZV gE polypeptide comprises amino acids 1-573 of SEQ ID NO: 10.

  In some embodiments, the variant VZV gE polypeptide has at least one mutation in one or more motifs associated with ER retention, wherein the mutation (s) in the one or more motifs are VZV Reduces retention of gE polypeptide in the ER and / or Golgi apparatus. In some embodiments, the variant VZV gE polypeptide has at least one mutation in one or more phosphorylated acidic motifs. For example, the variant VZV gE polypeptide can be a full-length VZV gE polypeptide having a Y582G mutation, a Y569A mutation, or both a Y582G mutation and a Y569A mutation. Alternatively, the variant VZV gE polypeptide can be, for example, an antigenic fragment comprising amino acids 1 to 573 of VZV gE and having the Y569A mutation. Alternatively, the variant VZV gE polypeptide can be an antigenic fragment having a mutation in an acidic phosphorylation motif such as an SST motif. For example, the variant VZV gE polypeptide can be an antigenic fragment having the AEAADA sequence (SEQ ID NO: 58).

  In some embodiments, the variant VZV gE polypeptide is a full length VZV gE polypeptide having an additional sequence at the C-terminus that facilitates secretion of the polypeptide. For example, the variant VZV gE polypeptide can be a full length VZV gE polypeptide having an Igκ sequence at the C-terminus. In some embodiments, the VZV gE polypeptide has an additional sequence at the C-terminus that promotes secretion (has an Igκ sequence at the C-terminus), and the variant VZV gE polypeptide has ER retention, TGN localization and At least one mutation in one or more motifs associated with endocytosis (eg, Y582G mutation, Y569A mutation or both Y582G mutation and Y569A mutation) and / or one or more phosphorylated acidic Has at least one mutation in the motif. In some embodiments, the variant VZV gE polypeptide lacks an anchor domain (ER retention domain) and has an additional sequence at the C-terminus that facilitates secretion of the polypeptide (eg, has an Igκ sequence at the C-terminus). A truncated polypeptide. In some embodiments, the truncated VZV gE polypeptide comprises amino acids 1-561 of SEQ ID NO: 10 and has an Igκ sequence at the C-terminus. In some embodiments, the variant VZV gE polypeptide lacks a carboxy-terminal tail domain and has an additional sequence at the C-terminus that facilitates secretion of the polypeptide (eg, has an Igκ sequence at the C-terminus) and is cleaved. Type polypeptide. In some embodiments, the truncated VZV gE polypeptide comprises amino acids 1-573 of SEQ ID NO: 10 and has an Igκ sequence at the C-terminus.

  In some embodiments, the VZV antigenic polypeptide is longer than 25 amino acids and shorter than 50 amino acids. Thus, polypeptides include gene products, natural polypeptides, synthetic polypeptides, homologs, orthologs, paralogs, fragments and other equivalents, variants and analogs described above. The polypeptide may be a single molecule or a multimolecular complex such as a dimer, trimer or tetramer. Polypeptides can also include single chain polypeptides or multi-chain polypeptides such as antibodies or insulin and can be associated or linked. Multi-chain polypeptides most commonly have disulfide bonds. The term polypeptide can also be applied to amino acid macromolecules in which at least one amino acid residue is an artificial chemical analog of the corresponding natural amino acid.

  The term “polypeptide variant” refers to a molecule whose amino acid sequence differs from a native or reference sequence. Amino acid sequence variants may have substitutions, deletions and / or insertions at specific positions within the amino acid sequence as compared to the native or reference sequence. Usually, variants have at least 50% identity to the native or reference sequence. In some embodiments, the variant shares at least 80% or at least 90% identity with the native or reference sequence.

  In some embodiments, “variant mimetics” are provided. As used herein, a “variant mimetic” contains at least one amino acid that can mimic an activation sequence. For example, glutamic acid can act as a mimic of phosphorylated threonine and / or phosphorylated serine. Alternatively, the variant mimetic can result in inactivation or an inactivation product containing the mimetic. For example, phenylalanine can act as an inactive substitution for tyrosine and alanine can act as an inactive substitution for serine.

  “Ortholog” refers to genes of different species that have evolved from a common ancestral gene by speciation. Orthologs usually retain the same function during evolution. Identification of orthologs is important for reliable prediction of newly sequenced genomic gene function.

  An “analog” continues to retain one or more of the properties of the parent or starting polypeptide, albeit differently due to one or more amino acid changes, eg, substitution, addition or deletion of amino acid residues. Is meant to include polypeptide variants.

  A “paralog” is a gene (or protein) that is related by duplication within the genome. Orthologs retain the same function during evolution, but paralogs evolve new functions, even if related to the original function.

  The present disclosure provides several types of compositions based on polynucleotides or polypeptides, including variants and derivatives. These include, for example, substitutions, insertional deletions and covalent variants and derivatives. The term “derivative” is used interchangeably with the term “variant” but generally refers to a molecule that has been modified and / or altered in any way compared to a reference molecule or starting molecule. .

  Thus, a polynucleotide encoding a peptide or polypeptide containing substitutions, insertions and / or additions, deletions and covalent modifications to a reference sequence, particularly a polypeptide sequence disclosed herein, is disclosed herein. It is included in the range. For example, a sequence tag or one or more amino acids such as lysine can be added to the peptide sequence (eg, at the N-terminus or C-terminus). The sequence tag can be used for detection, purification or localization of the peptide. Lysine can be used to increase the solubility of the peptide or to allow biotinylation. Alternatively, amino acid residues located in the carboxy terminal region and amino terminal region of the amino acid sequence of the peptide or protein may be optionally deleted to provide a truncated sequence. Alternatively, depending on the use of the sequence, eg, expressing the sequence as part of a larger sequence that is soluble or linked to a solid support, etc. Group) may be deleted. In alternative embodiments, the signal sequence, termination sequence, transmembrane domain, linker, multimerization domain (eg, foldon region, etc.) and equivalent sequences (or sequences encoding them) are identical or similar. An alternative sequence that achieves the above function may be substituted. Such sequences can be readily identified by those skilled in the art. Some of the sequences provided herein may also contain, for example, a sequence tag or terminal peptide sequence (eg, at the N-terminus or C-terminus) that may be deleted immediately prior to preparation of an RNA (eg, mRNA) vaccine. I want you to understand.

  A “substitution variant” with respect to a polypeptide is one in which at least one amino acid residue in the native or starting sequence has been deleted and another amino acid inserted in its place instead. The substitution may be a single substitution in which only one amino acid in the molecule is substituted, or a plurality of substitutions in which two or more amino acids in the same molecule are substituted.

  As used herein, the term “conservative amino acid substitution” refers to a substitution that replaces an amino acid normally present in a sequence with another amino acid of similar size, charge or polarity. Examples of conservative substitutions include substitution of a nonpolar (hydrophobic) residue such as isoleucine, valine and leucine with another nonpolar residue. Similarly, examples of conservative substitutions include substitutions that make one polar (hydrophilic) residue another polar, eg, between arginine and lysine, between glutamine and asparagine, and between glycine and serine. Substitution may be mentioned. In addition, a substitution of one basic residue such as lysine, arginine or histidine to another basic residue, or a substitution of one acidic residue such as aspartic acid or glutamic acid to another acidic residue is also a conservative substitution. It is a further example. Examples of non-conservative substitutions include substitution of nonpolar (hydrophobic) amino acid residues such as isoleucine, valine, leucine, alanine or methionine to polar (hydrophilic) residues such as cysteine, glutamine, glutamic acid or lysine, And / or substitution of polar residues to nonpolar residues.

  A “characteristic” for a polypeptide or polynucleotide is defined as an amino acid sequence-based component or a nucleotide-based component, respectively, that is distinctly different in the molecule. The characteristics of the polypeptide encoded by the polynucleotide include surface expression, local conformational shape, folding, loop, half-loop, domain, half-domain, site, end, or any combination thereof.

  As used herein with respect to a polypeptide, the term “domain” refers to one or more identifiable structural or functional characteristics or properties (eg, binding ability, function as a site of protein-protein interaction). ).

  As used herein with respect to a polypeptide, the term “site” is used interchangeably with “amino acid residue” and “amino acid side chain” when it relates to an amino acid based embodiment. As used herein with respect to a polypeptide, the term “site” is used interchangeably with “nucleotide” when it relates to a nucleotide-based embodiment. A site represents a position within a peptide or polypeptide or polynucleotide that can be modified, manipulated, altered, derivatized or altered within a polypeptide-based molecule or polynucleotide-based molecule.

As used herein with respect to a polypeptide or polynucleotide, the term “terminal” refers to the end of the polypeptide or polynucleotide, respectively. Such ends are not limited to only the first or last site of a polypeptide or polynucleotide, but may include amino acids or nucleotides added to the terminal region. Polypeptide-based molecules can be characterized as having both an N-terminus (ending with an amino acid having a free amino group (NH ₂ )) and a C-terminus (ending with an amino acid having a free carboxyl group (COOH)). Proteins are sometimes composed of multiple polypeptide chains joined together by disulfide bonds or non-covalent forces (multimers, oligomers). These proteins have multiple N-termini and C-termini. Alternatively, the end of the polypeptide may be modified to begin or end with a non-polypeptide-based moiety, such as an organic conjugate, as the situation requires.

  As will be appreciated by those skilled in the art, protein fragments, functional protein domains and homologous proteins are also considered within the scope of the polypeptide of interest. For example, any protein fragment that is 10, 20, 30, 40, 50, 60, 70, 80, 90, 100 or more than 100 amino acids in length of the reference protein (ie, at least one amino acid residue above the reference polypeptide sequence) Polypeptide sequences that are short but otherwise identical) are provided herein. In another example, 20, which is 40%, 50%, 60%, 70%, 80%, 90%, 95% or 100% identical to any of the sequences described herein, Any protein comprising a stretch of 30, 40, 50 or 100 amino acids can be utilized in accordance with the present disclosure. In some embodiments, the polypeptide has 2, 3, 4, 5, 6, 7, 8, 9, 10 as shown, any of the sequences described or referenced herein. Or more mutations. In some embodiments, the protein fragment is longer than 25 amino acids and shorter than 50 amino acids.

  A polypeptide molecule or polynucleotide molecule of the present disclosure is a reference molecule (eg, a reference polypeptide or reference polynucleotide), eg, a molecule described in the art (eg, an engineered or engineered or wild type molecule). It may share some degree of sequence similarity or sequence identity. The term “identity” refers to the relationship between the sequences of two or more polypeptides or polynucleotides as determined by comparing the sequences, as is known in the art. In the art, identity also means the degree of sequence relationship between sequences determined by the number of matches between two or more amino acid residues or strings of nucleic acid residues. Identity assesses the percent identity match between smaller sequences of two or more sequences with gap alignment (if any) processed by a specific mathematical model or computer program (eg, “algorithm”) To do. The identity of related peptides can be easily calculated by known methods. A “percent identity” applied to a polypeptide or polynucleotide sequence refers to the amino acid sequence of the second sequence after aligning the sequences and, if necessary, introducing gaps to achieve the maximum percent identity. Defined as the percentage of residues (amino acid residues or nucleic acid residues) in an amino acid or nucleic acid candidate sequence that are identical to residues in the nucleic acid sequence. Methods and computer programs for alignment are well known in the art. It is understood that identity depends on the calculation of percent identity, but the value can vary depending on gaps and penalties introduced into the calculation. In general, a particular polynucleotide or polypeptide variant is described relative to a particular reference polynucleotide or polypeptide sequence as determined herein by sequence alignment programs and parameters known to those of skill in the art. , At least 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, but less than 100% sequence identity. Such alignment tools include those of the BLAST suite (Stephen F. Altschul, et al., (1997), “Gapped BLAST and PSI-BLAST: a new generation of protein database search programs”, NucleicA. 25: 3389-3402). Another frequently used local alignment technique is based on the Smith-Waterman algorithm (Smith, TF & Waterman, MS (1981) “Identification of common molecular sequences.” J. Mol. Biol. 147. 195-197). A common global alignment technique based on dynamic programming is the Needleman-Wunsch algorithm (Needleman, SB & Wunsch, CD (1970) “A general method applicable to the search for similar mines. acid sequences of two proteins. "J. Mol. Biol. 48: 443-453.). More recently, Fast Optimal Global Sequence Alignment Algorithm (FOGSAA), which is said to generate global alignments of nucleotide and protein sequences faster than other optimal global alignment methods including the Needleman-Wunsch algorithm, has been developed. Other tools are described herein, specifically in the definition of “identity” below.

  As used herein, the term “homology” refers to the overall relationship between macromolecules, eg, nucleic acid molecules (eg, DNA and / or RNA molecules) and / or polypeptide molecules. Point to. Macromolecules (eg, nucleic acid molecules (eg, DNA and / or RNA molecules) and / or polypeptide molecules) that share a threshold level of similarity or identity determined by alignment of matching residues are homologous. be called. Homology is a qualitative term that describes the relationship between molecules and can be based on quantitative similarity or identity. Similarity or identity is a quantitative term that defines the degree of sequence match between two comparison sequences. In some embodiments, the macromolecule is at least 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80% in sequence. , 85%, 90%, 95% or 99% identical or similar are considered “homologous” to each other. The term “homologous” necessarily refers to a comparison between at least two sequences (polynucleotide or polypeptide sequences). The two polynucleotide sequences are such that the polypeptide encoded by the sequences is at least 50%, 60%, 70%, 80%, 90%, 95% or even 99% for at least one stretch of at least 20 amino acids. If so, they are considered homologous. In some embodiments, homologous polynucleotide sequences are characterized by the ability to encode a uniquely designated stretch of at least 4-5 amino acids. For polynucleotide sequences less than 60 nucleotides in length, homology is determined by the ability to encode a uniquely specified stretch of at least 4-5 amino acids. Two protein sequences are considered homologous if the proteins are at least 50%, 60%, 70%, 80% or 90% identical for at least one stretch of at least 20 amino acids.

  Homology suggests that the sequences being compared have differentiated from an evolutionary common origin. The term “homolog” refers to a first amino acid sequence or nucleic acid sequence (eg, a gene (DNA or RNA) or protein sequence) that is related to a second amino acid sequence or nucleic acid sequence by being derived from a common ancestral sequence. . The term “homolog” can be applied to the relationship between genes and / or proteins separated by speciation events, or the relationship between genes and / or proteins separated by gene duplication events.

Multiprotein and multicomponent vaccines The present disclosure relates to VZV vaccines comprising multiple RNA (eg, mRNA) polynucleotides each encoding a single antigenic polypeptide, and more than one antigenic polypeptide (eg, a fusion). VZV vaccines comprising a single RNA polynucleotide encoding (as a polypeptide) are included. Accordingly, an RNA polynucleotide (e.g., mRNA) having an open reading frame encoding a first VZV antigenic polypeptide and an RNA polynucleotide (e.g., an open reading frame encoding a second VZV antigenic polypeptide) a vaccine composition comprising: (a) a first RNA polynucleotide encoding a first VZV antigenic polypeptide; and a second RNA polynucleotide encoding a second VZV antigenic polypeptide; And (b) a vaccine comprising a single RNA polynucleotide encoding a first and second VZV antigenic polypeptide (eg, as a fusion polypeptide). VZV RNA vaccines of the present disclosure may in some embodiments be 2-10 (eg, 2, 3, 4, 5, 6, 7, each) having an open reading frame that each encodes a different VZV antigenic polypeptide. 8, 9 or 10) or more RNA polynucleotides (or a single RNA polynucleotide encoding 2-10 or more different VZV antigenic polypeptides). In some embodiments, the VZV RNA vaccine comprises an RNA polynucleotide having an open reading frame encoding a VZV gE protein, an RNA polynucleotide having an open reading frame encoding a VZV gI protein, an open reading encoding a VZV gB protein. RNA polynucleotide with frame, RNA polynucleotide with open reading frame encoding VZV gH protein, RNA polynucleotide with open reading frame encoding VZV gK protein, RNA polynucleotide with open reading frame encoding VZV gL protein Open reading frame encoding nucleotide, VZV gC protein Including RNA polynucleotide having a beam, RNA polynucleotides having an open reading frame encoding a VZV gN proteins, and RNA polynucleotides having an open reading frame encoding a VZV gM protein. In some embodiments, the VZV RNA vaccine comprises an RNA polynucleotide having an open reading frame encoding VZV gE and an RNA polynucleotide having an open reading frame encoding a VZV gI protein. In some embodiments, the VZV RNA vaccine comprises an RNA polynucleotide having an open reading frame encoding a VZV gE protein or gE variant.

  In some embodiments, the RNA polynucleotide encodes a VZV antigenic polypeptide fused to a signal peptide (eg, SEQ ID NO: 56, 57, 109, 110 or 111). The signal peptide can be fused to the N-terminus or C-terminus of the antigenic polypeptide.

Signal Peptide In some embodiments, the antigenic polypeptide encoded by the VZV polynucleotide comprises a signal peptide. The signal peptide contains an N-terminal 15-60 amino acid protein and is typically required for translocation across the membrane in the secretory pathway, and thus, in both eukaryotic and prokaryotic organisms, most proteins are Universally controls entry into the secretory pathway. A signal peptide generally consists of three regions of different lengths, an N-terminal region (usually containing positively charged amino acids), a hydrophobic region, and a short carboxy-terminal peptide region. In eukaryotes, the nascent precursor protein (preprotein) signal peptide directs the ribosome to the rough endoplasmic reticulum (ER) membrane and initiates the transport of peptide chains that extend through the membrane. However, the signal peptide is not involved in the final destination of the mature protein. Secreted proteins that lack additional address tags in the sequence are usually secreted into the external environment. The signal peptide is cleaved from the precursor protein by a signal peptidase present in the endoplasmic reticulum (ER) or functions as a membrane anchor without being cleaved. In recent years, a more advanced view of signal peptides has been derived, and it has been shown that the function and immunodominance of certain signal peptides are much more diverse than previously anticipated.

  Signal peptides typically function to facilitate targeting of newly synthesized proteins to the endoplasmic reticulum (ER) for processing. ER processing produces a mature envelope protein where the signal peptide is typically cleaved by the host cell signal peptidase. The signal peptide can also facilitate targeting of the protein to the cell membrane. A VZV vaccine of the present disclosure can include, for example, an RNA polynucleotide encoding an artificial signal peptide, the sequence encoding the signal peptide being operably linked to the coding sequence of the VZV antigenic polypeptide and in frame with the sequence. It is. Accordingly, the VZV vaccines of the present disclosure, in some embodiments, produce an antigenic polypeptide that includes a VZV antigenic polypeptide fused to a signal peptide. In some embodiments, the signal peptide is fused to the N-terminus of the VZV antigenic polypeptide. In some embodiments, the signal peptide is fused to the C-terminus of the VZV antigenic polypeptide.

  In some embodiments, the signal peptide fused to the VZV antigenic polypeptide is an artificial signal peptide. In some embodiments, the artificial signal peptide fused to a VZV antigenic polypeptide encoded by a VZV RNA (eg, mRNA) vaccine is derived from an immunoglobulin protein, eg, an IgE signal peptide or IgG signal peptide. In some embodiments, the signal peptide fused to the VZV antigenic polypeptide encoded by the VZV RNA (eg, mRNA) vaccine is an Ig heavy chain ε-1 signal peptide having the sequence MDWTWILFLVAAATRVHS (SEQ ID NO: 56). (IgE HC SP). In some embodiments, the signal peptide fused to the VZV antigenic polypeptide encoded by the VZV RNA (eg, mRNA) vaccine is the HAk of the IgGk chain V-III region having the sequence of METPAQLLFLLLWLPDTTTG (SEQ ID NO: 57). Signal peptide (IgGkSP). In some embodiments, a VZV antigenic polypeptide encoded by a VZV RNA (eg, mRNA) vaccine is 10 fused to a signal peptide of any of SEQ ID NOs: 56, 57, 109, 110, and 111. , 14, 18, 22, 26, 30, 34, 38, 42 and 45-55. The examples disclosed herein are not intended to be limiting and are known in the art to facilitate targeting of proteins to the ER and / or targeting of proteins to the cell membrane for processing. Any signal peptide can be used in accordance with the present disclosure.

  The signal peptide can have a length of 15-60 amino acids. For example, the signal peptide is 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59 or 60 amino acids in length Can have. In some embodiments, the signal peptide is 20-60, 25-60, 30-60, 35-60, 40-60, 45-60, 50-60, 55-60, 15-55, 20-55. 25-55, 30-55, 35-55, 40-55, 45-55, 50-55, 15-50, 20-50, 25-50, 30-50, 35-50, 40-50, 45 -50, 15-45, 20-45, 25-45, 30-45, 35-45, 40-45, 15-40, 20-40, 25-40, 30-40, 35-40, 15-35 It may have a length of 20-35, 25-35, 30-35, 15-30, 20-30, 25-30, 15-25, 20-25 or 15-20 amino acids.

  The signal peptide is typically cleaved from the nascent polypeptide at the cleavage site during ER processing. Mature VZV antigenic polypeptides produced by the VZV RNA vaccines of the present disclosure typically do not include a signal peptide.

Chemical Modifications RNA (eg, mRNA) vaccines of the present disclosure, in some embodiments, include at least one ribonucleic acid having an open reading frame encoding at least one respiratory syncytial virus (VZV) antigenic polypeptide. RNA) polynucleotide, the RNA comprising at least one chemical modification.

  The terms “chemically modified” and “chemically modified” refer to ribonucleosides or deoxyribonucleosides of adenosine (A), guanosine (G), uridine (U), thymidine (T) or cytidine (C). Refers to a modification in at least one of its position, pattern, percentage or population. In general, these terms do not refer to ribonucleotide modifications in the naturally occurring 5 'terminal mRNA cap portion.

  Polynucleotide modifications include, but are not limited to, those described herein, including but not limited to modifications including chemical modifications. A polynucleotide (eg, an RNA polynucleotide such as an mRNA polynucleotide) can include modifications that are natural, non-natural, or a polynucleotide can include a combination of natural and non-natural modifications. A polynucleotide may comprise any useful modification, for example, a modification of a sugar, nucleobase or internucleoside linkage (eg, a phosphate, phosphodiester linkage or linkage to a phosphodiester backbone).

  With respect to polypeptides, the term “modification” refers to modifications to the standard form of the 20 amino acid set. A polypeptide provided herein is also considered “modified” if it contains an amino acid substitution, insertion, or a combination of substitution and insertion.

  A polynucleotide (eg, an RNA polynucleotide, such as an mRNA polynucleotide), in some embodiments, includes various (more than one) different modifications. In some embodiments, specific regions of the polynucleotide contain one, two or more (optionally different) nucleoside or nucleotide modifications. In some embodiments, a modified RNA polynucleotide (eg, a modified mRNA polynucleotide) is reduced in each of the cell or organism when introduced into the cell or organism as compared to an unmodified polynucleotide. Indicates decomposition. In some embodiments, a modified RNA polynucleotide (eg, a modified mRNA polynucleotide), when introduced into a cell or organism, is reduced immunogenicity (eg, reduced in each of the cell or organism). An innate response).

  A polynucleotide (eg, an RNA polynucleotide, such as an mRNA polynucleotide), in some embodiments, is a non-naturally modified nucleotide introduced during or after synthesis of the polynucleotide to achieve a desired function or property. including. Modifications may be present on internucleotide bonds, purine or pyrimidine bases, or sugars. Modifications can be introduced at the chain ends or elsewhere in the chain using chemical synthesis or polymerase enzymes. Any region of the polynucleotide can be chemically modified.

  The present disclosure provides modified nucleosides and nucleotides of polynucleotides (eg, RNA polynucleotides such as mRNA polynucleotides). A “nucleoside” is a compound that contains a sugar molecule (eg, pentose or ribose) or derivative thereof in combination with an organic base (eg, purine or pyrimidine) or derivative thereof (also referred to herein as “nucleobase”). Point to. “Nucleotide” refers to a nucleoside containing a phosphate group. Modified nucleotides can be synthesized to include one or more modified or unnatural nucleosides by any useful method, eg, chemically, enzymatically or recombinantly. A polynucleotide may comprise one or more regions of linked nucleosides. Such regions can have various backbone bonds. The linkage may be a standard phosphodiester linkage, in which case the polynucleotide will comprise a region of nucleotides.

  Modified nucleotide base pairing includes not only standard adenosine-thymine, adenosine-uracil or guanosine-cytosine base pairs, but also between nucleotides and / or modified nucleotides containing non-standard or modified bases. Also included are base pairs formed in which the arrangement of hydrogen bond donors and hydrogen bond acceptors is between a non-standard base and a standard base or two complementary non-standard base structures (e.g., Such as those in polynucleotides having at least one chemical modification). An example of such non-standard base pairing is base pairing between the modified nucleotide inosine and adenine, cytosine or uracil. Any combination of base / sugar or linker can be incorporated into the polynucleotides of this disclosure.

Modifications of polynucleotides useful in the disclosed compositions, vaccines, methods and synthetic procedures, including but not limited to chemical modifications (eg, RNA polynucleotides such as mRNA polynucleotides) include, but are not limited to: The following are included: 2-methylthio-N6- (cis-hydroxyisopentenyl) adenosine, 2-methylthio-N6-methyladenosine, 2-methylthio-N6-threonylcarbamoyladenosine, N6-glycinylcarbamoyladenosine, N6 -Isopentenyl adenosine, N6-methyladenosine, N6-threonylcarbamoyl adenosine, 1,2'-O-dimethyladenosine, 1-methyladenosine, 2'-O-methyladenosine, 2'-O-ribosyladenosine (phosphate ), 2-methyladenosine, 2 Methylthio-N6 isopentenyl adenosine, 2-methylthio-N6-hydroxynorvalylcarbamoyl adenosine, 2'-O-methyl adenosine, 2'-O-ribosyl adenosine (phosphate), isopentenyl adenosine, N6- (cis-hydroxyiso) Pentenyl) adenosine, N6,2′-O-dimethyladenosine, N6,2′-O-dimethyladenosine, N6, N6,2′-O-trimethyladenosine, N6, N6-dimethyladenosine, N6-acetyladenosine, N6- Hydroxynorvalylcarbamoyladenosine, N6-methyl-N6-threonylcarbamoyladenosine, 2-methyladenosine, 2-methylthio-N6-isopentenyladenosine, 7-deaza-adenosine, N1-methyl-adenosine, N6, N6 (dimethyl) ) Adenine, N6-cis-hydroxy-isopentenyl-adenosine, α-thio-adenosine, 2 (amino) adenine, 2 (aminopropyl) adenine, 2 (methylthio) N6 (isopentenyl) adenine, 2- (alkyl) adenine 2- (aminoalkyl) adenine, 2- (aminopropyl) adenine, 2- (halo) adenine, 2- (halo) adenine, 2- (propyl) adenine, 2′-amino-2′-deoxy-ATP, 2'-azido-2'-deoxy-ATP, 2'-deoxy-2'-a-aminoadenosine TP, 2'-deoxy-2'-a-azidoadenosine TP, 6 (alkyl) adenine, 6 (methyl) Adenine, 6- (alkyl) adenine, 6- (methyl) adenine, 7 (deaza) adenine, 8 (alkenyl) adenine, 8 (alkynyl) Adenine, 8 (amino) adenine, 8 (thioalkyl) adenine, 8- (alkenyl) adenine, 8- (alkyl) adenine, 8- (alkynyl) adenine, 8- (amino) adenine, 8- (halo) adenine, 8 -(Hydroxyl) adenine, 8- (thioalkyl) adenine, 8- (thiol) adenine, 8-azido-adenosine, azaadenine, deazaadenine, N6 (methyl) adenine, N6- (isopentyl) adenine, 7-deaza-8-aza Adenosine, 7-methyladenine, 1-deazaadenosine TP, 2′fluoro-N6-Bz-deoxyadenosine TP, 2′-OMe-2-amino-ATP, 2′O-methyl-N6-Bz-deoxyadenosine TP, 2′-a-ethynyl adenosine TP, 2-aminoadenine, 2-aminoadenosine TP, 2-amino-ATP, 2'-a-trifluoromethyladenosine TP, 2-azidoadenosine TP, 2'-b-ethynyladenosine TP, 2-bromoadenosine TP, 2'-b-trifluoromethyladenosine TP, 2-chloroadenosine TP, 2′-deoxy-2 ′, 2′-difluoroadenosine TP, 2′-deoxy-2′-a-mercaptoadenosine TP, 2′-deoxy-2′-a-thiomethoxyadenosine TP, 2′-deoxy-2′-b-aminoadenosine TP, 2′-deoxy-2′-b-azidoadenosine TP, 2′-deoxy-2′-b-bromoadenosine TP, 2′-deoxy-2 '-B-chloroadenosine TP, 2'-deoxy-2'-b-fluoroadenosine TP, 2'-deoxy-2'-b-iodoadenosine TP, 2'-deoxy-2' b-mercaptoadenosine TP, 2′-deoxy-2′-b-thiomethoxyadenosine TP, 2-fluoroadenosine TP, 2-iodoadenosine TP, 2-mercaptoadenosine TP, 2-methoxy-adenine, 2-methylthio-adenine 2-trifluoromethyladenosine TP, 3-deaza-3-bromoadenosine TP, 3-deaza-3-chloroadenosine TP, 3-deaza-3-fluoroadenosine TP, 3-deaza-3-iodoadenosine TP, 3 -Deazaadenosine TP, 4'-azidoadenosine TP, 4'-carbocyclic adenosine TP, 4'-ethynyladenosine TP, 5'-homo-adenosine TP, 8-aza-ATP, 8-bromo-adenosine TP, 8-trifluoromethyladenosine TP, 9-deazaadenosine TP, 2-amino Phosphorus, 7-deaza-2,6-diaminopurine, 7-deaza-8-aza-2,6-diaminopurine, 7-deaza-8-aza-2-aminopurine, 2,6-diaminopurine, 7- Deaza-8-aza-adenine, 7-deaza-2-aminopurine, 2-thiocytidine, 3-methylcytidine, 5-formylcytidine, 5-hydroxymethylcytidine, 5-methylcytidine, N4-acetylcytidine, 2′- O-methylcytidine, 2′-O-methylcytidine, 5,2′-O-dimethylcytidine, 5-formyl-2′-O-methylcytidine, ricidin, N4,2′-O-dimethylcytidine, N4-acetyl -2'-O-methylcytidine, N4-methylcytidine, N4, N4-dimethyl-2'-OMe-cytidine TP, 4-methylcytidine, 5-aza-cytidine, pso Do-iso-cytidine, pyrrolo-cytidine, α-thio-cytidine, 2- (thio) cytosine, 2′-amino-2′-deoxy-CTP, 2′-azido-2′-deoxy-CTP, 2′- Deoxy-2′-a-aminocytidine TP, 2′-deoxy-2′-a-azidocytidine TP, 3 (deaza) 5 (aza) cytosine, 3 (methyl) cytosine, 3- (alkyl) cytosine, 3- ( Deaza) 5 (aza) cytosine, 3- (methyl) cytidine, 4,2′-O-dimethylcytidine, 5 (halo) cytosine, 5 (methyl) cytosine, 5 (propynyl) cytosine, 5 (trifluoromethyl) cytosine , 5- (alkyl) cytosine, 5- (alkynyl) cytosine, 5- (halo) cytosine, 5- (propynyl) cytosine, 5- (trifluoromethyl) cytosine, 5-bromo-cytidine 5-iodo-cytidine, 5-propynylcytosine, 6- (azo) cytosine, 6-aza-cytidine, azacytosine, deazacytosine, N4 (acetyl) cytosine, 1-methyl-1-deaza-pseudoisocytidine, 1- Methyl-pseudoisocytidine, 2-methoxy-5-methyl-cytidine, 2-methoxy-cytidine, 2-thio-5-methyl-cytidine, 4-methoxy-1-methyl-pseudoisocytidine, 4-methoxy- Pseudoisocytidine, 4-thio-1-methyl-1-deaza-pseudoisocytidine, 4-thio-1-methyl-pseudoisocytidine, 4-thio-pseudoisocytidine, 5-aza-zebularine, 5-methyl-zebularine, pyrrolo-pseudoisocytidine, zebularine, (E) -5- (2-bromo-vinyl) cytidine P, 2,2′-anhydro-cytidine TP hydrochloride, 2′fluoro-N4-Bz-cytidine TP, 2′fluoro-N4-acetyl-cytidine TP, 2′-O-methyl-N4-acetyl-cytidine TP, 2'O-methyl-N4-Bz-cytidine TP, 2'-a-ethynylcytidine TP, 2'-a-trifluoromethylcytidine TP, 2'-b-ethynylcytidine TP, 2'-b-trifluoromethyl Cytidine TP, 2′-deoxy-2 ′, 2′-difluorocytidine TP, 2′-deoxy-2′-a-mercaptocytidine TP, 2′-deoxy-2′-a-thiomethoxycytidine TP, 2′- Deoxy-2′-b-aminocytidine TP, 2′-deoxy-2′-b-azidocytidine TP, 2′-deoxy-2′-b-bromocytidine TP, 2′-deoxy-2′-b-chlorocytidine TP 2'-deoxy-2'-b-fluorocytidine TP, 2'-deoxy-2'-b-iodocytidine TP, 2'-deoxy-2'-b-mercaptocytidine TP, 2'-deoxy-2 ' -B-thiomethoxycytidine TP, 2'-O-methyl-5- (1-propynyl) cytidine TP, 3'-ethynylcytidine TP, 4'-azidocytidine TP, 4'-carbocyclic cytidine TP, 4'- Ethynylcytidine TP, 5- (1-propynyl) ara-cytidine TP, 5- (2-chloro-phenyl) -2-thiocytidine TP, 5- (4-amino-phenyl) -2-thiocytidine TP, 5-aminoallyl- CTP, 5-cyanocytidine TP, 5-ethynylara-cytidine TP, 5-ethynylcytidine TP, 5'-homo-cytidine TP, 5-methoxycytidine TP, 5-trifluoro Cyl-cytidine TP, N4-amino-cytidine TP, N4-benzoyl-cytidine TP, pseudoisocytidine, 7-methylguanosine, N2,2′-O-dimethylguanosine, N2-methylguanosine, wyocin, 1,2 ′ -O-dimethyl guanosine, 1-methyl guanosine, 2'-O-methyl guanosine, 2'-O-ribosyl guanosine (phosphate), 2'-O-methyl guanosine, 2'-O-ribosyl guanosine (phosphate) 7-aminomethyl-7-deazaguanosine, 7-cyano-7-deazaguanosine, alkaeosin, methylwyocin, N2,7-dimethylguanosine, N2, N2,2′-O-trimethylguanosine, N2, N2,7-trimethylguanosine, N2, N2-dimethylguanosine, N2,7,2′-O-trimethylguanosine , 6-thio-guanosine, 7-deaza-guanosine, 8-oxo-guanosine, N1-methyl-guanosine, α-thio-guanosine, 2 (propyl) guanine, 2- (alkyl) guanine, 2′-amino- 2'-deoxy-GTP, 2'-azido-2'-deoxy-GTP, 2'-deoxy-2'-a-aminoguanosine TP, 2'-deoxy-2'-a-azidoguanosine TP, 6 (methyl ) Guanine, 6- (alkyl) guanine, 6- (methyl) guanine, 6-methyl-guanosine, 7 (alkyl) guanine, 7 (deaza) guanine, 7 (methyl) guanine, 7- (alkyl) guanine, 7- (Deaza) guanine, 7- (methyl) guanine, 8 (alkyl) guanine, 8 (alkynyl) guanine, 8 (halo) guanine, 8 (thioalkyl) guani 8- (alkenyl) guanine, 8- (alkyl) guanine, 8- (alkynyl) guanine, 8- (amino) guanine, 8- (halo) guanine, 8- (hydroxyl) guanine, 8- (thioalkyl) guanine, 8- (thiol) guanine, azaguanine, deazaguanine, N (methyl) guanine, N- (methyl) guanine, 1-methyl-6-thio-guanosine, 6-methoxy-guanosine, 6-thio-7-deaza-8- Aza-guanosine, 6-thio-7-deaza-guanosine, 6-thio-7-methyl-guanosine, 7-deaza-8-aza-guanosine, 7-methyl-8-oxo-guanosine, N2, N2-dimethyl- 6-thio-guanosine, N2-methyl-6-thio-guanosine, 1-Me-GTP, 2′fluoro-N2-isobutyl-guan Nosin TP, 2'O-methyl-N2-isobutyl-guanosine TP, 2'-a-ethynyl guanosine TP, 2'-a-trifluoromethyl guanosine TP, 2'-b-ethynyl guanosine TP, 2'-b- Trifluoromethylguanosine TP, 2′-deoxy-2 ′, 2′-difluoroguanosine TP, 2′-deoxy-2′-a-mercaptoguanosine TP, 2′-deoxy-2′-a-thiomethoxyguanosine TP, 2'-deoxy-2'-b-aminoguanosine TP, 2'-deoxy-2'-b-azidoguanosine TP, 2'-deoxy-2'-b-bromoguanosine TP, 2'-deoxy-2'- b-Chlorogannosine TP, 2′-deoxy-2′-b-fluoroguanosine TP, 2′-deoxy-2′-b-iodoguanosine TP, 2′-deoxy-2′-b-merka Ptoguanosine TP, 2'-deoxy-2'-

b-thiomethoxyguanosine TP, 4'-azidoguanosine TP, 4'-carbocyclic guanosine TP, 4'-ethynylguanosine TP, 5'-homo-guanosine TP, 8-bromo-guanosine TP, 9-deazaguanosine TP, N2-isobutyl-guanosine TP, 1-methylinosine, inosine, 1,2'-O-dimethylinosine, 2'-O-methylinosine, 7-methylinosine, 2'-O-methylinosine, epoxy quasosine , Galactosyl-Queosin, Mannosilk eosin, Queosin, Allylamino-thymidine, Azathymidine, Deazathymidine, Deoxy-thymidine, 2'-O-methyluridine, 2-thiouridine, 3-methyluridine, 5-carboxymethyluridine, 5-hydroxyuridine , 5-methyluridine, 5-taurinome Ru-2-thiouridine, 5-taurinomethyluridine, dihydrouridine, pseudouridine, (3- (3-amino-3-carboxypropyl) uridine, 1-methyl-3- (3-amino-5-carboxypropyl) pseudouridine 1-methyl pseudouridine, 1-ethyl-pseudouridine, 2′-O-methyluridine, 2′-O-methyl pseudouridine, 2′-O-methyluridine, 2-thio-2′-O-methyl Uridine, 3- (3-amino-3-carboxypropyl) uridine, 3,2′-O-dimethyluridine, 3-methyl-pseudo-uridine TP, 4-thiouridine, 5- (carboxyhydroxymethyl) uridine, 5- (Carboxyhydroxymethyl) uridine methyl ester, 5,2′-O-dimethyluridine, 5,6-di Hydro-uridine, 5-aminomethyl-2-thiouridine, 5-carbamoylmethyl-2′-O-methyluridine, 5-carbamoylmethyluridine, 5-carboxyhydroxymethyluridine, 5-carboxyhydroxymethyluridine methyl ester, 5- Carboxymethylaminomethyl-2′-O-methyluridine, 5-carboxymethylaminomethyl-2-thiouridine, 5-carboxymethylaminomethyl-2-thiouridine, 5-carboxymethylaminomethyluridine, 5-carboxymethylaminomethyluridine 5-carbamoylmethyluridine TP, 5-methoxycarbonylmethyl-2′-O-methyluridine, 5-methoxycarbonylmethyl-2-thiouridine, 5-methoxycarbonylmethyluridine, 5-methyluri ,), 5-methoxyuridine, 5-methyl-2-thiouridine, 5-methylaminomethyl-2-selenouridine, 5-methylaminomethyl-2-thiouridine, 5-methylaminomethyluridine, 5-methyldihydrouridine 5-oxyacetic acid-uridine TP, 5-oxyacetic acid-methyl ester-uridine TP, N1-methyl-pseudo-uracil, N1-ethyl-pseudo-uracil, uridine 5-oxyacetic acid, uridine 5-oxyacetic acid methyl ester, 3- (3-amino-3-carboxypropyl) -uridine TP, 5- (iso-pentenylaminomethyl) -2-thiouridine TP, 5- (iso-pentenylaminomethyl) -2′-O-methyluridine TP, 5- (iso-pentenylaminomethyl) uridine TP, 5-propynylura , Α-thio-uridine, 1 (aminoalkylamino-carbonylethylenyl) -2 (thio) -pseudouracil, 1 (aminoalkylaminocarbonylethylenyl) -2,4- (dithio) pseudouracil, 1 (aminoalkylamino Carbonylethylenyl) -4 (thio) pseudouracil, 1 (aminoalkylaminocarbonylethylenyl) -pseudouracil, 1 (aminocarbonylethylenyl) -2 (thio) -pseudouracil, 1 (aminocarbonylethylenyl) -2,4- (Dithio) pseudouracil, 1 (aminocarbonylethylenyl) -4 (thio) pseudouracil, 1 (aminocarbonylethylenyl) -pseudouracil, 1-substituted 2 (thio) -pseudouracil, 1-substituted 2,4- (dithio) pseudouracil Sil, 1-substituted 4 (thio) pseudouracil, 1-substituted pseudouracil, 1- (aminoalkylamino-carbonylethylenyl) -2- (thio) -pseudouracil, 1-methyl-3- (3-amino-3-carboxypropyl) Pseudouridine TP, 1-methyl-3- (3-amino-3-carboxypropyl) pseudo-UTP, 1-methyl-pseudo-UTP, 1-ethyl-pseudo-UTP, 2 (thio) pseudouracil, 2 ′ deoxyuridine, 2 'fluorouridine, 2- (thio) uracil, 2,4- (dithio) pseudouracil, 2' methyl, 2 'amino, 2' azide, 2 'fluro-guanosine, 2'-amino-2'-deoxy-UTP 2'-azido-2'-deoxy-UTP, 2'-azido-deoxyuridine TP, 2'-O-methylpsoi Uridine, 2 ′ deoxyuridine, 2 ′ fluorouridine, 2′-deoxy-2′-a-aminouridine TP, 2′-deoxy-2′-a-azidouridine TP, 2-methyl pseudouridine, 3 (3 amino -3 carboxypropyl) uracil, 4 (thio) pseudouracil, 4- (thio) pseudouracil, 4- (thio) uracil, 4-thiouracil, 5 (1,3-diazol-1-alkyl) uracil, 5 (2-amino) Propyl) uracil, 5 (aminoalkyl) uracil, 5 (dimethylaminoalkyl) uracil, 5 (guanidinium alkyl) uracil, 5 (methoxycarbonylmethyl) -2- (thio) uracil, 5 (methoxycarbonyl-methyl) uracil 5 (methyl) 2 (thio) uracil, 5 (methyl) 2,4 (dithio) uracil, (Methyl) 4 (thio) uracil, 5 (methylaminomethyl) -2 (thio) uracil, 5 (methylaminomethyl) -2,4 (dithio) uracil, 5 (methylaminomethyl) -4 (thio) uracil, 5 (propynyl) uracil, 5 (trifluoromethyl) uracil, 5- (2-aminopropyl) uracil, 5- (alkyl) -2- (thio) pseudouracil, 5- (alkyl) -2,4 (dithio) pseudouracil , 5- (alkyl) -4 (thio) pseudouracil, 5- (alkyl) pseudouracil, 5- (alkyl) uracil, 5- (alkynyl) uracil, 5- (allylamino) uracil, 5- (cyanoalkyl) uracil, 5 -(Dialkylaminoalkyl) uracil, 5- (dimethylaminoalkyl) uracil, 5- (guanidinium) Mualkyl) uracil, 5- (halo) uracil, 5- (l, 3-diazol-1-alkyl) uracil, 5- (methoxy) uracil, 5- (methoxycarbonylmethyl) -2- (thio) uracil, 5- (Methoxycarbonyl-methyl) uracil, 5- (methyl) 2 (thio) uracil, 5- (methyl) 2,4 (dithio) uracil, 5- (methyl) 4 (thio) uracil, 5- (methyl) -2 -(Thio) pseudouracil, 5- (methyl) -2,4 (dithio) pseudouracil, 5- (methyl) -4 (thio) pseudouracil, 5- (methyl) pseudouracil, 5- (methylaminomethyl) -2 (thio ) Uracil, 5- (methylaminomethyl) -2,4 (dithio) uracil, 5- (methylaminomethyl) -4- (thio) uracil, 5- (propini ) Uracil, 5- (trifluoromethyl) uracil, 5-aminoallyl-uridine, 5-bromo-uridine, 5-iodo-uridine, 5-uracil, 6 (azo) uracil, 6- (azo) uracil, 6-aza -Uridine, allylamino-uracil, azauracil, deazauracil, N3 (methyl) uracil, pseudo-UTP-1-ethanoic acid, pseudouracil, 4-thio-pseudo-UTP, 1-carboxymethyl-pseudouridine, 1-methyl-1 -Deaza-pseudouridine, 1-propynyl-uridine, 1-taurinomethyl-1-methyl-uridine, 1-taurinomethyl-4-thio-uridine, 1-taurinomethyl-pseudouridine, 2-methoxy-4-thio-pseudouridine, 2-thio -1-methyl-1-deazapuso Douridine, 2-thio-1-methyl-pseudouridine, 2-thio-5-aza-uridine, 2-thio-dihydropseuduridine, 2-thio-dihydrouridine, 2-thio-pseudouridine, 4-methoxy-2- Thio-pseudouridine, 4-methoxy-pseudouridine, 4-thio-1-methyl-pseudouridine, 4-thio-pseudouridine, 5-aza-uridine, dihydropseudouridine, (±) 1- (2-hydroxypropyl) pseudouridine TP (2R) -1- (2-hydroxypropyl) pseudouridine TP, (2S) -1- (2-hydroxypropyl) pseudouridine TP, (E) -5- (2-bromo-vinyl) ara-uridine TP, E) -5- (2-Bromo-vinyl) uridine TP, (Z) -5- (2-butyl) Mo-vinyl) ara-uridine TP, (Z) -5- (2-bromo-vinyl) uridine TP, 1- (2,2,2-trifluoroethyl) -pseudo-UTP, 1- (2,2, 3,3,3-pentafluoropropyl) pseudouridine TP, 1- (2,2-diethoxyethyl) pseudouridine TP, 1- (2,4,6-trimethylbenzyl) pseudouridine TP, 1- (2,4,6 -Trimethyl-benzyl) pseudo-UTP, 1- (2,4,6-trimethyl-phenyl) pseudo-UTP, 1- (2-amino-2-carboxyethyl) pseudo-UTP, 1- (2-amino-ethyl) ) Pseudo-UTP, 1- (2-hydroxyethyl) pseudouridine TP, 1- (2-M ethoxyethyl) pseudouridine TP, 1- (3,4-bis-to Fluoromethoxybenzyl) pseudouridine TP, 1- (3,4-dimethoxybenzyl) pseudouridine TP, 1- (3-amino-3-carboxypropyl) pseudo-UTP, 1- (3-amino-propyl) pseudo-UTP, 1 -(3-cyclopropyl-prop-2-ynyl) pseudouridine TP, 1- (4-amino-4-carboxybutyl) pseudo-UTP, 1- (4-amino-benzyl) pseudo-UTP, 1- (4- Amino-butyl) pseudo-UTP, 1- (4-amino-phenyl) pseudo-UTP, 1- (4-azidobenzyl) pseudouridine TP, 1- (4-bromobenzyl) pseudouridine TP, 1- (4-chlorobenzyl) ) Pseudouridine TP, 1- (4-fluorobenzyl) pseudouridine TP, 1- (4-iodobenzyl) pseudouridine TP, 1- (4-methanesulfonylbenzyl) pseudouridine TP, 1- (4-methoxybenzyl) pseudouridine TP, 1- (4-methoxybenzyl) pseudo-UTP, 1- ( 4-methoxy-phenyl) pseudo-UTP, 1- (4-methylbenzyl) pseudouridine TP, 1- (4-methyl-benzyl) pseudo-UTP, 1- (4-nitrobenzyl) pseudouridine TP, 1- (4- Nitro-benzyl) pseudo-UTP, 1 (4-nitro-phenyl) pseudo-UTP, 1- (4-thiomethoxybenzyl) pseudouridine TP, 1- (4-trifluoromethoxybenzyl) pseudouridine TP, 1- (4- Trifluoromethylbenzyl) pseudouridine TP, 1- ( -Amino-pentyl) pseudo-UTP, 1- (6-amino-hexyl) pseudo-UTP, 1,6-dimethyl-pseudo-UTP, 1- [3- (2- {2- [2- (2-amino Ethoxy) -ethoxy] -ethoxy} -ethoxy) -propionyl] pseudouridine TP, 1- {3- [2- (2-aminoethoxy) -ethoxy] -propionyl} pseudouridine TP, 1-acetyl pseudouridine TP, 1- Alkyl-6- (1-propynyl) -pseudo-UTP, 1-alkyl-6- (2-propynyl) -pseudo-UTP, 1-alkyl-6-allyl-pseudo-UTP, 1-alkyl-6-ethynyl- Pseudo-UTP, 1-alkyl-6-homoallyl-pseudo-UTP, 1-alkyl-6-vinyl-pseudo-UTP, 1-alkyl Lil pseudouridine TP, 1-aminomethyl - pseudo -UTP, 1-benzoyl pseudouridine TP, 1-benzyloxymethyl pseudouridine TP, 1-benzyl - pseudo -UTP, 1-biotinyl -

PEG2-pseudouridine TP, 1-biotinyl pseudouridine TP, 1-butyl-pseudo-UTP, 1-cyanomethyl pseudouridine TP, 1-cyclobutylmethyl-pseudo-UTP, 1-cyclobutyl-pseudo-UTP, 1- Cycloheptylmethyl-pseudo-UTP, 1-cycloheptyl-pseudo-UTP, 1-cyclohexylmethyl-pseudo-UTP, 1-cyclohexyl-pseudo-UTP, 1-cyclooctylmethyl-pseudo-UTP, 1-cyclooctyl-pseudo -UTP, 1-cyclopentylmethyl-pseudo-UTP, 1-cyclopentyl-pseudo-UTP, 1-cyclopropylmethyl-pseudo-UTP, 1-cyclopropyl-pseudo-UTP, 1-ethyl-pseudo-UTP, 1-hexyl Pseudo-UTP, 1-homoallyl pseudouridine TP, 1-hydroxymethyl pseudouridine TP, 1-iso-propyl-pseudo-UTP, 1-Me-2-thio-pseudo-UTP, 1-Me-4- Thio-pseudo-UTP, 1-Me-alpha-thio-pseudo-UTP, 1-methanesulfonylmethyl pseudouridine TP, 1-methoxymethyl pseudouridine TP, 1-methyl-6- (2,2,2- Trifluoroethyl) pseudo-UTP, 1-methyl-6- (4-morpholino) -pseudo-UTP, 1-methyl-6- (4-thiomorpholino) -pseudo-UTP, 1-methyl-6- (substituted phenyl) ) Pseudo-UTP, 1-methyl-6-amino-pseudo-UTP, 1-methyl-6-azido-pseudo-UTP, 1-methyl -6-bromo-pseudo-UTP, 1-methyl-6-butyl-pseudo-UTP, 1-methyl-6-chloro-pseudo-UTP, 1-methyl-6-cyano-pseudo-UTP, 1-methyl-6 -Dimethylamino-pseudo-UTP, 1-methyl-6-ethoxy-pseudo-UTP, 1-methyl-6-ethylcarboxylate-pseudo-UTP, 1-methyl-6-ethyl-pseudo-UTP, 1-methyl- 6-fluoro-pseudo-UTP, 1-methyl-6-formyl-pseudo-UTP, 1-methyl-6-hydroxyamino-pseudo-UTP, 1-methyl-6-hydroxy-pseudo-UTP, 1-methyl-6 -Iodo-Pseudo-UTP, 1-Methyl-6-iso-propyl-Pseudo-UTP, 1-Methyl-6-methoxy-Pseudo- UTP, 1-methyl-6-methylamino-pseudo-UTP, 1-methyl-6-phenyl-pseudo-UTP, 1-methyl-6-propyl-pseudo-UTP, 1-methyl-6-tert-butyl-pseudo -UTP, 1-methyl-6-trifluoromethoxy-pseudo-UTP, 1-methyl-6-trifluoromethyl-pseudo-UTP, 1-morpholinomethyl pseudouridine TP, 1-pentyl-pseudo-UTP, 1- Phenyl-pseudo-UTP, 1-pivaloyl pseudouridine TP, 1-propargyl pseudouridine TP, 1-propyl-pseudo-UTP, 1-propynyl-pseudouridine, 1-p-tolyl-pseudo-UTP, 1-tert -Butyl-pseudo-UTP, 1-thiomethoxymethyl pseudouridine T 1-thiomorpholinomethyl pseudouridine TP, 1-trifluoroacetyl pseudouridine TP, 1-trifluoromethyl-pseudouridine TP, 1-vinyl pseudouridine TP, 2,2′-anhydrous-uridine TP, 2 '-Bromo-deoxyuridine TP, 2'-F-5-methyl-2'-deoxy-UTP, 2'-OMe-5-Me-UTP, 2'-OMe-pseudo-UTP, 2'-a-ethynyl Uridine TP, 2′-a-trifluoromethyluridine TP, 2′-b-ethynyluridine TP, 2′-b-trifluoromethyluridine TP, 2′-deoxy-2 ′, 2′-difluorouridine TP, 2 '-Deoxy-2'-a-mercaptouridine TP, 2'-deoxy-2'-a-thiomethoxyuridine TP, 2'-deoxy-2'-b-aminouridine TP 2'-deoxy-2'-b-azidouridine TP, 2'-deoxy-2'-b-bromouridine TP, 2'-deoxy-2'-b-chlorouridine TP, 2'-deoxy-2'-b -Fluorouridine TP, 2'-deoxy-2'-b-iodouridine TP, 2'-deoxy-2'-b-mercaptouridine TP, 2'-deoxy-2'-b-thiomethoxyuridine TP, 2- Methoxy-4-thio-uridine, 2-methoxyuridine, 2′-O-methyl-5- (1-propynyl) uridine TP, 3-alkyl-pseudo-UTP, 4′-azidouridine TP, 4′-carbocyclic Uridine TP, 4′-ethynyluridine TP, 5- (1-propynyl) ara-uridine TP, 5- (2-furanyl) uridine TP, 5-cyanouridine TP, 5-dimethylaminouridine TP 5'-homo-uridine TP, 5-iodo-2'-fluoro-deoxyuridine TP, 5-phenylethynyluridine TP, 5-trideuteromethyl-6-deuteriumuridine TP, 5-trifluoromethyl-uridine TP 5-vinylallauridine TP, 6- (2,2,2-trifluoroethyl) -pseudo-UTP, 6- (4-morpholino) -pseudo-UTP, 6- (4-thiomorpholino) -pseudo-UTP 6- (substituted phenyl) -pseudo-UTP, 6-amino-pseudo-UTP, 6-azido-pseudo-UTP, 6-bromo-pseudo-UTP, 6-butyl-pseudo-UTP, 6-chloro-pseudo- UTP, 6-cyano-pseudo-UTP, 6-dimethylamino-pseudo-UTP, 6-ethoxy-pseudo-UTP, 6-ethyl Ruboxylate-Pseudo-UTP, 6-Ethyl-Pseudo-UTP, 6-Fluoro-Pseudo-UTP, 6-Formyl-Pseudo-UTP, 6-hydroxyamino-Pseudo-UTP, 6-Hydroxy-Pseudo-UTP, 6-iodo -Pseudo-UTP, 6-Isopropyl-Pseudo-UTP, 6-Methoxy-Pseudo-UTP, 6-Methylamino-Pseudo-UTP, 6-Methyl-Pseudo-UTP, 6-Phenyl-Pseudo-UTP, 6- Phenyl-Pseudo-UTP, 6-Propyl-Pseudo-UTP, 6-tert-Butyl-Pseudo-UTP, 6-Trifluoromethoxy-Pseudo-UTP, 6-Trifluoromethyl-Pseudo-UTP, Alpha-Thio-Pseudo- UTP, pseudouridine 1- (4-methylbenzene) Sulfonic acid) TP, pseudouridine 1- (4-methylbenzoic acid) TP, pseudouridine TP1- [3- (2-ethoxy)] propionic acid, pseudouridine TP1- [3- {2- (2- [2- (2- Ethoxy) -ethoxy] -ethoxy) -ethoxy}] propionic acid, pseudouridine TP1- [3- {2- (2- [2- {2 (2-ethoxy) -ethoxy} -ethoxy] -ethoxy) -ethoxy}] Propionic acid, pseudouridine TP1- [3- {2- (2- [2-ethoxy] -ethoxy) -ethoxy}] propionic acid, pseudouridine TP1- [3- {2- (2-ethoxy) -ethoxy}] propionic acid Pseudouridine TP1-methylphosphonic acid, pseudouridine TP1-methylphosphonic acid diethyl ester, pseudo-UT P-N1-3-propionic acid, pseudo-UTP-N1-4-butanoic acid, pseudo-UTP-N1-5-pentanoic acid, pseudo-UTP-N1-6-hexanoic acid, pseudo-UTP-N1-7- Heptanoic acid, pseudo-UTP-N1-methyl-p-benzoic acid, pseudo-UTP-N1-p-benzoic acid, wybutosine, hydroxywibutosine, isowyosine, peroxywybutosine, undermodified hydroxywybutosine 4-demethylwyocin, 2,6- (diamino) purine, 1- (aza) -2- (thio) -3- (aza) -phenoxazin-1-yl: 1,3- (diaza)- 2- (oxo) -phenothiazin-1-yl, 1,3- (diaza) -2- (oxo) -phenoxazin-1-yl, 1,3,5- ( Riaza) -2,6- (dioxa) -naphthalene, 2 (amino) purine, 2,4,5- (trimethyl) phenyl, 2'methyl, 2'amino, 2'azide, 2'fluro-cytidine, 2 ' Methyl, 2 ′ amino, 2 ′ azide, 2 ′ fluro-adenine, 2 ′ methyl, 2 ′ amino, 2 ′ azide, 2 ′ fluro-uridine, 2′-amino-2′-deoxyribose, 2-amino-6 -Chloro-purine, 2-aza-inosinyl, 2'-azido-2'-deoxyribose, 2'fluoro-2'-deoxyribose, 2'-fluoro-modified base, 2'-O-methyl-ribose, 2 -Oxo-7-aminopyridopyrimidin-3-yl, 2-oxo-pyridopyrimidin-3-yl, 2-pyridinone, 3nitropyrrole, 3- (methyl) -7- (propynyl) isocarbostyryl, 3- (Methyl) Socarbostyryl, 4- (fluoro) -6- (methyl) benzimidazole, 4- (methyl) benzimidazole, 4- (methyl) indolyl, 4,6- (dimethyl) indolyl, 5nitroindole, 5 substituted pyrimidine , 5- (methyl) isocarbostyril, 5-nitroindole, 6- (aza) pyrimidine, 6- (azo) thymine, 6- (methyl) -7- (aza) indolyl, 6-chloro-purine, 6 -Phenyl-pyrrolo-pyrimidin-2-one-3-yl, 7- (aminoalkylhydroxy) -1- (aza) -2- (thio) -3- (aza) -phenothiazin-1-yl, 7- ( Aminoalkylhydroxy) -1- (aza) -2- (thio) -3- (aza) -phenoxazin-1-yl, 7- (aminoalkylhydroxy) -1,3- ( Aza) -2- (oxo) -phenoxazin-1-yl, 7- (aminoalkylhydroxy) -1,3- (diaza) -2- (oxo) -phenothiazin-1-yl, 7- (aminoalkylhydroxy) ) -1,3- (diaza) -2- (oxo) -phenoxazin-1-yl, 7- (aza) indolyl, 7- (guanidinium alkylhydroxy) -1- (aza) -2- (thio) ) -3- (Aza) -phenoxazin-1-yl, 7- (guanidinium alkylhydroxy) -1- (aza) -2- (thio) -3- (aza) -phenothiazin-1-yl, 7- (Guanidinium alkylhydroxy) -1- (aza) -2- (thio) -3- (aza) -phenoxazin-1-yl, 7- (guanidinium alkylhydroxy) -1,3- (diaza) -2- (O SO) -phenoxazin-1-yl, 7- (guanidiniumalkyl-hydroxy) -1,3- (diaza) -2- (oxo) -phenothiazin-1-yl, 7- (guanidiniumalkylhydroxy) -1,3- (diaza) -2- (oxo) -phenoxazin-1-yl, 7- (propynyl) isocarbostyryl, 7- (propynyl) isocarbostyryl, propynyl-7- (aza) indolyl 7-Deaza-inosinyl, 7-substituted 1- (aza) -2- (thio) -3- (aza) -phenoxazin-1-yl, 7-substituted 1,3- (diaza) -2- (oxo ) -Phenoxazin-1-yl, 9- (methyl) -imidazopyridinyl, aminoindolyl, anthracenyl, bis-ortho- (aminoalkylhydroxy) -6-phenyl-pyrrolo-pi Limidin-2-one-3-yl, bis-ortho-substituted-6-phenyl-pyrrolo-pyrimidin-2-one-3-yl, difluorotolyl, hypoxanthine, imidisopyridinyl, inosinyl, isocarboxtyryl , Isoguanidine, N2-substituted purines, N6-methyl-2-amino-purines, N6-substituted purines, N-alkylated derivatives, naphthalenyl, nitrobenzoimidazolyl, nitroimidazolyl, nitroindazolyl, nitropyrazolyl, nubraline, O6-substituted Purine, O-alkylated derivatives, ortho- (aminoalkylhydroxy) -6-phenyl-pyrrolo-pyrimidin-2-one-3-yl, ortho-substituted-6-phenyl-pyrrolo-pyrimidin-2-one-3- Yl, oxoformicin TP, para- (aminoalkylhydroxy) 6-phenyl - pyrrolo - pyrimidin-2-on-3-yl, para - substituted-6-phenyl - pyrrolo - pyrimidin-2-on-3-yl, pentacenyl, phenanthracenyl, phenyl

, Propynyl-7- (aza) indolyl, pyrenyl, pyridopyrimidin-3-yl, pyridopyrimidin-3-yl, 2-oxo-7-amino-pyridopyrimidin-3-yl, pyrrolo-pyrimidin-2- On-3-yl, pyrrolopyrimidinyl, pyrrolopyridinyl, stilbenzyl, substituted 1,2,4-triazole, tetracenyl, tubercidin, xanthine, xanthosine-5′-TP, 2-thio-zebraline, 5-aza-2-thio- Zebralin, 7-deaza-2-amino-purine, pyridin-4-one ribonucleoside, 2-amino-riboside-TP, formycin ATP, formycin BTP, pyrrolosin TP, 2′-OH-ara-adenosine TP, 2′- OH-ara-cytidine TP, 2'-OH-ara-uridine TP, 2'-OH-ara-gua Singh TP, 5- (2- carbomethoxy-vinyl) uridine TP, and N6-(19-amino - penta dioxanone A decyl) adenosine TP.

  In some embodiments, the polynucleotide (eg, an RNA polynucleotide, such as an mRNA polynucleotide) comprises a combination of at least two (eg, 2, 3, 4 or more) of the aforementioned modified nucleobases.

  In some embodiments, the modified nucleobase in the polynucleotide (eg, an RNA polynucleotide such as an mRNA polynucleotide) is pseudouridine (ψ), 2-thiouridine (s2U), 4′-thiouridine, 5-methylcytosine, 2-thio-1-methyl-1-deaza-pseudouridine, 2-thio-1-methyl-pseudouridine, 2-thio-5-aza-uridine, 2-thio-dihydropseudouridine, 2-thio-dihydrouridine, 2-thio-pseudouridine, 4-methoxy-2-thio-pseudouridine, 4-methoxy-pseudouridine, 4-thio-1-methyl-pseudouridine, 4-thio-pseudouridine, 5-aza-uridine, dihydropseudouridine, 5 -Methyluridine, 5-methoxyuridine, 2 -O-methyluridine, 1-methyl-pseudouridine (m1ψ), 1-ethyl-pseudouridine (e1ψ), 5-methoxy-uridine (mo5U), 5-methyl-cytidine (m5C), α-thio-guanosine, α- Thio-adenosine, 5-cyanouridine, 4′-thiouridine 7-deaza-adenine, 1-methyl-adenosine (m1A), 2-methyl-adenine (m2A), N6-methyl-adenosine (m6A) and 2,6- Diaminopurine, (I), 1-methyl-inosine (m1I), wyocin (imG), methylwyosin (mimG), 7-deaza-guanosine, 7-cyano-7-deaza-guanosine (preQ0), 7-amino Methyl-7-deaza-guanosine (preQ1), 7-methyl-guanosine (m7G), 1-methyl Guanosine (m1G), 8-oxo-guanosine, 7-methyl-8-oxo-guanosine, 2,8-dimethyladenosine, 2-geranylthiouridine, 2-ricidin, 2-selenouridine, 3- (3-amino- 3-carboxypropyl) -5,6-dihydrouridine, 3- (3-amino-3-carboxypropyl) pseudouridine, 3-methyl pseudouridine, 5- (carboxyhydroxymethyl) -2′-O-methyluridine methyl Ester, 5-aminomethyl-2-geranylthiouridine, 5-aminomethyl-2-selenouridine, 5-aminomethyluridine, 5-carbamoylhydroxymethyluridine, 5-carbamoylmethyl-2-thiouridine, 5-carboxymethyl- 2-thiouridine, 5-carboxymethylaminome Ru-2-geranylthiouridine, 5-carboxymethylaminomethyl-2-selenouridine, 5-cyanomethyluridine, 5-hydroxycytidine, 5-methylaminomethyl-2-geranylthiouridine, 7-aminocarboxypropyl-de Methyl wyocin, 7-aminocarboxypropyl wyocin, 7-aminocarboxypropyl wyocin methyl ester, 8-methyladenosine, N4, N4-dimethylcytidine, N6-formyladenosine, N6-hydroxymethyladenosine, agmatidine, cyclic N6 -Threonylcarbamoyl adenosine, glutamyl-queosin, methylated hypomodified hydroxywibutosine, N4, N4,2'-O-trimethylcytidine, geranylated 5-methylaminomethyl-2-thiouridine, geranylated 5 -Selected from the group consisting of carboxymethylaminomethyl-2-thiouridine, Q base, preQ0 base, preQ1 base, and combinations of two or more thereof. In some embodiments, the at least one chemically modified nucleoside is selected from the group consisting of pseudouridine, 1-methyl-pseudouridine, 1-ethyl-pseudouridine, 5-methylcytosine, 5-methoxyuridine and combinations thereof. In some embodiments, a polyribonucleotide (eg, an RNA polyribonucleotide such as an mRNA polyribonucleotide) is a combination of at least two (eg, 2, 3, 4 or more) of the aforementioned modified nucleobases. including. In some embodiments, the polynucleotide (eg, an RNA polynucleotide, such as an mRNA polynucleotide) comprises a combination of at least two (eg, 2, 3, 4 or more) of the aforementioned modified nucleobases.

  In some embodiments, the modified nucleobase in the polynucleotide (eg, an RNA polynucleotide such as an mRNA polynucleotide) is 1-methyl-pseudouridine (m1ψ), 1-ethyl-pseudouridine (e1ψ), 5-methoxy- It is selected from the group consisting of uridine (mo5U), 5-methyl-cytidine (m5C), pseudouridine (ψ), α-thio-guanosine and α-thio-adenosine. In some embodiments, the polyribonucleotide comprises a combination of at least two (eg, 2, 3, 4 or more) of the aforementioned modified nucleobases, including but not limited to chemical modifications.

  In some embodiments, the polynucleotide (eg, an RNA polynucleotide such as an mRNA polynucleotide) comprises pseudouridine (ψ) and 5-methyl-cytidine (m5C). In some embodiments, the polyribonucleotide (eg, RNA such as mRNA) comprises 1-methyl-pseudouridine (m1ψ). In some embodiments, the polyribonucleotide (eg, RNA such as mRNA) comprises 1-ethyl-pseudouridine (e1ψ). In some embodiments, the polyribonucleotide (eg, RNA such as mRNA) comprises 1-methyl-pseudouridine (m1ψ) and 5-methyl-cytidine (m5C). In some embodiments, the polyribonucleotide (eg, RNA such as mRNA) comprises 1-ethyl-pseudouridine (e1ψ) and 5-methyl-cytidine (m5C). In some embodiments, the polyribonucleotide (eg, RNA such as mRNA) comprises 2-thiouridine (s2U). In some embodiments, the polyribonucleotide (eg, RNA such as mRNA) comprises 2-thiouridine and 5-methyl-cytidine (m5C). In some embodiments, the polyribonucleotide (eg, RNA such as mRNA) comprises methoxy-uridine (mo5U). In some embodiments, the polyribonucleotide (eg, RNA such as mRNA) comprises 5-methoxy-uridine (mo5U) and 5-methyl-cytidine (m5C). In some embodiments, the polyribonucleotide (eg, RNA such as mRNA) comprises 2'-O-methyluridine. In some embodiments, the polyribonucleotide (eg, RNA such as mRNA) comprises 2'-O-methyluridine and 5-methyl-cytidine (m5C). In some embodiments, the polyribonucleotide (eg, RNA such as mRNA) comprises N6-methyl-adenosine (m6A). In some embodiments, the polyribonucleotide (eg, RNA such as mRNA) comprises N6-methyl-adenosine (m6A) and 5-methyl-cytidine (m5C).

  In some embodiments, a polynucleotide (eg, an RNA polynucleotide such as an mRNA polynucleotide) is uniformly modified for a particular modification (eg, fully modified, modified throughout the sequence). . For example, the polynucleotide can be uniformly modified with 1-methyl-pseudouridine, ie, all uridine residues in the mRNA sequence are replaced with 1-methyl-pseudouridine. Similarly, a polynucleotide can be uniformly modified by replacing any type of nucleoside residue present in the sequence with a modified residue such as those described above.

  Exemplary nucleobases and nucleosides with modified cytosines include N4-acetyl-cytidine (ac4C), 5-methyl-cytidine (m5C), 5-halo-cytidine (eg, 5-iodo-cytidine), 5-hydroxy Examples include methyl-cytidine (hm5C), 1-methyl-pseudoisocytidine, 2-thio-cytidine (s2C) and 2-thio-5-methyl-cytidine.

  In some embodiments, the modified nucleobase is a modified uridine. Exemplary nucleobases and nucleosides with modified uridines include 1-methyl-pseudouridine (m1ψ), 1-ethyl-pseudouridine (e1ψ), 5-methoxyuridine, 2-thiouridine, 5-cyanouridine, 2′-O. -Methyluridine and 4'-thiouridine.

  In some embodiments, the modified nucleobase is a modified adenine. Exemplary nucleobases and nucleosides with modified adenine include 7-deaza-adenine, 1-methyl-adenosine (m1A), 2-methyl-adenine (m2A) and N6-methyl-adenosine (m6A).

  In some embodiments, the modified nucleobase is a modified guanine. Exemplary nucleobases and nucleosides with modified guanines include inosine (I), 1-methyl-inosine (m1I), wyosin (imG), methyl wyocin (mimG), 7-deaza-guanosine, 7-cyano- 7-deaza-guanosine (preQ0), 7-aminomethyl-7-deaza-guanosine (preQ1), 7-methyl-guanosine (m7G), 1-methyl-guanosine (m1G), 8-oxo-guanosine and 7-methyl And -8-oxo-guanosine.

  The polynucleotides of this disclosure can be partially or fully modified over the entire length of the molecule. For example, one or more or all or a given type of nucleotide (eg, purine or pyrimidine, or A) in a polynucleotide of the invention or a predetermined sequence region thereof (eg, an mRNA with or without a poly A tail) , Any one or more of G, U, and C) can be uniformly modified. In some embodiments, every nucleotide X in the polynucleotide of the present disclosure (or a given sequence region thereof) is a modified nucleotide, where X is among nucleotides A, G, U, C Or any one of the combinations A + G, A + U, A + C, G + U, G + C, U + C, A + G + U, A + G + C, G + U + C or A + G + C.

  A polynucleotide comprises from about 1% to about 100% modified nucleotides (based on the overall nucleotide content or one or more types of nucleotides (ie, any one of A, G, U or C). Or any percentage in between (e.g. 1% to 20%, 1% to 25%, 1% to 50%, 1% to 60%, 1% to 70%, 1% to 80) %, 1% to 90%, 1% to 95%, 10% to 20%, 10% to 25%, 10% to 50%, 10% to 60%, 10% to 70%, 10% to 80%, 10% -90%, 10% -95%, 10% -100%, 20% -25%, 20% -50%, 20% -60%, 20% -70%, 20% -80%, 20% -90%, 20% -95%, 20% -100%, 50% -60%, 50% -70%, 50% 80%, 50% to 90%, 50% to 95%, 50% to 100%, 70% to 80%, 70% to 90%, 70% to 95%, 70% to 100%, 80% to 90% 80% to 95%, 80% to 100%, 90% to 95%, 90% to 100%, and 95% to 100%). It will be understood that any remaining percentage is accounted for by the presence of unmodified A, G, U or C.

  A polynucleotide has a minimum of 1% and a maximum of 100% modified nucleotides, or any percentage in between, eg, at least 5% modified nucleotides, at least 10% modified nucleotides, at least 25% modified nucleotides, at least 50% modified It may contain nucleotides, at least 80% modified nucleotides, or at least 90% modified nucleotides. For example, the polynucleotide may contain a modified pyrimidine such as modified uracil or modified cytosine. In some embodiments, at least 5%, at least 10%, at least 25%, at least 50%, at least 80%, at least 90% or 100% of uracil in the polynucleotide is modified uracil (eg, 5-substituted uracil). ). The modified uracil may be replaced by a compound having a single unique structure, or may be replaced by multiple compounds having different structures (eg, 2, 3, 4 or more unique structures) Good. In some embodiments, at least 5%, at least 10%, at least 25%, at least 50%, at least 80%, at least 90% or 100% of the cytosine in the polynucleotide is a modified cytosine (eg, a 5-substituted cytosine ). The modified cytosine may be replaced by a compound having a single unique structure or may be replaced by multiple compounds having different structures (eg, 2, 3, 4 or more unique structures) Good.

  Thus, in some embodiments, an RNA vaccine comprises a 5 ′ UTR element, optionally a codon optimized open reading frame and a 3 ′ UTR element, a poly (A) sequence and / or a polyadenylation signal, wherein the RNA is It is not chemically modified.

In some embodiments, the modified nucleobase is modified uracil. Exemplary nucleobases and nucleosides with modified uracils include pseudouridine (ψ), pyridine-4-one ribonucleoside, 5-aza-uridine, 6-aza-uridine, 2-thio-5-aza-uridine, 2 - thio - uridine ^(s 2 U), 4- thio - uridine ^(s 4 U), 4- thio - pseudouridine, 2-thio - pseudouridine, 5-hydroxy - uridine ^(ho 5 U), 5-aminoallyl - uridine, 5-halo-uridine (eg, 5-iodo-uridine or 5-bromo-uridine), 3-methyl-uridine (m ³ U), 5-methoxy-uridine (mo ⁵ U), uridine 5-oxyacetic acid (cmo) ⁵ U), uridine 5-oxyacetic acid methyl ester (mcmo ⁵ U), 5- carboxymethyl - uridine ^(cm 5 U), 1- Rubokishimechiru - pseudouridine, 5-carboxymethyl-hydroxymethyl - uridine ^(chm 5 U), 5-carboxymethyl-hydroxymethyl - uridine methyl ester (mchm ⁵ U), 5- methoxycarbonylmethyl - uridine ^(mcm 5 U), 5-methoxycarbonylmethyl 2-thio-uridine (mcm ⁵ s ² U), 5-aminomethyl-2-thio-uridine (nm ⁵ s ² U), 5-methylaminomethyl-uridine (mnm ⁵ U), 5-methylaminomethyl 2-thio-uridine (mnm ⁵ s ² U), 5-methylaminomethyl-2-seleno-uridine (mnm ⁵ se ² U), 5-carbamoylmethyl-uridine (ncm ⁵ U), 5-carboxymethylamino methyl - uridine (cmnm ⁵ U), 5- carboxymethyl Ami Methyl-2-thio - uridine ^{(cmnm 5 s 2 U),} 5- propynyl - uridine, 1-propynyl - pseudouridine, 5-Taurinomechiru - uridine (τm ⁵ U), 1- Taurinomechiru - pseudouridine, 5-Taurinomechiru 2- Thio-uridine (τm ⁵ s ² U), 1-taurinomethyl-4-thio-pseudouridine, 5-methyl-uridine (m ⁵ U, ie with nucleobase deoxythymine), 1-methyl-pseudouridine (m ¹ ψ ), 1-ethyl-pseudouridine (e1ψ), 5-methyl-2-thio-uridine (m ⁵ s ² U), 1-methyl-4-thio-pseudouridine (m ¹ s ⁴ ψ), 4-thio-1 - methyl - pseudouridine, 3-methyl - pseudouridine ^{(m 3} ψ), 2- thio-1-methyl - Puso Douridine, 1-methyl-1-deaza-pseudouridine, 2-thio-1-methyl-1-deaza-pseudouridine, dihydrouridine (D), dihydropseudouridine, 5,6-dihydrouridine, 5-methyl-dihydrouridine ^(m 5 D) 2-thio - dihydro uridine, 2-thio - dihydro pseudouridine, 2-methoxy - uridine, 2-methoxy-4-thio - uridine, 4-methoxy - pseudouridine, 4-methoxy-2- Thio-pseudouridine, N1-methyl-pseudouridine, 3- (3-amino-3-carboxypropyl) uridine (acp ³ U), 1-methyl-3- (3-amino-3-carboxypropyl) pseudouridine (acp ³ ψ ), 5- (isopentenyl aminomethyl) uridine ^(inm 5 U), - (isopentenyl aminomethyl) -2-thio - uridine ^{(inm 5 s 2 U),} α- thio - uridine, 2'-O-methyl - uridine (Um), 5,2'-O- dimethyl - uridine ( m ⁵ Um), 2′-O-methyl-pseudouridine (ψm), 2-thio-2′-O-methyl-uridine (s ² Um), 5-methoxycarbonylmethyl-2′-O-methyl-uridine ( mcm ⁵ Um), 5-carbamoylmethyl-2′-O-methyl-uridine (ncm ⁵ Um), 5-carboxymethylaminomethyl-2′-O-methyl-uridine (cmnm ⁵ Um), 3,2′- O- dimethyl - uridine ^(m 3 Um), and 5- (isopentenyl aminomethyl) -2'-O- methyl - uridine ^(inm 5 Um), 1-thio - uridine, deoxythymidine, 2'-F- La - uridine, 2'-F- uridine, 2'-OH @ - Ala - uridine, 5- (2-carbomethoxy-vinyl) uridine and 5- [3- (1-E- propenylamino)], and uridine.

In some embodiments, the modified nucleobase is a modified cytosine. Exemplary nucleobases and nucleosides with modified cytosines include 5-aza-cytidine, 6-aza-cytidine, pseudoisocytidine, 3-methyl-cytidine (m ³ C), N4-acetyl-cytidine (ac ⁴ C), 5-formyl-cytidine (f ⁵ C), N4-methyl-cytidine (m ⁴ C), 5-methyl-cytidine (m ⁵ C), 5-halo-cytidine (eg 5-iodo-cytidine) 5-hydroxymethyl-cytidine (hm ⁵ C), 1-methyl-pseudoisocytidine, pyrrolo-cytidine, pyrrolo-pseudoisocytidine, 2-thio-cytidine (s ² C), 2-thio-5 Methyl-cytidine, 4-thio-pseudoisocytidine, 4-thio-1-methyl-pseudoisocytidine, 4-thio-1-methyl-1-deaza-pseudoisocyti 1-methyl-1-deaza-pseudoisocytidine, zebularine, 5-aza-zebularine, 5-methyl-zebularine, 5-aza-2-thio-zebularine, 2-thio-zebularine, 2-methoxy-cytidine 2-methoxy-5-methyl-cytidine, 4-methoxy-pseudoisocytidine, 4-methoxy-1-methyl-pseudoisocytidine, lysidine (k ₂ C), α-thio-cytidine, 2′-O - methyl - cytidine (Cm), 5,2'-O- dimethyl - cytidine ^(m 5 Cm), N4- acetyl -2'-O-methyl - cytidine ^{(ac 4 Cm), N4,2'-} O- dimethyl - cytidine ^(m 4 Cm), 5- formyl--2'-O-methyl - cytidine ^{(f 5 Cm), N4,} N4,2'-O- trimethyl - cytidine _^(m 4 2 Cm), 1- thio - cytidine , 2'-F-ara-cytidine, 2'-F-cytidine and 2'-OH-ara-cytidine.

In some embodiments, the modified nucleobase is a modified adenine. Exemplary nucleobases and nucleosides with modified adenine include 2-amino-purine, 2,6-diaminopurine, 2-amino-6-halo-purine (eg, 2-amino-6-chloro-purine), 6-halo-purine (eg 6-chloro-purine), 2-amino-6-methyl-purine, 8-azido-adenosine, 7-deaza-adenine, 7-deaza-8-aza-adenine, 7-deaza 2-amino-purine, 7-deaza-8-aza-2-amino-purine, 7-deaza-2,6-diaminopurine, 7-deaza-8-aza-2,6-diaminopurine, 1-methyl Adenosine (m ¹ A), 2-methyl-adenine (m ² A), N6-methyl-adenosine (m ⁶ A), 2-methylthio-N6-methyl-adenosine (ms ² m ⁶ A), N6-isope Nthenyl-adenosine (i ⁶ A), 2-methylthio-N6-isopentenyl-adenosine (ms ² i ⁶ A), N6- (cis-hydroxyisopentenyl) adenosine (io ⁶ A), 2-methylthio-N6- ( cis - hydroxy isopentenyl) adenosine ^{(ms 2 io 6 A),} N6- glycidyl senior carbamoyl - adenosine ^(g 6 A), N6- threonyl-carbamoyl - adenosine ^(t 6 A), N6- methyl -N6- threonyl carbamoyl - adenosine ^{(m 6 t 6 A),} 2- methylthio -N6- threonyl-carbamoyl - adenosine ^{(ms 2 g 6 A),} N6, N6- dimethyl - adenosine _^(m 6 2 A), N6- hydroxy nor burrs carbamoyl - adenosine ^(hn 6 A), 2- methylthio -N6- hydroxy-nor burrs Carbamoyl - adenosine ^{(ms 2 hn 6 A),} N6- acetyl - adenosine ^(ac 6 A), 7- methyl - adenine, 2-methylthio - adenine, 2-methoxy - adenine, alpha-thio - adenosine, 2'-O - methyl - adenosine (Am), N6,2'-O- dimethyl - adenosine ^{(m 6 Am), N6,} N6,2'-O- trimethyl - adenosine _{^{(m 6 2 Am), 1,2'}} -O- Dimethyl-adenosine (m ¹ Am), 2′-O-ribosyl adenosine (phosphate) (Ar (p)), 2-amino-N6-methyl-purine, 1-thio-adenosine, 8-azido-adenosine, 2 Examples include '-F-ara-adenosine, 2'-F-adenosine, 2'-OH-ara-adenosine and N6- (19-amino-pentaoxanone adecyl) -adenosine.

In some embodiments, the modified nucleobase is a modified guanine. Exemplary nucleobases and nucleosides with modified guanines include inosine (I), 1-methyl-inosine (m ¹ I), wyocin (imG), methyl wyocin (mimG), 4-demethyl-wyosin (imG- 14), Isowyosine (imG2), Wibutosin (yW), Peroxywibutosine (o ₂ yW), Hydroxywibutosine (OhyW), Low-Modified Hydroxywibutosine (OhyW ^* ), 7-Deaza-Guanosine, Queosin ( Q), epoxy queosin (oQ), galactosyl-queosin (galQ), mannosyl-queosin (manQ), 7-cyano-7-deaza-guanosine (preQ ₀ ), 7-aminomethyl-7-deaza-guanosine (preQ _1), alk eosin ^(G +), 7- deaza-8-A - guanosine, 6-thio - guanosine, 6-thio-7-deaza - guanosine, 6-thio-7-deaza-8-aza - guanosine, 7-methyl - guanosine ^(m 7 G), 6-thio-7 Methyl-guanosine, 7-methyl-inosine, 6-methoxy-guanosine, 1-methyl-guanosine (m ¹ G), N2-methyl-guanosine (m ² G), N 2, N2-dimethyl-guanosine (m ² ₂ G ), N2,7-dimethyl-guanosine (m ^2,7 G), N2, N2,7-dimethyl-guanosine (m ^2,2,7 G), 8-oxo-guanosine, 7-methyl-8-oxo- Guanosine, 1-methyl-6-thio-guanosine, N2-methyl-6-thio-guanosine, N2, N2-dimethyl-6-thio-guanosine, α-thio-guanosine, 2′-O-methi - guanosine (Gm), N2- methyl -2'-O-methyl - guanosine ^{(m 2 Gm), N2,} N2- dimethyl -2'-O-methyl - guanosine _^(m 2 2 Gm), 1- methyl-2 '-O-methyl-guanosine (m ¹ Gm), N2,7-dimethyl-2'-O-methyl-guanosine (m ^2,7 Gm), 2'-O-methyl-inosine (Im), 1,2 '-O-dimethyl-inosine (m ¹ Im), 2'-O-ribosyl guanosine (phosphate) (Gr (p)), 1-thio-guanosine, O6-methyl-guanosine, 2'-F-ara- Examples include guanosine and 2′-F-guanosine.

In vitro transcription of RNA (eg, mRNA) VZV vaccines of the present disclosure comprise at least one RNA polynucleotide, such as mRNA (eg, modified mRNA). For example, mRNA is transcribed in vitro from a template DNA called “in vitro transcription template”. In some embodiments, at least one RNA polynucleotide has at least one chemical modification. The at least one chemical modification can include, but is not limited to, any modification described herein.

  In vitro transcription of RNA is known in the art and is described in International Publication No. WO / 2014/152027, which is hereby incorporated by reference in its entirety. For example, in some embodiments, an RNA transcript is generated using an unamplified linear DNA template in an in vitro transcription reaction to generate an RNA transcript. In some embodiments, the RNA transcript is capped by enzymatic capping. In some embodiments, the RNA transcript is purified by chromatographic methods, eg, using an oligo dT substrate. Some embodiments exclude the use of DNase. In some embodiments, the RNA transcript is a non-amplified linear DNA template encoding the gene of interest by enzymatic in vitro transcription reaction utilizing T7 phage RNA polymerase and the nucleotide triphosphate of the desired chemical. Is synthesized from Any number of RNA polymerases or variants can be used in the methods of the invention. The polymerase may be a phage RNA polymerase, such as T7 RNA polymerase, T3 RNA polymerase, SP6 RNa polymerase and / or mutant polymerases (eg, but not limited to chemically modified nucleic acids and / or nucleotides, including modified nucleic acids and / or nucleotides). Or a polymerase capable of incorporating modified nucleotides), but is not limited thereto.

  In some embodiments, unamplified linearized plasmid DNA is utilized as template DNA for in vitro transcription. In some embodiments, the template DNA is isolated DNA. In some embodiments, the template DNA is cDNA. In some embodiments, the cDNA is formed by reverse transcription of an RNA polynucleotide, such as, but not limited to, VZV RNA, such as VZV mRNA. In some embodiments, the cell is, for example, a bacterial cell, such as E. coli. For example, DH-1 cells are transfected with a plasmid DNA template. In some embodiments, the transfected cells are cultured to replicate the plasmid DNA, after which the plasmid DNA is isolated and purified. In some embodiments, the DNA template comprises an RNA polymerase promoter, eg, a T7 promoter, located 5 'and operably linked to the gene of interest.

  In some embodiments, the in vitro transcription template encodes a 5 'untranslated (UTR) region, contains an open reading frame, and encodes a 3' UTR and a poly A tail. The composition and length of the specific nucleic acid sequence of the in vitro transcription template depends on the mRNA encoded by the template.

  A “5 ′ untranslated region” (UTR) is an mRNA that is directly upstream (ie, 5 ′) from an initiation codon that does not encode a polypeptide (ie, the first codon of an mRNA transcript translated by the ribosome). Refers to the area.

  A “3 ′ untranslated region” (UTR) is a region of mRNA that is directly downstream (ie, 3 ′) from a stop codon that does not encode a polypeptide (ie, a codon of an mRNA transcript that conveys the termination of translation). Refers to an area.

  An “open reading frame” is a continuous stretch of DNA that begins with a start codon (eg, methionine (ATG)) and ends with a stop codon (eg, TAA, TAG, or TGA) and encodes a polypeptide.

  A “poly A tail” is a region of mRNA that contains a large number of consecutive adenosine monophosphates downstream from, eg, directly downstream (ie, 3 ′) from the 3 ′ UTR. The poly A tail can contain 10 to 300 adenosine monophosphates. For example, the poly A tail is 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, 210, 220. , 230, 240, 250, 260, 270, 280, 290 or 300 adenosine monophosphates. In some embodiments, the poly A tail contains 50 to 250 adenosine monophosphates. Within the relevant biological environment (eg, intracellular, in vivo), the poly (A) tail functions, for example, to protect mRNA from enzymatic degradation in the cytoplasm, and also terminates transcription and / or nuclei. Helps transport and translate mRNA from

  In some embodiments, the polynucleotide comprises 200 to 3,000 nucleotides. For example, the polynucleotide is 200-500, 200-1000, 200-1500, 200-3000, 500-1000, 500-1500, 500-2000, 500-3000, 1000-1500, 1000-2000, 1000-3000, It may contain 1500-3000 or 2000-3000 nucleotides.

Methods of Treatment Provided herein are compositions (eg, pharmaceutical compositions), methods, kits and reagents for the prevention and / or treatment of VZV in humans and other animals. VZV RNA vaccines can be used as therapeutic or prophylactic agents. This can be used as a medicament for the prevention and / or treatment of infectious diseases. In an exemplary embodiment, the VZV RNA vaccine of the present invention is used to provide prophylactic protection from chickenpox and herpes zoster. Chickenpox is an acute infection caused by VZV. Primary infection with varicella-zoster virus leading to chicken pox (varicella) may lead to complications including viral pneumonia or secondary bacterial pneumonia. Even when the clinical symptoms of chicken pox are resolved, VZV continues to lurk in the nervous system of the infected trigeminal and dorsal root ganglia, and activates later, returning from the sensory ganglia to the skin where there are shingles. Or it can cause a disease known as herpes zoster (rash), and it can cause several neurological conditions ranging from aseptic meningitis to encephalitis. VZV vaccines of the present disclosure can be used to prevent and / or treat both primary infections (chicken pox) and reactivated viral infections (herpes zoster or herpes zoster) Can be particularly useful for prevention and / or treatment to prevent herpes zoster or reduce its severity and / or duration.

  Prophylactic protection from VZV can be achieved after administration of the VZV RNA vaccine of the present disclosure. The vaccine can be administered once, twice, three times, four times or more, but it may be sufficient to administer the vaccine once (optionally followed by a single booster). Although less desirable, it is possible to administer a vaccine to an infected individual to achieve a therapeutic response. The dose may need to be adjusted accordingly.

  In aspects of the present disclosure, a method of eliciting a subject's immune response to VZV is provided. The method involves administering to a subject a VZV RNA vaccine comprising at least one RNA (eg, mRNA) polynucleotide having an open reading frame encoding at least one VZV antigenic polypeptide or immunogenic fragment thereof, This induces an immune response specific to the VZV antigenic polypeptide or immunogenic fragment thereof in the subject, and the anti-antigenic polypeptide antibody titer of the subject is against VZV after vaccination. Increased compared to the anti-antigenic polypeptide antibody titer of a subject vaccinated with a conventional vaccine at a prophylactically effective dose. An “anti-antigenic polypeptide antibody” is a serum antibody that specifically binds to an antigenic polypeptide.

  A prophylactically effective dose is a therapeutically effective dose that prevents viral infection at clinically acceptable levels. In some embodiments, the therapeutically effective dose is a dose listed in a vaccine package insert. Conventional vaccine, as used herein, refers to a vaccine other than the mRNA vaccine of the present disclosure. For example, conventional vaccines include, but are not limited to, live microbial vaccines, dead microbial vaccines, subunit vaccines, protein antigen vaccines, DNA vaccines, VLP vaccines, and the like. In an exemplary embodiment, the conventional vaccine is a vaccine that has been approved by a regulatory authority and / or registered by a national drug regulatory agency, such as the US Food and Drug Administration (FDA) or the European Medicines Agency (EMA). .

  In aspects of the invention, methods of eliciting a subject's immune response to VZV are provided. The method involves administering to a subject a VZV RNA vaccine comprising at least one RNA polynucleotide having an open reading frame encoding at least one VZV antigenic polypeptide or an immunogenic fragment thereof, whereby the subject In which an anti-antigenic polypeptide antibody titer of the subject prevents a conventional vaccine against VZV after vaccination, which induces an immune response specific for the VZV antigenic polypeptide or immunogenic fragment thereof. Increased compared to the anti-antigenic polypeptide antibody titer of the subject inoculated with the top effective dose. An “anti-antigenic polypeptide antibody” is a serum antibody that specifically binds to an antigenic polypeptide.

  A prophylactically effective dose is a therapeutically effective dose that prevents viral infection at clinically acceptable levels. In some embodiments, the therapeutically effective dose is a dose listed in a vaccine package insert. Conventional vaccine, as used herein, refers to a vaccine other than the mRNA vaccine of the present invention. For example, conventional vaccines include, but are not limited to, live microorganism vaccines, dead microorganism vaccines, subunit vaccines, protein antigen vaccines, DNA vaccines, and the like.

  In some embodiments, the subject's anti-antigenic polypeptide antibody titer is compared to the anti-antigenic polypeptide antibody titer of the subject vaccinated and then vaccinated with a conventional vaccine against VZV at a prophylactically effective dose. Increase by 1 log to 10 log.

  In some embodiments, the subject's anti-antigenic polypeptide antibody titer is compared to the anti-antigenic polypeptide antibody titer of the subject vaccinated and then vaccinated with a conventional vaccine against VZV at a prophylactically effective dose. Increase by 1 log.

  In some embodiments, the subject's anti-antigenic polypeptide antibody titer is compared to the anti-antigenic polypeptide antibody titer of the subject vaccinated and then vaccinated with a conventional vaccine against VZV at a prophylactically effective dose. Increase by 2 logs.

  In some embodiments, the subject's anti-antigenic polypeptide antibody titer is compared to the anti-antigenic polypeptide antibody titer of the subject vaccinated and then vaccinated with a conventional vaccine against VZV at a prophylactically effective dose. Increase by 3 logs.

  In some embodiments, the subject's anti-antigenic polypeptide antibody titer is compared to the anti-antigenic polypeptide antibody titer of the subject vaccinated and then vaccinated with a conventional vaccine against VZV at a prophylactically effective dose. Increase by 5 logs.

  In some embodiments, the subject's anti-antigenic polypeptide antibody titer is compared to the anti-antigenic polypeptide antibody titer of the subject vaccinated and then vaccinated with a conventional vaccine against VZV at a prophylactically effective dose. Increase by 10 logs.

  In another aspect of the invention, a method of eliciting a subject's immune response against VZV is provided. The method involves administering to a subject a VZV RNA vaccine comprising at least one RNA polynucleotide having an open reading frame encoding at least one VZV antigenic polypeptide or immunogenic fragment thereof, whereby the subject An immune response specific to a VZV antigenic polypeptide or an immunogenic fragment thereof, wherein the immune response in the subject is 2 to 100 times that of a conventional vaccine against VZV versus an RNA vaccine. Equivalent to an immune response in subjects inoculated at a dose level.

  In some embodiments, the subject's immune response is equivalent to that of a subject vaccinated with a conventional vaccine at a dose level twice that of a VZV RNA vaccine.

  In some embodiments, the subject's immune response is equivalent to that of a subject vaccinated with a conventional vaccine at a dose level three times that of a VZV RNA vaccine.

  In some embodiments, the subject's immune response is equivalent to that of a subject vaccinated with a conventional vaccine at a dose level four times that of a VZV RNA vaccine.

  In some embodiments, the subject's immune response is equivalent to that of a subject vaccinated with a conventional vaccine at a dose level five times that of a VZV RNA vaccine.

  In some embodiments, the subject's immune response is equivalent to that of a subject vaccinated with a conventional vaccine at a 10-fold dose level relative to a VZV RNA vaccine.

  In some embodiments, the subject's immune response is equivalent to that of a subject vaccinated with a conventional vaccine at a 50-fold dose level relative to a VZV RNA vaccine.

  In some embodiments, the subject's immune response is equivalent to that of a subject vaccinated with a conventional vaccine at a dose level 100 times that of a VZV RNA vaccine.

  In some embodiments, the subject's immune response is equivalent to the subject's immune response vaccinated with a conventional vaccine at a dose level 10 to 1000 times that of a VZV RNA vaccine.

  In some embodiments, the subject's immune response is equivalent to that of a subject inoculated with a conventional vaccine at a dose level 100-1000 times that of a VZV RNA vaccine.

  In other embodiments, the immune response is assessed by determining the [protein] antibody titer in the subject.

  In another aspect, the present invention provides a subject with a VZV RNA vaccine comprising at least one RNA polynucleotide having an open reading frame encoding at least one VZV antigenic polypeptide or immunogenic fragment thereof. A method of inducing an immune response against VZV in the subject, thereby inducing a specific immune response in the subject to a VZV antigenic polypeptide or an immunogenic fragment thereof. The response is induced 2 days to 10 weeks earlier compared to the immune response elicited in subjects vaccinated with conventional vaccines against VZV at a prophylactically effective dose. In some embodiments, the immune response in the subject is induced in a subject vaccinated with a prophylactically effective dose of a conventional vaccine, which is a 2 to 100 fold dose relative to the RNA vaccine.

  In some embodiments, the immune response in the subject is induced two days earlier compared to the immune response elicited in a subject vaccinated with a prophylactically effective dose of a conventional vaccine.

  In some embodiments, the immune response in the subject is induced 3 days earlier compared to the immune response elicited in a subject vaccinated with a prophylactically effective dose of a conventional vaccine.

  In some embodiments, the immune response in the subject is induced one week earlier compared to the immune response elicited in a subject vaccinated with a prophylactically effective dose of a conventional vaccine.

  In some embodiments, the immune response in the subject is induced two weeks earlier compared to the immune response elicited in a subject vaccinated with a prophylactically effective dose of a conventional vaccine.

  In some embodiments, the immune response in the subject is induced 3 weeks earlier compared to the immune response elicited in a subject vaccinated with a prophylactically effective dose of a conventional vaccine.

  In some embodiments, the immune response in the subject is induced 5 weeks earlier compared to the immune response elicited in a subject vaccinated with a prophylactically effective dose of a conventional vaccine.

  In some embodiments, the immune response in the subject is induced 10 weeks earlier compared to the immune response elicited in a subject vaccinated with a prophylactically effective dose of a conventional vaccine.

  A method of eliciting a subject's immune response against VZV by administering to the subject a VZV RNA vaccine having an open reading frame encoding a first antigenic polypeptide, said RNA polynucleotide comprising a stabilizing element. Does not include, and does not co-formulate or co-administer the adjuvant with the vaccine.

Broad-spectrum VZV vaccines Situations at risk of infection with two or more VZV strains are envisaged. RNA (eg, mRNA) therapeutic vaccines include, but are not limited to, mixed vaccines due to a number of factors including, but not limited to, production speed, the ability to rapidly adjust the vaccine to meet recognized geographic threats, etc. Especially suitable for the technique. Furthermore, since the vaccine uses the human body to produce antigenic proteins, it is suitable for the production of larger and more complex antigenic proteins, thereby allowing appropriate folding, surface expression, antigen presentation, etc. in human subjects Is possible. An RNA encoding at least one antigenic polypeptide protein of the first VZV (or an antigenic portion thereof) to protect against more than one VZV strain, and at least one antigenic poly of the second VZV A combination vaccine can be administered that further comprises RNA encoding the peptide protein (or antigenic portion thereof). The RNA (mRNA) may be formulated together, for example, in a single lipid nanoparticle (LNP) or in separate LNPs scheduled for co-administration.

Flagellin adjuvant Flagellin is a monomeric protein of about 500 amino acids that forms flagella involved in bacterial movement by polymerizing. Flagellin is expressed by various flagellar bacteria (eg, Salmonella typhimurium) and non-flagellar bacteria (Escherichia coli, etc.). The detection of flagellin by innate immune system cells (dendritic cells, macrophages, etc.) is mediated by Toll-like receptor 5 (TLR5) and Nod-like receptors (NLR) Ipaf and Naip5. TLRs and NLRs have been identified to play a role in activating innate and adaptive immune responses. Thus, flagellin provides an adjuvant effect in vaccines.

  Nucleotide and amino acid sequences encoding known flagellin polypeptides are published in the NCBI GenBank database. In particular, S.M. Typhimurium, H.M. Pylori, V.M. Cholera, S .; marcesens, S.M. flexneri, T.M. Pallidum, L.M. pneumophila, B.I. burgdorferei, C.I. difficile, R.D. meliloti, A.M. tumefaciens, R.A. lupini, B.M. clarridgeiae, P.C. mirabilis, B.M. subtilus, L .; monocytogenes, P.M. aeruginosa and E. coli. The flagellin sequence derived from E. coli is known.

  Flagellin polypeptide, as used herein, refers to full-length flagellin protein, immunogenic fragments thereof, and peptides having at least 50% sequence identity to the flagellin protein or immunogenic fragment thereof. Exemplary flagellin proteins include Salmonella typhi (UniPro entry number Q56086), Salmonella typhimurium (A0A0C9DG09), Salmonella enteritidis (A0A0C9BAB7), and Salmonella choleris (X0), Salmonella typhi (from A0A0C9BA7) In some embodiments, the flagellin polypeptide is at least 60%, 70%, 75%, 80%, 90%, 95%, 97%, 98% or 99% of the flagellin protein or immunogenic fragment thereof. % Sequence identity.

  In some embodiments, the flagellin polypeptide is an immunogenic fragment. An immunogenic fragment is the part of a flagellin protein that elicits an immune response. In some embodiments, the immune response is a TLR5 immune response. An example of an immunogenic fragment is a flagellin protein in which all or part of the hinge region has been deleted or replaced with other amino acids. For example, an antigenic polypeptide can be inserted into the hinge region. The hinge region is the hypervariable region of flagellin. The hinge region of flagellin is also referred to as “D3 domain or D3 region”, “propeller domain or propeller region”, “hypervariable domain or hypervariable region” and “variable domain or region variable region”. “At least part of the hinge region” as used herein refers to any portion of the hinge region of flagellin or the entire hinge region. In other embodiments, the immunogenic fragment of flagellin is a 20, 25, 30, 35 or 40 amino acid C-terminal fragment of flagellin.

  The flagellin monomer is formed by domains D0-D3. D0 and D1, which form the stem, are composed of long alpha helices arranged vertically and are highly conserved among various bacteria. The D1 domain contains several amino acid stretches that are useful for TLR5 activation. The entire D1 domain or one or more of the active regions within the domain is an immunogenic fragment of flagellin. Examples of immunogenic regions within the D1 domain include residues 88-114 and residues 411-431 of Salmonella typhimurium FliC flagellin. Of the 13 amino acids in the 88-100 region, at least 6 substitutions are possible between Salmonella flagellin and other flagellin proteins that retain TLR5 activation. Thus, an immunogenic fragment of flagellin activates TLR5 and contains a 13 amino acid motif that is 53% or more identical to the 88-100 sequence of Salmonella FliC (LQRVRELAVQSAN, SEQ ID NO: 118). including.

  In some embodiments, an RNA (eg, mRNA) vaccine comprises RNA encoding a fusion protein of flagellin and one or more antigenic polypeptides. As used herein, “fusion protein” refers to the linking of two components of a construct. In some embodiments, the carboxy terminus of the antigenic polypeptide is fused or linked to the amino terminus of the flagellin polypeptide. In other embodiments, the amino terminus of the antigenic polypeptide is fused or linked to the carboxy terminus of the flagellin polypeptide. A fusion protein includes, for example, 1, 2, 3, 4, 5, 6 or more flagellin polypeptides linked to 1, 2, 3, 4, 5, 6 or more antigenic polypeptides. obtain. Where two or more flagellin polypeptides and / or two or more antigenic polypeptides are linked, such a construct may be referred to as a “multimer”.

  Each component of the fusion protein may be directly linked to each other or may be connected via a linker. For example, the linker may be an amino acid linker. The amino acid linker for linking the components of the fusion protein encoded by the RNA (eg mRNA) vaccine is selected, for example, from the group consisting of lysine residues, glutamic acid residues, serine residues and arginine residues It may include at least one element. In some embodiments, the linker is 1-30, 1-25, 1-25, 5-10, 5, 15 or 5-20 amino acids in length.

  In other embodiments, an RNA (eg, mRNA) vaccine comprises at least two individual RNA polynucleotides, one encoding one or more antigenic polypeptides and the other encoding a flagellin polypeptide. The at least two RNA polynucleotides can be formulated together in a carrier such as a lipid nanoparticle.

Therapeutic and Prophylactic Compositions Provided herein are compositions (eg, pharmaceutical compositions), methods, kits and reagents for the prevention, treatment and / or diagnosis of VZV, for example, in humans and other animals. VZV RNA (eg, mRNA) vaccines can be used as therapeutic or prophylactic agents. This can be used as a medicament for the prevention and / or treatment of infectious diseases. In some embodiments, the VZV vaccines of the invention can be envisaged for use in priming immune effector cells, for example, peripheral blood mononuclear cells (PBMC) are activated ex vivo and then injected into a subject ( Reinject).

  In an exemplary embodiment, a VZV vaccine containing an RNA polynucleotide described herein can be administered to a subject (eg, a mammalian subject such as a human subject) and the RNA polynucleotide is administered in vivo. To produce an antigenic polypeptide.

  VZV RNA vaccines can induce translation of polypeptides (eg, antigens or immunogens) in cells, tissues or organisms. In exemplary embodiments, such translation occurs in vivo, but embodiments where such translation occurs ex vivo, media or in vitro can also be envisioned. In an exemplary embodiment, the cell, tissue or organism is contacted with an effective amount of a composition containing a VZV RNA vaccine containing a polynucleotide having at least one translatable region encoding an antigenic polypeptide.

  An “effective amount” of a VZV RNA vaccine can, at least in part, be the target tissue, target cell type, means of administration, physical properties of the polynucleotide (eg, size and extent of modified nucleosides) and other VZV RNA vaccine other Provided based on components as well as other determinants. In general, an effective amount of a VZV RNA vaccine composition results in an immune response that is induced or boosted relative to antigen production in the cell. In general, an effective amount of a VZV RNA vaccine containing an RNA polynucleotide having at least one chemical modification is preferably more effective than a composition containing a similar unmodified polynucleotide encoding the same antigen or peptide antigen. is there. Increased antigen production increases cell transfection (percentage of cells transfected with RNA vaccines), increases protein translation from polynucleotides, decreases nucleic acid degradation (eg, prolongs protein translation from modified polynucleotides) Or by a change in the antigen-specific immune response of the host cell.

  The term “pharmaceutical composition” refers to a combination of an active substance and an inert or active carrier, which makes the composition particularly suitable for in vivo or ex vivo diagnostic or therapeutic applications. A “pharmaceutically acceptable carrier” does not cause undesired physiological effects after or upon administration to a subject. The carrier in the pharmaceutical composition must be “acceptable” in the sense of being compatible with the active ingredient and capable of stabilizing the active ingredient. One or more solubilizers can be utilized as a pharmaceutical carrier for delivery of the active agent. Examples of pharmaceutically acceptable carriers include, but are not limited to, biocompatible vehicles, adjuvants, additives and diluents that achieve compositions that can be used as dosage forms. Examples of other carriers include colloidal silicon oxide, magnesium stearate, cellulose and sodium lauryl sulfate. Further suitable pharmaceutical carriers and diluents and pharmaceutical needs for their use are described in Remington's Pharmaceutical Sciences.

  In some embodiments, RNA vaccines (including polynucleotides and encoded polypeptides thereof) according to the present disclosure can be used for the treatment or prevention of VZV.

  VZV RNA vaccines can be administered prophylactically or therapeutically to healthy individuals as part of an active immunization scheme, or early in infection during the incubation period or after active onset. In some embodiments, the amount of the RNA vaccine of the present disclosure provided to a cell, tissue or subject can be an amount effective for immune prevention.

  VZV RNA (eg, mRNA) vaccines can be administered with other prophylactic or therapeutic compounds. By way of non-limiting example, the prophylactic or therapeutic compound can be an adjuvant or a booster. As used herein with respect to prophylactic compositions such as vaccines, the term “booster” refers to additional administration of a prophylactic (vaccine) composition. The booster (or booster vaccine) can be administered after the previous administration of the prophylactic composition. The time from the first administration of the prophylactic composition to the booster administration is not limited, but is 1 minute, 2 minutes, 3 minutes, 4 minutes, 5 minutes, 6 minutes, 7 minutes, 8 minutes, 9 minutes, 10 minutes 15 minutes 20 minutes 35 minutes 40 minutes 45 minutes 50 minutes 55 minutes 1 hour 2 hours 3 hours 4 hours 5 hours 6 hours 7 hours 8 hours 9 hours 10 hours 11 hours, 12 hours, 13 hours, 14 hours, 15 hours, 16 hours, 17 hours, 18 hours, 19 hours, 20 hours, 21 hours, 22 hours, 23 hours, 1 day, 36 hours, 2 days, 3 days 4 days, 5 days, 6 days, 1 week, 10 days, 2 weeks, 3 weeks, 1 month, 2 months, 3 months, 4 months, 5 months, 6 months, 7 months, 8 months, 9 months, 10 months, 11 months, 1 year, 18 months, 2 years, 3 years, 4 years, 5 years, 6 years, 7 years, 8 years, 9 years, 10 years, 11 years, 12 years, 13 years, 1 Year 15, 15, 16, 17, 18, 19, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, It can be 75 years, 80 years, 85 years, 90 years, 95 years or more than 99 years. In exemplary embodiments, the time from the initial administration of the prophylactic composition to the booster administration is not limited to 1 week, 2 weeks, 3 weeks, 1 month, 2 months, 3 months, 6 months or 1 Can be years.

  In some embodiments, the VZV RNA vaccine can be administered intramuscularly, intranasally or intradermally, similar to the administration of inactivated vaccines known in the art.

  VZV RNA vaccines can be used in a variety of environments depending on the prevalence of infectious diseases or the degree or level of unmet medical needs. As a non-limiting example, RNA vaccines can be utilized to treat and / or prevent various infectious diseases. RNA vaccines have superior properties in that they have a higher antibody titer and provide a faster response compared to commonly available anti-viruses.

  Provided herein are pharmaceutical compositions comprising a VZV RNA vaccine and RNA vaccine composition and / or conjugate, optionally in combination with one or more pharmaceutically acceptable excipients.

  VZV RNA (eg, mRNA) vaccines can be formulated or administered alone or in combination with one or more other components. For example, a VZV RNA vaccine (vaccine composition) can include other components including, but not limited to, an adjuvant.

  In some embodiments, the VZV RNA vaccine does not include an adjuvant (adjuvant free).

  A VZV RNA (eg, mRNA) vaccine can be formulated or administered in combination with one or more pharmaceutically acceptable excipients. In some embodiments, the vaccine composition includes at least one additional active agent, such as a therapeutically effective agent, a prophylactically effective agent, or a combination of both. The vaccine composition may be sterile, pyrogen free, or both sterile and pyrogen free. Items that should generally be considered in the formulation and / or manufacture of pharmaceuticals such as vaccine compositions are described, for example, in Remington: The Science and Practice of Pharmacy 21st ed. , Lippincott Williams & Wilkins, 2005 (incorporated herein by reference in its entirety).

  In some embodiments, the VZV RNA vaccine is administered to a human, human patient or subject. For the purposes of this disclosure, the term “active ingredient” generally refers to an RNA polynucleotide or RNA polynucleotide (eg, an mRNA polynucleotide) that encodes an antigenic polypeptide contained therein.

  Formulations of the vaccine compositions described herein can be prepared by any method known in the pharmacology field or later developed. In general, such preparation methods involve the steps of combining the active ingredient (eg, mRNA polynucleotide) with excipients and / or one or more other accessory ingredients, and then necessary and / or Or, where desired, dividing the product into desired single or multiple dose units, molding and / or packaging.

  The relative amounts of active ingredients, pharmaceutically acceptable excipients and / or any additional ingredients in the pharmaceutical composition according to the present disclosure may depend on the characteristics, physique and / or condition of the subject to be treated, and Depending on the route by which the composition is administered, it can vary. By way of example, the composition may comprise between 0.1% and 100% active ingredient, for example 0.5-50%, 1-30%, 5-80%, at least 80% (w / w).

  VZV RNA vaccines (1) increase stability, (2) increase cell transfection, (3) allow sustained or delayed release (eg from a depot formulation), (4) alter biodistribution (Eg, targeting to a specific tissue or cell type), (5) increasing in vivo translation of the encoded protein, and / or (6) in vivo of the encoded protein (antigen). One or more excipients that alter the release profile can be formulated. Excipients include conventional excipients such as solvents, dispersion media, diluents or other liquid vehicles, dispersion aids or suspension aids, surfactants, isotonic agents, thickeners or emulsifiers. In addition to, but not limited to, any and all of the preservatives, cells transfected with lipidoids, liposomes, lipid nanoparticles, polymers, lipoplexes, core-shell nanoparticles, peptides, proteins, VZV RNA vaccines (Eg, for transplantation into a subject), hyaluronidase, nanoparticle mimics, and combinations thereof may be included.

Stabilizing Elements Eukaryotic natural mRNA molecules may contain stabilizing elements, such as, but not limited to, 5 ′ cap structures or other structural features such as 3 ′ poly (A) tails. It has been found to contain an 'untranslated region (UTR) at the end (5'UTR) and / or a UTR (3'UTR) at its 3' end. Both 5'UTR and 3'UTR are typically transcribed from genomic DNA and are elements of immature mRNA. The characteristic structural features of mature mRNA, such as the 5 ′ cap and 3 ′ poly (A) tail, are usually added to the transcribed (immature) mRNA during mRNA processing. The 3 ′ poly (A) tail is typically a stretch of adenine nucleotides added to the 3 ′ end of the transcribed mRNA and can contain up to about 400 adenine nucleotides. In some embodiments, the length of the 3 ′ poly (A) tail can be an essential factor with respect to the stability of individual mRNAs.

  In some embodiments, the RNA vaccine may include one or more stabilizing elements. The stabilizing element can include, for example, a histone stem loop. Stem loop binding protein (SLBP), a 32 kDa protein, has been identified. SLBP associates with the histone stem loop at the 3 'end of the histone message in both the nucleus and the cytoplasm. Its expression level is regulated by the cell cycle and peaks during S phase, when histone mRNA levels also rise. This protein has been shown to be required for efficient 3 'end processing of histone pre-mRNA by U7 snRNP. SLBP continues to associate with the stem loop after processing and then stimulates the translation of mature histone mRNA into histone proteins in the cytoplasm. The RNA binding domain of SLBP is conserved across metazoans and protozoa, and its binding to histone stem loops depends on the loop structure. The minimal binding sites are at least 3 nucleotides 5 'and 2 nucleotides 3' to the stem loop.

  In some embodiments, the RNA vaccine comprises a coding region, at least one histone stem loop, and optionally a poly (A) sequence or polyadenylation signal. A poly (A) sequence or polyadenylation signal will generally improve the expression level of the encoded protein. The encoded protein is in some embodiments a histone protein, a reporter protein (eg, luciferase, GFP, EGFP, β-galactosidase, EGFP) or a marker or selection protein (eg, α-globin, galactokinase and xanthine: Not guanine phosphoribosyltransferase (GPT)).

  In some embodiments, the combination of a poly (A) sequence or polyadenylation signal and at least one histone stem loop, both naturally exhibit an alternative mechanism, but act synergistically to provide individual elements. Increases protein expression beyond the level observed with either. It has been found that the synergistic effect of the combination of poly (A) and at least one histone stem loop does not depend on the order of the elements or the length of the poly (A) sequence.

  In some embodiments, the RNA vaccine does not include a histone downstream element (HDE). The “histone downstream element” (HDE) contains a purine-rich polynucleotide stretch of about 15-20 nucleotides 3 ′ to the native stem loop, which is involved in the processing of histone pre-mRNA to mature histone mRNA. Represents the binding site of U7 snRNA. In some embodiments, the nucleic acid does not include introns.

  In some embodiments, the RNA vaccine may or may not contain enhancer sequences and / or promoter sequences, which sequences may be modified or unmodified and activated. It may be inactivated. In some embodiments, the histone stem loop is usually derived from a histone gene and is formed by two adjacent partially or fully reverse complementary, separated by a short sequence spacer that forms a loop of the structure. Includes intramolecular base pairing of sequences. The unpaired loop region typically cannot base pair with any of the stem loop elements. This occurs more frequently in RNA because it is an important component of many RNA secondary structures, but can also be present in single-stranded DNA as well. The stability of the stem-loop structure usually depends on the length of the pairing region, the number of mismatches or bulges, and the base composition. In some embodiments, wobble base pairing (non-Watson-Crick base pairing) can occur. In some embodiments, the at least one histone stem loop sequence comprises 15 to 45 nucleotides in length.

  In other embodiments, the RNA vaccine may have one or more AU rich sequences removed. These sequences are sometimes referred to as AURES and are destabilizing sequences found in the 3'UTR. AURES can be removed from the RNA vaccine. Alternatively, AURES may be left in the RNA vaccine.

Nanoparticle Formation In some embodiments, VZV RNA (eg, mRNA) vaccines are formulated in nanoparticles. In some embodiments, the VZV RNA vaccine is formulated in lipid nanoparticles. In some embodiments, the VZV RNA vaccine is formulated in a lipid-polycation complex called cationic lipid nanoparticles. Formation of lipid nanoparticles can be accomplished by methods known in the art and / or methods described in US Patent Application Publication No. 20122018702, which is incorporated herein by reference in its entirety. it can. By way of non-limiting example, polycations can include cationic peptides or polypeptides, including but not limited to polylysine, polyornithine and / or polyarginine and International Publication No. WO20112013326 or US patents. And the cationic peptides described in published application US20130142818, each of which is incorporated herein by reference in its entirety. In some embodiments, the VZV RNA vaccine is formulated in lipid nanoparticles comprising non-cationic lipids such as, but not limited to, cholesterol or dioleoylphosphatidylethanolamine (DOPE).

  Lipid nanoparticle formulations can be influenced by biophysical parameters such as, but not limited to, the selection of cationic lipid components, the degree of saturation of cationic lipids, the nature of PEGylation, the proportion of all components, and size. I can receive it. Sample et al. (Nature Biotech. 2010 28: 172-176, incorporated herein by reference in its entirety), the lipid nanoparticle formulation is 57.1% cationic lipid, 7.1% dipalmitoyl phosphatidylcholine. , 34.3% cholesterol and 1.4% PEG-c-DMA. As another example, altering the composition of cationic lipids has shown that siRNA is efficiently delivered by various antigen-presenting cells (Basha et al. Mol Ther. 2011 19: 2186-2200, in its entirety. Is incorporated herein by reference).

  In some embodiments, the lipid nanoparticle formulation is 35-45% cationic lipid, 40% -50% cationic lipid, 50% -60% cationic lipid and / or 55% -65%. Cationic lipids can be included. In some embodiments, the lipid to RNA (eg, mRNA) ratio of the lipid nanoparticles is 5: 1 to 20: 1, 10: 1 to 25: 1, 15: 1 to 30: 1 and / or at least. It may be 30: 1.

  In some embodiments, the PEG ratio in the lipid nanoparticle formulation may be increased or decreased and / or the carbon chain length of the PEG lipid is changed from C14 to C18 and / or the pharmacokinetics of the lipid nanoparticle formulation and / or The body distribution may be changed. As non-limiting examples, lipid nanoparticle formulations can be 0.5% to 3.0%, 1.0% to 3.5%, 1.5% to 1.5% compared to cationic lipids, DSPC and cholesterol. PEG-c-DOMG (R-3 with a lipid molar ratio of 4.0%, 2.0% -4.5%, 2.5% -5.0% and / or 3.0% -6.0% -[(Ω-methoxy-poly (ethylene glycol) 2000) carbamoyl)]-1,2-dimyristyloxypropyl-3-amine) (also referred to herein as PEG-DOMG). In some embodiments, PEG-c-DOMG includes, but is not limited to, PEG-DSG (1,2-distearoyl-sn-glycerol, methoxypolyethylene glycol), PEG-DMG (1,2-diglycerol). It may be replaced by PEG lipids such as myristoyl-sn-glycerol) and / or PEG-DPG (1,2-dipalmitoyl-sn-glycerol, methoxypolyethylene glycol). The cationic lipid can be selected from any lipid known in the art including, but not limited to, DLin-MC3-DMA, DLin-DMA, C12-200, and DLin-KC2-DMA. .

  In some embodiments, the VZV RNA (eg, mRNA) vaccine formulation is a nanoparticle comprising at least one lipid. Lipids include, but are not limited to, DLin-DMA, DLin-K-DMA, 98N12-5, C12-200, DLin-MC3-DMA, DLin-KC2-DMA, DODMA, PLGA, PEG, PEG-DMG, (12Z, 15Z) -N, N-dimethyl-2-nonylhenicosa-12,15-dien-1-amine (L608), N, N-dimethyl-1-[(1S, 2R) -2-octylcyclopropyl] It can be selected from heptadecan-8-amine (L530), PEGylated lipids and aminoalcohol lipids.

In some embodiments, the lipid is
It is.

In some embodiments, the lipid is
It is.

  In some embodiments, the lipid is a cationic lipid such as, but not limited to, DLin-DMA, DLin-D-DMA, DLin-MC3-DMA, DLin-KC2-DMA, DODMA and amino alcohol lipids. It may be. The aminoalcohol cationic lipid may be a lipid described in US Patent Application Publication No. US20130150625 (incorporated herein by reference in its entirety) and / or described in that patent application publication. It may be produced by a method. As a non-limiting example, the cationic lipid is 2-amino-3-[(9Z, 12Z) -octadeca-9,12-dien-1-yloxy] -2-{[(9Z, 2Z) -octadeca- 9,12-Dien-1-yloxy] methyl} propan-1-ol (Compound 1 of US20130150625), 2-amino-3-[(9Z) -octadec-9-en-1-yloxy] -2-{[ (9Z) -Octadeca-9-en-1-yloxy] methyl} propan-1-ol (Compound 2 of US20130150625), 2-amino-3-[(9Z, 12Z) -octadeca-9,12-diene-1 -Yloxy] -2-[(octyloxy) methyl] propan-1-ol (compound 3 of US20130150625) and 2- (dimethylamino) -3- (9Z, 12Z) -Octadeca-9,12-dien-1-yloxy] -2-{[(9Z, 12Z) -octadec-9,12-dien-1-yloxy] methyl} propan-1-ol (US20130150625) 4), or any pharmaceutically acceptable salt or stereoisomer thereof.

  Lipid nanoparticle formulations are typically lipids, particularly ionic cationic lipids such as 2,2-dilinoleyl-4-dimethylaminoethyl- [1,3] -dioxolane (DLin-KC2-DMA), dilinoleyl. -Methyl-4-dimethylaminobutyrate (DLin-MC3-DMA) or di ((Z) -non-2-en-1-yl) 9-((4- (dimethylamino) butanoyl) oxy) heptadecandio And a molecule capable of reducing aggregation of neutral lipids sterols and particles, such as PEG lipids or PEG-modified lipids.

  In some embodiments, the lipid nanoparticle formulation comprises (i) 2,2-dilinoleyl-4-dimethylaminoethyl- [1,3] -dioxolane (DLin-KC2-DMA), dilinoleyl-methyl-4-dimethyl. Consisting of aminobutyrate (DLin-MC3-DMA) and di ((Z) -non-2-en-1-yl) 9-((4- (dimethylamino) butanoyl) oxy) heptadecandioate (L319) At least one lipid selected from the group; (ii) a neutral lipid selected from DSPC, DPPC, POPC, DOPE and SM; (iii) a sterol, such as cholesterol; and (iv) a PEG-lipid, such as , PEG-DMG or PEG-cDMA, cationic lipid 20-60%: neutral lipid 5-25%: sterol 25 to 55%: with PEG lipid from 0.5 to 15% of the molar ratio, essentially constructed.

  In some embodiments, the lipid nanoparticle formulation is 2,2-dilinoleyl-4-dimethylaminoethyl- [1,3] -dioxolane (DLin-KC2-DMA), dilinoleyl-methyl-4-dimethylaminobutyrate. Selected from the group consisting of (DLin-MC3-DMA) and di ((Z) -non-2-en-1-yl) 9-((4- (dimethylamino) butanoyl) oxy) heptadecandioate (L319) The cationic lipid to be included comprises 25% to 75% on a molar basis, such as 35 to 65%, 45 to 65%, 60%, 57.5%, 50% or 40% on a molar basis.

  In some embodiments, the lipid nanoparticle formulation is 0.5% to 15% on a molar basis, such as 3-12%, 5-10% or 15%, 10% or 7.5% on a molar basis. Contains neutral lipids. Examples of neutral lipids include, but are not limited to, DSPC, POPC, DPPC, DOPE and SM. In some embodiments, the formulation is 5% to 50% sterols on a molar basis (eg, 15-45%, 20-40%, 40%, 38.5%, 35% or 31% on a molar basis). including. A non-limiting example of a sterol is cholesterol. In some embodiments, the lipid nanoparticle formulation is 0.5% to 20% on a molar basis (eg, 0.5 to 10%, 0.5 to 5%, 1.5%,. 5%, 1.5%, 3.5% or 5% PEG lipid or PEG modified lipid In some embodiments, the PEG lipid or PEG modified lipid comprises a PEG molecule having an average molecular weight of 2,000 Da. In some embodiments, the PEG lipid or PEG-modified lipid comprises a PEG molecule having an average molecular weight of less than 2,000, eg, about 1,500 Da, about 1,000 Da, or about 500 Da. Limited examples include PEG-distearoylglycerol (PEG-DMG) (also referred to herein as PEG-C14 or C14-PEG) and PEG-cDMA. It is (Reyes et al.J.Controlled Release, further are discussed, incorporated herein by reference in its entirety in the 107,276-287 (2005)).

  In some embodiments, the lipid nanoparticle formulation is 2,2-dilinoleyl-4-dimethylaminoethyl- [1,3] -dioxolane (DLin-KC2-DMA), dilinoleyl-methyl-4- on a molar basis. From dimethylaminobutyrate (DLin-MC3-DMA) and di ((Z) -non-2-en-1-yl) 9-((4- (dimethylamino) butanoyl) oxy) heptadecandioate (L319) 25 to 75% cationic lipid selected from the group consisting of 0.5 to 15% neutral lipid, 5 to 50% sterol, 0.5 to 20% PEG lipid or PEG modified lipid including.

  In some embodiments, the lipid nanoparticle formulation is 2,2-dilinoleyl-4-dimethylaminoethyl- [1,3] -dioxolane (DLin-KC2-DMA), dilinoleyl-methyl-4- on a molar basis. From dimethylaminobutyrate (DLin-MC3-DMA) and di ((Z) -non-2-en-1-yl) 9-((4- (dimethylamino) butanoyl) oxy) heptadecandioate (L319) 35-65% cationic lipid selected from the group consisting of 3-12% neutral lipid, 15-45% sterol, and 0.5-10% PEG lipid or PEG-modified lipid .

  In some embodiments, the lipid nanoparticle formulation is 2,2-dilinoleyl-4-dimethylaminoethyl- [1,3] -dioxolane (DLin-KC2-DMA), dilinoleyl-methyl-4- on a molar basis. From dimethylaminobutyrate (DLin-MC3-DMA) and di ((Z) -non-2-en-1-yl) 9-((4- (dimethylamino) butanoyl) oxy) heptadecandioate (L319) 45-65% cationic lipid selected from the group consisting of, 5-10% neutral lipid, 25-40% sterol, and 0.5-10% PEG lipid or PEG modified lipid .

  In some embodiments, the lipid nanoparticle formulation is 2,2-dilinoleyl-4-dimethylaminoethyl- [1,3] -dioxolane (DLin-KC2-DMA), dilinoleyl-methyl-4- on a molar basis. From dimethylaminobutyrate (DLin-MC3-DMA) and di ((Z) -non-2-en-1-yl) 9-((4- (dimethylamino) butanoyl) oxy) heptadecandioate (L319) 60% cationic lipid selected from the group consisting of 7.5% neutral lipid, 31% sterol and 1.5% PEG lipid or PEG modified lipid.

  In some embodiments, the lipid nanoparticle formulation is 2,2-dilinoleyl-4-dimethylaminoethyl- [1,3] -dioxolane (DLin-KC2-DMA), dilinoleyl-methyl-4- on a molar basis. From dimethylaminobutyrate (DLin-MC3-DMA) and di ((Z) -non-2-en-1-yl) 9-((4- (dimethylamino) butanoyl) oxy) heptadecandioate (L319) 50% cationic lipid selected from the group consisting of 10% neutral lipid, 38.5% sterol and 1.5% PEG lipid or PEG modified lipid.

  In some embodiments, the lipid nanoparticle formulation is 2,2-dilinoleyl-4-dimethylaminoethyl- [1,3] -dioxolane (DLin-KC2-DMA), dilinoleyl-methyl-4- on a molar basis. From dimethylaminobutyrate (DLin-MC3-DMA) and di ((Z) -non-2-en-1-yl) 9-((4- (dimethylamino) butanoyl) oxy) heptadecandioate (L319) 50% cationic lipids selected from the group consisting of 10% neutral lipids, 35% sterols, 4.5% or 5% PEG lipids or PEG modified lipids, and 0.5% target Contains lipidated.

  In some embodiments, the lipid nanoparticle formulation is 2,2-dilinoleyl-4-dimethylaminoethyl- [1,3] -dioxolane (DLin-KC2-DMA), dilinoleyl-methyl-4- on a molar basis. From dimethylaminobutyrate (DLin-MC3-DMA) and di ((Z) -non-2-en-1-yl) 9-((4- (dimethylamino) butanoyl) oxy) heptadecandioate (L319) 40% cationic lipid selected from the group consisting of 15% neutral lipid, 40% sterol and 5% PEG lipid or PEG modified lipid.

  In some embodiments, the lipid nanoparticle formulation is 2,2-dilinoleyl-4-dimethylaminoethyl- [1,3] -dioxolane (DLin-KC2-DMA), dilinoleyl-methyl-4- on a molar basis. From dimethylaminobutyrate (DLin-MC3-DMA) and di ((Z) -non-2-en-1-yl) 9-((4- (dimethylamino) butanoyl) oxy) heptadecandioate (L319) 57.2% cationic lipid selected from the group consisting of 7.1% neutral lipid, 34.3% sterol and 1.4% PEG lipid or PEG modified lipid.

  In some embodiments, the lipid nanoparticle formulation is further discussed on a molar basis in PEG lipids, PEG-cDMA (PEG-cDMA is described in Reyes et al. (J. Controlled Release, 107, 276-287 (2005)). And 57.5% cationic lipids, 7.5% neutral lipids, 31.5% sterols, selected from 3), which are incorporated herein by reference in their entirety. 5% PEG lipid or PEG modified lipid.

  In some embodiments, the lipid nanoparticle formulation is a lipid mixture in a molar ratio of cationic lipid 20-70%: neutral lipid 5-45%: cholesterol 20-55%: PEG-modified lipid 0.5-15%. Consists essentially of In some embodiments, the lipid nanoparticle formulation is a lipid mixture in a molar ratio of cationic lipid 20-60%: neutral lipid 5-25%: cholesterol 25-55%: PEG modified lipid 0.5-15%. Consists essentially of

  In some embodiments, the lipid molar ratio is 50/10 / 38.5 / 1.5 (mol% cationic lipid / neutral lipid (eg DSPC) / Chol / PEG modified lipid (eg PEG-DMG, PEG -DSG or PEG-DPG)), 57.2 / 7.1134.3 / 1.4 (mol% cationic lipid / neutral lipid (eg DPPC) / Chol / PEG modified lipid (eg PEG-cDMA)), 40/15/40/5 (mol% cationic lipid / neutral lipid (eg DSPC) / Chol / PEG modified lipid (eg PEG-DMG)), 50/10/35 / 4.5 / 0.5 (mol % Cationic lipid / neutral lipid (eg DSPC) / Chol / PEG modified lipid (eg PEG-DSG)), 50/10/35/5 (cationic lipid / neutral Quality (eg DSPC) / Chol / PEG modified lipid (eg PEG-DMG)), 40/10/40/10 (mol% cationic lipid / neutral lipid (eg DSPC) / Chol / PEG modified lipid (eg PEG- DMG or PEG-cDMA)), 35/15/40/10 (mol% cationic lipid / neutral lipid (eg DSPC) / Chol / PEG modified lipid (eg PEG-DMG or PEG-cDMA)), or 52 / 13/30/5 (mol% cationic lipid / neutral lipid (eg DSPC) / Chol / PEG modified lipid (eg PEG-DMG or PEG-cDMA).

  Non-limiting examples of lipid nanoparticle compositions and methods of making the same can be found in, for example, Sample et al. (2010) Nat. Biotechnol. 28: 172-176; Jayarama et al. (2012), Angew. Chem. Int. Ed. 51: 8529-8533, and Maier et al. (2013) Molecular Therapy 21, 1570-1578, the entire contents of each of which are incorporated herein by reference.

  In some embodiments, the lipid nanoparticle formulation can include a cationic lipid, a PEG lipid, and a structural lipid, and can optionally include a non-cationic lipid. By way of non-limiting example, lipid nanoparticles are composed of 40-60% cationic lipid, 5-15% non-cationic lipid, 1-2% PEG lipid, and 30-50% structural lipid. Can be included. As another non-limiting example, lipid nanoparticles can include 50% cationic lipid, 10% non-cationic lipid, 1.5% PEG lipid, and 38.5% structural lipid. As yet another non-limiting example, a lipid nanoparticle may comprise 55% cationic lipid, 10% non-cationic lipid, 2.5% PEG lipid, and 32.5% structural lipid. In some embodiments, the cationic lipid may be any cationic lipid described herein, such as, but not limited to, DLin-KC2-DMA, DLin-MC3-DMA, and L319. .

  In some embodiments, the lipid nanoparticle formulations described herein can be quaternary lipid nanoparticles. Lipid nanoparticles can include cationic lipids, non-cationic lipids, PEG lipids, and structural lipids. By way of non-limiting example, lipid nanoparticles are composed of 40-60% cationic lipid, 5-15% non-cationic lipid, 1-2% PEG lipid, and 30-50% structural lipid. Can be included. As another non-limiting example, lipid nanoparticles can include 50% cationic lipid, 10% non-cationic lipid, 1.5% PEG lipid, and 38.5% structural lipid. As yet another non-limiting example, a lipid nanoparticle may comprise 55% cationic lipid, 10% non-cationic lipid, 2.5% PEG lipid, and 32.5% structural lipid. In some embodiments, the cationic lipid may be any cationic lipid described herein, such as, but not limited to, DLin-KC2-DMA, DLin-MC3-DMA, and L319. .

  In some embodiments, the lipid nanoparticle formulations described herein can include cationic lipids, non-cationic lipids, PEG lipids, and structural lipids. As a non-limiting example, the lipid nanoparticles are 50% cationic lipid DLin-KC2-DMA, 10% non-cationic lipid DSPC, 1.5% PEG lipid PEG-DOMG, 38.5. % Structural lipids and cholesterol. As a non-limiting example, the lipid nanoparticles are 50% cationic lipid DLin-MC3-DMA, 10% non-cationic lipid DSPC, 1.5% PEG lipid PEG-DOMG, 38.5. % Structural lipids and cholesterol. As a non-limiting example, the lipid nanoparticles are 50% cationic lipid DLin-MC3-DMA, 10% non-cationic lipid DSPC, 1.5% PEG lipid PEG-DMG, 38.5. % Structural lipids and cholesterol. As yet another non-limiting example, lipid nanoparticles are 55% cationic lipid L319, 10% non-cationic lipid DSPC, 2.5% PEG lipid PEG-DMG, 32.5% Of structural lipids.

  The relative amounts of active ingredients, pharmaceutically acceptable excipients and / or any additional ingredients in the vaccine composition may depend on what is being treated, on the physique and / or condition, Depending on the route by which the composition is administered, it may vary. For example, the composition may contain from 0.1% to 99% (w / w) active ingredient. By way of example, the composition may comprise between 0.1% and 100% active ingredient, for example 0.5-50%, 1-30%, 5-80%, at least 80% (w / w).

  In some embodiments, the RNA vaccine composition can comprise a polynucleotide described herein, a lipid nanoparticle comprising MC3, cholesterol, DSPC, and PEG2000-DMG, trisodium citrate buffer. Formulated in liquid, sucrose and water for injection. By way of non-limiting example, the composition comprises 2.0 mg / mL drug substance (eg, a polynucleotide encoding VZV), 21.8 mg / mL MC3, 10.1 mg / mL cholesterol, 5 4 mg / mL DSPC, 2.7 mg / mL PEG2000-DMG, 5.16 mg / mL trisodium citrate, 71 mg / mL sucrose, and 1.0 mL water for injection.

  In some embodiments, the nanoparticles (eg, lipid nanoparticles) have an average diameter of 10-500 nm, 20-400 nm, 30-300 nm, 40-200 nm. In some embodiments, the nanoparticles (eg, lipid nanoparticles) have an average diameter of 50-150 nm, 50-200 nm, 80-100 nm, or 80-200 nm.

Liposomes, Lipoplexes and Lipid Nanoparticles In some embodiments, the RNA vaccine pharmaceutical composition includes, but is not limited to, DiLa2 liposomes (Marina Biotech (Bothell, WA)), SMARTICSLES® (Marina Biotech ( Bothell, WA)), neutral DOPC (1,2-dioleoyl-sn-glycero-3-phosphocholine) based liposomes (eg siRNA delivery for ovarian cancer (Landen et al. Cancer Biology & Therapy 2006 5 (12) 1708-). 1713), which is incorporated herein by reference in its entirety) and formulations in liposomes such as hyaluronan-coated liposomes (Quiet Therapeutics (Israel)). It may be.

  In some embodiments, the RNA vaccine may be formulated with a lyophilized gel phase liposome composition as described in US Patent Application Publication No. US2012060293, which is hereby incorporated by reference in its entirety. .

  The nanoparticle formulation may include a phosphate conjugate. Phosphate conjugates can prolong in vivo circulation time and / or increase targeted delivery of nanoparticles. The phosphate conjugates used in the present invention can be made by the method described in WO20130333838 or US Patent Application Publication No. US201301196948, the entire contents of each of which are incorporated herein by reference. As a non-limiting example, the phosphate conjugate can include a compound of any one of the formulas described in International Publication No. WO20130333438, which is hereby incorporated by reference in its entirety. .

  The nanoparticle formulation can comprise a polymer conjugate. The polymer conjugate may be a water soluble conjugate. The polymer conjugate may have the structure described in US Patent Application Publication No. 20130059360, the entire contents of which are hereby incorporated by reference. In some embodiments, a polymer conjugate with a polynucleotide of the invention comprises a method and / or segmented polymer reagent described in US Patent Application Publication No. 20130072709, which is incorporated herein by reference in its entirety. Can be made using. In other embodiments, the polymer conjugate is a ring, such as, but not limited to, the polymer conjugate described in US Patent Application Publication No. US201301196948, the entire contents of which are hereby incorporated by reference. It may have pendant side groups that include a moiety.

  Nanoparticle formulations can include conjugates that improve delivery of the nanoparticles of the invention in a subject. Furthermore, the conjugate may suppress phagocytic clearance of the nanoparticles in the subject. In some embodiments, the conjugate is by a “self” peptide designed from human membrane protein CD47 (eg, Rodriguez et al. (Science 2013, 339, 971-975, incorporated herein by reference in its entirety). As described "self" particles). As shown by Rodriguez et al., Self-peptides delayed macrophage-mediated nanoparticle clearance and improved nanoparticle delivery. In other embodiments, the conjugate may be the membrane protein CD47 (see, eg, Rodriguez et al. Science 2013, 339, 971-975, which is hereby incorporated by reference in its entirety). Rodriguez et al. Have shown that CD47 can increase the proportion of circulating particles in subjects compared to scrambled peptides and PEG-coated nanoparticles, as well as “self” peptides.

  In some embodiments, the RNA vaccines of the invention are formulated in nanoparticles comprising a conjugate that improves delivery of the nanoparticles of the invention in a subject. The conjugate may be a CD47 membrane, or the conjugate may be derived from a CD47 membrane protein, such as the “self” peptide described above. In other embodiments, the nanoparticles can comprise PEG and a CD47 conjugate or derivative thereof. In yet other embodiments, the nanoparticles may include both the “self” peptide described above and the membrane protein CD47.

  In some embodiments, “self” peptides and / or CD47 proteins can be conjugated to virus-like particles or pseudovirions as described herein for delivery of RNA vaccines of the invention. .

  In other embodiments, the RNA vaccine pharmaceutical composition comprises a polynucleotide of the invention and a conjugate that may have a degradable linkage. Non-limiting examples of conjugates include aromatic moieties containing ionic hydrogen atoms, spacer moieties, and water soluble polymers. As a non-limiting example, a pharmaceutical composition comprising a conjugate having a degradable bond and a method for delivering the pharmaceutical composition are described in US Patent Application Publication No. US20130184443, the entire contents of which are Which is incorporated herein by reference.

  The nanoparticle formulation can be a carbohydrate nanoparticle comprising a carbohydrate carrier and an RNA vaccine. As non-limiting examples, carbohydrate carriers can include, but are not limited to, anhydride-modified phytoglycogen or glycogen-type materials, phytoglycogen octenyl succinate, phytoglycogen β-dextrin, anhydride-modified phytoglycogen β-dextrin. (For example, see International Publication No. WO2012109121, the entire contents of which are incorporated herein by reference).

  The nanoparticle formulations of the present invention may be coated with a surfactant or polymer to improve particle delivery. In some embodiments, the nanoparticles can be coated with a hydrophilic coating such as, but not limited to, a PEG coating and / or a coating with a neutral surface charge. A hydrophilic coating can help deliver nanoparticles containing a large payload, such as but not limited to RNA vaccines, into the central nervous system. By way of non-limiting example, nanoparticles comprising a hydrophilic coating and methods for making the nanoparticles are described in US Patent Application Publication No. US201303183244, the entire contents of which are hereby incorporated by reference.

  In some embodiments, the lipid nanoparticles of the present invention can be hydrophilic polymer particles. Non-limiting examples of hydrophilic polymer particles and methods of making hydrophilic polymer particles are described in US Patent Application Publication No. US20130210991, the entire contents of which are hereby incorporated by reference.

  In other embodiments, the lipid nanoparticles of the present invention can be hydrophobic polymer particles.

  Lipid nanoparticle formulations can be improved by replacing cationic lipids with biodegradable cationic lipids known as rapidly eliminated lipid nanoparticles (reLNP). Although not limited, ionic cationic lipids such as DLinDMA, DLin-KC2-DMA and DLin-MC3-DMA have been shown to accumulate in plasma and tissues over time, and potentially Can be a toxicogen. Rapid metabolism of lipids that are rapidly eliminated can improve the tolerability and therapeutic index of lipid nanoparticles in rats from doses of 1 mg / kg to doses of 10 mg / kg. Inclusion of enzymatically degraded ester linkages can improve the degradation and metabolic profile of the cationic component while maintaining the activity of the reLNP formulation. The ester bond may be intrinsic in the lipid chain or may be located at the end of the lipid chain. The internal ester bond may replace any carbon in the lipid chain.

  In some embodiments, the internal ester linkage may be located on either side of the saturated carbon.

  In some embodiments, an immune response can be elicited by delivering lipid nanoparticles that can include nanochemical species, polymers, and immunogens (US Patent Application Publication No. 20120189700 and International Publication No. WO201299805, respectively). The entirety of which is incorporated herein by reference).

  The polymer can encapsulate the nano species or can partially encapsulate the nano species. The immunogen may be a recombinant protein, a modified RNA and / or a polynucleotide described herein. In some embodiments, the lipid nanoparticles can be formulated for use in a vaccine, including but not limited to a vaccine against a pathogen.

  Lipid nanoparticles may be modified by manipulating the surface properties of the particles such that the lipid nanoparticles pass through the mucosal barrier. Mucus includes, but is not limited to, oral cavity (eg, cheek and esophageal membranes and tonsil tissue), eye, gastrointestinal tract (eg, stomach, small intestine, large intestine, colon, rectum), nose, respiratory organ (eg, Located in mucosal tissues such as the nose, pharynx, trachea and bronchial membranes) and genitals (eg, vagina, cervix and urethral membranes). Nanoparticles larger than 10-200 nm have high drug encapsulation efficiency and are preferred for their ability to provide sustained delivery of a wide range of drugs, but are considered too large to diffuse rapidly into the mucosal barrier. As mucus is continuously secreted, excreted, discarded or digested, and reused, most of the captured particles can be removed from the mucosal tissue within seconds or hours. Large polymer nanoparticles (200-500 nm in diameter) coated densely with low molecular weight polyethylene glycol (PEG) diffused through the mucus only 4-6 times slower than the same particles that diffuse in water (Lai et al. PNAS 2007 104 (5): 1482-487; Lai et al. Adv Drug Delv Rev. 2009 61 (2): 158-171, each of which is incorporated herein by reference in its entirety. Nanoparticle transport is determined using transit speed and / or fluorescence microscopy, such as, but not limited to, post-fading fluorescence recovery (FRAP) and high resolution multiple particle tracking (MPT). be able to. By way of non-limiting example, compositions that can pass through the mucosal barrier are described in US Pat. No. 8,241,670 or International Publication No. WO2013110028, the entire contents of each of which are incorporated herein by reference. Can be made.

  Lipid nanoparticles engineered to pass through mucus can include polymeric materials (eg, polymer cores) and / or polymer-vitamin conjugates and / or triblock copolymers. Polymer materials include polyamine, polyether, polyamide, polyester, polycarbamate, polyurea, polycarbonate, poly (styrene), polyimide, polysulfone, polyurethane, polyacetylene, polyethylene, polyethyleneimine, polyisocyanate, polyacrylate, polymethacrylate, poly Examples include, but are not limited to, acrylonitrile and polyarylate. The polymeric material can be biodegradable and / or biocompatible. Non-limiting examples of biocompatible polymers are described in International Publication No. WO2013116804, the entire contents of which are hereby incorporated by reference. The polymeric material may be further irradiated. As a non-limiting example, the polymeric material can be gamma irradiated (see, eg, International Publication No. WO201282165, which is incorporated herein by reference in its entirety). Non-limiting examples of specific polymers include poly (caprolactone) (PCL), ethylene vinyl acetate polymer (EVA), poly (lactic acid) (PLA), poly (L-lactic acid) (PLLA), poly (glycol) Acid) (PGA), poly (lactic acid-co-glycolic acid) (PLGA), poly (L-lactic acid-co-glycolic acid) (PLLGA), poly (D, L-lactide) (PDLA), poly (L- Lactide) (PLLA), poly (D, L-lactide-co-caprolactone), poly (D, L-lactide-co-caprolactone-co-glycolide), poly (D, L-lactide-co-PEO-co- D, L-lactide), poly (D, L-lactide-co-PPO-co-D, L-lactide), polyalkylcyanoacrylate, polyurethane, poly-L Lysine (PLL), hydroxypropyl methacrylate (HPMA), polyethylene glycol, poly-L-glutamic acid, poly (hydroxy acid), polyanhydride, polyorthoester, poly (ester amide), polyamide, poly (ester ether), polycarbonate Polyalkylenes such as polyethylene and polypropylene, polyalkylene glycols such as poly (ethylene glycol) (PEG), polyalkylene oxides (PEO), polyalkylene terephthalates such as poly (ethylene terephthalate), polyvinyl alcohol (PVA), Polyvinyl ether, polyvinyl ester, eg, poly (vinyl acetate), polyvinyl halide, eg, poly (vinyl chloride) (PVC), polyvinyl pyrrolide , Polysiloxane, polystyrene (PS), polyurethane, derivatized cellulose such as alkylcellulose, hydroxyalkylcellulose, cellulose ether, cellulose ester, nitrocellulose, hydroxypropylcellulose, carboxymethylcellulose, polymers of acrylic acid such as poly (methyl (Meth) acrylate) (PMMA), poly (ethyl (meth) acrylate), poly (butyl (meth) acrylate), poly (isobutyl (meth) acrylate), poly (hexyl (meth) acrylate), poly (isodecyl (meta) ) Acrylate), poly (lauryl (meth) acrylate), poly (phenyl (meth) acrylate), poly (methyl acrylate), poly (isopropyl acrylate), poly (isobutene) Til acrylate), poly (octadecyl acrylate) and copolymers and mixtures thereof, polydioxanone and copolymers thereof, polyhydroxyalkanoate, polypropylene fumarate, polyoxymethylene, poloxamer, poly (ortho) esters, poly (butyric acid), poly (good) Herbic acid), poly (lactide-co-caprolactone), PEG-PLGA-PEG and trimethylene carbonate, polyvinylpyrrolidone. Lipid nanoparticles include, but are not limited to, block copolymers (such as the branched polyether-polyamide block copolymers described in International Publication No. WO2013012476, which is hereby incorporated by reference in its entirety) and (Ethylene glycol))-(poly (propylene oxide))-(poly (ethylene glycol)) triblock copolymers (e.g., U.S. Patent Application Publication No. 20120121718, U.S. Patent Application Publication No. 2010001003337 and U.S. Patent No. 8,263). No. 665, each of which is incorporated herein by reference in its entirety) or may be associated with these. The copolymer can be a GRAS (generally recognized as safe) polymer and the formation of lipid nanoparticles can be made in such a way that no new chemical entities are generated. For example, lipid nanoparticles can include poloxamer-coated PLGA nanoparticles that can still rapidly pass through human mucus without forming a new chemical entity (Yang et al. Angew. Chem. Int. Ed. 2011 50: 25972600, the entire contents of which are incorporated herein by reference). A non-limiting scalable method for producing nanoparticles that can pass through human mucus has been described by Xu et al. (See, eg, J Control Release 2013, 170 (2): 279-86, The entire contents of which are incorporated herein by reference).

  The vitamin of the polymer-vitamin conjugate may be vitamin E. The vitamin portion of the conjugate includes, but is not limited to, hydrophobic components of vitamin A, vitamin E, other vitamins, cholesterol, hydrophobic moieties or other surfactants (eg, sterol chains, fatty acids, hydrocarbons) May be substituted with other suitable components such as chains and alkylene oxide chains).

  In some embodiments, an RNA (eg, mRNA) vaccine pharmaceutical composition includes, but is not limited to, DiLa2 liposomes (Marina Biotech (Bothell, WA)), SMARTICS® (Marina Biotech (Bothell, WA). )), Neutral DOPC (1,2-dioleoyl-sn-glycero-3-phosphocholine) based liposomes (eg, siRNA delivery for ovarian cancer (Landen et al. Cancer Biology & Therapy 2006 (12) 1708-1713, And may be formulated in liposomes such as hyaluronan-coated liposomes (Quiet Therapeutics (Israel)).

  In some embodiments, the RNA vaccine may be formulated with a lyophilized gel phase liposome composition as described in US Patent Application Publication No. US2012060293, which is hereby incorporated by reference in its entirety. .

  The nanoparticle formulation may include a phosphate conjugate. Phosphate conjugates can prolong in vivo circulation time and / or increase targeted delivery of nanoparticles. The phosphate conjugates used in the present invention can be made by the methods described in WO20130333838 or US Patent Application Publication No. 201301196948, the entire contents of each of which are incorporated herein by reference. As a non-limiting example, the phosphate conjugate can include a compound of any one of the formulas described in International Publication No. WO20130333438, which is hereby incorporated by reference in its entirety. .

  The nanoparticle formulation can comprise a polymer conjugate. The polymer conjugate may be a water soluble conjugate. The polymer conjugate may have the structure described in US Patent Application Publication No. 20130059360, the entire contents of which are hereby incorporated by reference. In some embodiments, a polymer conjugate with a polynucleotide of the invention comprises a method and / or segmented polymer reagent described in US Patent Application Publication No. 20130072709, which is incorporated herein by reference in its entirety. Can be made using. In other embodiments, the polymer conjugate is a ring, such as, but not limited to, the polymer conjugate described in US Patent Application Publication No. US201301196948, the entire contents of which are hereby incorporated by reference. It may have pendant side groups that include a moiety.

  Nanoparticle formulations can include conjugates that improve delivery of the nanoparticles of the invention in a subject. Furthermore, the conjugate may suppress phagocytic clearance of the nanoparticles in the subject. In some embodiments, the conjugate is a “self” peptide designed from human membrane protein CD47 (eg, Rodriguez et al. (Science 2013, 339, 971-975), incorporated herein by reference in its entirety). The “self” particles described by As shown by Rodriguez et al., Self-peptides delayed macrophage-mediated nanoparticle clearance and improved nanoparticle delivery. In other embodiments, the conjugate may be the membrane protein CD47 (see, eg, Rodriguez et al. Science 2013, 339, 971-975, which is hereby incorporated by reference in its entirety). Rodriguez et al. Have shown that CD47 can increase the proportion of circulating particles in subjects compared to scrambled peptides and PEG-coated nanoparticles, as well as “self” peptides.

  In some embodiments, the RNA vaccines of the invention are formulated in nanoparticles comprising a conjugate that enhances delivery of the disclosed nanoparticles in a subject. The conjugate may be a CD47 membrane, or the conjugate may be derived from a CD47 membrane protein, such as the “self” peptide described above. In other embodiments, the nanoparticles can comprise PEG and a CD47 conjugate or derivative thereof. In yet other embodiments, the nanoparticles may include both the “self” peptide described above and the membrane protein CD47.

  In some embodiments, “self” peptides and / or CD47 proteins can be conjugated to virus-like particles or pseudovirions as described herein for delivery of RNA vaccines of the invention.

  In other embodiments, the RNA vaccine pharmaceutical composition comprises a polynucleotide of the invention and a conjugate that may have a degradable linkage. Non-limiting examples of conjugates include aromatic moieties containing ionic hydrogen atoms, spacer moieties, and water soluble polymers. As a non-limiting example, a pharmaceutical composition comprising a conjugate having a degradable bond and a method for delivering the pharmaceutical composition are described in US Patent Application Publication No. US20130184443, the entire contents of which are Which is incorporated herein by reference.

  The nanoparticle formulation can be a carbohydrate nanoparticle comprising a carbohydrate carrier and an RNA (eg, mRNA) vaccine. As non-limiting examples, carbohydrate carriers can include anhydride-modified phytoglycogen or glycogen-type material, phytoglycogen octenyl succinate, phytoglycogen β-dextrin, or anhydride-modified phytoglycogen β-dextrin, There is no limitation (for example, see International Publication No. WO2012109121, the entire contents of which are incorporated herein by reference).

  The nanoparticle formulations of the present invention may be coated with a surfactant or polymer to improve particle delivery. In some embodiments, the nanoparticles can be coated with a hydrophilic coating such as, but not limited to, a PEG coating and / or a coating with a neutral surface charge. A hydrophilic coating can help deliver nanoparticles containing a large payload, such as but not limited to RNA vaccines, into the central nervous system. By way of non-limiting example, nanoparticles comprising a hydrophilic coating and methods for making the nanoparticles are described in US Patent Application Publication No. US201303183244, the entire contents of which are hereby incorporated by reference.

  In some embodiments, the lipid nanoparticles of the present invention can be hydrophilic polymer particles. Non-limiting examples of hydrophilic polymer particles and methods of making hydrophilic polymer particles are described in US Patent Application Publication No. US20130210991, the entire contents of which are hereby incorporated by reference.

  In other embodiments, the lipid nanoparticles of the present invention can be hydrophobic polymer particles.

  Lipid nanoparticle formulations can be improved by replacing cationic lipids with biodegradable cationic lipids known as rapidly eliminated lipid nanoparticles (reLNP). Although not limited, ionic cationic lipids such as DLinDMA, DLin-KC2-DMA and DLin-MC3-DMA have been shown to accumulate in plasma and tissues over time, and potentially Can be a toxicogen. Rapid metabolism of lipids that are rapidly eliminated can improve the tolerability and therapeutic index of lipid nanoparticles in rats from doses of 1 mg / kg to doses of 10 mg / kg. Inclusion of enzymatically degraded ester linkages can improve the degradation and metabolic profile of the cationic component while maintaining the activity of the reLNP formulation. The ester bond may be intrinsic in the lipid chain or may be located at the end of the lipid chain. The internal ester bond may replace any carbon in the lipid chain.

  In some embodiments, the internal ester linkage may be located on either side of the saturated carbon.

  In some embodiments, an immune response can be elicited by delivering lipid nanoparticles that can include nanochemical species, polymers, and immunogens (US Patent Application Publication No. 20120189700 and International Publication No. WO201299805, respectively). The entirety of which is incorporated herein by reference).

  The polymer can encapsulate the nano species or can partially encapsulate the nano species. The immunogen may be a recombinant protein, a modified RNA and / or a polynucleotide described herein. In some embodiments, the lipid nanoparticles can be formulated for use in a vaccine, including but not limited to a vaccine against a pathogen.

  Lipid nanoparticles may be modified by manipulating the surface properties of the particles such that the lipid nanoparticles pass through the mucosal barrier. Mucus includes, but is not limited to, oral cavity (eg, cheek and esophageal membranes and tonsil tissue), eye, gastrointestinal tract (eg, stomach, small intestine, large intestine, colon, rectum), nose, respiratory organ (eg, Located in mucosal tissues such as the nose, pharynx, trachea and bronchial membranes) and genitals (eg, vagina, cervix and urethral membranes). Nanoparticles larger than 10-200 nm have high drug encapsulation efficiency and are preferred for their ability to provide sustained delivery of a wide range of drugs, but are considered too large to diffuse rapidly into the mucosal barrier. As mucus is continuously secreted, excreted, discarded or digested, and reused, most of the captured particles can be removed from the mucosal tissue within seconds or hours. Large polymer nanoparticles (200-500 nm in diameter) coated densely with low molecular weight polyethylene glycol (PEG) diffused through the mucus only 4-6 times slower than the same particles that diffuse in water (Lai et al. PNAS 2007 104 (5): 1482-487; Lai et al. Adv Drug Delv Rev. 2009 61 (2): 158-171, each of which is incorporated herein by reference in its entirety. Nanoparticle transport is determined using transit speed and / or fluorescence microscopy, such as, but not limited to, post-fading fluorescence recovery (FRAP) and high resolution multiple particle tracking (MPT). be able to. By way of non-limiting example, compositions that can pass through the mucosal barrier are described in US Pat. No. 8,241,670 or International Publication No. WO2013110028, the entire contents of each of which are incorporated herein by reference. Can be made.

  Lipid nanoparticles engineered to pass through mucus can include a polymeric material (ie, a polymer core) and / or a polymer-vitamin conjugate and / or a triblock copolymer. Polymer materials include polyamine, polyether, polyamide, polyester, polycarbamate, polyurea, polycarbonate, poly (styrene), polyimide, polysulfone, polyurethane, polyacetylene, polyethylene, polyethyleneimine, polyisocyanate, polyacrylate, polymethacrylate, poly Examples include, but are not limited to, acrylonitrile and polyarylate. The polymeric material can be biodegradable and / or biocompatible. Non-limiting examples of biocompatible polymers are described in International Publication No. WO2013116804, the entire contents of which are hereby incorporated by reference. The polymeric material may be further irradiated. As a non-limiting example, the polymeric material can be gamma irradiated (see, eg, International Publication No. WO201282165, which is incorporated herein by reference in its entirety). Non-limiting examples of specific polymers include poly (caprolactone) (PCL), ethylene vinyl acetate polymer (EVA), poly (lactic acid) (PLA), poly (L-lactic acid) (PLLA), poly (glycol) Acid) (PGA), poly (lactic acid-co-glycolic acid) (PLGA), poly (L-lactic acid-co-glycolic acid) (PLLGA), poly (D, L-lactide) (PDLA), poly (L- Lactide) (PLLA), poly (D, L-lactide-co-caprolactone), poly (D, L-lactide-co-caprolactone-co-glycolide), poly (D, L-lactide-co-PEO-co- D, L-lactide), poly (D, L-lactide-co-PPO-co-D, L-lactide), polyalkylcyanoacrylate, polyurethane, poly-L Lysine (PLL), hydroxypropyl methacrylate (HPMA), polyethylene glycol, poly-L-glutamic acid, poly (hydroxy acid), polyanhydride, polyorthoester, poly (ester amide), polyamide, poly (ester ether), polycarbonate Polyalkylenes such as polyethylene and polypropylene, polyalkylene glycols such as poly (ethylene glycol) (PEG), polyalkylene oxides (PEO), polyalkylene terephthalates such as poly (ethylene terephthalate), polyvinyl alcohol (PVA), Polyvinyl ether, polyvinyl ester, eg, poly (vinyl acetate), polyvinyl halide, eg, poly (vinyl chloride) (PVC), polyvinyl pyrrolide , Polysiloxane, polystyrene (PS), polyurethane, derivatized cellulose such as alkylcellulose, hydroxyalkylcellulose, cellulose ether, cellulose ester, nitrocellulose, hydroxypropylcellulose, carboxymethylcellulose, polymers of acrylic acid such as poly (methyl (Meth) acrylate) (PMMA), poly (ethyl (meth) acrylate), poly (butyl (meth) acrylate), poly (isobutyl (meth) acrylate), poly (hexyl (meth) acrylate), poly (isodecyl (meta) ) Acrylate), poly (lauryl (meth) acrylate), poly (phenyl (meth) acrylate), poly (methyl acrylate), poly (isopropyl acrylate), poly (isobutene) Til acrylate), poly (octadecyl acrylate) and copolymers and mixtures thereof, polydioxanone and copolymers thereof, polyhydroxyalkanoate, polypropylene fumarate, polyoxymethylene, poloxamer, poly (ortho) esters, poly (butyric acid), poly (good) Herbic acid), poly (lactide-co-caprolactone), PEG-PLGA-PEG and trimethylene carbonate, polyvinylpyrrolidone. Lipid nanoparticles include, but are not limited to, block copolymers (such as the branched polyether-polyamide block copolymers described in International Publication No. WO2013012476, which is hereby incorporated by reference in its entirety) and (Ethylene glycol))-(poly (propylene oxide))-(poly (ethylene glycol)) triblock copolymers (e.g., U.S. Patent Publication No. 20120121718 and U.S. Patent Publication No. 2010001003337 and U.S. Patent No. 8,263). No. 665, each of which is incorporated herein by reference in its entirety) or may be associated with these. The copolymer can be a GRAS (generally recognized as safe) polymer and the formation of lipid nanoparticles can be made in such a way that no new chemical entities are generated. For example, lipid nanoparticles can include poloxamer-coated PLGA nanoparticles that can still rapidly pass through human mucus without forming a new chemical entity (Yang et al. Angew. Chem. Int. Ed. 2011 50: 25972600, the entire contents of which are incorporated herein by reference). A non-limiting scalable method for producing nanoparticles that can pass through human mucus has been described by Xu et al. (See, eg, J Control Release 2013, 170 (2): 279-86, The entire contents of which are incorporated herein by reference).

  The vitamin of the polymer-vitamin conjugate may be vitamin E. The vitamin portion of the conjugate includes, but is not limited to, hydrophobic components of vitamin A, vitamin E, other vitamins, cholesterol, hydrophobic moieties or other surfactants (eg, sterol chains, fatty acids, hydrocarbons) May be substituted with other suitable components such as chains and alkylene oxide chains).

  Lipid nanoparticles engineered to pass through mucus include, but are not limited to, polynucleotides, anionic proteins (eg, bovine serum albumin), surfactants (eg, dimethyldioctadecyl-ammonium bromide, etc. Cationic surfactants), sugars or sugar derivatives (eg, cyclodextrins), nucleic acids, polymers (eg, heparin, polyethylene glycol and poloxamers), mucolytic agents (eg, N-acetylcysteine, mugwort, bromelain, papain, Cleroden drum, acetylcysteine, bromhexine, carbocysteine, eprazinone, mesna, ambroxol, sobrerol, domiodol, letostein, stepronin, thiopronin, gelsolin, thymosin β4 dornase alpha, Rutenekishin may include surface modifiers such as various DNase containing erdosteine) and rhDNase. The surface modifier may be embedded in the particle surface, entangled on the particle surface, or placed on the surface of the lipid nanoparticle (eg, by coating, adsorption, covalent bonding or other processes) ( See, for example, US Patent Application Publication No. 201100215580 and US Patent Application Publication No. 200801666414 and US201304164343, the entire contents of each of which are incorporated herein by reference).

  In some embodiments, lipid nanoparticles that pass through mucus can comprise at least one polynucleotide described herein. The polynucleotide can be encapsulated in the lipid nanoparticle and / or disposed on the surface of the particle. The polynucleotide can be covalently bound to the lipid nanoparticle. A lipid nanoparticle formulation that passes through mucus may comprise a plurality of nanoparticles. In addition, the formulation contains particles that can interact with mucus and alter the structural properties and / or adherence of peripheral mucus that reduces mucoadhesion, which can increase the delivery of lipid nanoparticles through the mucus to mucosal tissue. May be.

  In other embodiments, lipid nanoparticles that pass through mucus can be hypotonic formulations that include a coating that improves mucosal passage. The formulation can be hypotonic to the delivered epithelium.

  Non-limiting examples of hypotonic formulations can be found in International Publication No. WO2013110028, the entire contents of which are hereby incorporated by reference.

  In some embodiments, the RNA vaccine formulation may or may be hypotonic to improve delivery across the mucosal barrier. Hypotonic fluids have been found to be able to increase the rate at which mucus inert particles, such as, but not limited to, particles that pass through mucus can reach the vaginal epithelial surface (eg, Ensign et al. Biomaterials). 2013, 34 (28): 6922-9, the entire contents of which are incorporated herein by reference).

  In some embodiments, the RNA vaccine is, but is not limited to, ATHEPLEX ™, DACC, DBTC and other siRNA lipoplex technologies from SILENCE THERAPEUTICS (London, United Kingdom), STECGENT® TM (Cambridge, MA), STEMFECT ™, and formulated as lipoplexes such as targeted and untargeted nucleic acid delivery based on polyethyleneimine (PEI) or protamine (Aleku et al. Cancer Res. 2008 68: 9788-9798; Strumberg et al. Int J Clin Pharmacol Ther 2012 50: 76-78; Gene Ther 2006 13: 1222-1234; Santel et al., Gene Ther 2006 13: 1360-1370; Guttier et al., Pulm Pharmacol. Ther. 2010 23: 334-344; Weide et al. J Immunother.2009 32: 498-507; Weide et al.J Immunother.2008 31: 180-188; Pascolo, Expert Opin.Biol.Ther. Mleczek et al., 2011 J. Immunother.34: 1-15; et al., Nature Biotechnol., 2005, 23: 709-717; Peer et al., Proc Natl Acad Sci USA A. 2007 6; 104: 4095-4100; deFougerles Hum Gene Ther.2008 19: 125-132. Each of which is incorporated herein by reference in its entirety.

  In some embodiments, such formulations are also passive in vivo for various cell types including but not limited to hepatocytes, immune cells, tumor cells, endothelial cells, antigen presenting cells and leukocytes. Or can be constructed or modified to be actively directed (Akinc et al. Mol Ther. 2010 18: 1357-1364; Song et al., Nat Biotechnol. 2005 23: 709-717; Judge et al., J Clin Invest. 2009 119: 661-673; Kaufmann et al., Microvas Res 2010 80: 286-293; Santel et al., Gene Ther 2006 13: 1222-1234; l., Gene Ther 2006 13: 1360-1370; Gutbier et al., Pulm Pharmacol.Ther. 2010 23: 334-344; Basha et al., Mol.Ther. 2011 19: 2186-2200; Opin Drug Deliv. 2008 5: 25-44; Peer et al., Science.2008 319: 627-630; Peer and Lieberman, Gene Ther.2011 18: 1127-1133, each of which is herein incorporated by reference in its entirety. ). An example of passive targeting of a formulation to hepatocytes includes DLin-DMA, DLin, which has been shown to bind to apolipoprotein E and promote binding and uptake of the formulation to hepatocytes in vivo. -KC2-DMA and DLin-MC3-DMA-based lipid nanoparticle formulations (Akinc et al. Mol Ther. 2010 18: 1357-1364, incorporated herein by reference in its entirety). The formulation is also selectively targeted by, but not limited to, expressing different ligands on its surface, as exemplified by folic acid, transferrin, N-acetylgalactosamine (GalNAc) and antibody targeting approaches. (Kolhatkar et al., Curr Drug Discov Technol. 2011 8: 197-206; Musacchio and Torchilin, Front Biosci. 2011 16: 1388-1412; Patil et al., Crit Rev The Drug Carrier Syst.2008 25: 1-61; Benoit et al., Bio Agromolecules.2011 12: 2708-2714; Zhao et al., Expert Opin Drug Deliv.2008 5: 309-319; Akinc et al., Mol Ther.2010 18: 1357-1364; 2012-820: 105-116; Ben-Arie et al., Methods Mol Biol.2012 757: 497-507; Peer 2010 J Control Release.20: 63-68; 2007 104: 4095-4100; Kim et al., Methods Mol Biol. 0111 721: 339-353; Subramanya et al., Mol Ther.2010 18: 2028-2037; Song et al., Nat Biotechnol.2005 23: 709-717; Peer et al., Science.2008 319-627-6. Peer and Lieberman, Gene Ther. 2011 18: 1127-1133, each of which is incorporated herein by reference in its entirety).

  In some embodiments, an RNA (eg, mRNA) vaccine is formulated as a solid lipid nanoparticle. Solid lipid nanoparticles (SLN) can be spherical with an average diameter of up to 1000 nm. SLN has a solid lipid core matrix that can solubilize lipophilic molecules and can be stabilized with surfactants and / or emulsifiers. In other embodiments, the lipid nanoparticles can be self-assembled lipid polymer nanoparticles (see Zhang et al., ACS Nano, 2008, 2 (8), pp 1696-1702, the entire contents of which are incorporated herein by reference). Incorporated herein by reference). As a non-limiting example, the SLN may be the SLN described in International Publication No. WO2013105101, the entire contents of which are incorporated herein by reference. As another non-limiting example, SLN can be made by the method or process described in International Publication No. WO2013105101, the entire contents of which are incorporated herein by reference.

  The formulation may be able to increase transfection of cells and / or increase translation of the encoded protein with RNA vaccines, but is targeted by polynucleotides using liposomes, lipoplexes or lipid nanoparticles. The efficiency of protein production can be improved. One such example may be the use of lipid encapsulation to allow effective systemic delivery of polyplex plasmid DNA (Heyes et al., Mol Ther. 2007 15: 713-720, in its entirety). Incorporated herein by reference). Liposomes, lipoplexes or lipid nanoparticles can also be used to increase the stability of the polynucleotide.

  In some embodiments, the RNA (eg, mRNA) vaccines of the invention can be formulated for controlled release and / or targeted delivery. As used herein, “controlled release” refers to the release profile of a pharmaceutical composition or compound consistent with a specific release pattern that achieves a therapeutic outcome. In some embodiments, the RNA vaccine can be encapsulated in a delivery material described herein and / or known in the art for controlled release and / or targeted delivery. As used herein, the term “encapsulate” means confined, enclosed, or encased. When referring to the formulation of the compounds of the present invention, the encapsulation may be substantial, complete or partial. The term “substantially encapsulated” refers to at least 50, 60, 70, 80, 85, 90, 95, 96, 97, 98, 99, 99.9, 99.99 of the pharmaceutical composition or compound of the invention. It means that more than 9 or more than 99.999% are trapped, surrounded or encapsulated within the delivery substance. “Partially encapsulated” means that less than 10%, 10, 20, 30, 40, 50 or less of the pharmaceutical composition or compound of the present invention is trapped, surrounded or encapsulated within the delivery agent. Advantageously, encapsulation can be determined by measuring leakage or activity of the pharmaceutical composition or compound of the invention using fluorescence and / or electron micrographs. For example, at least 1, 5, 10, 20, 30, 40, 50, 60, 70, 80, 85, 90, 95, 96, 97, 98, 99, 99.9, of the pharmaceutical composition or compound of the present invention, More than 99.99 or more than 99.99% are encapsulated in the delivery material.

  In some embodiments, the controlled release formulation can include, but is not limited to, a triblock copolymer. As a non-limiting example, the formulation may comprise two different types of triblock copolymers (WO 2012131104 and WO2012131106, the entire contents of each of which are incorporated herein by reference).

  In other embodiments, the RNA vaccine can be encapsulated in lipid nanoparticles or in rapidly excluded lipid nanoparticles, which lipid nanoparticles or rapidly excluded lipid nanoparticles are then Can be encapsulated in polymers, hydrogels and / or surgical sealants described in the literature and / or known in the art. By way of non-limiting example, the polymer, hydrogel or surgical sealant can be PLGA, ethylene vinyl acetate (EVAc), poloxamer, GELSITE® (Nanotherapeutics, Inc. (Alachua, FL)), HYLENEX® ( Halozyme Therapeutics (San Diego CA)), fibrinogen polymer (Ethicon Inc. (Corelia, GA)), TISSELL (registered trademark) (Baxter International, Inc (Deerfield, IL)), PEG series sealant CO Surgical sealants such as International, Inc (Deerfield, IL) There.

  In other embodiments, the lipid nanoparticles may be encapsulated in any polymer known in the art that can form a gel when injected into a subject. As another non-limiting example, lipid nanoparticles may be encapsulated within a polymer matrix that may be biodegradable.

  In some embodiments, RNA vaccine formulations for controlled release and / or targeted delivery can also include at least one controlled release coating. Controlled release coatings include OPADRY®, polyvinylpyrrolidone / vinyl acetate copolymer, polyvinylpyrrolidone, hydroxypropylmethylcellulose, hydroxypropylcellulose, hydroxyethylcellulose, EUDRAGIT RL®, EUDRAGIT RS®, and ethylcellulose aqueous Cellulose derivatives such as, but not limited to, dispersions (AQUACOAT® and SURELEASE®) are included.

  In some embodiments, an RNA (eg, mRNA) vaccine controlled release and / or targeted delivery formulation can include at least one degradable polyester that can contain polycationic side chains. Degradable polyesters include, but are not limited to, poly (serine ester), poly (L-lactide-co-L-lysine), poly (4-hydroxy-L-proline ester) and combinations thereof. In other embodiments, the degradable polyester can include a PEG conjugate to form a PEGylated polymer.

  In some embodiments, RNA vaccine controlled release and / or targeted delivery formulations comprising at least one polynucleotide are described in US Pat. No. 8,404,222, which is hereby incorporated by reference in its entirety. It may comprise at least one PEG and / or PEG-related polymer derivative as described.

  In other embodiments, an RNA vaccine controlled release delivery formulation comprising at least one polynucleotide is a controlled release polymer system described in US Patent Application Publication No. 20130130348, which is hereby incorporated by reference in its entirety. It may be.

  In some embodiments, an RNA (eg, mRNA) vaccine of the invention can be encapsulated in a therapeutic nanoparticle, referred to herein as a “therapeutic nanoparticle RNA vaccine”. The therapeutic nanoparticles may be any of the methods described herein and methods known in the art, such as, but not limited to, International Publication Nos. WO2010005740, WO20130030763, WO2010005721, No. WO2010005723, No. WO2012055433, U.S. Patent Application Publication No.US20110262491, U.S.20110146645, U.S.20100108337, U.S. US201303123351 and US201303030567, and U.S. Pat. Nos. 8,206,747 and 8,293,276. , It may be formulated according to the method described in the Nos. 8,318,208 item and the second 8,318,211 (incorporated its respective herein by reference the entire contents). In other embodiments, therapeutic polymer nanoparticles can be identified by the methods described in US Patent Application Publication No. US20120140790, the entire contents of which are hereby incorporated by reference.

  In some embodiments, the therapeutic nanoparticulate RNA vaccine can be formulated for sustained release. As used herein, “sustained release” refers to a pharmaceutical composition or compound that follows a certain release rate over a specified period of time. Specific periods include, but are not limited to hours, days, weeks, months, and years. By way of non-limiting example, a sustained release nanoparticle can include a polymer and a therapeutic agent such as, but not limited to, a polynucleotide of the present invention (WO2000075072 as well as US Patent Application Publication No. US20100216804). No., US201102177377 and US20120201859, each of which is incorporated herein by reference in its entirety). In another non-limiting example, the sustained release formulation includes an agent that enables sustained bioavailability such as, but not limited to, crystals, macromolecular gels and / or particulate suspensions. (See US Patent Application Publication No. US20130150295, the entire contents of which are incorporated herein by reference).

  In some embodiments, the therapeutic nanoparticulate RNA vaccine can be formulated to be target specific. As a non-limiting example, the therapeutic nanoparticles can include corticosteroids (see International Publication No. WO201108518, which is incorporated herein by reference in its entirety). By way of non-limiting example, therapeutic nanoparticles can be found in International Publication Nos. WO2008121949, WO2010005726, WO2010005725, WO2011045521, and U.S. Patent Publication Nos. US20100006426, U.S. Can be formulated into the nanoparticles described in US Pat. No. 5, each of which is incorporated herein by reference in its entirety.

  In some embodiments, the nanoparticles of the present invention can comprise a polymer matrix. By way of non-limiting example, the nanoparticles can be, but are not limited to, polyethylene, polycarbonate, polyanhydrides, polyhydroxy acids, polypropyl fumarate, polycaprolactone, polyamide, polyacetal, polyether, polyester, poly (ortho Ester), polycyanoacrylate, polyvinyl alcohol, polyurethane, polyphosphazene, polyacrylate, polymethacrylate, polycyanoacrylate, polyurea, polystyrene, polyamine, polylysine, poly (ethyleneimine), poly (serine ester), poly (L- It may comprise two or more polymers such as lactide-co-L-lysine), poly (4-hydroxy-L-proline ester) or combinations thereof.

  In some embodiments, the therapeutic nanoparticles can include a diblock copolymer. In some embodiments, the diblock copolymer is PEG, including but not limited to polyethylene, polycarbonate, polyanhydride, polyhydroxy acid, polypropyl fumarate, polycaprolactone, polyamide, polyacetal, polyether, polyester. , Poly (orthoester), polycyanoacrylate, polyvinyl alcohol, polyurethane, polyphosphazene, polyacrylate, polymethacrylate, polycyanoacrylate, polyurea, polystyrene, polyamine, polylysine, poly (ethyleneimine), poly (serine ester), It may be included in combination with a polymer such as poly (L-lactide-co-L-lysine), poly (4-hydroxy-L-proline ester) or combinations thereof. In yet other embodiments, the diblock copolymer may be a high X diblock copolymer such as those described in International Publication No. WO2013120052, the entire contents of which are incorporated herein by reference.

  By way of non-limiting example, the therapeutic nanoparticles comprise a PLGA-PEG block copolymer (see US Patent Application Publication No. US20120004293 and US Pat. No. 8,236,330, each of which is hereby incorporated by reference in its entirety. ). In another non-limiting example, the therapeutic nanoparticles are stealth nanoparticles comprising diblock copolymers of PEG and PLA or PEG and PLGA (see US Pat. No. 8,246,968 and International Publication No. WO2012166923). The entire contents of each of which are incorporated herein by reference). In yet another non-limiting example, the therapeutic nanoparticle is a stealth nanoparticle or target-specific stealth as described in U.S. Patent Application Publication No. 2013030172406, the entire contents of which are hereby incorporated by reference. Nanoparticles.

  In some embodiments, the therapeutic nanoparticles can include multi-block copolymers (see, eg, US Pat. Nos. 8,263,665 and 8,287,910 and US Patent Application Publication No. 20130195987, The entire contents of each of which are incorporated herein by reference).

  In yet another non-limiting example, the lipid nanoparticles comprise the block copolymer PEG-PLGA-PEG (see, for example, Lee et al. “Thermosensitive Hydroxas TGF-β1 Gene Delivery Vehicle Rehabilitation Wheed”). , 2003 20 (12): 1995-2000 as a delivery vehicle for the TGF-β1 gene, Li et al. “Controlled Gene Delivery System Based on Thermosensitive Regenerative Hydrogen” Pharma. 2003 20 (6): 884-888; and Chang et al., “Non-ionic amiphiphilic biogradegradable PEG-PLGA-PEG copolymer enhancers gene sele te et al. Reference was made to a thermosensitive hydrogel (PEG-PLGA-PEG) used as a gene delivery system, each of which is incorporated herein by reference in its entirety). An RNA (eg, mRNA) vaccine of the present disclosure can be formulated in lipid nanoparticles comprising a PEG-PLGA-PEG block copolymer.

  In some embodiments, the block copolymers described herein may be included in a polyionic complex comprising non-polymeric micelles and block copolymers (see, eg, US Patent Publication No. 20120076836, Which is incorporated herein by reference in its entirety).

  In some embodiments, the therapeutic nanoparticles can include at least one acrylic polymer. Acrylic polymers include acrylic acid, methacrylic acid, copolymers of acrylic acid and methacrylic acid, methyl methacrylate copolymer, ethoxyethyl methacrylate, cyanoethyl methacrylate, aminoalkyl methacrylate copolymer, poly (acrylic acid), poly (methacrylic acid), polycyanoacrylate And combinations thereof, but are not limited thereto.

  In some embodiments, the therapeutic nanoparticles can include at least one poly (vinyl ester) polymer. The poly (vinyl ester) polymer may be a copolymer such as a random copolymer. By way of non-limiting example, the random copolymer has a structure such as that described in International Publication No. WO20130332829 or U.S. Patent Application Publication No. 20130129554, the entire contents of which are incorporated herein by reference. obtain. In some embodiments, the poly (vinyl ester) polymer can be conjugated to the polynucleotides described herein. In other embodiments, the poly (vinyl ester) polymers that can be used in the present invention may be those described herein.

  In some embodiments, the therapeutic nanoparticles can include at least one diblock copolymer. The diblock copolymer may be, but is not limited to, a poly (milk) acid-poly (ethylene) glycol copolymer (see, eg, International Publication No. WO2013044219, which is incorporated herein by reference in its entirety). . As a non-limiting example, therapeutic nanoparticles can be used to treat cancer (see International Publication No. WO2013042219, which is hereby incorporated by reference in its entirety).

  In some embodiments, the therapeutic nanoparticles can include at least one cationic polymer as described herein and / or known in the art.

  In some embodiments, the therapeutic nanoparticles are at least one amine-containing polymer, including but not limited to polylysine, polyethyleneimine, poly (amidoamine) dendrimers, poly (β-amino esters) (eg, US patents). No. 8,287,849, which is incorporated herein by reference in its entirety) and combinations thereof. In other embodiments, the nanoparticles described herein comprise amine cationic lipids such as those described in International Publication No. WO2013059496, the entire contents of which are incorporated herein by reference. obtain. In some embodiments, the cationic lipid may have an amino-amine or amino-amide moiety.

  In some embodiments, the therapeutic nanoparticles can include at least one degradable polyester that can contain polycationic side chains. Degradable polyesters include, but are not limited to, poly (serine ester), poly (L-lactide-co-L-lysine), poly (4-hydroxy-L-proline ester) and combinations thereof. In other embodiments, the degradable polyester can include a PEG conjugate to form a PEGylated polymer.

  In other embodiments, the therapeutic nanoparticles can comprise a conjugate of at least one targeting ligand. The targeting ligand may be any ligand known in the art, including but not limited to a monoclonal antibody (Kirpotin et al, Cancer Res. 2006 66: 6732-6740, in its entirety. Is incorporated herein by reference).

  In some embodiments, the therapeutic nanoparticles can be formulated in an aqueous solution, which can be used to target cancer (see International Publication No. WO2011108453 and US Patent Application Publication No. 20110294717, each of which The entirety of which is incorporated herein by reference).

  In some embodiments, a therapeutic nanoparticle RNA vaccine (eg, a therapeutic nanoparticle comprising at least one RNA vaccine) is disclosed in US Pat. No. 8,404,799, the entire contents of which are hereby incorporated by reference. Can be formulated using the method described by Podobiski et al.

  In some embodiments, the RNA (eg, mRNA) vaccine can be encapsulated in, bound to, and / or associated with a synthetic nanocarrier. Synthetic nanocarriers include International Publication Nos. WO2010005740, WO20121494554, and WO20131069669, and U.S. Patent Application Publication Nos. US20110262491, U.S.2010104645, U.S. Are incorporated herein by reference), but are not limited thereto. Synthetic nanocarriers can be formulated using methods known in the art and / or methods described herein. By way of non-limiting example, synthetic nanocarriers may include International Publication Nos. WO2010005740, WO20130030763 and WO201213501, and U.S. Patent Application Publication Nos. US20110262491, U.S.20110146645, U.S. Can be formulated according to the methods described in US Pat. In other embodiments, synthetic nanocarrier formulations are described in International Publication Nos. WO2011072218 and US Pat. No. 8,211,473, the entire contents of each of which are incorporated herein by reference. Can be freeze-dried. In yet other embodiments, formulations of the invention comprising, but not limited to, synthetic nanocarriers are described in US Patent Application Publication No. 201303030568, the entire contents of which are hereby incorporated by reference. Can be lyophilized or reconstituted by different methods.

  In some embodiments, the synthetic nanocarrier may contain reactive groups that release the polynucleotides described herein (see International Publication No. WO20120295552 and US Patent Application Publication No. Is incorporated herein by reference).

  In some embodiments, the synthetic nanocarrier may contain an immunoactivator that improves the immune response from delivery of the synthetic nanocarrier. As a non-limiting example, a synthetic nanocarrier can include a Th1 immune activator that can improve the Th1 response of the immune system (see International Publication No. WO20101233569 and US Patent Application Publication No. 20111022231, each in its entirety. Is incorporated herein by reference).

  In some embodiments, the synthetic nanocarrier can be formulated for targeted release. In some embodiments, the synthetic nanocarrier is formulated to release the polynucleotide at a specified pH and / or after a desired time interval. As a non-limiting example, synthetic nanoparticles can be formulated to release RNA vaccines after 24 hours and / or at pH 4.5 (International Publication Nos. WO2010138193 and WO2010138194 and published US patent applications). No. US20110020388 and US20110027217, each of which is incorporated herein by reference in its entirety.

  In some embodiments, the synthetic nanocarrier can be formulated for controlled and / or sustained release of the polynucleotides described herein. By way of non-limiting example, a synthetic nanocarrier for sustained release can be prepared by methods known in the art, methods described herein, and / or International Publication Nos. WO2010138192 and US Patent Application Publication No. 2013033850. Can be formulated according to the methods described in US Pat.

  In some embodiments, the RNA vaccine can be formulated for controlled release and / or sustained release, wherein the formulation comprises at least one polymer that is a crystalline side chain (CYSC) polymer. CYSC polymers are described in US Pat. No. 8,399,007, which is hereby incorporated by reference in its entirety.

  In some embodiments, the synthetic nanocarrier can be formulated for use as a vaccine. In some embodiments, the synthetic nanocarrier can encapsulate at least one polynucleotide encoding at least one antigen. As a non-limiting example, a synthetic nanocarrier can comprise at least one antigen and an excipient for a vaccine dosage form (see International Publication No. WO2011150264 and U.S. Patent Application Publication No. 20110293723, each in its entirety. Is incorporated herein by reference). As another non-limiting example, a vaccine dosage form may comprise at least two synthetic nanocarriers containing the same or different antigens and excipients (WO 201111024949 and US 20110293701). References, each of which is incorporated herein by reference in its entirety). Vaccine dosage forms can be prepared by methods described herein, methods known in the art, and / or International Publication No. WO2011110258 and US Patent Application Publication No. US20120027806 (each of which is hereby incorporated by reference in its entirety). The method described in (incorporated in Japanese) may be selected.

  In some embodiments, the synthetic nanocarrier can include at least one polynucleotide encoding at least one adjuvant. As non-limiting examples, adjuvants include dimethyldioctadecylammonium bromide, dimethyldioctadecylammonium chloride, dimethyldioctadecylammonium phosphate or dimethyldioctadecylammonium acetate (DDA), and apolar fraction of mycobacterium total lipid extract Alternatively, it may include a portion of the nonpolar fraction (see, eg, US Pat. No. 8,241,610, which is incorporated herein by reference in its entirety). In other embodiments, the synthetic nanocarrier may comprise at least one polynucleotide and an adjuvant. As a non-limiting example, a synthetic nanocarrier comprising an adjuvant is produced by the methods described in International Publication No. WO2011150240 and US Patent Application Publication No. US201110293700, each of which is incorporated herein by reference in its entirety. It can be formulated.

  In some embodiments, the synthetic nanocarrier can encapsulate at least one polynucleotide encoding a virus-derived peptide, fragment or region. As non-limiting examples, synthetic nanocarriers include International Publication Nos. WO2012024621, WO2012202629, WO20122024632 and U.S. Patent Application Publication Nos. US20120064110, US20120058153 and US20120058154 (the respective ones thereof). Mention may be made of the nanocarriers described in (incorporated herein by reference in their entirety).

  In some embodiments, the synthetic nanocarrier can be coupled to a polynucleotide that can be capable of eliciting a humoral response and / or a cytotoxic T lymphocyte (CTL) response (eg, International Publication No. WO20131019669). No., which is incorporated herein by reference in its entirety).

  In some embodiments, the RNA vaccine can be encapsulated in, bound to, and / or associated with the zwitterionic lipid. Non-limiting examples of zwitterlipids and methods of using zwitterlipids are described in US Patent Publication No. 20130216607, the entire contents of which are hereby incorporated by reference. In some embodiments, zwitterionic lipids can be used in the liposomes and lipid nanoparticles described herein.

  In some embodiments, RNA vaccines can be formulated in colloidal nanocarriers as described in US Patent Application Publication No. 2013030197100, the entire contents of which are hereby incorporated by reference.

  In some embodiments, the nanoparticles can be optimized for oral administration. The nanoparticles can include at least one cationic biopolymer such as, but not limited to, chitosan or a derivative thereof. As a non-limiting example, the nanoparticles can be formulated by the methods described in US Patent Application Publication No. 201202282343, which is hereby incorporated by reference in its entirety.

  In some embodiments, the LNP comprises lipid KL52 (aminolipids disclosed in US Patent Application Publication No. 2012/0295832, expressly incorporated herein by reference in its entirety). The activity and / or safety of LNP administration (determined by examining one or more of ALT / AST, leukocyte count and cytokine induction) can be improved by incorporating such lipids. LNPs including KL52 can be administered intravenously and / or in one or more doses. In some embodiments, administration of LNP comprising KL52 results in the same amount or improved mRNA and / or protein expression compared to LNP comprising MC3.

  In some embodiments, the RNA vaccine may be delivered using a smaller LNP. Such particles have a diameter of less than 0.1 μm up to 100 nm, such as, but not limited to, less than 0.1 μm, less than 1.0 μm, less than 5 μm, less than 10 μm, less than 15 μm, less than 20 μm, less than 25 μm, <30 μm, <35 μm, <40 μm, <50 μm, <55 μm, <60 μm, <65 μm, <70 μm, <75 μm, <80 μm, <85 μm, <90 μm, <95 μm, <100 μm, <125 μm, <150 μm, <175 μm Less than 200 μm, less than 225 μm, less than 250 μm, less than 275 μm, less than 300 μm, less than 325 μm, less than 350 μm, less than 400 μm, less than 425 μm, less than 450 μm, less than 475 μm, less than 500 μm, less than 525 μm, less than 550 μm, less than 575 μm, 6 Less than 00 μm, less than 625 μm, less than 650 μm, less than 675 μm, less than 700 μm, less than 725 μm, less than 750 μm, less than 775 μm, less than 800 μm, less than 825 μm, less than 850 μm, less than 875 μm, less than 900 μm, less than 925 μm, less than 950 μm Good.

  In other embodiments, the RNA (eg, mRNA) vaccine is about 1 nm to about 100 nm, about 1 nm to about 10 nm, about 1 nm to about 20 nm, about 1 nm to about 30 nm, about 1 nm to about 40 nm, about 1 nm to about 50 nm. About 1 nm to about 60 nm, about 1 nm to about 70 nm, about 1 nm to about 80 nm, about 1 nm to about 90 nm, about 5 nm to about 100 nm, about 5 nm to about 10 nm, about 5 nm to about 20 nm, about 5 nm to about 30 nm, about 5 nm to about 40 nm, about 5 nm to about 50 nm, about 5 nm to about 60 nm, about 5 nm to about 70 nm, about 5 nm to about 80 nm, about 5 nm to about 90 nm, about 10 to about 50 nm, about 20 to about 50 nm, about 30 to About 50 nm, about 40 to about 50 nm, about 20 to about 60 nm, about 30 to about 60 nm, about 40 to about 60 nm, about 20 to about 70 nm, about 0 to about 70 nm, about 40 to about 70 nm, about 50 to about 70 nm, about 60 to about 70 nm, about 20 to about 80 nm, about 30 to about 80 nm, about 40 to about 80 nm, about 50 to about 80 nm, about 60 to Smaller LNPs that may be about 80 nm, about 20 to about 90 nm, about 30 to about 90 nm, about 40 to about 90 nm, about 50 to about 90 nm, about 60 to about 90 nm, and / or about 70 to about 90 nm in diameter May be used to deliver.

  In some embodiments, such LNPs are synthesized using a method comprising a microfluidic mixer. Exemplary microfluidic mixers can include, but are not limited to, slit-type interdigital micromixers, such as, but not limited to, those made by Microinnova (Allerheigen bei Wildon, Austria)) And / or zigzag herringbone micromixer (SHM) (Zhigaltsev, I.V. et al., Bottom-up design and synthesis of limit of the size of the squeezing of the sig- nals. La gmuir.2012.28: 3633-40; (Belliveau, N.M. et al., Microfluidic synthesis of high 201 liters of RNA i.e. Chen, D. et al., Rapid discovery of potential siRNA-containing lipid nanoparticulate enabled by controllable microfluidic formation.Jam Chem69 48. -51, the entirety of each of which is incorporated herein by reference).

  In some embodiments, the method of generating LNP with SHM further comprises mixing at least two inflows, the mixing caused by microstructure induced chaotic advection (MICA). According to this method, the fluid flow flows through the channels present in the herringbone pattern, causing a rotational flow and the fluids fold over one another. The method may also include a surface for fluid mixing where the surface changes direction while the fluid is circulating. Methods for generating LNP using SHM are disclosed in US Patent Application Publication Nos. 2004/0262223 and 2012/0276209, each of which is expressly incorporated herein by reference in its entirety. Is included.

  In some embodiments, the RNA vaccine of the present invention includes, but is not limited to, a slit interdigital microstructure mixer (SIMM-V2) or a standard slit interdigital micromixer (SSIMM) or caterpillar (CPMM) or It can be formulated into lipid nanoparticles generated using a micromixer such as jet impact (IJMM) (Institut fur Mikrotechnik Mainz GmbH (Mainz Germany)).

  In some embodiments, an RNA (eg, mRNA) vaccine of the present disclosure can be formulated in lipid nanoparticles generated using microfluidic technology (Whitesides, George M. The Origins and the Future of). Microfluidics. Nature, 2006 442: 368-373; and Abraham et al. Chaotic Mixer for Microchannels. Science, 2002 295: 647-651, each of which is incorporated herein by reference in its entirety). As a non-limiting example, a controlled microfluidic formulation involves a passive method of mixing a driven flow with a low Reynolds number steady pressure within a microchannel (eg, Abraham et al. Chaotic Mixer for Microchannels.Science, 2002 295: 647651, which is incorporated herein by reference in its entirety).

  In some embodiments, an RNA (eg, mRNA) vaccine of the invention is a micro, such as, but not limited to, those from Harvard Apparatus (Holliston, Mass.) Or Dolomite Microfluidics (Royston, UK). It can be formulated into lipid nanoparticles produced using a mixer chip. A micromixer chip can be used to rapidly mix two or more fluid streams by a slit and recombination mechanism.

  In some embodiments, an RNA (eg, mRNA) vaccine of the present invention can be found in International Publication No. WO2013063468 or US Pat. No. 8,440,614, each of which is hereby incorporated by reference in its entirety. It can be formulated for delivery using the described drug-encapsulated microspheres. Microspheres may be of the formula (I), (II), (III), (IV), (V) or (as described in International Publication No. WO2013063468, the entire contents of which are hereby incorporated by reference. The compound of VI) may be included. In other embodiments, amino acids, peptides, polypeptides, lipids (APPL) are useful for delivering the RNA vaccines of the invention to cells (see International Publication No. WO2013063468, the entire contents of which are hereby incorporated by reference). ).

  In some embodiments, an RNA (eg, mRNA) vaccine of this disclosure is about 10 to about 100 nm, such as, but not limited to, about 10 to about 20 nm, about 10 to about 30 nm, about 10 to about 40 nm, about 10 to about 50 nm, about 10 to about 60 nm, about 10 to about 70 nm, about 10 to about 80 nm, about 10 to about 90 nm, about 20 to about 30 nm, about 20 to about 40 nm, about 20 to about 50 nm, About 20 to about 60 nm, about 20 to about 70 nm, about 20 to about 80 nm, about 20 to about 90 nm, about 20 to about 100 nm, about 30 to about 40 nm, about 30 to about 50 nm, about 30 to about 60 nm, about 30 To about 70 nm, about 30 to about 80 nm, about 30 to about 90 nm, about 30 to about 100 nm, about 40 to about 50 nm, about 40 to about 60 nm, about 40 to about 70 nm, about 40 to about 80 m, about 40 to about 90 nm, about 40 to about 100 nm, about 50 to about 60 nm, about 50 to about 70 nm, about 50 to about 80 nm, about 50 to about 90 nm, about 50 to about 100 nm, about 60 to about 70 nm, about 60 to about 80 nm, about 60 to about 90 nm, about 60 to about 100 nm, about 70 to about 80 nm, about 70 to about 90 nm, about 70 to about 100 nm, about 80 to about 90 nm, about 80 to about 100 nm, and / or about It can be formulated in lipid nanoparticles having a diameter of 90 to about 100 nm.

  In some embodiments, lipid nanoparticles can have a diameter of about 10-500 nm.

  In some embodiments, the lipid nanoparticles are greater than 100 nm, greater than 150 nm, greater than 200 nm, greater than 250 nm, greater than 300 nm, greater than 350 nm, greater than 400 nm, greater than 450 nm, greater than 500 nm, greater than 600 nm, greater than 650 nm, greater than 700 nm. , Greater than 750 nm, greater than 800 nm, greater than 850 nm, greater than 900 nm, 950 nm, or greater than 1000 nm.

  In some embodiments, the lipid nanoparticle may be a critical size lipid nanoparticle described in International Publication No. WO20130559922, the entire contents of which are incorporated herein by reference. The critical size lipid nanoparticles can include a lipid bilayer surrounding an aqueous or hydrophobic core, where the lipid bilayer includes, but is not limited to, diacylphosphatidylcholine, diacylphosphatidylethanolamine, ceramide, sphingomyelin Phospholipids such as, dihydrosphingomyelin, cephalin, cerebroside, C8-C20 fatty acid diacylphosphatidylcholine and 1-palmitoyl-2-oleoylphosphatidylcholine (POPC). In other embodiments, the critical size lipid nanoparticles can include polyethylene glycol lipids such as, but not limited to, DLPE-PEG, DMPE-PEG, DPPC-PEG and DSPE-PEG.

  In some embodiments, the RNA vaccine is delivered to a specific location using the delivery method described in International Publication No. WO2013063530, the entire contents of which are hereby incorporated by reference. It may be localized and / or concentrated. As a non-limiting example, empty polymer particles may be administered to a subject prior to, concurrently with, or after delivery of an RNA vaccine to the subject. When the empty polymer particles come into contact with the object, the volume changes and stays, is embedded, immobilized or captured at a specific location within the object.

  In some embodiments, the RNA vaccine can be formulated in an active agent release system (see, eg, US Patent Application Publication No. US20130125545, the entire contents of which are hereby incorporated by reference). The active substance release system comprises 1) at least one nanoparticle bound to an oligonucleotide inhibitor strand that hybridizes with a catalytic nucleic acid, and 2) a therapeutically effective substance (eg, a polynucleotide described herein) ) Bound to at least one substrate molecule, wherein the therapeutically effective substance is released by cleavage of the substrate molecule by a catalytically active nucleic acid.

  In some embodiments, RNA (eg, mRNA) vaccines can be formulated in nanoparticles that include an inner core that includes non-cellular material and an outer surface that includes a cell membrane. The cell membrane may be derived from a cell or a virus-derived membrane. As a non-limiting example, nanoparticles can be made by the methods described in International Publication No. WO2013052167, which is incorporated herein by reference in its entirety. As another non-limiting example, the nanoparticles described in International Publication No. WO2013052167 (incorporated herein by reference in its entirety) are used to deliver the RNA vaccines described herein. May be used.

  In some embodiments, RNA vaccines can be formulated in lipid bilayers (progenitor cells) supported by porous nanoparticles. Progenitor cells are described in International Publication No. WO2013056132, the entire contents of which are incorporated herein by reference.

  In some embodiments, the RNA vaccines described herein are U.S. Patent Nos. 8,420,123 and 8,518,963 and European Patent No. EP2073848B1 (see the entire contents of each of which). Can be formulated in polymer nanoparticles as described in US Pat. No. 6,069,038, or made by the methods described therein. By way of non-limiting example, the nanoparticles described in US Pat. No. 8,518,963 (the entire contents of which are incorporated herein by reference) or made by the methods described in that patent Polymer nanoparticles, such as nanoparticles, can have a high glass transition temperature. As another non-limiting example, polymeric nanoparticles for oral and parenteral formulations are made by the methods described in European Patent No. EP 2073848 B1, the entire contents of which are hereby incorporated by reference. Can be done.

  In other embodiments, the RNA (eg, mRNA) vaccines described herein can be formulated in nanoparticles used in imaging. The nanoparticle may be a liposomal nanoparticle such as those described in US Patent Application Publication No. 201301296636, which is incorporated herein by reference in its entirety. As a non-limiting example, the liposome is gadolinium (III) 2- {4,7-bis-carboxymethyl-10-[(N, N-distearylamidomethyl-N′-amido-methyl] -1,4. , 7,10-tetra-azacyclododec-1-yl} -acetic acid and a neutral, fully saturated phospholipid component (see, eg, US Patent Application Publication No. US20130129636, the entire contents of which are incorporated herein by reference). Incorporated herein by reference).

  In some embodiments, nanoparticles that can be used in the present invention are formed by the methods described in US Patent Application Publication No. 20130130348, the entire contents of which are hereby incorporated by reference. .

  The nanoparticles of the present invention can further include nutrients such as, but not limited to, those that can cause health hazards ranging from anemia to neural tube defects when deficient (see, eg, nanoparticles described in International Publication No. WO20130372929). The entire contents of which are incorporated herein by reference). By way of non-limiting example, the nutrient may be ferrous salt, ferric salt or elemental iron, iodine, folic acid, vitamins or micronutrients.

  In some embodiments, the RNA (eg, mRNA) vaccines of the invention can be formulated in swellable nanoparticles. The swellable nanoparticles may be, but are not limited to, those described in US Pat. No. 8,440,231, the entire contents of which are incorporated herein by reference. As a non-limiting embodiment, swellable nanoparticles can be used to deliver an RNA (eg, mRNA) vaccine of the invention to the pulmonary system (see, eg, US Pat. No. 8,440,231, see The entire contents are incorporated herein by reference).

  The RNA (eg, mRNA) vaccines of the present invention include, but are not limited to, poly, such as those described in US Pat. No. 8,449,916, the entire contents of which are incorporated herein by reference. It can be formulated in acid anhydride nanoparticles. The nanoparticles and microparticles of the present invention may be geometrically manipulated to control macrophage and / or immune responses. In some embodiments, the geometrically engineered particles can be of various shapes, sizes and / or sizes to incorporate the polynucleotides of the invention for targeted delivery such as, but not limited to, pulmonary delivery. Or it may have a surface charge (see, for example, International Publication No. WO2013082111, the entire contents of which are incorporated herein by reference). Other physical characteristics of the geometrically manipulated particles may include, but are not limited to, window formation, angular arms, asymmetry and surface roughness, charge, and Can change the interaction with the organization. As a non-limiting example, the nanoparticles of the present invention can be made by the method described in International Publication No. WO2013082111, the entire contents of which are incorporated herein by reference.

  In some embodiments, the nanoparticles of the present invention are described in water-soluble nanoparticles, such as, but not limited to, International Publication No. WO2013090601, the entire contents of which are incorporated herein by reference. It may be a thing. The nanoparticles can be inorganic nanoparticles that are small and have a zwitterionic ligand to exhibit good water solubility. Nanoparticles can also have a small hydrodynamic diameter (HD), stability to time, pH and salt concentration, and low levels of non-specific protein binding.

  In some embodiments, the nanoparticles of the present invention can be developed by the methods described in US Patent Application Publication No. US20130172406, the entire contents of which are hereby incorporated by reference.

  In some embodiments, the nanoparticles of the present invention include, but are not limited to, those described in US Patent Application Publication No. 20130172406, the entire contents of which are incorporated herein by reference. Stealth nanoparticles or target-specific stealth nanoparticles. Nanoparticles of the present invention can be made by the methods described in US Patent Application Publication No. 2013030172406, the entire contents of which are hereby incorporated by reference.

  In other embodiments, stealth or target-specific stealth nanoparticles can include a polymer matrix. Polymer matrices include, but are not limited to, polyethylene, polycarbonate, polyanhydrides, polyhydroxy acids, polypropyl fumerate, polycaprolactone, polyamide, polyacetal, polyether, polyester, poly (orthoester), polycyanoacrylate , Polyvinyl alcohol, polyurethane, polyphosphazene, polyacrylate, polymethacrylate, polycyanoacrylate, polyurea, polystyrene, polyamine, polyester, polyanhydride, polyether, polyurethane, polymethacrylate, polyacrylate, polycyanoacrylate or these It may contain two or more polymers, such as a combination.

  In some embodiments, the nanoparticle may be a nanoparticle-nucleic acid hybrid structure having a dense nucleic acid layer. As a non-limiting example, a nanoparticle-nucleic acid hybrid structure can be made by the method described in US Patent Application Publication No. 201301171646, the entire contents of which are incorporated herein by reference. Nanoparticles can include nucleic acids such as, but not limited to, the polynucleotides described herein and / or polynucleotides known in the art.

  At least one of the nanoparticles of the present invention can be embedded in a core nanostructure, or a low density porous 3D structure or coating capable of carrying or associating at least one payload within or on the nanostructure It can be coated with. Non-limiting examples of nanostructures comprising at least one nanoparticle are described in International Publication No. WO2013123523, the entire contents of which are hereby incorporated by reference.

Vaccine Administration Methods VZV RNA (eg, mRNA) vaccines can be administered by any route that provides a therapeutically effective outcome. These include, but are not limited to, intradermal, intramuscular, intranasal and / or subcutaneous administration. The present disclosure provides a method comprising administering an RNA vaccine to a subject in need thereof. The exact amount required may vary from subject to subject, depending on the species, age and general condition of the subject, the severity of the disease, the particular composition, its mode of administration, its mode of activity and the like. VZV RNA (eg, mRNA) vaccine compositions are typically formulated in unit dosage form for ease of administration and uniformity of dosage. It will be understood, however, that the total daily dosage of the VZV RNA (eg, mRNA) vaccine composition can be determined by the attending physician within the scope of sound medical judgment. The specific therapeutically effective dose level for any particular patient, the prophylactically effective dose level, the appropriate imaging dose level, the disease being treated and the severity of the disease, the activity of the particular compound employed, the adoption Specific composition used, patient age, weight, general condition, sex and diet, time of administration of specific compound employed, route of administration and excretion rate, duration of treatment, specific compound employed It can depend on various factors, including drugs used in combination or simultaneously, as well as similar factors well known in the medical field.

  In some embodiments, the VZV RNA (eg, mRNA) vaccine composition is 0.0001 mg / kg to 100 mg / kg, 0.001 mg / kg to 0.05 mg / kg, per kg subject body weight per day, 0.005 mg / kg to 0.05 mg / kg, 0.001 mg / kg to 0.005 mg / kg, 0.05 mg / kg to 0.5 mg / kg, 0.01 mg / kg to 50 mg / kg, 0.1 mg / kg sufficient to deliver kg-40 mg / kg, 0.5 mg / kg-30 mg / kg, 0.01 mg / kg-10 mg / kg, 0.1 mg / kg-10 mg / kg or 1 mg / kg-25 mg / kg At a dose level, administered once or more times a day, once a week, once a month or more, etc. to achieve a desired therapeutic effect, diagnostic effect, preventive effect or image Effect can be obtained (see, for example, a unit dose range as described in WO WO2013078199, incorporated herein by reference in its entirety). The desired dose is three times a day, twice a day, once a day, once every two days, once every three days, every two weeks, every three weeks, every four weeks, every two months, It can be delivered every 3 months, every 6 months, and so on. In certain embodiments, the desired dose is administered multiple times (eg, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14 or more doses). Can be delivered using. Where multiple doses are employed, divided dosing schedules such as those described herein may be used. In an exemplary embodiment, the VZV RNA (eg, mRNA) vaccine composition is from 0.0005 mg / kg to 0.01 mg / kg, such as from about 0.0005 mg / kg to about 0.0075 mg / kg, such as about At dosage levels sufficient to deliver 0.0005 mg / kg, about 0.001 mg / kg, about 0.002 mg / kg, about 0.003 mg / kg, about 0.004 mg / kg or about 0.005 mg / kg Can be administered.

  In some embodiments, the VZV RNA (eg, mRNA) vaccine composition is 0.025 mg / kg to 0.250 mg / kg, 0.025 mg / kg to 0.500 mg / kg, 0.025 mg / kg to 0. It may be administered once or twice (or more) at a dosage level sufficient to deliver 750 mg / kg or 0.025 mg / kg to 1.0 mg / kg.

  In some embodiments, the VZV RNA (eg, mRNA) vaccine composition is 0.0100 mg, 0.025 mg, 0.050 mg, 0.075 mg, 0.100 mg, 0.125 mg, 0.150 mg, 0.175 mg. 0.200 mg, 0.225 mg, 0.250 mg, 0.275 mg, 0.300 mg, 0.325 mg, 0.350 mg, 0.375 mg, 0.400 mg, 0.425 mg, 0.450 mg, 0.475 mg, 0 .500 mg, 0.525 mg, 0.550 mg, 0.575 mg, 0.600 mg, 0.625 mg, 0.650 mg, 0.675 mg, 0.700 mg, 0.725 mg, 0.750 mg, 0.775 mg, 0.800 mg , 0.825mg, 0.850mg, 0.875mg, 0.90 mg, 0.925 mg, 0.950 mg, 0.975 mg, or 1.0 mg total dose or dose levels sufficient to deliver these total doses (eg, 0 and 7 days, 0 Day 14 and Day 0, Day 0 and Day 21, Day 0 and Day 28, Day 0 and Day 60, Day 0 and Day 90, Day 0 and Day 120, Day 0 And 150 days, 0 days and 180 days, 0 days and 3 months, 0 days and 6 months, 0 days and 9 months, 0 days and 12 months, 0 days and 18 days Month, day 0 and 2 years, day 0 and 5 years or day 0 and 10 years). Higher and lower doses and frequency of administration are encompassed by the present disclosure. For example, a VZV RNA (eg, mRNA) vaccine composition can be administered three or four times.

  In some embodiments, the VZV RNA (eg, mRNA) vaccine composition is a total dose of 0.010 mg, 0.025 mg, 0.100 mg or 0.400 mg or a dose sufficient to deliver these total doses. 2 levels (for example, 0 and 7 days, 0 and 14 days, 0 and 21 days, 0 and 28 days, 0 and 60 days, 0 days Eyes and 90 days, 0 days and 120 days, 0 days and 150 days, 0 days and 180 days, 0 days and 3 months, 0 days and 6 months, 0 days and 9 months, 0 days and 12 months, 0 days and 18 months, 0 days and 2 years, 0 days and 5 years or 0 days and 10 years).

  In some embodiments, the VZV RNA (eg, mRNA) vaccine used in the method of vaccinating a subject is an amount effective for vaccinating the subject from 10 μg / kg to 400 μg / kg nucleic acid vaccine. A single dose of is administered to the subject. In some embodiments, the RNA vaccine used in the method of vaccinating a subject is an amount effective for vaccinating the subject and a single dose of 10 μg to 400 μg of nucleic acid vaccine is administered to the subject. . In some embodiments, a VZV RNA (eg, mRNA) vaccine used in a method of vaccinating a subject is a single dose of 25-1000 μg (eg, a single dose of mRNA encoding a VZV antigen). As administered to a subject. In some embodiments, the VZV RNA vaccine is 25, 50, 100, 150, 200, 250, 300, 350, 400, 450, 500, 550, 600, 650, 700, 750, 800, 850, 900, Administered to the subject as a single dose of 950 or 1000 μg. For example, the VZV RNA vaccine is a single dose of 25-100, 25-500, 50-100, 50-500, 50-1000, 100-500, 100-1000, 250-500, 250-1000 or 500-1000 μg. As can be administered to a subject. In some embodiments, the VZV RNA (eg, mRNA) vaccine used in the method of vaccinating the subject is administered to the subject as two doses equal to 25-1000 μg of VZV RNA (eg, mRNA) vaccine. Is done.

  VZV RNA (eg, mRNA) vaccine pharmaceutical compositions described herein can be intranasally, intratracheally or injectable (eg, intravenous, intraocular, intravitreal, intramuscular, intradermal, intracardiac, abdominal cavity). Can be formulated into the dosage forms described herein (internal and subcutaneous).

VZV RNA Vaccine Formulation and Methods of Use Some aspects of the present disclosure provide a formulation of a VZV RNA (eg, mRNA) vaccine, wherein the VZV RNA vaccine is an antigen-specific immune response (eg, an anti-VZV) in a subject. In an amount effective to result in the production of antibodies specific for the antigenic polypeptide). An “effective amount” is a dose of a VZV RNA (eg, mRNA) vaccine that is effective to produce an antigen-specific immune response. Also provided herein are methods for inducing an antigen-specific immune response in a subject.

  In some embodiments, the antigen-specific immune response measures the titer of anti-VZV antigenic polypeptide antibody produced in a subject administered a VZV RNA (eg, mRNA) vaccine provided herein. Is characterized by Antibody titer is a measure of the amount of antibody in a subject, eg, the amount of an antibody that is specific for a particular antigen (eg, an anti-VZV antigenic polypeptide) or epitope of an antigen. Antibody titers are typically expressed as the reciprocal of the highest dilution that produces a positive result. For example, enzyme-linked immunosorbent assay (ELISA) is a common assay for determining antibody titers.

  In some embodiments, antibody titers are used to assess whether a subject has become infected or to determine whether immunization is necessary. In some embodiments, the antibody titer determines the strength of the autoimmune response, determines if booster immunity is required, determines if the previous vaccine was effective, and any recent or previous Used to identify infection. According to the present disclosure, antibody titers are used to determine the strength of an immune response induced in a subject by a VZV RNA (eg, mRNA) vaccine.

  In some embodiments, the titer of the anti-VZV antigenic polypeptide antibody produced in the subject is increased by at least 1 log relative to the control. For example, the titer of an anti-VZV antigenic polypeptide antibody produced in a subject can be increased by at least 1.5, at least 2, at least 2.5 or at least 3 log compared to a control. In some embodiments, the titer of the anti-VZV antigenic polypeptide antibody produced in the subject is increased by 1, 1.5, 2, 2.5 or 3 logs compared to the control. In some embodiments, the titer of anti-VZV antigenic polypeptide antibody produced in the subject is increased by 1 to 3 logs relative to the control. For example, the titer of an anti-VZV antigenic polypeptide antibody produced in a subject is 1-1.5, 1-2, 1-2.5, 1-3, 1.5-2 compared to a control. 1.5-2.5, 1.5-3, 2-2.5, 2-3, or 2.5-3 log.

  In some embodiments, the titer of anti-VZV antigenic polypeptide antibody produced in the subject is increased by at least 2-fold compared to the control. For example, the titer of the anti-VZV antigenic polypeptide antibody produced in the subject is at least 3-fold, at least 4-fold, at least 5-fold, at least 6-fold, at least 7-fold, at least 8-fold, at least compared to the control It can be increased 9 times or at least 10 times. In some embodiments, the titer of the anti-VZV antigenic polypeptide antibody produced in the subject is increased by 2, 3, 4, 5, 6, 7, 8, 9 or 10 fold compared to the control. . In some embodiments, the titer of the anti-VZV antigenic polypeptide antibody produced in the subject is increased by 2-10 fold compared to the control. For example, the titer of an anti-VZV antigenic polypeptide antibody produced in a subject is 2-10, 2-9, 2-8, 2-7, 2-6, 2-5, 2 compared to a control. -4, 2-3, 3-10, 3-9, 3-8, 3-7, 3-6, 3-5, 3-4, 4-10, 4-9, 4-8, 4-7 4-6, 4-5, 5-10, 5-9, 5-8, 5-7, 5-6, 6-10, 6-9, 6-8, 6-7, 7-10, 7 -9, 7-8, 8-10, 8-9 or 9-10 fold.

  The control is, in some embodiments, the titer of anti-VZV antigenic polypeptide antibody produced in a subject who has never received a VZV RNA (eg, mRNA) vaccine. In some embodiments, the control is the titer of anti-VZV antigenic polypeptide antibody produced in a subject who has been administered a live attenuated VZV vaccine. An attenuated vaccine is a viable (live) vaccine made by reducing toxicity. The attenuated virus is modified to be harmless or less toxic compared to a live virus that has not been modified. In some embodiments, the control is the titer of anti-VZV antigenic polypeptide antibody produced in a subject that has been administered a VZV inactivated vaccine. In some embodiments, the control is the titer of anti-VZV antigenic polypeptide antibody produced in a subject that has been administered a recombinant or purified VZV protein vaccine. Recombinant protein vaccines typically contain either protein antigens produced in a heterologous expression system (eg, bacteria or yeast) or protein antigens purified from large quantities of pathogenic organisms. In some embodiments, the control is administration of a VZV virus-like particle (VLP) vaccine (eg, a particle that contains a viral capsid protein but does not contain a viral genome and is therefore unable to replicate / produce progeny virus). The titer of anti-VZV antigenic polypeptide antibody produced in a subject who has undergone. In some embodiments, the control is a VLP VZV vaccine comprising a pre-fusion or post-fusion F protein or a combination of the two.

  In some embodiments, an effective amount of a VZV RNA (eg, mRNA) vaccine is a small dose compared to a standard therapeutic dose of a recombinant VZV protein vaccine. “Standard treatment” as provided herein refers to medical or psychological treatment guidelines and may be general or specific. “Standard treatment” defines an appropriate treatment based on scientific evidence and cooperation between medical professionals involved in the treatment of a given condition. This is a diagnostic and treatment process that a physician / clinician should follow for a particular type of patient, disease or clinical environment. A “standard therapeutic dose” is a dose of a recombinant or purified VZV protein vaccine, or a live attenuated or inactivated VZV vaccine, or a VZV VLP vaccine, as described herein, A dose that a physician or other medical professional administers to a subject to treat or prevent a VZV or VZV-related condition while following standard treatment guidelines for treating or preventing a VZV or VZV-related condition.

  In some embodiments, the titer of the anti-VZV antigenic polypeptide antibody produced in the subject administered an effective amount of a VZV RNA vaccine is a recombinant or purified VZV protein vaccine, or a live attenuated VZV vaccine or not. Equivalent to the titer of anti-VZV antigenic polypeptide antibody produced in a control subject administered an activated VZV vaccine or a standard therapeutic dose of a VZV VLP vaccine.

  In some embodiments, an effective amount of a VZV RNA (eg, mRNA) vaccine is a dose equivalent to a dose that reduces the standard therapeutic dose of a recombinant or purified VZV protein vaccine by at least one-half. For example, an effective amount of a VZV RNA vaccine is at least 1/3, at least 1/4, at least 1/5, at least 1/6, at least 1/7, at least 1 of a standard or therapeutic dose of a recombinant or purified VZV protein vaccine. It can be a dose equivalent to a dose reduced to / 8, at least 1/9 or at least 1/10. In some embodiments, an effective amount of a VZV RNA vaccine is equivalent to a dose that reduces the standard therapeutic dose of a recombinant or purified VZV protein vaccine to at least 1/100, at least 1/500, or at least 1/1000. Dose. In some embodiments, an effective amount of the VZV RNA vaccine is a standard therapeutic dose of recombinant or purified VZV protein vaccine at 1/2, 1/3, 1/4, 1/5, 1/6, 1 / 7, 1/8, 1/9, 1/10, 1/20, 1/50, 1/100, 1/250, 1/500 or 1/1000 equivalent dose. In some embodiments, the titer of anti-VZV antigenic polypeptide antibody produced in a subject administered an effective amount of a VZV RNA vaccine is a recombinant or protein VZV protein vaccine, or a live attenuated or inactivated VZV vaccine. Equivalent to the titer of anti-VZV antigenic polypeptide antibody produced in a control subject who received a standard therapeutic dose of vaccine, or VZV VLP vaccine. In some embodiments, an effective amount of a VZV RNA (eg, mRNA) vaccine is 1/2 to 1/1000 (eg, 1/2 to 1/100) of a standard therapeutic dose of a recombinant or purified VZV protein vaccine. The titer of the anti-VZV antigenic polypeptide antibody produced in the subject is equal to the dose reduced to 1/10 to 1/1000), the recombinant or purified VZV protein vaccine, or Equivalent to the titer of anti-VZV antigenic polypeptide antibody produced in a control subject administered a standard therapeutic dose of VZV vaccine or inactivated VZV vaccine, or VZV VLP vaccine.

  In some embodiments, an effective amount of a VZV RNA (eg, mRNA) vaccine is 1/2 to 1/1000, 1/2 to 1/900, 1/2 to 1 of a standard therapeutic dose of a recombinant VZV protein vaccine. / 800, 1/2 to 1/700, 1/2 to 1/600, 1/2 to 1/500, 1/2 to 1/400, 1/2 to 1/300, 1/2 to 1/200 1/2 to 1/100, 1/2 to 1/90, 1/2 to 1/80, 1/2 to 1/70, 1/2 to 1/60, 1/2 to 1/50, / 2 to 1/40, 1/2 to 1/30, 1/2 to 1/20, 1/2 to 1/10, 1/2 to 1/9, 1/2 to 1/8, 1/2 -1/7, 1 / 2-1 / 6, 1 / 2-1 / 5, 1 / 2-1 / 4, 1 / 2-1 / 3, 1 / 3-1 / 1000, 1 / 3-1 / 900, 1/3 to 1/800 1/3 to 1/700, 1/3 to 1/600, 1/3 to 1/500, 1/3 to 1/400, 1/3 to 1/300, 1/3 to 1/200, 1 / 3/1/100, 1/3 to 1/90, 1/3 to 1/80, 1/3 to 1/70, 1/3 to 1/60, 1/3 to 1/50, 1/3 1/40, 1/3 to 1/30, 1/3 to 1/20, 1/3 to 1/10, 1/3 to 1/9, 1/3 to 1/8, 1/3 to 1 / 7, 1/3 to 1/6, 1/3 to 1/5, 1/3 to 1/4, 1/4 to 1/1000, 1/4 to 1/900, 1/4 to 1/800, 1/4 to 1/700, 1/4 to 1/600, 1/4 to 1/500, 1/4 to 1/400, 1/4 to 1/400, 1/4 to 1/200, 1 / 4 to 1/100, 1/4 to 1/90, 1/4 to 1/80, 1/4 to 1/70, 1/4 to 1 / 60, 1/4 to 1/50, 1/4 to 1/40, 1/4 to 1/30, 1/4 to 1/20, 1/4 to 1/10, 1/4 to 1/9, 1/4 to 1/8, 1/4 to 1/7, 1/4 to 1/6, 1/4 to 1/5, 1/4 to 1/4, 1/5 to 1/1000, 1 / 5/1/900, 1/5 to 1/800, 1/5 to 1/700, 1/5 to 1/600, 1/5 to 1/500, 1/5 to 1/400, 1/5 1/300, 1/5 to 1/200, 1/5 to 1/100, 1/5 to 1/90, 1/5 to 1/80, 1/5 to 1/70, 1/5 to 1 / 60, 1/5 to 1/50, 1/5 to 1/40, 1/5 to 1/30, 1/5 to 1/20, 1/5 to 1/10, 1/5 to 1/9, 1/5 to 1/8, 1/5 to 1/7, 1/5 to 1/6, 1/6 to 1/1000, 1/6 to 1/900, 1 / ~ 1/800, 1/6-1/700, 1/6-1/600, 1/6-1/500, 1/6-1/400, 1/6-1/300, 1/6-1 / 200, 1/6 to 1/100, 1/6 to 1/90, 1/6 to 1/80, 1/6 to 1/70, 1/6 to 1/60, 1/6 to 1/50 1/6 to 1/40, 1/6 to 1/30, 1/6 to 1/20, 1/6 to 1/10, 1/6 to 1/9, 1/6 to 1/8, 1 / 6 to 1/7, 1/7 to 1/1000, 1/7 to 1/900, 1/7 to 1/800, 1/7 to 1/700, 1/7 to 1/600, 1/7 ~ 1/500, 1/7 to 1/400, 1/7 to 1/300, 1/7 to 1/200, 1/7 to 1/100, 1/7 to 1/90, 1/7 to 1 / 80, 1/7 to 1/70, 1/7 to 1/60, 1/7 to 1/50, 1/7 to / 40, 1/7 to 1/30, 1/7 to 1/20, 1/7 to 1/10, 1/7 to 1/9, 1/7 to 1/8, 1/8 to 1/1000 1/8 to 1/900, 1/8 to 1/800, 1/8 to 1/700, 1/8 to 1/600, 1/8 to 1/500, 1/8 to 1/400, / 8 to 1/300, 1/8 to 1/200, 1/8 to 1/100, 1/8 to 1/90, 1/8 to 1/80, 1/8 to 1/70, 1/8 1/60, 1/8 to 1/50, 1/8 to 1/40, 1/8 to 1/30, 1/8 to 1/20, 1/8 to 1/10, 1/8 to 1 / 9, 1/9 to 1/1000, 1/9 to 1/900, 1/9 to 1/800, 1/9 to 1/700, 1/9 to 1/600, 1/9 to 1/500 1/9 to 1/400, 1/9 to 1/300, 1/9 to 1/200, 1/9 to 1 / 100, 1/9 to 1/90, 1/9 to 1/80, 1/9 to 1/70, 1/9 to 1/60, 1/9 to 1/50, 1/9 to 1/40 1/9 to 1/30, 1/9 to 1/20, 1/9 to 1/10, 1/10 to 1/1000, 1/10 to 1/900, 1/10 to 1/800, 1 / 10 to 1/700, 1/10 to 1/600, 1/10 to 1/500, 1/10 to 1/400, 1/10 to 1/300, 1/10 to 1/200, 1/10 ~ 1/100, 1/10 to 1/90, 1/10 to 1/80, 1/10 to 1/70, 1/10 to 1/60, 1/10 to 1/50, 1/10 to 1 / 40, 1/10 to 1/30, 1/10 to 1/20, 1/20 to 1/1000, 1/20 to 1/900, 1/20 to 1/800, 1/20 to 1/700 , 1/20 to 1/600, / 20 to 1/500, 1/20 to 1/400, 1/20 to 1/300, 1/20 to 1/200, 1/20 to 1/100, 1/20 to 1/90, 1/20 ~ 1/80, 1/20 to 1/70, 1/20 to 1/60, 1/20 to 1/50, 1/20 to 1/40, 1/20 to 1/30, 1/30 to 1 / 1000, 1/30 to 1/900, 1/30 to 1/800, 1/30 to 1/700, 1/30 to 1/600, 1/30 to 1/500, 1/30 to 1/400 1/30 to 1/300, 1/30 to 1/200, 1/30 to 1/100, 1/30 to 1/90, 1/30 to 1/80, 1/30 to 1/70, 1 / 30 to 1/60, 1/30 to 1/50, 1/30 to 1/40, 1/40 to 1/1000, 1/40 to 1/900, 1/40 to 1/800, 1/4 ~ 1/700, 1/40 ~ 1/600, 1/40 ~ 1/500, 1/40 ~ 1/400, 1/40 ~ 1/300, 1/40 ~ 1/200, 1/40 ~ 1 / 100, 1/40 to 1/90, 1/40 to 1/80, 1/40 to 1/70, 1/40 to 1/60, 1/40 to 1/50, 1/50 to 1/1000. 1/50 to 1/900, 1/50 to 1/800, 1/50 to 1/700, 1/50 to 1/600, 1/50 to 1/500, 1/50 to 1/400, 1 / 50 to 1/300, 1/50 to 1/200, 1/50 to 1/100, 1/50 to 1/90, 1/50 to 1/80, 1/50 to 1/70, 1/50 1/60, 1/60 to 1/1000, 1/60 to 1/900, 1/60 to 1/800, 1/60 to 1/700, 1/60 to 1/600, 1/6 0/1/500, 1/60 to 1/400, 1/60 to 1/300, 1/60 to 1/200, 1/60 to 1/100, 1/60 to 1/90, 1/60 to 1/80, 1/60 to 1/70, 1/70 to 1/1000, 1/70 to 1/900, 1/70 to 1/800, 1/70 to 1/700, 1/70 to 1 / 600, 1/70 to 1/500, 1/70 to 1/400, 1/70 to 1/300, 1/70 to 1/200, 1/70 to 1/100, 1/70 to 1/90, 1/70 to 1/80, 1/80 to 1/1000, 1/80 to 1/900, 1/80 to 1/800, 1/80 to 1/700, 1/80 to 1/600, 1 / 80 to 1/500, 1/80 to 1/400, 1/80 to 1/300, 1/80 to 1/200, 1/80 to 1/100, 1/80 to 1/90 1/90 to 1/1000, 1/90 to 1/900, 1/90 to 1/800, 1/90 to 1/700, 1/90 to 1/600, 1/90 to 1/500, 1/90 90 to 1/400, 1/90 to 1/300, 1/90 to 1/200, 1/90 to 1/100, 1/100 to 1/1000, 1/100 to 1/900, 1/100 to 1/800, 1/100 to 1/700, 1/100 to 1/600, 1/100 to 1/500, 1/100 to 1/400, 1/100 to 1/300, 1/100 to 1 / 200, 1/200 to 1/1000, 1/200 to 1/900, 1/200 to 1/800, 1/200 to 1/700, 1/200 to 1/600, 1/200 to 1/500, 1/200 to 1/400, 1/200 to 1/300, 1/300 to 1/1000, 1 / 00 to 1/900, 1/300 to 1/800, 1/300 to 1/700, 1/300 to 1/600, 1/300 to 1/500, 1/300 to 1/400, 1/400 to 1/1000, 1/400 to 1/900, 1/400 to 1/800, 1/400 to 1/700, 1/400 to 1/600, 1/400 to 1/500, 1/500 to 1 / 1000, 1/500 to 1/900, 1/500 to 1/800, 1/500 to 1/700, 1/500 to 1/600, 1/600 to 1/1000, 1/600 to 1/900, 1/600 to 1/800, 1/600 to 1/700, 1/700 to 1/1000, 1/700 to 1/900, 1/700 to 1/800, 1/800 to 1/1000, 1 / Reduced to 800 ~ 1/900 or 1/900 ~ 1/1000 The dose is equivalent to the dose. In some embodiments, such as those described above, the titer of the anti-VZV antigenic polypeptide antibody produced in the subject is a recombinant or purified VZV protein vaccine, or a live attenuated or inactivated VZV vaccine, or VZV. Equivalent to the titer of anti-VZV antigenic polypeptide antibody produced in control subjects receiving a standard therapeutic dose of VLP vaccine. In some embodiments, the effective amount is 1/2, 1/3, 1/4, 1/5, 1/6, 1/7, 1/8, 1/9 of a recombinant VZV protein vaccine standard therapeutic dose. 1/10, 1/20, 1/30, 1/40, 1/50, 1/60, 1/70, 1/80, 1/90, 1/100, 1/110, 1/120, 1 / 130, 1/140, 1/150, 1/160, 1/170, 1/1280, 1/190, 1/200, 1/210, 1/220, 1/230, 1/240, 1/250 1/260, 1/270, 1/280, 1/290, 1/300, 1/310, 1/320, 1/330, 1/340, 1/350, 1/360, 1/370, 1 / 380, 1/490, 1/400, 1/410, 1/420, 1/430, 1/440, 1/4 0, 1/4360, 1/470, 1/480, 1/490, 1/500, 1/510, 1/520, 1/530, 1/540, 1/550, 1/560, 1/5760, 1/580, 1/590, 1/600, 1/610, 1/620, 1/630, 1/640, 1/650, 1/660, 1/670, 1/680, 1/690, 1 / 700, 1/710, 1/720, 1/730, 1/740, 1/750, 1/760, 1/770, 1/780, 1/790, 1/800, 1/810, 1/820, 1/830, 1/840, 1/850, 1/860, 1/870, 1/880, 1/890, 1/900, 1/910, 1/920, 1/930, 1/940, 1 / 950, 1/960, 1/970, 1/980, 1/990 or 1 / A dose equivalent dose and that was reduced to 000 (or at least equivalent). In some embodiments, such as those described above, the titer of the anti-VZV antigenic polypeptide antibody produced in the subject is a recombinant or purified VZV protein vaccine, or a live attenuated or inactivated VZV vaccine, or VZV. Equivalent to the titer of anti-VZV antigenic polypeptide antibody produced in control subjects receiving a standard therapeutic dose of VLP vaccine.

  In some embodiments, an effective amount of VZV RNA (eg, mRNA) vaccine is a total dose of 50-1000 μg. In some embodiments, an effective amount of a VZV RNA (eg, mRNA) vaccine is 50-1000, 50-900, 50-800, 50-700, 50-600, 50-500, 50-400, 50-. 300, 50-200, 50-100, 50-90, 50-80, 50-70, 50-60, 60-1000, 60-900, 60-800, 60-700, 60-600, 60-500, 60-400, 60-300, 60-200, 60-100, 60-90, 60-80, 60-70, 70-1000, 70-900, 70-800, 70-700, 70-600, 70- 500, 70-400, 70-300, 70-200, 70-100, 70-90, 70-80, 80-1000, 80-900, 80-800, 80- 00, 80-600, 80-500, 80-400, 80-300, 80-200, 80-100, 80-90, 90-1000, 90-900, 90-800, 90-700, 90-600, 90-500, 90-400, 90-300, 90-200, 90-100, 100-1000, 100-900, 100-800, 100-700, 100-600, 100-500, 100-400, 100- 300, 100-200, 200-1000, 200-900, 200-800, 200-700, 200-600, 200-500, 200-400, 200-300, 300-1000, 300-900, 300-800, 300-700, 300-600, 300-500, 300-400, 400-1000, 400-900 400-800, 400-700, 400-600, 400-500, 500-1000, 500-900, 500-800, 500-700, 500-600, 600-1000, 600-900, 600-900, 600 -700, 700-1000, 700-900, 700-800, 800-1000, 800-900 or 900-1000 [mu] g total dose. In some embodiments, an effective amount of a VZV RNA (eg, mRNA) vaccine is 50, 100, 150, 200, 250, 300, 350, 400, 450, 500, 550, 600, 650, 700, 750, A total dose of 800, 850, 900, 950 or 1000 μg. In some embodiments, the effective amount is a 25-500 μg dose administered to the subject a total of two times. In some embodiments, an effective amount of a VZV RNA (eg, mRNA) vaccine is administered to the subject a total of two times, 25-500, 25-400, 25-300, 25-200, 25-100, 25. -50, 50-500, 50-400, 50-300, 50-200, 50-100, 100-500, 100-400, 100-300, 100-200, 150-500, 150-400, 150-300 150-200, 200-500, 200-400, 200-300, 250-500, 250-400, 250-300, 300-500, 300-400, 350-500, 350-400, 400-500 or 450 A dose of ˜500 μg. In some embodiments, an effective amount of VZV RNA (eg, mRNA) vaccine is administered to the subject a total of 25, 50, 100, 150, 200, 250, 300, 350, 400, 450, or 500 μg. Is the total dose.

Additional Embodiments At least one messenger ribonucleic acid (mRNA) having a 1.5 ′ end cap, an open reading frame encoding at least one varicella-zoster virus (VZV) antigenic polypeptide, and a 3 ′ poly A tail. ) A VZV vaccine comprising a polynucleotide.

  2. The vaccine of paragraph 1, wherein the at least one mRNA polynucleotide is encoded by a sequence specified by SEQ ID NO: 11.

  3. The vaccine of paragraph 1, wherein the at least one mRNA polynucleotide comprises the sequence specified by SEQ ID NO: 92.

  4). The vaccine of paragraph 1, wherein the at least one antigenic polypeptide comprises the sequence specified by SEQ ID NO: 10.

  5. The vaccine of paragraph 1, wherein the at least one mRNA polynucleotide is encoded by a sequence specified by SEQ ID NO: 15.

  6). The vaccine of paragraph 1, wherein the at least one mRNA polynucleotide comprises the sequence specified by SEQ ID NO: 93.

  7). The vaccine of paragraph 1, wherein the at least one antigenic polypeptide comprises the sequence specified by SEQ ID NO: 14.

  8). The vaccine of paragraph 1, wherein the at least one mRNA polynucleotide is encoded by a sequence specified by SEQ ID NO: 19.

  9. The vaccine of paragraph 1, wherein the at least one mRNA polynucleotide comprises the sequence specified by SEQ ID NO: 94.

  10. The vaccine of paragraph 1, wherein the at least one antigenic polypeptide comprises the sequence specified by SEQ ID NO: 18.

  11. The vaccine of paragraph 1, wherein the at least one mRNA polynucleotide is encoded by a sequence specified by SEQ ID NO: 23.

  12 The vaccine of paragraph 1, wherein the at least one mRNA polynucleotide comprises the sequence specified by SEQ ID NO: 95.

  13. The vaccine of paragraph 1, wherein the at least one antigenic polypeptide comprises the sequence specified by SEQ ID NO: 22.

  14 The vaccine of paragraph 1, wherein the at least one mRNA polynucleotide is encoded by a sequence specified by SEQ ID NO: 27.

  15. The vaccine of paragraph 1, wherein the at least one mRNA polynucleotide comprises the sequence specified by SEQ ID NO: 96.

  16. The vaccine of paragraph 1, wherein the at least one antigenic polypeptide comprises the sequence specified by SEQ ID NO: 26.

  17. The vaccine of paragraph 1, wherein the at least one mRNA polynucleotide is encoded by a sequence specified by SEQ ID NO: 31.

  18. The vaccine of paragraph 1, wherein the at least one mRNA polynucleotide comprises the sequence specified by SEQ ID NO: 97.

  19. The vaccine of paragraph 1, wherein the at least one antigenic polypeptide comprises the sequence specified by SEQ ID NO: 30.

  20. The vaccine of paragraph 1, wherein the at least one mRNA polynucleotide is encoded by a sequence specified by SEQ ID NO: 35.

  21. The vaccine of paragraph 1, wherein the at least one mRNA polynucleotide comprises the sequence specified by SEQ ID NO: 98.

  22. The vaccine of paragraph 1, wherein the at least one antigenic polypeptide comprises the sequence specified by SEQ ID NO: 34.

  23. The vaccine of paragraph 1, wherein the at least one mRNA polynucleotide is encoded by the sequence specified by SEQ ID NO: 39.

  24. The vaccine of paragraph 1, wherein the at least one mRNA polynucleotide comprises the sequence specified by SEQ ID NO: 99.

  25. The vaccine of paragraph 1, wherein the at least one antigenic polypeptide comprises the sequence specified by SEQ ID NO: 38.

  26. The vaccine of paragraph 1, wherein the at least one mRNA polynucleotide is encoded by a sequence specified by SEQ ID NO: 62.

  27. The vaccine of paragraph 1, wherein the at least one mRNA polynucleotide comprises a sequence specified by SEQ ID NO: 101.

  28. 28. The vaccine of paragraph 26 or 27, wherein the at least one antigenic polypeptide comprises the sequence specified by SEQ ID NO: 38.

  29. The vaccine of paragraph 1, wherein the at least one mRNA polynucleotide is encoded by a sequence specified by SEQ ID NO: 66.

  30. The vaccine of claim 1, wherein the at least one mRNA polynucleotide comprises a sequence specified by SEQ ID NO: 102.

  31. 32. The vaccine of paragraph 30 or 31, wherein the at least one antigenic polypeptide comprises the sequence specified by SEQ ID NO: 38.

  32. The vaccine of paragraph 1, wherein the at least one mRNA polynucleotide is encoded by the sequence specified by SEQ ID NO: 70.

  33. The vaccine of paragraph 1, wherein the at least one mRNA polynucleotide comprises the sequence specified by SEQ ID NO: 103.

  34. 34. The vaccine of paragraph 32 or 33, wherein the at least one antigenic polypeptide comprises the sequence specified by SEQ ID NO: 38.

  35. The vaccine of paragraph 1, wherein the at least one mRNA polynucleotide is encoded by a sequence specified by SEQ ID NO: 74.

  36. The vaccine of paragraph 1, wherein the at least one mRNA polynucleotide comprises the sequence specified by SEQ ID NO: 104.

  37. The vaccine of paragraph 35 or 36, wherein the at least one antigenic polypeptide comprises the sequence specified by SEQ ID NO: 38.

  38. The vaccine of paragraph 1, wherein the at least one mRNA polynucleotide is encoded by a sequence specified by SEQ ID NO: 78.

  39. The vaccine of paragraph 1, wherein the at least one mRNA polynucleotide comprises the sequence specified by SEQ ID NO: 105.

  40. 40. The vaccine of paragraph 38 or 39, wherein the at least one antigenic polypeptide comprises the sequence specified by SEQ ID NO: 38.

  41. The vaccine of paragraph 1, wherein the at least one mRNA polynucleotide is encoded by the sequence specified by SEQ ID NO: 82.

  42. The vaccine of paragraph 1, wherein the at least one mRNA polynucleotide comprises the sequence specified by SEQ ID NO: 106.

  43. 43. The vaccine of paragraph 41 or 42, wherein the at least one antigenic polypeptide comprises the sequence specified by SEQ ID NO: 38.

  44. The vaccine of paragraph 1, wherein the at least one mRNA polynucleotide is encoded by a sequence specified by SEQ ID NO: 86.

  45. The vaccine of paragraph 1, wherein the at least one mRNA polynucleotide comprises a sequence specified by SEQ ID NO: 107 or 134.

  46. 46. The vaccine of paragraph 44 or 45, wherein the at least one antigenic polypeptide comprises the sequence specified by SEQ ID NO: 38.

  47. The vaccine of paragraph 1, wherein the at least one mRNA polynucleotide is encoded by a sequence specified by SEQ ID NO: 90.

  48. The vaccine of paragraph 1, wherein the at least one mRNA polynucleotide comprises the sequence specified by SEQ ID NO: 108.

  49. 49. The vaccine of paragraph 47 or 48, wherein the at least one antigenic polypeptide comprises the sequence specified by SEQ ID NO: 38.

  50. 50. The vaccine of any one of paragraphs 1-49, wherein the 5 'end cap is or includes 7mG (5') ppp (5 ') NlpNp.

  51. 51. The vaccine of any one of paragraphs 1-50, wherein 100% of the uracil in the open reading frame is modified to contain N1-methyl pseudouridine at position 5 of the uracil.

  52. Formulated in lipid nanoparticles comprising DLin-MC3-DMA, cholesterol, 1,2-distearoyl-sn-glycero-3-phosphocholine (DSPC) and polyethylene glycol (PEG) 2000-DMG, paragraphs 1 to 51. The vaccine according to any one of 51.

  53. 53. The vaccine of paragraph 52, wherein the lipid nanoparticles further comprise trisodium citrate buffer, sucrose and water.

  Comprising at least one messenger ribonucleic acid (mRNA) polynucleotide having a 54.5 ′ end cap 7mG (5 ′) ppp (5 ′) NlmpNp, the sequence specified by SEQ ID NO: 92, and a 3 ′ poly A tail A varicella-zoster virus (VZV) vaccine, wherein the uracil nucleotide of the sequence specified by SEQ ID NO: 92 is modified to contain N1-methyl pseudouridine at position 5 of the uracil nucleotide.

  55.5 ′ end cap comprising at least one messenger ribonucleic acid (mRNA) polynucleotide having 7mG (5 ′) ppp (5 ′) NlmpNp, the sequence specified by SEQ ID NO: 93 and a 3 ′ poly A tail A varicella-zoster virus (VZV) vaccine, wherein the uracil nucleotide of the sequence specified by SEQ ID NO: 93 is modified to contain N1-methyl pseudouridine at position 5 of the uracil nucleotide.

  56.5 ′ end cap comprising at least one messenger ribonucleic acid (mRNA) polynucleotide having 7mG (5 ′) ppp (5 ′) NlmpNp, the sequence specified by SEQ ID NO: 94, and a 3 ′ poly A tail A varicella-zoster virus (VZV) vaccine, wherein the uracil nucleotide of the sequence specified by SEQ ID NO: 94 is modified to contain N1-methyl pseudouridine at position 5 of the uracil nucleotide.

  Comprising at least one messenger ribonucleic acid (mRNA) polynucleotide having a 57.5 'end cap 7mG (5') ppp (5 ') NlpNp, the sequence specified by SEQ ID NO: 95, and a 3' poly A tail A varicella-zoster virus (VZV) vaccine, wherein the uracil nucleotide of the sequence specified by SEQ ID NO: 95 is modified to contain N1-methyl pseudouridine at position 5 of the uracil nucleotide.

  58.5 'end cap comprising at least one messenger ribonucleic acid (mRNA) polynucleotide having 7mG (5') ppp (5 ') NlmpNp, a sequence specified by SEQ ID NO: 96, and a 3' poly A tail A varicella-zoster virus (VZV) vaccine, wherein the uracil nucleotide of the sequence specified by SEQ ID NO: 96 is modified to contain N1-methyl pseudouridine at position 5 of the uracil nucleotide.

  59.5 'end cap comprising at least one messenger ribonucleic acid (mRNA) polynucleotide having 7mG (5') ppp (5 ') NlmpNp, the sequence specified by SEQ ID NO: 97, and a 3' poly A tail A varicella-zoster virus (VZV) vaccine, wherein the uracil nucleotide of the sequence specified by SEQ ID NO: 97 is modified to contain N1-methyl pseudouridine at position 5 of the uracil nucleotide.

  60.5 ′ end cap comprising at least one messenger ribonucleic acid (mRNA) polynucleotide having 7mG (5 ′) ppp (5 ′) NlmpNp, the sequence specified by SEQ ID NO: 98, and a 3 ′ poly A tail A varicella-zoster virus (VZV) vaccine, wherein the uracil nucleotide of the sequence specified by SEQ ID NO: 98 is modified to contain N1-methyl pseudouridine at position 5 of the uracil nucleotide.

  61.5 ′ end cap comprising at least one messenger ribonucleic acid (mRNA) polynucleotide having 7mG (5 ′) ppp (5 ′) NlmpNp, the sequence specified by SEQ ID NO: 99, and a 3 ′ poly A tail A varicella-zoster virus (VZV) vaccine, wherein the uracil nucleotide of the sequence specified by SEQ ID NO: 99 is modified to contain N1-methyl pseudouridine at position 5 of the uracil nucleotide.

  Comprising at least one messenger ribonucleic acid (mRNA) polynucleotide having a 62.5 ′ end cap 7mG (5 ′) ppp (5 ′) NlmpNp, a sequence specified by SEQ ID NO: 101, and a 3 ′ poly A tail A varicella-zoster virus (VZV) vaccine, wherein the uracil nucleotide of the sequence specified by SEQ ID NO: 101 is modified to contain N1-methyl pseudouridine at position 5 of the uracil nucleotide.

  63.5 'end cap comprising at least one messenger ribonucleic acid (mRNA) polynucleotide having 7mG (5') ppp (5 ') NlpNp, the sequence specified by SEQ ID NO: 102, and a 3' poly A tail A varicella-zoster virus (VZV) vaccine, wherein the uracil nucleotide of the sequence specified by SEQ ID NO: 102 is modified to contain N1-methyl pseudouridine at position 5 of the uracil nucleotide.

  Comprising at least one messenger ribonucleic acid (mRNA) polynucleotide having a 64.5 ′ end cap 7mG (5 ′) ppp (5 ′) NlpNp, a sequence specified by SEQ ID NO: 103, and a 3 ′ poly A tail A varicella-zoster virus (VZV) vaccine, wherein the uracil nucleotide of the sequence specified by SEQ ID NO: 103 is modified to contain N1-methyl pseudouridine at position 5 of the uracil nucleotide.

  65.5 'end cap comprising at least one messenger ribonucleic acid (mRNA) polynucleotide having 7mG (5') ppp (5 ') NlpNp, the sequence specified by SEQ ID NO: 104, and a 3' poly A tail A varicella-zoster virus (VZV) vaccine, wherein the uracil nucleotide of the sequence specified by SEQ ID NO: 104 is modified to contain N1-methyl pseudouridine at position 5 of the uracil nucleotide.

  66.5 'comprising at least one messenger ribonucleic acid (mRNA) polynucleotide having a 7mG (5') ppp (5 ') NlpNp, a sequence specified by SEQ ID NO: 105, and a 3' poly A tail A varicella-zoster virus (VZV) vaccine, wherein the uracil nucleotide of the sequence specified by SEQ ID NO: 105 is modified to contain N1-methyl pseudouridine at position 5 of the uracil nucleotide.

  Comprising at least one messenger ribonucleic acid (mRNA) polynucleotide having a 67.5 'end cap 7mG (5') ppp (5 ') NlpNp, a sequence specified by SEQ ID NO: 106, and a 3' poly A tail A varicella-zoster virus (VZV) vaccine, wherein the uracil nucleotide of the sequence specified by SEQ ID NO: 106 is modified to contain N1-methyl pseudouridine at position 5 of the uracil nucleotide.

  68.5 'end cap 7mG (5') ppp (5 ') NlpNp, at least one messenger ribonucleic acid (mRNA) polynucleotide having a sequence specified by SEQ ID NO: 107 or 134 and a 3' poly A tail A varicella-zoster virus (VZV) vaccine, wherein the uracil nucleotide of the sequence specified by SEQ ID NO: 107 or 134 is modified to contain N1-methyl pseudouridine at position 5 of the uracil nucleotide.

  69.5 'end cap comprising at least one messenger ribonucleic acid (mRNA) polynucleotide having 7mG (5') ppp (5 ') NlpNp, the sequence specified by SEQ ID NO: 108, and a 3' poly A tail A varicella-zoster virus (VZV) vaccine, wherein the uracil nucleotide of the sequence specified by SEQ ID NO: 108 is modified to contain N1-methyl pseudouridine at position 5 of the uracil nucleotide.

  70. 56. Formulated in lipid nanoparticles comprising DLin-MC3-DMA, cholesterol, 1,2-distearoyl-sn-glycero-3-phosphocholine (DSPC) and polyethylene glycol (PEG) 2000-DMG. The vaccine according to any one of -69.

  The invention is not limited in its application to the details of construction and the arrangement of components set forth in the following description or illustrated in the drawings. The invention is capable of other embodiments and of being practiced or carried out in various ways. Also, the terms and terms used herein are for the purpose of explanation and should not be considered limiting. The use of “including”, “comprising” or “having”, “containing”, “involving”, and variations thereof herein is listed below. To be included and equivalents thereof as well as additional items.

Example 1: Production of Polynucleotides According to the present disclosure, the production of polynucleotides and / or portions or regions thereof is described in International Publication No. WO 2014/152027 entitled “Manufacturing Methods for Production of RNA Transscripts”. This can be accomplished utilizing the methods taught in (herein incorporated by reference in its entirety).

  Purification methods can include those taught in International Publication Nos. WO2014 / 152030 and International Publication No. WO2014 / 152031, each of which is incorporated herein by reference in its entirety.

  Polynucleotide detection and characterization methods can be performed as taught in International Publication No. WO 2014/144039, which is hereby incorporated by reference in its entirety.

  Characterization of the polynucleotides of the present disclosure can be accomplished using polynucleotide mapping, reverse transcriptase sequencing, charge distribution analysis, RNA impurity detection or any combination of two or more of the foregoing. “Characterizing” includes determining the sequence of an RNA transcript, determining the purity of an RNA transcript, or determining the charge heterogeneity of an RNA transcript. Such methods are taught, for example, in International Publication Nos. WO2014 / 144711 and International Publication No. WO2014 / 144767, the entire contents of each of which are incorporated herein by reference.

Example 2: Chimeric polynucleotide synthesis According to the present disclosure, a triphosphate chemistry can be used to link or ligate two regions or portions of a chimeric polynucleotide. For example, a first region or portion of 100 nucleotides or less is chemically synthesized by 5 ′ phosphate and terminal 3 ′ desOH or blocking OH. If the region is longer than 80 nucleotides, it can be synthesized as two strands for ligation.

  When in vitro transcription (IVT) is used to synthesize the first region or portion as a non-positionally modified region or portion, conversion to 5 'phosphate followed by 3' end capping is performed. Can be broken.

  The monophosphate protecting group can be selected from any of those known in the art.

  The second region or portion of the chimeric polynucleotide can be synthesized using either chemical synthesis or IVT methods. The IVT method can include an RNA polymerase that can utilize a primer with a modified cap. Alternatively, caps up to 130 nucleotides may be chemically synthesized and linked to the IVT region or IVT moiety.

  In the ligation method, concatamerization is easily avoided by ligation with DNA T4 ligase and subsequent DNAse treatment.

  The entire chimeric polynucleotide need not be made with a phosphate-sugar backbone. Where one of the regions or portions encodes a polypeptide, such a region or portion can include a phosphate-sugar backbone.

  The ligation is then performed using any known click chemistry, ortho click chemistry, sollink or other bioconjugate chemistry known to those skilled in the art.

Synthetic Route A series of starting segments can be used to make a chimeric polynucleotide. Such segments include:
(A) a cap and protected 5 ′ segment (SEG.1) containing normal 3 ′ OH,
(B) a 5 ′ triphosphate segment (SEG.2), which may contain the coding region of the polypeptide and a normal 3 ′ OH,
(C) 5 ′ phosphate segment (SEG.3) for the 3 ′ end (eg tail) of the chimeric polynucleotide with or without cordycepin
Is included.

  After synthesis (chemical synthesis or IVT synthesis), segment 3 (SEG.3) is treated with cordycepin and then with pyrophosphatase to produce the 5 'phosphate.

  RNA ligase is then used to convert segment 2 (SEG.2) to SEG. 3 can be ligated. The ligated polynucleotide is then purified and treated with pyrophosphatase to cleave the diphosphate. The processed SEG. 2-SEG. 3 constructs were purified and SEG. Ligate 1 Further purification steps of the chimeric polynucleotide may be performed.

  If the chimeric polynucleotide encodes a polypeptide, the ligated or ligated segment can be represented as follows: 5'UTR (SEG.1), open reading frame or ORF (SEG.2) and 3'UTR + poly A (SEG.3).

  The yield of each step can be as high as 90-95%.

Example 3: PCR for cDNA generation
The PCR step to prepare the cDNA can be performed using 2 × KAPA HIFI ™ HotStart ReadyMix by Kapa Biosystems (Woburn, Mass.). This system contains 12.5 μl of 2 × KAPA ReadyMix, 0.75 μl of forward primer (10 μM), 0.75 μl of reverse primer (10 μM), 100 ng of template cDNA and is diluted to 25.0 μl with dH ₂ O. Reaction conditions may be 95 ° C. for 5 minutes, 98 ° C. for 20 seconds, then 58 ° C. for 15 seconds, then 72 ° C. for 45 seconds for 25 cycles, then 72 ° C. for 5 minutes, then complete The reaction can be carried out at 4 ° C.

  Invitrogen's PURELINK ™ PCR Micro Kit (Carlsbad, Calif.) Can be used according to the manufacturer's instructions to clean up the reaction (up to 5 μg). Larger reactions may require cleanup using products with higher tolerances. Following cleanup, the cDNA can be quantified using NANODROP ™ and analyzed by agarose gel electrophoresis to confirm that the cDNA is of the expected size. The cDNA is then subjected to sequencing analysis and then proceeds to in vitro transcription reaction.

Example 4: In vitro transcription (IVT)
In vitro transcription reactions produce RNA polynucleotides. Such polynucleotides can include regions or portions of the polynucleotides of the present disclosure, including chemically modified RNA (eg, mRNA) polynucleotides. A chemically modified RNA polynucleotide can be a uniformly modified polynucleotide. In vitro transcription reactions utilize custom nucleotide triphosphate (NTP) mixtures. The NTP can comprise a chemically modified NTP or a mixture of natural and chemically modified NTPs.

A typical in vitro transcription reaction includes:
1) Template cDNA 1.0 μg
2) 10 × transcription buffer 2.0 μl
(400 mM Tris-HCl (pH 8.0), 190 mM MgCl ₂ , 50 mM DTT, 10 mM spermidine)
3) Custom NTP (25 mM each) 0.2 μl
4) RNase inhibitor 20U
5) T7 RNA polymerase 3000U
6) dH ₂ O up to 20.0 μl, and 7) Incubation at 37 ° C. for 3-5 hours.

  The crude IVT mixture can be stored at 4 ° C. overnight in preparation for the next day's cleanup. 1 U of RNase-free DNase is then used to digest the original template. After 15 minutes incubation at 37 ° C., mRNA can be purified using Ambion's MEGACLEAR ™ kit (Austin, TX) according to the manufacturer's instructions. This kit can purify up to 500 μg of RNA. Following this cleanup, the RNA polynucleotide is quantified using NANODROP ™ and analyzed by agarose gel electrophoresis to ensure that the RNA polynucleotide is the correct size and no RNA degradation has occurred. Can be confirmed.

Example 5: Enzyme capping RNA polynucleotide capping is performed as follows. In this case, the mixture contains 60 μg to 180 μg of IVT RNA and a maximum of 72 μl of dH ₂ O. The mixture is incubated at 65 ° C. for 5 minutes to denature the RNA and then immediately transferred to ice.

The protocol then consisted of 10 × capping buffer (0.5 M Tris-HCl (pH 8.0), 60 mM KCl, 12.5 mM MgCl ₂ ) (10.0 μl), 20 mM GTP (5.0 μl), 20 mM S-adeno. Mixing sylmethionine (2.5 μl), RNase inhibitor (100 U), 2′-O-methyltransferase (400 U), vaccinia capping enzyme (guanylyltransferase) (40 U), dH ₂ O (up to 28 μl); Incubation at 37 ° C. for 30 minutes when RNA is 60 μg and up to 2 hours when RNA is 180 μg.

  RNA polynucleotides can then be purified using Ambion's MEGACEAR ™ kit (Austin, TX) according to the manufacturer's instructions. Following this cleanup, RNA is quantitated using NanoDrop ™ (ThermoFisher, Waltham, Mass.) And analyzed by agarose gel electrophoresis to confirm that the RNA polynucleotide is of the appropriate size and RNA degradation. Can confirm that is not happening. RNA polynucleotide products may also be sequenced by performing reverse transcription PCR to generate cDNA for sequencing.

Example 6: Poly A tailing reaction If there is no poly T in the cDNA, it is necessary to carry out the poly A tailing reaction before cleaning the final product. This consists of capped IVT RNA (100 μl), RNase inhibitor (20 U), 10 × tailing buffer (0.5 M Tris-HCl (pH 8.0), 2.5 M NaCl, 100 mM MgCl ₂ ) (12.0 μl) , 20 mM ATP (6.0 μl), poly A polymerase (20 U), dH ₂ O up to 123.5 μl, and incubated at 37 ° C. for 30 minutes. If a poly A tail is already present in the transcript, the tailing reaction can be skipped and proceed directly to cleanup (up to 500 μg) with Ambion's MEGACEAR ™ kit (Austin, TX). The poly-A polymerase can be a recombinant enzyme expressed in yeast.

  It should be understood that the throughput or completeness of a poly A tailing reaction does not always result in a precisely sized poly A tail. Thus, approximately 40-200 nucleotides, e.g., about 40, 50, 60, 70, 80, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104 , 105, 106, 107, 108, 109, 110, 150-165, 155, 156, 157, 158, 159, 160, 161, 162, 163, 164 or 165 are within the scope of this disclosure. is there.

Example 7: Capping Assay Protein Expression Assay A polynucleotide (eg, mRNA) containing any of the caps taught herein and encoding a polypeptide can be transfected into cells at equal concentrations. At 6, 12, 24 and / or 36 hours after transfection, the amount of protein secreted into the culture medium can be assayed by ELISA. A synthetic polynucleotide that secretes higher levels of protein into the medium corresponds to a synthetic polynucleotide having a cap structure with a higher translation ability.

Purity Analytical Synthesis RNA (eg, mRNA) polynucleotides containing any of the caps taught herein and encoding polypeptides are compared for purity using denaturing agarose urea gel electrophoresis or HPLC analysis. can do. An RNA polynucleotide having a single integrated band by electrophoresis corresponds to a product having a higher purity than a polynucleotide having a plurality of bands or striped bands. Chemically modified RNA polynucleotides with a single HPLC peak are also highly pure products. The higher the efficiency of the capping reaction, the purer the polynucleotide population is.

Cytokine analysis An RNA (eg, mRNA) polynucleotide containing any of the caps taught herein and encoding a polypeptide can be transfected into a cell at multiple concentrations. 6, 12, 24 and / or 36 hours after transfection, the amount of pro-inflammatory cytokines such as TNF-α and IFN-β secreted into the culture medium can be assayed by ELISA. An RNA polynucleotide that secretes higher levels of pro-inflammatory cytokines into the medium corresponds to a polynucleotide containing an immune activation cap structure.

Capping reaction efficiency RNA (eg, mRNA) polynucleotides containing any of the caps taught herein and encoding a polypeptide can be analyzed for capping reaction efficiency by LC-MS after nuclease treatment. . Nuclease treatment of capped polynucleotides results in a mixture of free nucleotides and capped 5′-5-triphosphate cap structures that can be detected by LC-MS. The amount of capped product in the LC-MS spectrum can be expressed as a percentage of the total polynucleotide from the reaction and corresponds to the capping reaction efficiency. A cap structure with high capping reaction efficiency has a large amount of capped product according to LC-MS.

Example 8: Agarose gel electrophoresis of modified RNA or RT PCR products Individual RNA polynucleotides (200-400 ng in 20 μl volume) or reverse transcribed PCR products (200-400 ng) were converted to non-denaturing 1.2% agarose E. -Load into wells on Gel (Invitrogen (Carlsbad, CA)) and run for 12-15 minutes according to manufacturer's protocol.

Example 9: Quantification of modified RNA with NANODROP (TM) and UV spectral data Chemically modified RNA polynucleotides in TE buffer (1 [mu] l) were used for Nanodrop (TM) UV absorbance measurements from chemical synthesis or in vitro transcription reactions. The yield of each polynucleotide is quantified.

Example 10: Formulation of modified mRNA using lipidoids RNA (eg, mRNA) polynucleotides are used for in vitro experiments by mixing the polynucleotides with lipidoids at a set ratio prior to addition to the cells. It can be formulated. In vivo formulations may require the addition of additional components to promote systemic circulation. To test the ability of these lipidoids to form particles suitable for in vivo action, the standard formulation process used for siRNA-lipidoid formulations can be used as a starting point. After the formation of the particles, the polynucleotide is added and integrated with the complex. Encapsulation efficiency is determined using a standard dye exclusion assay.

Example 11: Exemplary nucleic acids encoding gE RNA polynucleotides for use in VZV vaccines The following sequences are examples that can be used to encode VZV RNA polynucleotides gE for use in VZV vaccines. It is a typical arrangement. A VZV vaccine may comprise, for example, at least one RNA polynucleotide encoded by at least one of the following sequences or a fragment of at least one of the following sequences: In some embodiments, the mRNA comprises a 5 ′ cap, eg, any of the caps disclosed herein, eg, the sequence m7G (5 ′) ppp (5 ′) G-2′-O-methyl. And further including a cap. In some embodiments, the mRNA does not have a cap sequence. In some embodiments, the mRNA has at least one chemical modification, eg, any of the chemical modifications disclosed herein, eg, an N1-methyl pseudouridine modification or an N1-ethyl pseudouridine modification. . In other embodiments, the mRNA does not have chemical modifications.

Each of the sequences described herein includes chemically modified sequences or unmodified sequences that do not contain modified nucleotides.
VZV gE full length Oka strain:
TCAAGCTTTTGGACCCTCGTACAGAAGCTAATACGACTCACTATAGGGAAATAAGAGAGAAAAGAAGAGTAAGAAGAAATATAAGAGCCACCATGGGGACAGTGAATAAGCCGGTTGTGGGCGTGCTTATGGGCTTTGGGATTATTACCGGTACATTACGAATTACCAATCCAGTGCGCGCCAGTGTGCTGCGTTACGACGACTTTCACATTGACGAGGATAAGCTGGATACTAACAGCGTGTACGAACCTTATTACCACTCAGATCATGCCGAATCAAGCTGGGTTAATAGAGGAGAAAGCAGCCGAAAAGCCTACGACCACAACTCACCTT TATTTGGCCCAGAAACGATTATGACGGTTTCCTGGAAAACGCACATGAACACCATGGAGTCTACAACCAAGGCAGGGGAATCGACAGTGGCGAGCGTCTTATGCAGCCAACACAGATGTCGGCACAGGAGGATCTCGGTGATGACACCGGCATACACGTGATTCCCACATTAAACGGCGACGACAGACATAAGATCGTCAATGTGGATCAGCGTCAGTATGGGGATGTCTTTAAAGGCGATTTGAATCCAAAGCCCCAAGGACAGAGACTGATCGAGGTCTCTGTAGAAGAAAATCACCCCTTCACTTTGCGCGCTCCAATCCAGAGGATTT CGGGGTGCGTTATACCGAAACTTGGAGTTTCTTGCCGTCACTGACGTGTACGGGGGATGCCGCCCCCGCAATCCAGCACATCTGTCTGAAACACACCACATGCTTTCAGGACGTGGTTGTGGATGTGGATTGCGCGGAAAACACAAAAGAAGACCAACTCGCCGAAATCAGCTATCGTTTTCAGGGTAAAAAAGAGGCCGACCAACCGTGGATTGTTGTGAATACGAGCACGCTCTTCGATGAGCTTGAACTCGATCCCCCGGAAATCGAGCCTGGGGTTCTAAAAGTGTTGAGGACCGAGAAGCAGTACCTCGGGGTTTATATCTGGAATAT GAGAGGCTCCGATGGCACCTCTACCTACGCAACGTTTCTGGTTACCTGGAAGGGAGACGAGAAGACACGGAATCCAACGCCCGCTGTGACCCCTCAGCCTAGGGGAGCCGAATTCCACATGTGGAACTATCACTCCCATGTATTCAGTGTGGGTGACACTTTCAGCCTGGCCATGCACCTGCAGTATAAGATTCACGAGGCACCCTTCGACCTCCTGCTGGAGTGGTTGTACGTACCTATTGATCCCACTTGTCAGCCCATGCGCCTGTACTCCACTTGCTTGTACCACCCCAATGCACCACAGTGTCTATCACACATGAACTCCGGGTGTAC TTTACTTCACCCCATCTTGCCCAGCGGGTCGCCAGCACAGTGTATCAGAACTGTGAGCATGCTGACAACTATACTGCTTATTGCCTCGGAATATCCCATATGGAGCCAAGCTTCGGGCTCATACTGCACGATGGTGGTACGACACTCAAGTTCGTGGACACCCCCGAAAGCCTTTCTGGCTTGTACGTGTTCGTGGTCTACTTCAATGGACATGTGGAGGCAGTGGCTTACACAGTGGTTTCGACAGTTGATCACTTTGTAAATGCCATTGAGGAACGCGGCTTCCCGCCTACAGCGGGCCAGCCCCCTGCGACAACAAAACCAAAAGAGAT ACGCCCGTTAATCCTGGGACTAGTCCATTGCTGAGGTATGCCGCCTGGACTGGCGGTCTGGCGGCCGTGGTACTTCTGTGTTTAGTCATATTTCTGATCTGTACCGCTAAACGTATGCGGGTCAAGGCTTACCGTGTTGACAAGTCTCCTTACAATCAGTCAATGTACTATGCAGGACTCCCTGTTGACGATTTCGAAGACTCAGAGAGTACAGACACAGAAGAAGAATTCGGAAACGCTATAGGTGGCTCTCACGGAGGTAGCTCGTATACAGTGTACATCGATAAAACCAGATGATAATAGGCTGGAGCCTCGGTGGCCATGCTTCTTGCC CCCTGGGGCCTCCCCCAGCCCCCTCCTCCCCTTCCTGCACCCGTACCCCCGTGGTCTTTGAATAAAAGTCTGAGTGGGCGGC (SEQ ID NO: 1)
VZV gE full length Oka strain (mRNA):
UCAAGCUUUUGGACCCUCGUACAGAAGCUAAUACGACUCACUAUAGGGAAAUAAGAGAGAAAAGAAGAGUAAGAAGAAAUAUAAGAGCCACCAUGGGGACAGUGAAUAAGCCGGUUGUGGGCGUGCUUAUGGGCUUUGGGAUUAUUACCGGUACAUUACGAAUUACCAAUCCAGUGCGCGCCAGUGUGCUGCGUUACGACGACUUUCACAUUGACGAGGAUAAGCUGGAUACUAACAGCGUGUACGAACCUUAUUACCACUCAGAUCAUGCCGAAUCAAGCUGGGUUAAUAGAGGAGAAAGCAGCCGAAAAGCCUACGACCACAACUCACCUU UAUUUGGCCCAGAAACGAUUAUGACGGUUUCCUGGAAAACGCACAUGAACACCAUGGAGUCUACAACCAAGGCAGGGGAAUCGACAGUGGCGAGCGUCUUAUGCAGCCAACACAGAUGUCGGCACAGGAGGAUCUCGGUGAUGACACCGGCAUACACGUGAUUCCCACAUUAAACGGCGACGACAGACAUAAGAUCGUCAAUGUGGAUCAGCGUCAGUAUGGGGAUGUCUUUAAAGGCGAUUUGAAUCCAAAGCCCCAAGGACAGAGACUGAUCGAGGUCUCUGUAGAAGAAAAUCACCCCUUCACUUUGCGCGCUCCAAUCCAGAGGAUUU CGGGGUGCGUUAUACCGAAACUUGGAGUUUCUUGCCGUCACUGACGUGUACGGGGGAUGCCGCCCCCGCAAUCCAGCACAUCUGUCUGAAACACACCACAUGCUUUCAGGACGUGGUUGUGGAUGUGGAUUGCGCGGAAAACACAAAAGAAGACCAACUCGCCGAAAUCAGCUAUCGUUUUCAGGGUAAAAAAGAGGCCGACCAACCGUGGAUUGUUGUGAAUACGAGCACGCUCUUCGAUGAGCUUGAACUCGAUCCCCCGGAAAUCGAGCCUGGGGUUCUAAAAGUGUUGAGGACCGAGAAGCAGUACCUCGGGGUUUAUAUCUGGAAUAU GAGAGGCUCCGAUGGCACCUCUACCUACGCAACGUUUCUGGUUACCUGGAAGGGAGACGAGAAGACACGGAAUCCAACGCCCGCUGUGACCCCUCAGCCUAGGGGAGCCGAAUUCCACAUGUGGAACUAUCACUCCCAUGUAUUCAGUGUGGGUGACACUUUCAGCCUGGCCAUGCACCUGCAGUAUAAGAUUCACGAGGCACCCUUCGACCUCCUGCUGGAGUGGUUGUACGUACCUAUUGAUCCCACUUGUCAGCCCAUGCGCCUGUACUCCACUUGCUUGUACCACCCCAAUGCACCACAGUGUCUAUCACACAUGAACUCCGGGUGUAC UUUACUUCACCCCAUCUUGCCCAGCGGGUCGCCAGCACAGUGUAUCAGAACUGUGAGCAUGCUGACAACUAUACUGCUUAUUGCCUCGGAAUAUCCCAUAUGGAGCCAAGCUUCGGGCUCAUACUGCACGAUGGUGGUACGACACUCAAGUUCGUGGACACCCCCGAAAGCCUUUCUGGCUUGUACGUGUUCGUGGUCUACUUCAAUGGACAUGUGGAGGCAGUGGCUUACACAGUGGUUUCGACAGUUGAUCACUUUGUAAAUGCCAUUGAGGAACGCGGCUUCCCGCCUACAGCGGGCCAGCCCCCUGCGACAACAAAACCAAAAGAGAU ACGCCCGUUAAUCCUGGGACUAGUCCAUUGCUGAGGUAUGCCGCCUGGACUGGCGGUCUGGCGGCCGUGGUACUUCUGUGUUUAGUCAUAUUUCUGAUCUGUACCGCUAAACGUAUGCGGGUCAAGGCUUACCGUGUUGACAAGUCUCCUUACAAUCAGUCAAUGUACUAUGCAGGACUCCCUGUUGACGAUUUCGAAGACUCAGAGAGUACAGACACAGAAGAAGAAUUCGGAAACGCUAUAGGUGGCUCUCACGGAGGUAGCUCGUAUACAGUGUACAUCGAUAAAACCAGAUGAUAAUAGGCUGGAGCCUCGGUGGCCAUGCUUCUUGCC CCUUGGGCCUCCCCCCCAGCCCCUCCCUCCCCUUCCCUGACCCCGUACCCCCCGUGGUCUUUGAAAUAAAGUCUGAGUGGGCGGC (SEQ ID NO: 123)

Example 12: Exemplary nucleic acid encoding a gI RNA polynucleotide for use in a VZV vaccine The following sequence encodes a VZV RNA polynucleotide gI for use in a VZV RNA (eg, mRNA) vaccine: An exemplary sequence that can be used. The gI polypeptide forms a complex with gE in infected cells. This complex promotes endocytosis of both glycoproteins and induces both glycoproteins in the trans-Golgi network (TGN), the place where the final viral envelope is acquired. A VZV vaccine may comprise, for example, at least one RNA (eg, mRNA) polynucleotide encoded by at least one of the following sequences or a fragment of at least one of the following sequences. In some embodiments, the mRNA comprises a 5 ′ cap, eg, any of the caps disclosed herein, eg, the sequence m7G (5 ′) ppp (5 ′) G-2′-O-methyl. And further including a cap. In other embodiments, the mRNA does not have a cap sequence. In some embodiments, the mRNA has at least one chemical modification, eg, any of the chemical modifications disclosed herein, eg, an N1-methyl pseudouridine modification or an N1-ethyl pseudouridine modification. . In other embodiments, the mRNA does not have chemical modifications.
VZV-GI full length (Oka strain):
TCAAGCTTTTGGACCCTCGTACAGAAGCTAATACGACTCACTATAGGGAAATAAGAGAGAAAAGAAGAGTAAGAAGAAATATAAGAGCCACCATGTTTTTAATCCAATGTTTGATATCGGCCGTTATATTTTACATACAAGTGACCAACGCTTTGATCTTCAAGGGCGACCACGTGAGCTTGCAAGTTAACAGCAGTCTCACGTCTATCCTTATTCCCATGCAAAATGATAATTATACAGAGATAAAAGGACAGCTTGTCTTTATTGGAGAGCAACTACCTACCGGGACAAACTATAGCGGAACACTGGAACTGTTATACGCGGATACGGTGG GTTTTGTTTCCGGTCAGTACAAGTAATAAGATACGACGGATGTCCCCGGATTAGAACGAGCGCTTTTATTTCGTGTAGGTACAAACATTCGTGGCATTATGGTAACTCAACGGATCGGATATCAACAGAGCCGGATGCTGGTGTAATGTTGAAAATTACCAAACCGGGAATAAATGATGCTGGTGTGTATGTACTTCTTGTTCGGTTAGACCATAGCAGATCCACCGATGGTTTCATTCTTGGTGTAAATGTATATACAGCGGGCTCGCATCACAACATTCACGGGGTTATCTACACTTCTCCATCTCTACAGAATGGATATTCTACAAGAG CCTTTTTCAACAAGCTCGTTTGTGTGATTTACCCGCGACACCCAAAGGGTCCGGTACCTCCCTGTTTCAACATATGCTTGATCTTCGTGCCGGTAAATCGTTAGAGGATAACCCTTGGTTACATGAGGACGTTGTTACGACAGAAACTAAGTCCGTTGTTAAGGAGGGGATAGAAAATCACGTATATCCAACGGATATGTCCACGTTACCCGAAAAGTCCCTTAATGATCCTCCAGAAAATCTACTTATAATTATTCCTATAGTAGCGTCTGTCATGATCCTCACCGCCATGGTTATTGTTATTGTAATAAGCGTTAAGCGACGTAGAATTAA AAAACATCCAATTTATCGCCCAAATACAAAAACAAGAAGGGGCATACAAAATGCGACACCAGAATCCGATGTGATGTTGGAGGCCGCCATTGCACAACTAGCAACGATTCGCGAAGAATCCCCCCCACATTCCGTTGTAAACCCGTTTGTTAAATAGTGATAATAGGCTGGAGCCTCGGTGGCCATGCTTCTTGCCCCTTGGGCCTCCCCCCAGCCCCTCCTCCCCTTCCTGCACCCGTACCCCCGTGGTCTTTGAATAAAGTCTGAGTGGGCGGC (SEQ ID NO: 2)
VZV-GI full length (Oka strain) (mRNA):
UCAAGCUUUUGGACCCUCGUACAGAAGCUAAUACGACUCACUAUAGGGAAAUAAGAGAGAAAAGAAGAGUAAGAAGAAAUAUAAGAGCCACCAUGUUUUUAAUCCAAUGUUUGAUAUCGGCCGUUAUAUUUUACAUACAAGUGACCAACGCUUUGAUCUUCAAGGGCGACCACGUGAGCUUGCAAGUUAACAGCAGUCUCACGUCUAUCCUUAUUCCCAUGCAAAAUGAUAAUUAUACAGAGAUAAAAGGACAGCUUGUCUUUAUUGGAGAGCAACUACCUACCGGGACAAACUAUAGCGGAACACUGGAACUGUUAUACGCGGAUACGGUGG GUUUUGUUUCCGGUCAGUACAAGUAAUAAGAUACGACGGAUGUCCCCGGAUUAGAACGAGCGCUUUUAUUUCGUGUAGGUACAAACAUUCGUGGCAUUAUGGUAACUCAACGGAUCGGAUAUCAACAGAGCCGGAUGCUGGUGUAAUGUUGAAAAUUACCAAACCGGGAAUAAAUGAUGCUGGUGUGUAUGUACUUCUUGUUCGGUUAGACCAUAGCAGAUCCACCGAUGGUUUCAUUCUUGGUGUAAAUGUAUAUACAGCGGGCUCGCAUCACAACAUUCACGGGGUUAUCUACACUUCUCCAUCUCUACAGAAUGGAUAUUCUACAAGAG CCUUUUUCAACAAGCUCGUUUGUGUGAUUUACCCGCGACACCCAAAGGGUCCGGUACCUCCCUGUUUCAACAUAUGCUUGAUCUUCGUGCCGGUAAAUCGUUAGAGGAUAACCCUUGGUUACAUGAGGACGUUGUUACGACAGAAACUAAGUCCGUUGUUAAGGAGGGGAUAGAAAAUCACGUAUAUCCAACGGAUAUGUCCACGUUACCCGAAAAGUCCCUUAAUGAUCCUCCAGAAAAUCUACUUAUAAUUAUUCCUAUAGUAGCGUCUGUCAUGAUCCUCACCGCCAUGGUUAUUGUUAUUGUAAUAAGCGUUAAGCGACGUAGAAUUAA AAAACAUCCAAUUUAUCGCCCAAAUACAAAAACAAGAAGGGGCAUACAAAAUGCGACACCAGAAUCCGAUGUGAUGUUGGAGGCCGCCAUUGCACAACUAGCAACGAUUCGCGAAGAAUCCCCCCCACAUUCCGUUGUAAACCCGUUUGUUAAAUAGUGAUAAUAGGCUGGAGCCUCGGUGGCCAUGCUUCUUGCCCCUUGGGCCUCCCCCCAGCCCCUCCUCCCCUUCCUGCACCCGUACCCCCGUGGUCUUUGAAUAAAGUCUGAGUGGGCGGC (SEQ ID NO: 124)

Example 13: mRNA encoding variant gE antigen with various C-terminal sequences for use in VZV vaccines
VZV is enveloped by a trans-Golgi network. Glycoprotein I (gI) forms a complex with gE in infected cells. This complex promotes endocytosis of both glycoproteins and induces both glycoproteins in the trans-Golgi network (TGN), the place where the final viral envelope is acquired. gE antigens with different C-terminal variant sequences to avoid gE capture by ER / Golgi / TGN, increase gE antigen localization to the plasma membrane, and improve immunostimulatory capacity MRNA was designed to encode. A schematic diagram of the gE antigen is shown in FIG.

Several different gE variant mRNA sequences (Oka strain) were engineered.
(1) gE variant mRNA (SEQ ID NO: 17 to 20) encoding a truncated polypeptide from which 62 amino acids at the end of the C-terminal region have been deleted. The resulting polypeptide has reduced localization to the trans-Golgi network and reduced endocytosis.
(2) gE variant encoding a truncated polypeptide in which 62 amino acids at the end of the C-terminal region are deleted and the signal peptide is replaced with Igκ (which becomes a secreted truncated gE polypeptide) mRNA (SEQ ID NOs: 21-24). The resulting polypeptide has reduced localization to the trans-Golgi network and reduced endocytosis.
(3) gE variant mRNA (SEQ ID NO: 33 to 36) encoding a truncated polypeptide from which 50 amino acids at the end of the C-terminal region have been deleted. The resulting polypeptide has reduced localization to the trans-Golgi network and reduced endocytosis.
(4) gE variant mRNA (SEQ ID NOs: 37 to 40) that encodes a truncated polypeptide lacking 50 amino acids at the end of the C-terminal region and having a point mutation Y569A. The “AYRV” motif (SEQ ID NO: 119) is a transport motif that targets the gE polypeptide to the trans-Golgi network. Thus, changing the AARV sequence of SEQ ID NO: 120 to AYRV of SEQ ID NO: 119 reduces the localization of the gE polypeptide to the trans-Golgi network.
(5) gE variant mRNA (SEQ ID NO: 25-28) encoding full length gE polypeptide comprising AEAADA (SEQ ID NO: 58) sequence. The A-E-A-A-D-A (SEQ ID NO: 58) sequence replaces SESTDT (SEQ ID NO: 59), which is a Ser / Thr rich “SSTT” (SEQ ID NO: 122) acidic cluster. It replaces with an array rich in Ala. This reduces CKII phosphorylation, resulting in reduced localization of the gE polypeptide to the trans-Golgi network.
(6) gE variant mRNA (SEQ ID NO: 29-32) that contains the AEAADA (SEQ ID NO: 58) sequence and encodes a full-length gE polypeptide having a point mutation Y582G. The “YAGL” (SEQ ID NO: 121) motif is an endocytic motif that promotes localization of the gE polypeptide to the trans-Golgi network. Thus, changing the GAGL sequence (SEQ ID NO: 132) to YAGL (SEQ ID NO: 121) reduces the endocytosis of the resulting polypeptide.

Each of these variants has modifications that reduce the localization of the encoded gE protein to the trans-Golgi network and improve transport to the plasma membrane. Table 1 summarizes the mRNA encoding variant gE antigens with various C-terminal sequences. In some embodiments, the variant mRNA has a 5 ′ cap, eg, any of the caps disclosed herein, eg, the sequence m7G (5 ′) ppp (5 ′) G-2′-O-methyl. And further including a cap. In some embodiments, the variant mRNA does not have a 5 ′ cap. In some embodiments, the variant mRNA has at least one chemical modification, such as any of the chemical modifications disclosed herein, such as an N1-methyl pseudouridine modification or an N1-ethyl pseudouridine modification. Have. In some embodiments, the mRNA does not have chemical modifications. The sequences encoding the mRNA variants are listed in the table below.
VZV-GE-deletion 562
TCAAGCTTTTGGACCCTCGTACAGAAGCTAATACGACTCACTATAGGGAAATAAGAGAGAAAAGAAGAGTAAGAAGAAATATAAGAGCCACCATGGGGACAGTTAATAAACCTGTGGTGGGGGTATTGATGGGGTTCGGAATTATCACGGGAACGTTGCGTATAACGAATCCGGTCAGAGCATCCGTCTTGCGATACGATGATTTTCACATCGATGAAGACAAACTGGATACAAACTCCGTATATGAGCCTTACTACCATTCAGATCATGCGGAGTCTTCATGGGTAAATCGGGGAGAGTCTTCGCGAAAAGCGTACGATCATAACTCACCTT TATATGGCCACGTAATGATTATGATGGATTTTTAGAGAACGCACACGAACACCATGGGGTGTATAATCAGGGCCGTGGTATCGATAGCGGGGAACGGTTAATGCAACCCACACAAATGTCTGCACAGGAGGATCTTGGGGACGATACGGGCATCCACGTTATCCCTACGTTAAACGGCGATGACAGACATAAAATTGTAAATGTGGACCAACGTCAATACGGTGACGTGTTTAAAGGAGATCTTAATCCAAAACCCCAAGGCCAAAGACTCATTGAGGTGTCAGTGGAAGAAAATCACCCGTTTACTTTACGCGCACCGATTCAGCGGATTT TGGAGTCCGGTACACCGAGACTTGGAGCTTTTTGCCGTCATTAACCTGTACGGGAGACGCAGCGCCCGCCATCCAGCATATATGTTTAAAACATACAACATGCTTTCAAGACGTGGTGGTGGATGTGGATTGCGCGGAAAATACTAAAGAGGATCAGTTGGCCGAAATCAGTTACCGTTTTCAAGGTAAGAAGGAAGCGGACCAACCGTGGATTGTTGTAAACACGAGCACACTGTTTGATGAACTCGAATTAGACCCCCCCGAGATTGAACCGGGTGTCTTGAAAGTACTTCGGACAGAAAAACAATACTTGGGTGTGTACATTTGGAACAT GCGCGGCTCCGATGGTACGTCTACCTACGCCACGTTTTTGGTCACCTGGAAAGGGGATGAAAAAACAAGAAACCCTACGCCCGCAGTAACTCCTCAACCAAGAGGGGCTGAGTTTCATATGTGGAATTACCACTCGCATGTATTTTCAGTTGGTGATACGTTTAGCTTGGCAATGCATCTTCAGTATAAGATACATGAAGCGCCATTTGATTTGCTGTTAGAGTGGTTGTATGTCCCCATCGATCCTACATGTCAACCAATGCGGTTATATTCTACGTGTTTGTATCATCCCAACGCACCCCAATGCCTCTCTCATATGAATTCCGGTTGTAC TTTACCTCGCCACATTTAGCCCAGCGTGTTGCAAGCACAGTGTATCAAAATTGTGAACATGCAGATAACTACACCGCATATTGTCTGGGAATATCTCATATGGAGCCTAGCTTTGGTCTAATCTTACACGACGGGGGCACCACGTTAAAGTTTGTAGATACACCCGAGAGTTTGTCGGGATTATACGTTTTTGTGGTGTATTTTAACGGGCATGTTGAAGCCGTAGCATACACTGTTGTATCCACAGTAGATCATTTTGTAAACGCAATTGAAGAGCGTGGATTTCCGCCAACGGCCGGTCAGCCACCGGCGACTACTAAACCCAAGGAAAT ACCCCCGTAAACCCCGGAACGTCACCACTTCTACGATATGCCGCATGGACCGGAGGGCTTGCAGCAGTAGTACTTTTATGTCTCGTAATATTTTTAATCTGTACGGCTTGATGATAATAGGCTGGAGCCTCGGTGGCCATGCTTCTTGCCCCTTGGGCCTCCCCCCAGCCCCTCCTCCCCTTCCTGCACCCGTACCCCCGTGGTCTTTGAATAAAGTCTGAGTGGGCGGC (SEQ ID NO: 3)
VZV-GE-deletion 562 (mRNA)
UCAAGCUUUUGGACCCUCGUACAGAAGCUAAUACGACUCACUAUAGGGAAAUAAGAGAGAAAAGAAGAGUAAGAAGAAAUAUAAGAGCCACCAUGGGGACAGUUAAUAAACCUGUGGUGGGGGUAUUGAUGGGGUUCGGAAUUAUCACGGGAACGUUGCGUAUAACGAAUCCGGUCAGAGCAUCCGUCUUGCGAUACGAUGAUUUUCACAUCGAUGAAGACAAACUGGAUACAAACUCCGUAUAUGAGCCUUACUACCAUUCAGAUCAUGCGGAGUCUUCAUGGGUAAAUCGGGGAGAGUCUUCGCGAAAAGCGUACGAUCAUAACUCACCUU UAUAUGGCCACGUAAUGAUUAUGAUGGAUUUUUAGAGAACGCACACGAACACCAUGGGGUGUAUAAUCAGGGCCGUGGUAUCGAUAGCGGGGAACGGUUAAUGCAACCCACACAAAUGUCUGCACAGGAGGAUCUUGGGGACGAUACGGGCAUCCACGUUAUCCCUACGUUAAACGGCGAUGACAGACAUAAAAUUGUAAAUGUGGACCAACGUCAAUACGGUGACGUGUUUAAAGGAGAUCUUAAUCCAAAACCCCAAGGCCAAAGACUCAUUGAGGUGUCAGUGGAAGAAAAUCACCCGUUUACUUUACGCGCACCGAUUCAGCGGAUUU UGGAGUCCGGUACACCGAGACUUGGAGCUUUUUGCCGUCAUUAACCUGUACGGGAGACGCAGCGCCCGCCAUCCAGCAUAUAUGUUUAAAACAUACAACAUGCUUUCAAGACGUGGUGGUGGAUGUGGAUUGCGCGGAAAAUACUAAAGAGGAUCAGUUGGCCGAAAUCAGUUACCGUUUUCAAGGUAAGAAGGAAGCGGACCAACCGUGGAUUGUUGUAAACACGAGCACACUGUUUGAUGAACUCGAAUUAGACCCCCCCGAGAUUGAACCGGGUGUCUUGAAAGUACUUCGGACAGAAAAACAAUACUUGGGUGUGUACAUUUGGAACAU GCGCGGCUCCGAUGGUACGUCUACCUACGCCACGUUUUUGGUCACCUGGAAAGGGGAUGAAAAAACAAGAAACCCUACGCCCGCAGUAACUCCUCAACCAAGAGGGGCUGAGUUUCAUAUGUGGAAUUACCACUCGCAUGUAUUUUCAGUUGGUGAUACGUUUAGCUUGGCAAUGCAUCUUCAGUAUAAGAUACAUGAAGCGCCAUUUGAUUUGCUGUUAGAGUGGUUGUAUGUCCCCAUCGAUCCUACAUGUCAACCAAUGCGGUUAUAUUCUACGUGUUUGUAUCAUCCCAACGCACCCCAAUGCCUCUCUCAUAUGAAUUCCGGUUGUAC UUUACCUCGCCACAUUUAGCCCAGCGUGUUGCAAGCACAGUGUAUCAAAAUUGUGAACAUGCAGAUAACUACACCGCAUAUUGUCUGGGAAUAUCUCAUAUGGAGCCUAGCUUUGGUCUAAUCUUACACGACGGGGGCACCACGUUAAAGUUUGUAGAUACACCCGAGAGUUUGUCGGGAUUAUACGUUUUUGUGGUGUAUUUUAACGGGCAUGUUGAAGCCGUAGCAUACACUGUUGUAUCCACAGUAGAUCAUUUUGUAAACGCAAUUGAAGAGCGUGGAUUUCCGCCAACGGCCGGUCAGCCACCGGCGACUACUAAACCCAAGGAAAU ACCCCCGUAAACCCCGGAACGUCACCACUUCUACGAUAUGCCGCAUGGACCGGAGGGCUUGCAGCAGUAGUACUUUUAUGUCUCGUAAUAUUUUUAAUCUGUACGGCUUGAUGAUAAUAGGCUGGAGCCUCGGUGGCCAUGCUUCUUGCCCCUUGGGCCUCCCCCCAGCCCCUCCUCCCCUUCCUGCACCCGUACCCCCGUGGUCUUUGAAUAAAGUCUGAGUGGGCGGC (SEQ ID NO: 125)
VZV-GE-deletion 562-Igκ
TCAAGCTTTTGGACCCTCGTACAGAAGCTAATACGACTCACTATAGGGAAATAAGAGAGAAAAGAAGAGTAAGAAGAAATATAAGAGCCACCATGGAAACCCCGGCGCAGCTGCTGTTTCTGCTGCTGCTGTGGCTGCCGGATACCACCGGCTCCGTCTTGCGATACGATGATTTTCACATCGATGAAGACAAACTGGATACAAACTCCGTATATGAGCCTTACTACCATTCAGATCATGCGGAGTCTTCATGGGTAAATCGGGGAGAGTCTTCGCGAAAAGCGTACGATCATAACTCACCTTATATATGGCCACGTAATGATTATGATGGAT TTTAGAGAACGCACACGAACACCATGGGGTGTATAATCAGGGCCGTGGTATCGATAGCGGGGAACGGTTAATGCAACCCACACAAATGTCTGCACAGGAGGATCTTGGGGACGATACGGGCATCCACGTTATCCCTACGTTAAACGGCGATGACAGACATAAAATTGTAAATGTGGACCAACGTCAATACGGTGACGTGTTTAAAGGAGATCTTAATCCAAAACCCCAAGGCCAAAGACTCATTGAGGTGTCAGTGGAAGAAAATCACCCGTTTACTTTACGCGCACCGATTCAGCGGATTTATGGAGTCCGGTACACCGAGACTTGGAGCT TTTGCCGTCATTAACCTGTACGGGAGACGCAGCGCCCGCCATCCAGCATATATGTTTAAAACATACAACATGCTTTCAAGACGTGGTGGTGGATGTGGATTGCGCGGAAAATACTAAAGAGGATCAGTTGGCCGAAATCAGTTACCGTTTTCAAGGTAAGAAGGAAGCGGACCAACCGTGGATTGTTGTAAACACGAGCACACTGTTTGATGAACTCGAATTAGACCCCCCCGAGATTGAACCGGGTGTCTTGAAAGTACTTCGGACAGAAAAACAATACTTGGGTGTGTACATTTGGAACATGCGCGGCTCCGATGGTACGTCTACCTACGC CACGTTTTTGGTCACCTGGAAAGGGGATGAAAAAACAAGAAACCCTACGCCCGCAGTAACTCCTCAACCAAGAGGGGCTGAGTTTCATATGTGGAATTACCACTCGCATGTATTTTCAGTTGGTGATACGTTTAGCTTGGCAATGCATCTTCAGTATAAGATACATGAAGCGCCATTTGATTTGCTGTTAGAGTGGTTGTATGTCCCCATCGATCCTACATGTCAACCAATGCGGTTATATTCTACGTGTTTGTATCATCCCAACGCACCCCAATGCCTCTCTCATATGAATTCCGGTTGTACATTTACCTCGCCACATTTAGCCCAGCGTGT GCAAGCACAGTGTATCAAAATTGTGAACATGCAGATAACTACACCGCATATTGTCTGGGAATATCTCATATGGAGCCTAGCTTTGGTCTAATCTTACACGACGGGGGCACCACGTTAAAGTTTGTAGATACACCCGAGAGTTTGTCGGGATTATACGTTTTTGTGGTGTATTTTAACGGGCATGTTGAAGCCGTAGCATACACTGTTGTATCCACAGTAGATCATTTTGTAAACGCAATTGAAGAGCGTGGATTTCCGCCAACGGCCGGTCAGCCACCGGCGACTACTAAACCCAAGGAAATTACCCCCGTAAACCCCGGAACGTCACCACT CTACGATATGCCGCATGGACCGGAGGGCTTGCAGCAGTAGTACTTTTATGTCTCGTAATATTTTTAATCTGTACGGCTTGATGATAATAGGCTGGAGCCTCGGTGGCCATGCTTCTTGCCCCTTGGGCCTCCCCCCAGCCCCTCCTCCCCTTCCTGCACCCGTACCCCCGTGGTCTTTGAATAAAGTCTGAGTGGGCGGC (SEQ ID NO: 4)
VZV-GE-deficient 562-Igκ (mRNA)
UCAAGCUUUUGGACCCUCGUACAGAAGCUAAUACGACUCACUAUAGGGAAAUAAGAGAGAAAAGAAGAGUAAGAAGAAAUAUAAGAGCCACCAUGGAAACCCCGGCGCAGCUGCUGUUUCUGCUGCUGCUGUGGCUGCCGGAUACCACCGGCUCCGUCUUGCGAUACGAUGAUUUUCACAUCGAUGAAGACAAACUGGAUACAAACUCCGUAUAUGAGCCUUACUACCAUUCAGAUCAUGCGGAGUCUUCAUGGGUAAAUCGGGGAGAGUCUUCGCGAAAAGCGUACGAUCAUAACUCACCUUAUAUAUGGCCACGUAAUGAUUAUGAUGGAU UUUAGAGAACGCACACGAACACCAUGGGGUGUAUAAUCAGGGCCGUGGUAUCGAUAGCGGGGAACGGUUAAUGCAACCCACACAAAUGUCUGCACAGGAGGAUCUUGGGGACGAUACGGGCAUCCACGUUAUCCCUACGUUAAACGGCGAUGACAGACAUAAAAUUGUAAAUGUGGACCAACGUCAAUACGGUGACGUGUUUAAAGGAGAUCUUAAUCCAAAACCCCAAGGCCAAAGACUCAUUGAGGUGUCAGUGGAAGAAAAUCACCCGUUUACUUUACGCGCACCGAUUCAGCGGAUUUAUGGAGUCCGGUACACCGAGACUUGGAGCU UUUGCCGUCAUUAACCUGUACGGGAGACGCAGCGCCCGCCAUCCAGCAUAUAUGUUUAAAACAUACAACAUGCUUUCAAGACGUGGUGGUGGAUGUGGAUUGCGCGGAAAAUACUAAAGAGGAUCAGUUGGCCGAAAUCAGUUACCGUUUUCAAGGUAAGAAGGAAGCGGACCAACCGUGGAUUGUUGUAAACACGAGCACACUGUUUGAUGAACUCGAAUUAGACCCCCCCGAGAUUGAACCGGGUGUCUUGAAAGUACUUCGGACAGAAAAACAAUACUUGGGUGUGUACAUUUGGAACAUGCGCGGCUCCGAUGGUACGUCUACCUACGC CACGUUUUUGGUCACCUGGAAAGGGGAUGAAAAAACAAGAAACCCUACGCCCGCAGUAACUCCUCAACCAAGAGGGGCUGAGUUUCAUAUGUGGAAUUACCACUCGCAUGUAUUUUCAGUUGGUGAUACGUUUAGCUUGGCAAUGCAUCUUCAGUAUAAGAUACAUGAAGCGCCAUUUGAUUUGCUGUUAGAGUGGUUGUAUGUCCCCAUCGAUCCUACAUGUCAACCAAUGCGGUUAUAUUCUACGUGUUUGUAUCAUCCCAACGCACCCCAAUGCCUCUCUCAUAUGAAUUCCGGUUGUACAUUUACCUCGCCACAUUUAGCCCAGCGUGU GCAAGCACAGUGUAUCAAAAUUGUGAACAUGCAGAUAACUACACCGCAUAUUGUCUGGGAAUAUCUCAUAUGGAGCCUAGCUUUGGUCUAAUCUUACACGACGGGGGCACCACGUUAAAGUUUGUAGAUACACCCGAGAGUUUGUCGGGAUUAUACGUUUUUGUGGUGUAUUUUAACGGGCAUGUUGAAGCCGUAGCAUACACUGUUGUAUCCACAGUAGAUCAUUUUGUAAACGCAAUUGAAGAGCGUGGAUUUCCGCCAACGGCCGGUCAGCCACCGGCGACUACUAAACCCAAGGAAAUUACCCCCGUAAACCCCGGAACGUCACCACU CUACGAUAUGCCGCAUGGACCGGAGGGCUUGCAGCAGUAGUACUUUUAUGUCUCGUAAUAUUUUUAAUCUGUACGGCUUGAUGAUAAUAGGCUGGAGCCUCGGUGGCCAUGCUUCUUGCCCCUUGGGCCUCCCCCCAGCCCCUCCUCCCCUUCCUGCACCCGUACCCCCGUGGUCUUUGAAUAAAGUCUGAGUGGGCGGC (SEQ ID NO: 126)
VZV-GE-deletion 574
TCAAGCTTTTGGACCCTCGTACAGAAGCTAATACGACTCACTATAGGGAAATAAGAGAGAAAAGAAGAGTAAGAAGAAATATAAGAGCCACCATGGGGACAGTTAATAAACCTGTGGTGGGGGTATTGATGGGGTTCGGAATTATCACGGGAACGTTGCGTATAACGAATCCGGTCAGAGCATCCGTCTTGCGATACGATGATTTTCACATCGATGAAGACAAACTGGATACAAACTCCGTATATGAGCCTTACTACCATTCAGATCATGCGGAGTCTTCATGGGTAAATCGGGGAGAGTCTTCGCGAAAAGCGTACGATCATAACTCACCTT TATATGGCCACGTAATGATTATGATGGATTTTTAGAGAACGCACACGAACACCATGGGGTGTATAATCAGGGCCGTGGTATCGATAGCGGGGAACGGTTAATGCAACCCACACAAATGTCTGCACAGGAGGATCTTGGGGACGATACGGGCATCCACGTTATCCCTACGTTAAACGGCGATGACAGACATAAAATTGTAAATGTGGACCAACGTCAATACGGTGACGTGTTTAAAGGAGATCTTAATCCAAAACCCCAAGGCCAAAGACTCATTGAGGTGTCAGTGGAAGAAAATCACCCGTTTACTTTACGCGCACCGATTCAGCGGATTT TGGAGTCCGGTACACCGAGACTTGGAGCTTTTTGCCGTCATTAACCTGTACGGGAGACGCAGCGCCCGCCATCCAGCATATATGTTTAAAACATACAACATGCTTTCAAGACGTGGTGGTGGATGTGGATTGCGCGGAAAATACTAAAGAGGATCAGTTGGCCGAAATCAGTTACCGTTTTCAAGGTAAGAAGGAAGCGGACCAACCGTGGATTGTTGTAAACACGAGCACACTGTTTGATGAACTCGAATTAGACCCCCCCGAGATTGAACCGGGTGTCTTGAAAGTACTTCGGACAGAAAAACAATACTTGGGTGTGTACATTTGGAACAT GCGCGGCTCCGATGGTACGTCTACCTACGCCACGTTTTTGGTCACCTGGAAAGGGGATGAAAAAACAAGAAACCCTACGCCCGCAGTAACTCCTCAACCAAGAGGGGCTGAGTTTCATATGTGGAATTACCACTCGCATGTATTTTCAGTTGGTGATACGTTTAGCTTGGCAATGCATCTTCAGTATAAGATACATGAAGCGCCATTTGATTTGCTGTTAGAGTGGTTGTATGTCCCCATCGATCCTACATGTCAACCAATGCGGTTATATTCTACGTGTTTGTATCATCCCAACGCACCCCAATGCCTCTCTCATATGAATTCCGGTTGTAC TTTACCTCGCCACATTTAGCCCAGCGTGTTGCAAGCACAGTGTATCAAAATTGTGAACATGCAGATAACTACACCGCATATTGTCTGGGAATATCTCATATGGAGCCTAGCTTTGGTCTAATCTTACACGACGGGGGCACCACGTTAAAGTTTGTAGATACACCCGAGAGTTTGTCGGGATTATACGTTTTTGTGGTGTATTTTAACGGGCATGTTGAAGCCGTAGCATACACTGTTGTATCCACAGTAGATCATTTTGTAAACGCAATTGAAGAGCGTGGATTTCCGCCAACGGCCGGTCAGCCACCGGCGACTACTAAACCCAAGGAAAT ACCCCCGTAAACCCCGGAACGTCACCACTTCTACGATATGCCGCATGGACCGGAGGGCTTGCAGCAGTAGTACTTTTATGTCTCGTAATATTTTTAATCTGTACGGCTAAACGAATGAGGGTTAAAGCCTATAGGGTAGACAAGTGATGATAATAGGCTGGAGCCTCGGTGGCCATGCTTCTTGCCCCTTGGGCCTCCCCCCAGCCCCTCCTCCCCTTCCTGCACCCGTACCCCCGTGGTCTTTGAATAAAGTCTGAGTGGGCGGC (SEQ ID NO: 5)
VZV-GE-deletion 574 (mRNA)
UCAAGCUUUUGGACCCUCGUACAGAAGCUAAUACGACUCACUAUAGGGAAAUAAGAGAGAAAAGAAGAGUAAGAAGAAAUAUAAGAGCCACCAUGGGGACAGUUAAUAAACCUGUGGUGGGGGUAUUGAUGGGGUUCGGAAUUAUCACGGGAACGUUGCGUAUAACGAAUCCGGUCAGAGCAUCCGUCUUGCGAUACGAUGAUUUUCACAUCGAUGAAGACAAACUGGAUACAAACUCCGUAUAUGAGCCUUACUACCAUUCAGAUCAUGCGGAGUCUUCAUGGGUAAAUCGGGGAGAGUCUUCGCGAAAAGCGUACGAUCAUAACUCACCUU UAUAUGGCCACGUAAUGAUUAUGAUGGAUUUUUAGAGAACGCACACGAACACCAUGGGGUGUAUAAUCAGGGCCGUGGUAUCGAUAGCGGGGAACGGUUAAUGCAACCCACACAAAUGUCUGCACAGGAGGAUCUUGGGGACGAUACGGGCAUCCACGUUAUCCCUACGUUAAACGGCGAUGACAGACAUAAAAUUGUAAAUGUGGACCAACGUCAAUACGGUGACGUGUUUAAAGGAGAUCUUAAUCCAAAACCCCAAGGCCAAAGACUCAUUGAGGUGUCAGUGGAAGAAAAUCACCCGUUUACUUUACGCGCACCGAUUCAGCGGAUUU UGGAGUCCGGUACACCGAGACUUGGAGCUUUUUGCCGUCAUUAACCUGUACGGGAGACGCAGCGCCCGCCAUCCAGCAUAUAUGUUUAAAACAUACAACAUGCUUUCAAGACGUGGUGGUGGAUGUGGAUUGCGCGGAAAAUACUAAAGAGGAUCAGUUGGCCGAAAUCAGUUACCGUUUUCAAGGUAAGAAGGAAGCGGACCAACCGUGGAUUGUUGUAAACACGAGCACACUGUUUGAUGAACUCGAAUUAGACCCCCCCGAGAUUGAACCGGGUGUCUUGAAAGUACUUCGGACAGAAAAACAAUACUUGGGUGUGUACAUUUGGAACAU GCGCGGCUCCGAUGGUACGUCUACCUACGCCACGUUUUUGGUCACCUGGAAAGGGGAUGAAAAAACAAGAAACCCUACGCCCGCAGUAACUCCUCAACCAAGAGGGGCUGAGUUUCAUAUGUGGAAUUACCACUCGCAUGUAUUUUCAGUUGGUGAUACGUUUAGCUUGGCAAUGCAUCUUCAGUAUAAGAUACAUGAAGCGCCAUUUGAUUUGCUGUUAGAGUGGUUGUAUGUCCCCAUCGAUCCUACAUGUCAACCAAUGCGGUUAUAUUCUACGUGUUUGUAUCAUCCCAACGCACCCCAAUGCCUCUCUCAUAUGAAUUCCGGUUGUAC UUUACCUCGCCACAUUUAGCCCAGCGUGUUGCAAGCACAGUGUAUCAAAAUUGUGAACAUGCAGAUAACUACACCGCAUAUUGUCUGGGAAUAUCUCAUAUGGAGCCUAGCUUUGGUCUAAUCUUACACGACGGGGGCACCACGUUAAAGUUUGUAGAUACACCCGAGAGUUUGUCGGGAUUAUACGUUUUUGUGGUGUAUUUUAACGGGCAUGUUGAAGCCGUAGCAUACACUGUUGUAUCCACAGUAGAUCAUUUUGUAAACGCAAUUGAAGAGCGUGGAUUUCCGCCAACGGCCGGUCAGCCACCGGCGACUACUAAACCCAAGGAAAU ACCCCCGUAAACCCCGGAACGUCACCACUUCUACGAUAUGCCGCAUGGACCGGAGGGCUUGCAGCAGUAGUACUUUUAUGUCUCGUAAUAUUUUUAAUCUGUACGGCUAAACGAAUGAGGGUUAAAGCCUAUAGGGUAGACAAGUGAUGAUAAUAGGCUGGAGCCUCGGUGGCCAUGCUUCUUGCCCCUUGGGCCUCCCCCCAGCCCCUCCUCCCCUUCCUGCACCCGUACCCCCGUGGUCUUUGAAUAAAGUCUGAGUGGGCGGC (SEQ ID NO: 127)
VZV-GE-deletion 574-Y569A
TCAAGCTTTTGGACCCTCGTACAGAAGCTAATACGACTCACTATAGGGAAATAAGAGAGAAAAGAAGAGTAAGAAGAAATATAAGAGCCACCATGGGGACAGTTAATAAACCTGTGGTGGGGGTATTGATGGGGTTCGGAATTATCACGGGAACGTTGCGTATAACGAATCCGGTCAGAGCATCCGTCTTGCGATACGATGATTTTCACATCGATGAAGACAAACTGGATACAAACTCCGTATATGAGCCTTACTACCATTCAGATCATGCGGAGTCTTCATGGGTAAATCGGGGAGAGTCTTCGCGAAAAGCGTACGATCATAACTCACCTT TATATGGCCACGTAATGATTATGATGGATTTTTAGAGAACGCACACGAACACCATGGGGTGTATAATCAGGGCCGTGGTATCGATAGCGGGGAACGGTTAATGCAACCCACACAAATGTCTGCACAGGAGGATCTTGGGGACGATACGGGCATCCACGTTATCCCTACGTTAAACGGCGATGACAGACATAAAATTGTAAATGTGGACCAACGTCAATACGGTGACGTGTTTAAAGGAGATCTTAATCCAAAACCCCAAGGCCAAAGACTCATTGAGGTGTCAGTGGAAGAAAATCACCCGTTTACTTTACGCGCACCGATTCAGCGGATTT TGGAGTCCGGTACACCGAGACTTGGAGCTTTTTGCCGTCATTAACCTGTACGGGAGACGCAGCGCCCGCCATCCAGCATATATGTTTAAAACATACAACATGCTTTCAAGACGTGGTGGTGGATGTGGATTGCGCGGAAAATACTAAAGAGGATCAGTTGGCCGAAATCAGTTACCGTTTTCAAGGTAAGAAGGAAGCGGACCAACCGTGGATTGTTGTAAACACGAGCACACTGTTTGATGAACTCGAATTAGACCCCCCCGAGATTGAACCGGGTGTCTTGAAAGTACTTCGGACAGAAAAACAATACTTGGGTGTGTACATTTGGAACAT GCGCGGCTCCGATGGTACGTCTACCTACGCCACGTTTTTGGTCACCTGGAAAGGGGATGAAAAAACAAGAAACCCTACGCCCGCAGTAACTCCTCAACCAAGAGGGGCTGAGTTTCATATGTGGAATTACCACTCGCATGTATTTTCAGTTGGTGATACGTTTAGCTTGGCAATGCATCTTCAGTATAAGATACATGAAGCGCCATTTGATTTGCTGTTAGAGTGGTTGTATGTCCCCATCGATCCTACATGTCAACCAATGCGGTTATATTCTACGTGTTTGTATCATCCCAACGCACCCCAATGCCTCTCTCATATGAATTCCGGTTGTAC TTTACCTCGCCACATTTAGCCCAGCGTGTTGCAAGCACAGTGTATCAAAATTGTGAACATGCAGATAACTACACCGCATATTGTCTGGGAATATCTCATATGGAGCCTAGCTTTGGTCTAATCTTACACGACGGGGGCACCACGTTAAAGTTTGTAGATACACCCGAGAGTTTGTCGGGATTATACGTTTTTGTGGTGTATTTTAACGGGCATGTTGAAGCCGTAGCATACACTGTTGTATCCACAGTAGATCATTTTGTAAACGCAATTGAAGAGCGTGGATTTCCGCCAACGGCCGGTCAGCCACCGGCGACTACTAAACCCAAGGAAAT ACCCCCGTAAACCCCGGAACGTCACCACTTCTACGATATGCCGCATGGACCGGAGGGCTTGCAGCAGTAGTACTTTTATGTCTCGTAATATTTTTAATCTGTACGGCTAAACGAATGAGGGTTAAAGCCGCCAGGGTAGACAAGTGATGATAATAGGCTGGAGCCTCGGTGGCCATGCTTCTTGCCCCTTGGGCCTCCCCCCAGCCCCTCCTCCCCTTCCTGCACCCGTACCCCCGTGGTCTTTGAATAAAGTCTGAGTGGGCGGC (SEQ ID NO: 6)
VZV-GE-deletion 574-Y569A (mRNA)
UCAAGCUUUUGGACCCUCGUACAGAAGCUAAUACGACUCACUAUAGGGAAAUAAGAGAGAAAAGAAGAGUAAGAAGAAAUAUAAGAGCCACCAUGGGGACAGUUAAUAAACCUGUGGUGGGGGUAUUGAUGGGGUUCGGAAUUAUCACGGGAACGUUGCGUAUAACGAAUCCGGUCAGAGCAUCCGUCUUGCGAUACGAUGAUUUUCACAUCGAUGAAGACAAACUGGAUACAAACUCCGUAUAUGAGCCUUACUACCAUUCAGAUCAUGCGGAGUCUUCAUGGGUAAAUCGGGGAGAGUCUUCGCGAAAAGCGUACGAUCAUAACUCACCUU UAUAUGGCCACGUAAUGAUUAUGAUGGAUUUUUAGAGAACGCACACGAACACCAUGGGGUGUAUAAUCAGGGCCGUGGUAUCGAUAGCGGGGAACGGUUAAUGCAACCCACACAAAUGUCUGCACAGGAGGAUCUUGGGGACGAUACGGGCAUCCACGUUAUCCCUACGUUAAACGGCGAUGACAGACAUAAAAUUGUAAAUGUGGACCAACGUCAAUACGGUGACGUGUUUAAAGGAGAUCUUAAUCCAAAACCCCAAGGCCAAAGACUCAUUGAGGUGUCAGUGGAAGAAAAUCACCCGUUUACUUUACGCGCACCGAUUCAGCGGAUUU UGGAGUCCGGUACACCGAGACUUGGAGCUUUUUGCCGUCAUUAACCUGUACGGGAGACGCAGCGCCCGCCAUCCAGCAUAUAUGUUUAAAACAUACAACAUGCUUUCAAGACGUGGUGGUGGAUGUGGAUUGCGCGGAAAAUACUAAAGAGGAUCAGUUGGCCGAAAUCAGUUACCGUUUUCAAGGUAAGAAGGAAGCGGACCAACCGUGGAUUGUUGUAAACACGAGCACACUGUUUGAUGAACUCGAAUUAGACCCCCCCGAGAUUGAACCGGGUGUCUUGAAAGUACUUCGGACAGAAAAACAAUACUUGGGUGUGUACAUUUGGAACAU GCGCGGCUCCGAUGGUACGUCUACCUACGCCACGUUUUUGGUCACCUGGAAAGGGGAUGAAAAAACAAGAAACCCUACGCCCGCAGUAACUCCUCAACCAAGAGGGGCUGAGUUUCAUAUGUGGAAUUACCACUCGCAUGUAUUUUCAGUUGGUGAUACGUUUAGCUUGGCAAUGCAUCUUCAGUAUAAGAUACAUGAAGCGCCAUUUGAUUUGCUGUUAGAGUGGUUGUAUGUCCCCAUCGAUCCUACAUGUCAACCAAUGCGGUUAUAUUCUACGUGUUUGUAUCAUCCCAACGCACCCCAAUGCCUCUCUCAUAUGAAUUCCGGUUGUAC UUUACCUCGCCACAUUUAGCCCAGCGUGUUGCAAGCACAGUGUAUCAAAAUUGUGAACAUGCAGAUAACUACACCGCAUAUUGUCUGGGAAUAUCUCAUAUGGAGCCUAGCUUUGGUCUAAUCUUACACGACGGGGGCACCACGUUAAAGUUUGUAGAUACACCCGAGAGUUUGUCGGGAUUAUACGUUUUUGUGGUGUAUUUUAACGGGCAUGUUGAAGCCGUAGCAUACACUGUUGUAUCCACAGUAGAUCAUUUUGUAAACGCAAUUGAAGAGCGUGGAUUUCCGCCAACGGCCGGUCAGCCACCGGCGACUACUAAACCCAAGGAAAU ACCCCCGUAAACCCCGGAACGUCACCACUUCUACGAUAUGCCGCAUGGACCGGAGGGCUUGCAGCAGUAGUACUUUUAUGUCUCGUAAUAUUUUUAAUCUGUACGGCUAAACGAAUGAGGGUUAAAGCCGCCAGGGUAGACAAGUGAUGAUAAUAGGCUGGAGCCUCGGUGGCCAUGCUUCUUGCCCCUUGGGCCUCCCCCCAGCCCCUCCUCCCCUUCCUGCACCCGUACCCCCGUGGUCUUUGAAUAAAGUCUGAGUGGGCGGC (SEQ ID NO: 128)
VZV-gE-full length-AEAADA (SEQ ID NO: 58)
TCAAGCTTTTGGACCCTCGTACAGAAGCTAATACGACTCACTATAGGGAAATAAGAGAGAAAAGAAGAGTAAGAAGAAATATAAGAGCCACCATGGGGACAGTTAATAAACCTGTGGTGGGGGTATTGATGGGGTTCGGAATTATCACGGGAACGTTGCGTATAACGAATCCGGTCAGAGCATCCGTCTTGCGATACGATGATTTTCACATCGATGAAGACAAACTGGATACAAACTCCGTATATGAGCCTTACTACCATTCAGATCATGCGGAGTCTTCATGGGTAAATCGGGGAGAGTCTTCGCGAAAAGCGTACGATCATAACTCACCTT TATATGGCCACGTAATGATTATGATGGATTTTTAGAGAACGCACACGAACACCATGGGGTGTATAATCAGGGCCGTGGTATCGATAGCGGGGAACGGTTAATGCAACCCACACAAATGTCTGCACAGGAGGATCTTGGGGACGATACGGGCATCCACGTTATCCCTACGTTAAACGGCGATGACAGACATAAAATTGTAAATGTGGACCAACGTCAATACGGTGACGTGTTTAAAGGAGATCTTAATCCAAAACCCCAAGGCCAAAGACTCATTGAGGTGTCAGTGGAAGAAAATCACCCGTTTACTTTACGCGCACCGATTCAGCGGATTT TGGAGTCCGGTACACCGAGACTTGGAGCTTTTTGCCGTCATTAACCTGTACGGGAGACGCAGCGCCCGCCATCCAGCATATATGTTTAAAACATACAACATGCTTTCAAGACGTGGTGGTGGATGTGGATTGCGCGGAAAATACTAAAGAGGATCAGTTGGCCGAAATCAGTTACCGTTTTCAAGGTAAGAAGGAAGCGGACCAACCGTGGATTGTTGTAAACACGAGCACACTGTTTGATGAACTCGAATTAGACCCCCCCGAGATTGAACCGGGTGTCTTGAAAGTACTTCGGACAGAAAAACAATACTTGGGTGTGTACATTTGGAACAT GCGCGGCTCCGATGGTACGTCTACCTACGCCACGTTTTTGGTCACCTGGAAAGGGGATGAAAAAACAAGAAACCCTACGCCCGCAGTAACTCCTCAACCAAGAGGGGCTGAGTTTCATATGTGGAATTACCACTCGCATGTATTTTCAGTTGGTGATACGTTTAGCTTGGCAATGCATCTTCAGTATAAGATACATGAAGCGCCATTTGATTTGCTGTTAGAGTGGTTGTATGTCCCCATCGATCCTACATGTCAACCAATGCGGTTATATTCTACGTGTTTGTATCATCCCAACGCACCCCAATGCCTCTCTCATATGAATTCCGGTTGTAC TTTACCTCGCCACATTTAGCCCAGCGTGTTGCAAGCACAGTGTATCAAAATTGTGAACATGCAGATAACTACACCGCATATTGTCTGGGAATATCTCATATGGAGCCTAGCTTTGGTCTAATCTTACACGACGGGGGCACCACGTTAAAGTTTGTAGATACACCCGAGAGTTTGTCGGGATTATACGTTTTTGTGGTGTATTTTAACGGGCATGTTGAAGCCGTAGCATACACTGTTGTATCCACAGTAGATCATTTTGTAAACGCAATTGAAGAGCGTGGATTTCCGCCAACGGCCGGTCAGCCACCGGCGACTACTAAACCCAAGGAAAT ACCCCCGTAAACCCCGGAACGTCACCACTTCTACGATATGCCGCATGGACCGGAGGGCTTGCAGCAGTAGTACTTTTATGTCTCGTAATATTTTTAATCTGTACGGCTAAACGAATGAGGGTTAAAGCCTATAGGGTAGACAAGTCCCCGTATAACCAAAGCATGTATTACGCTGGCCTTCCAGTGGACGATTTCGAGGACGCCGAAGCCGCCGATGCCGAAGAAGAGTTTGGTAACGCGATTGGAGGGAGTCACGGGGGTTCGAGTTACACGGTGTATATAGATAAGACCCGGTGATGATAATAGGCTGGAGCCTCGGTGGCCATGCTTCTT GCCCCTTGGGCCTCCCCCCCAGCCCCCTCCTCCCCTTCCTGCACCCGTACCCCCGTGGTCTTTTGAATAAAGTCCTGAGTGGGCGGC (SEQ ID NO: 7)
VZV-gE-full length-AEAADA (SEQ ID NO: 58) (mRNA)
UCAAGCUUUUGGACCCUCGUACAGAAGCUAAUACGACUCACUAUAGGGAAAUAAGAGAGAAAAGAAGAGUAAGAAGAAAUAUAAGAGCCACCAUGGGGACAGUUAAUAAACCUGUGGUGGGGGUAUUGAUGGGGUUCGGAAUUAUCACGGGAACGUUGCGUAUAACGAAUCCGGUCAGAGCAUCCGUCUUGCGAUACGAUGAUUUUCACAUCGAUGAAGACAAACUGGAUACAAACUCCGUAUAUGAGCCUUACUACCAUUCAGAUCAUGCGGAGUCUUCAUGGGUAAAUCGGGGAGAGUCUUCGCGAAAAGCGUACGAUCAUAACUCACCUU UAUAUGGCCACGUAAUGAUUAUGAUGGAUUUUUAGAGAACGCACACGAACACCAUGGGGUGUAUAAUCAGGGCCGUGGUAUCGAUAGCGGGGAACGGUUAAUGCAACCCACACAAAUGUCUGCACAGGAGGAUCUUGGGGACGAUACGGGCAUCCACGUUAUCCCUACGUUAAACGGCGAUGACAGACAUAAAAUUGUAAAUGUGGACCAACGUCAAUACGGUGACGUGUUUAAAGGAGAUCUUAAUCCAAAACCCCAAGGCCAAAGACUCAUUGAGGUGUCAGUGGAAGAAAAUCACCCGUUUACUUUACGCGCACCGAUUCAGCGGAUUU UGGAGUCCGGUACACCGAGACUUGGAGCUUUUUGCCGUCAUUAACCUGUACGGGAGACGCAGCGCCCGCCAUCCAGCAUAUAUGUUUAAAACAUACAACAUGCUUUCAAGACGUGGUGGUGGAUGUGGAUUGCGCGGAAAAUACUAAAGAGGAUCAGUUGGCCGAAAUCAGUUACCGUUUUCAAGGUAAGAAGGAAGCGGACCAACCGUGGAUUGUUGUAAACACGAGCACACUGUUUGAUGAACUCGAAUUAGACCCCCCCGAGAUUGAACCGGGUGUCUUGAAAGUACUUCGGACAGAAAAACAAUACUUGGGUGUGUACAUUUGGAACAU GCGCGGCUCCGAUGGUACGUCUACCUACGCCACGUUUUUGGUCACCUGGAAAGGGGAUGAAAAAACAAGAAACCCUACGCCCGCAGUAACUCCUCAACCAAGAGGGGCUGAGUUUCAUAUGUGGAAUUACCACUCGCAUGUAUUUUCAGUUGGUGAUACGUUUAGCUUGGCAAUGCAUCUUCAGUAUAAGAUACAUGAAGCGCCAUUUGAUUUGCUGUUAGAGUGGUUGUAUGUCCCCAUCGAUCCUACAUGUCAACCAAUGCGGUUAUAUUCUACGUGUUUGUAUCAUCCCAACGCACCCCAAUGCCUCUCUCAUAUGAAUUCCGGUUGUAC UUUACCUCGCCACAUUUAGCCCAGCGUGUUGCAAGCACAGUGUAUCAAAAUUGUGAACAUGCAGAUAACUACACCGCAUAUUGUCUGGGAAUAUCUCAUAUGGAGCCUAGCUUUGGUCUAAUCUUACACGACGGGGGCACCACGUUAAAGUUUGUAGAUACACCCGAGAGUUUGUCGGGAUUAUACGUUUUUGUGGUGUAUUUUAACGGGCAUGUUGAAGCCGUAGCAUACACUGUUGUAUCCACAGUAGAUCAUUUUGUAAACGCAAUUGAAGAGCGUGGAUUUCCGCCAACGGCCGGUCAGCCACCGGCGACUACUAAACCCAAGGAAAU ACCCCCGUAAACCCCGGAACGUCACCACUUCUACGAUAUGCCGCAUGGACCGGAGGGCUUGCAGCAGUAGUACUUUUAUGUCUCGUAAUAUUUUUAAUCUGUACGGCUAAACGAAUGAGGGUUAAAGCCUAUAGGGUAGACAAGUCCCCGUAUAACCAAAGCAUGUAUUACGCUGGCCUUCCAGUGGACGAUUUCGAGGACGCCGAAGCCGCCGAUGCCGAAGAAGAGUUUGGUAACGCGAUUGGAGGGAGUCACGGGGGUUCGAGUUACACGGUGUAUAUAGAUAAGACCCGGUGAUGAUAAUAGGCUGGAGCCUCGGUGGCCAUGCUUCUU GCCCCUUGGGCCUCCCCCCCAGCCCCUCCCCCCCUCUCGUCACCCCGUACCCCCCGUGGUCUUGAAUAAAGUCUGAGUGGGCGGC (SEQ ID NO: 129)
VZV-GE-complete-AEAADA (SEQ ID NO: 58) -Y582G
TCAAGCTTTTGGACCCTCGTACAGAAGCTAATACGACTCACTATAGGGAAATAAGAGAGAAAAGAAGAGTAAGAAGAAATATAAGAGCCACCATGGGGACAGTTAATAAACCTGTGGTGGGGGTATTGATGGGGTTCGGAATTATCACGGGAACGTTGCGTATAACGAATCCGGTCAGAGCATCCGTCTTGCGATACGATGATTTTCACATCGATGAAGACAAACTGGATACAAACTCCGTATATGAGCCTTACTACCATTCAGATCATGCGGAGTCTTCATGGGTAAATCGGGGAGAGTCTTCGCGAAAAGCGTACGATCATAACTCACCTT TATATGGCCACGTAATGATTATGATGGATTTTTAGAGAACGCACACGAACACCATGGGGTGTATAATCAGGGCCGTGGTATCGATAGCGGGGAACGGTTAATGCAACCCACACAAATGTCTGCACAGGAGGATCTTGGGGACGATACGGGCATCCACGTTATCCCTACGTTAAACGGCGATGACAGACATAAAATTGTAAATGTGGACCAACGTCAATACGGTGACGTGTTTAAAGGAGATCTTAATCCAAAACCCCAAGGCCAAAGACTCATTGAGGTGTCAGTGGAAGAAAATCACCCGTTTACTTTACGCGCACCGATTCAGCGGATTT TGGAGTCCGGTACACCGAGACTTGGAGCTTTTTGCCGTCATTAACCTGTACGGGAGACGCAGCGCCCGCCATCCAGCATATATGTTTAAAACATACAACATGCTTTCAAGACGTGGTGGTGGATGTGGATTGCGCGGAAAATACTAAAGAGGATCAGTTGGCCGAAATCAGTTACCGTTTTCAAGGTAAGAAGGAAGCGGACCAACCGTGGATTGTTGTAAACACGAGCACACTGTTTGATGAACTCGAATTAGACCCCCCCGAGATTGAACCGGGTGTCTTGAAAGTACTTCGGACAGAAAAACAATACTTGGGTGTGTACATTTGGAACAT GCGCGGCTCCGATGGTACGTCTACCTACGCCACGTTTTTGGTCACCTGGAAAGGGGATGAAAAAACAAGAAACCCTACGCCCGCAGTAACTCCTCAACCAAGAGGGGCTGAGTTTCATATGTGGAATTACCACTCGCATGTATTTTCAGTTGGTGATACGTTTAGCTTGGCAATGCATCTTCAGTATAAGATACATGAAGCGCCATTTGATTTGCTGTTAGAGTGGTTGTATGTCCCCATCGATCCTACATGTCAACCAATGCGGTTATATTCTACGTGTTTGTATCATCCCAACGCACCCCAATGCCTCTCTCATATGAATTCCGGTTGTAC TTTACCTCGCCACATTTAGCCCAGCGTGTTGCAAGCACAGTGTATCAAAATTGTGAACATGCAGATAACTACACCGCATATTGTCTGGGAATATCTCATATGGAGCCTAGCTTTGGTCTAATCTTACACGACGGGGGCACCACGTTAAAGTTTGTAGATACACCCGAGAGTTTGTCGGGATTATACGTTTTTGTGGTGTATTTTAACGGGCATGTTGAAGCCGTAGCATACACTGTTGTATCCACAGTAGATCATTTTGTAAACGCAATTGAAGAGCGTGGATTTCCGCCAACGGCCGGTCAGCCACCGGCGACTACTAAACCCAAGGAAAT ACCCCCGTAAACCCCGGAACGTCACCACTTCTACGATATGCCGCATGGACCGGAGGGCTTGCAGCAGTAGTACTTTTATGTCTCGTAATATTTTTAATCTGTACGGCTAAACGAATGAGGGTTAAAGCCTATAGGGTAGACAAGTCCCCGTATAACCAAAGCATGTATGGCGCTGGCCTTCCAGTGGACGATTTCGAGGACGCCGAAGCCGCCGATGCCGAAGAAGAGTTTGGTAACGCGATTGGAGGGAGTCACGGGGGTTCGAGTTACACGGTGTATATAGATAAGACCCGGTGATGATAATAGGCTGGAGCCTCGGTGGCCATGCTTCTT GCCCCTTGGGCCTCCCCCCCAGCCCCCTCCTCCCCTTCCTGCACCCGTACCCCCGTGGTCTTTTGAATAAAGTCCTGAGTGGGCGGC (SEQ ID NO: 8)
VZV-GE-complete-AEAADA (SEQ ID NO: 58) -Y582G (mRNA)
UCAAGCUUUUGGACCCUCGUACAGAAGCUAAUACGACUCACUAUAGGGAAAUAAGAGAGAAAAGAAGAGUAAGAAGAAAUAUAAGAGCCACCAUGGGGACAGUUAAUAAACCUGUGGUGGGGGUAUUGAUGGGGUUCGGAAUUAUCACGGGAACGUUGCGUAUAACGAAUCCGGUCAGAGCAUCCGUCUUGCGAUACGAUGAUUUUCACAUCGAUGAAGACAAACUGGAUACAAACUCCGUAUAUGAGCCUUACUACCAUUCAGAUCAUGCGGAGUCUUCAUGGGUAAAUCGGGGAGAGUCUUCGCGAAAAGCGUACGAUCAUAACUCACCUU UAUAUGGCCACGUAAUGAUUAUGAUGGAUUUUUAGAGAACGCACACGAACACCAUGGGGUGUAUAAUCAGGGCCGUGGUAUCGAUAGCGGGGAACGGUUAAUGCAACCCACACAAAUGUCUGCACAGGAGGAUCUUGGGGACGAUACGGGCAUCCACGUUAUCCCUACGUUAAACGGCGAUGACAGACAUAAAAUUGUAAAUGUGGACCAACGUCAAUACGGUGACGUGUUUAAAGGAGAUCUUAAUCCAAAACCCCAAGGCCAAAGACUCAUUGAGGUGUCAGUGGAAGAAAAUCACCCGUUUACUUUACGCGCACCGAUUCAGCGGAUUU UGGAGUCCGGUACACCGAGACUUGGAGCUUUUUGCCGUCAUUAACCUGUACGGGAGACGCAGCGCCCGCCAUCCAGCAUAUAUGUUUAAAACAUACAACAUGCUUUCAAGACGUGGUGGUGGAUGUGGAUUGCGCGGAAAAUACUAAAGAGGAUCAGUUGGCCGAAAUCAGUUACCGUUUUCAAGGUAAGAAGGAAGCGGACCAACCGUGGAUUGUUGUAAACACGAGCACACUGUUUGAUGAACUCGAAUUAGACCCCCCCGAGAUUGAACCGGGUGUCUUGAAAGUACUUCGGACAGAAAAACAAUACUUGGGUGUGUACAUUUGGAACAU GCGCGGCUCCGAUGGUACGUCUACCUACGCCACGUUUUUGGUCACCUGGAAAGGGGAUGAAAAAACAAGAAACCCUACGCCCGCAGUAACUCCUCAACCAAGAGGGGCUGAGUUUCAUAUGUGGAAUUACCACUCGCAUGUAUUUUCAGUUGGUGAUACGUUUAGCUUGGCAAUGCAUCUUCAGUAUAAGAUACAUGAAGCGCCAUUUGAUUUGCUGUUAGAGUGGUUGUAUGUCCCCAUCGAUCCUACAUGUCAACCAAUGCGGUUAUAUUCUACGUGUUUGUAUCAUCCCAACGCACCCCAAUGCCUCUCUCAUAUGAAUUCCGGUUGUAC UUUACCUCGCCACAUUUAGCCCAGCGUGUUGCAAGCACAGUGUAUCAAAAUUGUGAACAUGCAGAUAACUACACCGCAUAUUGUCUGGGAAUAUCUCAUAUGGAGCCUAGCUUUGGUCUAAUCUUACACGACGGGGGCACCACGUUAAAGUUUGUAGAUACACCCGAGAGUUUGUCGGGAUUAUACGUUUUUGUGGUGUAUUUUAACGGGCAUGUUGAAGCCGUAGCAUACACUGUUGUAUCCACAGUAGAUCAUUUUGUAAACGCAAUUGAAGAGCGUGGAUUUCCGCCAACGGCCGGUCAGCCACCGGCGACUACUAAACCCAAGGAAAU ACCCCCGUAAACCCCGGAACGUCACCACUUCUACGAUAUGCCGCAUGGACCGGAGGGCUUGCAGCAGUAGUACUUUUAUGUCUCGUAAUAUUUUUAAUCUGUACGGCUAAACGAAUGAGGGUUAAAGCCUAUAGGGUAGACAAGUCCCCGUAUAACCAAAGCAUGUAUGGCGCUGGCCUUCCAGUGGACGAUUUCGAGGACGCCGAAGCCGCCGAUGCCGAAGAAGAGUUUGGUAACGCGAUUGGAGGGAGUCACGGGGGUUCGAGUUACACGGUGUAUAUAGAUAAGACCCGGUGAUGAUAAUAGGCUGGAGCCUCGGUGGCCAUGCUUCUU GCCCCUUGGGCCUCCCCCCCAGCCCCUCCCCCCCUCUCGUCACCCCGUACCCCCCGUGGUCUUGAAUAAAGUCUGAGUGGGCGGC (SEQ ID NO: 130)
VZV_gE_Oka_hIgκ
TCAAGCTTTTGGACCCTCGTACAGAAGCTAATACGACTCACTATAGGGAAATAAGAGAGAAAAGAAGAGTAAGAAGAAATATAAGAGCCACCATGGAGACTCCCGCTCAGCTACTGTTCCTCCTGCTCCTTTGGCTGCCTGATACTACAGGCTCTGTTTTGCGGTACGACGACTTTCACATCGATGAGGACAAGCTCGACACTAATAGCGTGTATGAGCCCTACTACCATTCAGATCACGCCGAGTCCTCTTGGGTGAACAGGGGTGAAAGTTCTAGGAAAGCCTATGATCACAACAGCCCTTATATTTGGCCACGGAATGATTACGACGGAT TCTCGAAAATGCCCACGAGCATCACGGAGTGTACAACCAGGGCCGTGGAATCGACTCTGGGGAGAGATTGATGCAACCTACACAGATGAGCGCCCAGGAAGATCTCGGGGATGATACAGGAATTCACGTTATCCCTACATTAAACGGAGATGACCGCCACAAAATCGTCAATGTCGATCAAAGACAGTATGGAGATGTGTTCAAAGGCGATCTCAACCCTAAGCCGCAGGGCCAGAGACTCATTGAGGTGTCTGTCGAAGAGAACCACCCTTTCACTCTGCGCGCTCCCATTCAGAGAATCTATGGAGTTCGCTATACGGAGACTTGGTCAT CCTTCCTTCCCTGACATGCACCGGAGACGCCGCCCCTGCCATTCAGCACATATGCCTGAAACATACCACCTGTTTCCAGGATGTGGTGGTTGATGTTGATTGTGCTGAAAATACCAAGGAAGACCAACTGGCCGAGATTAGTTACCGGTTCCAAGGGAAAAAGGAAGCCGACCAGCCATGGATTGTGGTTAATACAAGCACTCTGTTCGATGAGCTCGAGCTGGATCCCCCCGAGATAGAACCCGGAGTTCTGAAAGTGCTCCGGACAGAAAAACAATATCTGGGAGTCTACATATGGAACATGCGCGGTTCCGATGGGACCTCCACTTATGC AACCTTTCTCGTCACGTGGAAGGGAGATGAGAAAACTAGGAATCCCACACCCGCTGTCACACCACAGCCAAGAGGGGCTGAGTTCCATATGTGGAACTATCATAGTCACGTGTTTAGTGTCGGAGATACGTTTTCATTGGCTATGCATCTCCAGTACAAGATTCATGAGGCTCCCTTCGATCTGTTGCTTGAGTGGTTGTACGTCCCGATTGACCCGACCTGCCAGCCCATGCGACTGTACAGCACCTGTCTCTACCATCCAAACGCTCCGCAATGTCTGAGCCACATGAACTCTGGGTGTACTTTCACCAGTCCCCACCTCGCCCAGCGGGT GCCTCTACTGTTTACCAGAACTGTGAGCACGCCGACAACTACACCGCATACTGCCTCGGTATTTCTCACATGGAACCCTCCTTCGGACTCATCCTGCACGATGGGGGCACTACCCTGAAGTTCGTTGATACGCCAGAATCTCTGTCTGGGCTCTATGTTTTCGTGGTCTACTTCAATGGCCATGTCGAGGCCGTGGCCTATACTGTCGTTTCTACCGTGGATCATTTTGTGAACGCCATCGAAGAACGGGGATTCCCCCCTACGGCAGGCCAGCCGCCTGCAACCACCAAGCCCAAGGAAATAACACCAGTGAACCCTGGCACCTCACCTCT CTAAGATATGCCGCGTGGACAGGGGGACTGGCGGCAGTGGTGCTCCTCTGTCTCGTGATCTTTCTGATCTGTACAGCCAAGAGGATGAGGGTCAAGGCTTATAGAGTGGACAAGTCCCCCTACAATCAGTCAATGTACTACGCCGGCCTTCCCGTTGATGATTTTGAGGATTCCGAGTCCACAGATACTGAGGAAGAGTTCGGTAACGCTATAGGCGGCTCTCACGGGGGTTCAAGCTACACGGTTTACATTGACAAGACACGCTGATAATAGGCTGGAGCCTCGGTGGCCATGCTTCTTGCCCCTTGGGCCTCCCCCCAGCCCCTCCTCCCC TTCCTGCACCCGTACCCCCGTGGTCTTTGAATAAAAGTCTGAGTGGGCGGC (SEQ ID NO: 41)
VZV_gE_Oka_hIgκ (mRNA)
UCAAGCUUUUGGACCCUCGUACAGAAGCUAAUACGACUCACUAUAGGGAAAUAAGAGAGAAAAGAAGAGUAAGAAGAAAUAUAAGAGCCACCAUGGAGACUCCCGCUCAGCUACUGUUCCUCCUGCUCCUUUGGCUGCCUGAUACUACAGGCUCUGUUUUGCGGUACGACGACUUUCACAUCGAUGAGGACAAGCUCGACACUAAUAGCGUGUAUGAGCCCUACUACCAUUCAGAUCACGCCGAGUCCUCUUGGGUGAACAGGGGUGAAAGUUCUAGGAAAGCCUAUGAUCACAACAGCCCUUAUAUUUGGCCACGGAAUGAUUACGACGGAU UCUCGAAAAUGCCCACGAGCAUCACGGAGUGUACAACCAGGGCCGUGGAAUCGACUCUGGGGAGAGAUUGAUGCAACCUACACAGAUGAGCGCCCAGGAAGAUCUCGGGGAUGAUACAGGAAUUCACGUUAUCCCUACAUUAAACGGAGAUGACCGCCACAAAAUCGUCAAUGUCGAUCAAAGACAGUAUGGAGAUGUGUUCAAAGGCGAUCUCAACCCUAAGCCGCAGGGCCAGAGACUCAUUGAGGUGUCUGUCGAAGAGAACCACCCUUUCACUCUGCGCGCUCCCAUUCAGAGAAUCUAUGGAGUUCGCUAUACGGAGACUUGGUCAU CCUUCCUUCCCUGACAUGCACCGGAGACGCCGCCCCUGCCAUUCAGCACAUAUGCCUGAAACAUACCACCUGUUUCCAGGAUGUGGUGGUUGAUGUUGAUUGUGCUGAAAAUACCAAGGAAGACCAACUGGCCGAGAUUAGUUACCGGUUCCAAGGGAAAAAGGAAGCCGACCAGCCAUGGAUUGUGGUUAAUACAAGCACUCUGUUCGAUGAGCUCGAGCUGGAUCCCCCCGAGAUAGAACCCGGAGUUCUGAAAGUGCUCCGGACAGAAAAACAAUAUCUGGGAGUCUACAUAUGGAACAUGCGCGGUUCCGAUGGGACCUCCACUUAUGC AACCUUUCUCGUCACGUGGAAGGGAGAUGAGAAAACUAGGAAUCCCACACCCGCUGUCACACCACAGCCAAGAGGGGCUGAGUUCCAUAUGUGGAACUAUCAUAGUCACGUGUUUAGUGUCGGAGAUACGUUUUCAUUGGCUAUGCAUCUCCAGUACAAGAUUCAUGAGGCUCCCUUCGAUCUGUUGCUUGAGUGGUUGUACGUCCCGAUUGACCCGACCUGCCAGCCCAUGCGACUGUACAGCACCUGUCUCUACCAUCCAAACGCUCCGCAAUGUCUGAGCCACAUGAACUCUGGGUGUACUUUCACCAGUCCCCACCUCGCCCAGCGGGU GCCUCUACUGUUUACCAGAACUGUGAGCACGCCGACAACUACACCGCAUACUGCCUCGGUAUUUCUCACAUGGAACCCUCCUUCGGACUCAUCCUGCACGAUGGGGGCACUACCCUGAAGUUCGUUGAUACGCCAGAAUCUCUGUCUGGGCUCUAUGUUUUCGUGGUCUACUUCAAUGGCCAUGUCGAGGCCGUGGCCUAUACUGUCGUUUCUACCGUGGAUCAUUUUGUGAACGCCAUCGAAGAACGGGGAUUCCCCCCUACGGCAGGCCAGCCGCCUGCAACCACCAAGCCCAAGGAAAUAACACCAGUGAACCCUGGCACCUCACCUCU CUAAGAUAUGCCGCGUGGACAGGGGGACUGGCGGCAGUGGUGCUCCUCUGUCUCGUGAUCUUUCUGAUCUGUACAGCCAAGAGGAUGAGGGUCAAGGCUUAUAGAGUGGACAAGUCCCCCUACAAUCAGUCAAUGUACUACGCCGGCCUUCCCGUUGAUGAUUUUGAGGAUUCCGAGUCCACAGAUACUGAGGAAGAGUUCGGUAACGCUAUAGGCGGCUCUCACGGGGGUUCAAGCUACACGGUUUACAUUGACAAGACACGCUGAUAAUAGGCUGGAGCCUCGGUGGCCAUGCUUCUUGCCCCUUGGGCCUCCCCCCAGCCCCUCCUCCCC UUCCUGCACCCCGUACCCCCCGUGGUCUUGAAAUAAAGUCUGAGUGGGCGGC (SEQ ID NO: 131)
G ^* Represents a 5 ′ end cap, for example 7 mG (5 ′) ppp (5 ′) NlpNp.

Example 14: Distribution of variant gE antigens in Vero and Mewo cells The expression and transport of VZV gE antigens with various C-terminal variants was investigated in Vero and Mewo cells.

Vero cells are a cell line used in cell culture. The “Vero” line is isolated from kidney epithelial cells taken from African green monkeys. MeWo cells are human malignant melanoma cells that are susceptible to VZV infection. Vero cells or Mewo cells were transfected with the constructs shown in Table 3 below. Transfected cells were stained with antibodies to gE and Golgi markers GM130 and Golgin. The stained cells were visualized using a confocal microscope. The results for each construct are listed in Table 3 ("Cell localization" column). FIG. 9 shows an exemplary experiment and shows the results of the following transfection constructs. (1) VZV gE mRNA encoding a VZV gE polypeptide having a 62 amino acid deletion at the C-terminus (encoded by SEQ ID NO: 3), (2) encoding a VZV gE polypeptide having an AEAADA sequence (SEQ ID NO: 58) Full length VZV gE mRNA (encoded by SEQ ID NO: 7), or (3) PBS (negative control). Using an anti-gE antibody, it can be seen from FIG. 9 that the truncated VZV gE polypeptide (with a 62 amino acid C-terminal deletion) localizes to the perinuclear location and organelle. A full-length VZV gE polypeptide having the AEAADA sequence (SEQ ID NO: 58) was localized to the Golgi and perinuclear positions. Importantly, some of the constructs, such as deletion from gE-truncated-574_Y569A, gE full length including AEAADA (SEQ ID NO: 58), gE full length including AEAADA (SEQ ID NO: 58) and Y582C mutations , A deletion from gE-truncated-574, and a deletion from gE-truncated-574 containing the Y569A mutation, each encoding a polypeptide that is localized to the cell membrane. Have been shown to have increased antigenicity.

Example 15: Immunization of BALB / C mice with VZV gE antigen encoded by mRNA formulated in MC3 is a candidate vaccine that achieves immunization in BALB / C mice after intramuscular or intradermal administration. As an initial evaluation of the action of mRNA encoding VZV antigen formulated with MC3, an immunization test was performed.

Candidate vaccines were as follows.
(1) 5 ′ cap: MC7 formulated VZVgE-hIgκ mRNA with m7G (5 ′) ppp (5 ′) G-2′-O-methyl, N1-methyl pseudouridine chemical modification and additional hIgκ sequence
(2) 5 'cap: MC7 formulated VZV gE mRNA with m7G (5') ppp (5 ') G-2'-O-methyl and N1-methyl pseudouridine chemical modifications
(3) 5 ′ cap: MC3 formulated VZV gE mRNA with m7G (5 ′) ppp (5 ′) G-2′-O-methyl and no chemical modification.

  All of the VZV gE mRNA was the Oka strain.

  BALB / C mice were given 10 μg dose or 10 μg dose twice (day 28) MC3 formulated VZV gE mRNA (either vaccine (1), (2) or (3) above) intramuscularly or Administered either intradermally. G5 refers to mRNA with N1-methyl pseudouridine chemical modification. G0 refers to unmodified mRNA. Cap 1 refers to the 5 'cap: m7G (5') ppp (5 ') G-2'-O-methyl. Each treatment group included 8 mice. The positive control was VARIVAX® vaccine and the negative control was PBS.

Blood samples were taken to determine the presence / level of serum proteins and antibodies. Western blots were performed at 6 hours to detect VZV-gE protein expression and ELISAs were performed to detect mouse IgG. A schematic diagram of a construct encoding VZV gE (Oka strain) is shown in FIG. A summary of the study design and injection schedule is shown in FIG. Table 4 shows the various time points for the collection of the various samples. Blood was collected for serum protein and antibody determination, 6 hours after administration on day 0 for groups 1-4, 13 and 14 and 6 hours after administration on day 28 for groups 2, 4 and 14. VZV protein expression was investigated. Antibody detection assays were performed on days -3, 14, 27, 42 and 56.

Example 16: Immunogenicity test: ELISA
This study was designed to test the immunogenicity in BALB / C mice of candidate VZV vaccines containing mRNA polynucleotides encoding VZV-derived glycoprotein gE. Mice were immunized with various VZV mRNA vaccine formulations at designated intervals, and serum was collected after each immunization. The immunization schedule is set forth in Table 2 of Example 15. The serum collection schedule is shown in Table 4 of Example 15.

Enzyme-linked immunosorbent assay (ELISA)
Serum antibody titers against VZV glycoprotein E were determined by enzyme linked immunosorbent assay (ELISA) using standard methods. In one study, the amount of anti-VZV gE mouse IgG was determined by pre-bleeding and (1) 5 ′ cap: m7G (5 ′) ppp (5 ′) G-2′-O-methyl and N1-methyl pseudouridine chemistry. VZV-gE-hIgκ with modification (first in Tables 2 and 3), (2) 5 ′ cap: m7G (5 ′) ppp (5 ′) G-2′-O-methyl, No VZV-gE (6th in Tables 2 and 3), (3) 5 'cap: m7G (5') ppp (5 ') G-2'-O-methyl and N1-methyl pseudouridine with chemical modification Vaccinate intramuscularly with two 10 μg doses of either VZV-gE (10th in Tables 2 and 3), (4) VARIVAX® vaccine (positive control), or (5) PBS (negative control) 14 days after vaccination and 42 It was measured in the sera collected in the eyes.

  Figures 5-7 show that the immune response with all VZV-gE encoded mRNA vaccines tested was very strong compared to the current VARIVAX (R) vaccine. FIG. 5 shows that anti-VZV-gE IgG titers on day 14 were determined as vaccine candidates (1) 5 ′ cap: m7G (5 ′) ppp (5 ′) G-2′-O-methyl and N1-methyl Serum of mice vaccinated with VZV-gE-hIgκ with chemical modification of uridine, approximately 10 μg / mL, vaccine candidate (3) VZV-gE 5 ′ cap: m7G (5 ′) ppp (5 ′) G- 2′-O-methyl and N1-methyl pseudouridine chemical modifications were shown to be about 50 μg / mL in the serum of mice vaccinated. Anti-VZV-gE IgG levels in the serum of mice vaccinated with VARIVAX® were not detected on day 14. On day 42, vaccine candidate (1) 5 ′ cap: V7V-gE-hIgκ or vaccine with chemical modification of m7G (5 ′) ppp (5 ′) G-2′-O-methyl and N1-methyl pseudouridine Candidate (3) 5 'cap: m7G (5') ppp (5 ') present in the serum of mice vaccinated with VZV-gE with chemical modification of G-2'-O-methyl and N1-methyl pseudouridine The amount of anti-VZV-gE IgG was approximately 1000 times greater than the amount of anti-VZV-gE IgG present in the serum of mice vaccinated with VARIVAX®. Vaccine candidate (2) 5 'cap: m7G (5') ppp (5 ') G-2'-O-methyl present in the serum of mice vaccinated with VZV-gE without chemical modification The amount of VZV gE IgG was almost 100 times greater than the amount of anti-VZV-gEIgG present in the serum of mice vaccinated with VARIVAX®. This study shows that each of the VZV gE mRNA vaccines tested is a more immunogenic vaccine than the current VARIVAX® VZV vaccine.

Example 17: Immunogenicity test: ELISA
This study was designed to test the immunogenicity in BALB / C mice of candidate VZV vaccines containing mRNA polynucleotides encoding VZV-derived glycoprotein gE. Mice were immunized with various VZV mRNA vaccine formulations at designated intervals, and serum was collected after each immunization. The immunization schedule is set forth in Table 4 of Example 15. The serum collection schedule is shown in Table 5 of Example 15.

  Serum antibody titers against VZV glycoprotein E were determined by enzyme linked immunosorbent assay (ELISA) using standard methods. In the second expansion test, serum samples were serially diluted so that the signal was within a range that could be detected using an ELISA. The amount of anti-VZV gE mouse IgG was measured using (1) 5 ′ cap: m7G (5 ′) ppp (5 ′) G-2′-O-methyl and VZV-gE-hIgκ with N1-methyl pseudouridine chemical modification. (No. 1 in Tables 2 and 3), (2) 5 'cap: m7G (5') ppp (5 ') G-2'-O-methyl and no chemical modification VZV-gE (Table 2 and 6 of 3), (3) 5 ′ cap: VZV-gE with m7G (5 ′) ppp (5 ′) G-2′-O-methyl and N1-methyl pseudouridine chemical modifications (Tables 2 and 3). 42) after vaccination in mice vaccinated intramuscularly with two 10 μg doses of either (4) VARIVAX® vaccine (positive control) or (5) PBS (negative control) Measured with serum collected in the eye It was. The concentration of anti-VZV-gE mouse IgG was measured by 10-fold serial dilution.

  FIG. 6 shows that the strongest immune response is VZV- with the vaccine candidate (1) 5 ′ cap: m7G (5 ′) ppp (5 ′) G-2′-O-methyl and N1-methyl pseudouridine chemical modifications. It is seen in mice vaccinated with gE-hIgκ. The second strongest response was vaccinated with vaccine candidate (3) VZV-gE 5 'cap: m7G (5') ppp (5 ') G-2'-O-methyl and N1-methyl pseudouridine chemical modifications Seen in mice. The third strongest response was the vaccine candidate (2) mice vaccinated with VZV-gE with 5 ′ cap: m7G (5 ′) ppp (5 ′) G-2′-O-methyl without chemical modification It was seen in. All three VZV gE mRNA vaccines resulted in a significantly greater immune response than the VARIVAX® vaccine.

  FIG. 7 shows the amount of anti-VZV-gE mouse IgG on days 3, 14 and 42 after vaccination present in mice vaccinated with vaccines (1)-(4) and (5) negative controls. Show.

Example 18: Immunogenicity test This test is designed to test the immunogenicity in BALB / C mice of a candidate VZV vaccine comprising an mRNA polynucleotide encoding a variant glycoprotein gE from VZV. Mice were immunized with various VZV mRNA vaccine formulations at designated intervals, and sera were collected at designated time points after each immunization. The immunization schedule is set forth in Table 6 below. The serum collection schedule is shown in Table 7 below.

  The amount of anti-VZV gE mouse IgG was measured in sera collected at the time points shown in Table 7 after vaccination in mice vaccinated intramuscularly with 10 μg dose or two 2 μg doses of the designated construct. All mRNAs used have 5 'cap: m7G (5') ppp (5 ') G-2'-O-methyl and N1-methyl pseudouridine chemical modifications. ZOSTAVAX® was used as a positive control and mice were injected twice intramuscularly at a clinical dose of 19400 pfu SC. PBS was used as a negative control.

Antibody titers against VZV gE variant polypeptides in the sera of mice immunized with the VZV gE variant mRNA vaccines shown in Table 6 were determined by enzyme-linked immunosorbent assay (ELISA). To perform the ELISA, VZV gE antigen (Abcam: ab43050) in PBS was coated to each well of the plate. 100 μl of VZV gE antigen was coated overnight at 4 ° C. using concentrations 1, 2 or 4 μg / ml. The wells were then washed 3 times with 300 μl PBST (PBS containing 0.05% tween). Wells coated with VZV gE were blocked for 30 minutes at room temperature with 200 μl blocking buffer containing 1% Blotto in PBS. Mouse serum containing anti-VZV gE antibody was diluted 1: 2000 and then subjected to serial dilutions of 1: 3 using PBST. Diluted serum was added to VZV gE coated wells and incubated for 1 hour at room temperature. Horseradish peroxidase (HRP) -conjugated rabbit anti-mouse secondary antibody (Abcam: ab6728) was diluted 1: 1000 with PBST and 100 μl of secondary antibody-containing solution was added to the wells and incubated at room temperature for 45 minutes. 100 μl of HRP substrate KPL TMB was added to the wells and incubated at room temperature for 3 minutes, and then 100 μl of reaction stop solution (2MH ₂ SO ₄ ) was added to stop the HRP reaction. The signal generated from the HRP substrate was measured at A450. The results are shown in FIGS. 11A, 11B, 12A, 12B, 13 and Tables 8 and 9.

  FIG. 11A shows that after two 10 μg doses, all gE variants induced a much stronger immune response than ZOSTAVAX®. FIG. 11B shows that after two 2 μg doses, all gE variants induced a much stronger immune response than ZOSTAVAX®. At both doses, the GE-deficient 574_Y569A and GE-deficient 562-IgκSP of the gE variant induced the strongest immune response, and the antibody titers measured in the sera of mice immunized with this gE variant were ZOSTAVAX ( > 10 times the antibody titer measured in the serum of mice immunized with (registered trademark), suggesting that GE-deleted 574_Y569A and GE-deleted 562-IgκSP mRNA are excellent vaccine candidates for VZV Is done.

  FIG. 12A shows the amount of antibody in titrated serum collected from mice immunized twice with 10 μg of the VZV gE mRNA variant described in Table 6. FIG. 12B shows the amount of antibody in titrated serum collected from mice immunized twice with 2 μg of the VZV gE mRNA variant described in Table 6. When sera were diluted more than 100 fold, antibody titers were higher in sera from VZV gE variant vaccinated mice than in ZOSTAVAX® vaccinated mice, and VZV gE mRNA variants were expressed in ZOSTAVAX (registered) in mice. It suggests that it induced a much stronger immune response than the trademark. All VZV gE mRNA variants tested showed similar ability to induce immune responses in mice.

  FIG. 13 is a graph showing the anti-VZV gE immune response induced by each VZV gE variant mRNA vaccine compared to ZOSTAVAX®. Deletion of VZV gE variant from GE-574-Y569A induced an immune response in mice that was approximately 1 log greater than ZOSTAVAX®.

Table 9 summarizes the IgG inverse titers (IC50) of sera collected from mice immunized twice with 10 μg or 2 μg of each VZV gE mRNA. Deletion from GE-574-Y569A induced a strong immune response at either 10 μg or 2 μg dose. Geometric mean titer (GMT) was used to demonstrate the immunogenic potential of the VZV gE variant mRNA vaccine. Deletion from GE-574-Y569A showed the highest GMT value, suggesting that it is most effective in inducing an immune response against VZV gE.

Example 19: In vitro neutralization assay of VZV A VZV in vitro neutralization assay was performed to evaluate anti-VZV gE antibodies in neutralizing VZV. Anti-VZV gE antibody was obtained by collecting the serum of mice administered with the VZV gE variant mRNA vaccine. Mice were administered VZV gE variant mRNA vaccine at a dose of 10 μg or 2 μg as described in Table 6, and sera were collected 2 weeks after the second immunization.

To perform the assay, mouse serum was diluted 1: 5 and then subjected to a serial dilution of 1: 2. VZV virus was added to the serum and neutralization was continued for 1 hour at room temperature. One day ago, ARPE-19 cells were seeded in 96 wells and the virus / serum mixture was added to ARPE-19 cells at 50-100 pfu / well. The next day, ARPE-19 cells were fixed and subjected to VZV specific staining. The plate was scanned and analyzed. The results of the in vitro neutralization assay for VZV are summarized in Table 10. The values in Table 10 are serum dilutions showing a 50% reduction in well coverage by VZV virus plaques. No decrease in plaque number was observed. As shown in Table 10, deletion from GE-574—one of the replicates of sera from mice immunized with a variant mRNA vaccine of Y569A is a 1:80 dilution with well coverage by VZV virus plaques. Could be reduced.

Example 20: Immunogenicity in mice Herpes zoster (HZ) or shingles is a debilitating disease characterized by a vesicular rash, the most common complication being postherpetic neuralgia (PHN). PHN is a continuous and severe pain that develops after the development on the skin is resolved and can persist for several years, thus contributing to the highly afflicted state of affected individuals. HZ is caused by the reactivation of latent varicella-zoster virus (VZV) from sensory ganglia. The immune response that occurs during VZV primary infection (chicken pox) has been shown to prevent reactivation of latent VZV. However, the incidence of HZ is strongly related to aging. Several studies have shown that T cell-mediated immune responses decrease with age and during immunosuppression, resulting in reactivation of VZV. However, anti-VZV antibody levels remain relatively stable with age, indicating that the humoral immune response may not be sufficient for the prevention of HZ. Several studies have reported the induction of VZV-specific CD4 ⁺ and CD8 ⁺ T cells, with CD4 ⁺ T cells governing the memory response.

  Approved Zostavax vaccines show about 60-70% effectiveness in adults aged 50-60 years and decline with age. In recent years, it has been shown that subunit adjuvanted vaccine (Shingrix: gE protein + ASO1B) has an efficacy of about 90% in all age groups of adults over 50 years of age. However, this vaccine showed grade 3 severe AEs in 10% of the vaccinated subjects. Shingrix showed approximately 1 log fold better T and B cell responses to Zostavax after 2 doses. In this study, the immunogenicity in mice and NHP was examined by mRNA immunization with the gE construct.

This study was designed to test the immunogenicity in BALB / C mice of candidate VZV vaccines containing mRNA polynucleotides encoding VZV-derived glycoprotein gE. Mice were immunized with various VZV mRNA vaccine formulations described in Table 11 below. In groups 1 to 5, ZOSTAVAX (registered trademark) was initially administered to reproduce the primary chickenpox exposure, and in the sixth group, VZV-gE-deficient 574_Y569A of mRNA construct was initially administered. As shown in Table 11, on the 28th day, all groups (groups 1 to 6) were additionally administered. -Blood was collected from the animals on days 3, 21, 38 and 42. Blood and spleen were collected on days 38 and 42 for serum and T cell analysis. As shown in FIG. 14A, all groups gave similar anti-gE antibody responses to mRNA vaccine administration, and animals that received the first and additional doses of mRNA tended to be higher (group 6). there were. As shown in FIG. 15A, all groups showed a CD4 T cell response, with the first dose of mRNA and the additional dose (group 6) tended to be a higher response. As shown in FIG. 15B, various CD8 T cell responses were observed, with the first and second doses of mRNA (Group 6) showing the highest CD8 T cell frequency.

Example 21: Immunogenicity in non-human primates Based on the data of Example 20, the immunogenicity of mRNA construct VZV-gE-deficient 574_Y569A was further evaluated in non-human primates. As shown in Table 12 below, rhesus monkeys 3 were given initial and additional doses of mRNA (VZV-gE-deleted 574_Y569A) or ZOSTAVAX®. Blood was collected from the animals on days 0, 14, 28 and 42 for serum and T cell analysis. T cell analysis was performed on days 0, 28 and 42. As shown in FIGS. 16A and 16B, the first and second doses of mRNA (Group 1) gave the highest anti-gE titers, followed by the first dose of ZOSTAVAX® boosted dose (Group 1). Group 2). The anti-gE titer of the latter group (Group 2) was about 10 times better than the first dose of ZOSTAVAX® / additional dose of ZOSTAVAX® (Group 3). 16C and 16D, CD4-T cells producing IFNγ, IL-2, or TNFα were detected in the ZOSTAVAX® initial administration / ZOSTAVAX® additional administration group (Group 3). There wasn't. In contrast, as shown in FIGS. 16C and 16D, in the mRNA initial administration / additional mRNA group (Group 1), CD4 T cells producing IFNγ, IL-2 or TNFα were detected with a reasonable frequency, There was no statistical difference in the ZOSTAVAX (registered trademark) initial administration / mRNA additional administration group (second group). These data indicate that a single dose of mRNA vaccine after exposure to Zostavax is equivalent to a double dose of mRNA vaccine in inducing a similar T cell response.

Equivalents Those skilled in the art will recognize, or be able to ascertain using no more than routine experimentation, many equivalents to the specific embodiments of the invention described herein. Such equivalents are intended to be encompassed by the following claims.

  All references disclosed herein, including patent documents, are hereby incorporated by reference in their entirety.

Claims (112)

  A VZV vaccine comprising at least one RNA polynucleotide having an open reading frame encoding at least one varicella-zoster virus (VZV) antigenic polypeptide and a pharmaceutically acceptable carrier or excipient.   The VZV vaccine of claim 1, wherein the at least one RNA polynucleotide has an open reading frame encoding two or more VZV antigenic polypeptides.   The VZV vaccine according to claim 1 or 2, wherein the at least one VZV antigenic polypeptide is a VZV glycoprotein or an antigenic fragment or epitope thereof.   The VZV vaccine according to claim 1 or 2, wherein the at least one VZV antigenic polypeptide is a VZV tegument protein or an antigenic fragment or epitope thereof.   4. The VZV vaccine of claim 3, wherein the VZV glycoprotein is selected from VZV gE, gI, gB, gH, gK, gL, gC, gN and gM.   6. The VZV vaccine of claim 5, wherein the VZV glycoprotein is VZV gE.   6. The VZV vaccine of claim 5, wherein the VZV glycoprotein is VZV gI.   The VZV vaccine of claim 6, wherein the VZV glycoprotein is a variant VZV gE polypeptide.   The VZV vaccine according to claim 8, wherein the variant VZV gE polypeptide is a truncated polypeptide lacking an anchor domain (ER retention domain).   9. The VZV vaccine of claim 8, wherein the variant VZV gE polypeptide is a truncated polypeptide lacking a carboxy terminal tail domain.   The VZV vaccine according to claim 9, wherein the VZV antigenic fragment is a truncated VZV gE polypeptide comprising amino acids 1 to 561 of SEQ ID NO: 10.   11. The VZV vaccine of claim 10, wherein the VZV antigenic fragment is a VZV gE variant polypeptide comprising amino acids 1 to 573 of SEQ ID NO: 18.   9. The variant VZV gE polypeptide has at least one mutation in at least one motif associated with ER retention, endocytosis and / or localization to the Golgi or trans-Golgi network. VZV vaccine.   14. The VZV vaccine of claim 13, wherein the variant VZV gE polypeptide has at least one mutation in at least one phosphorylated acidic motif.   14. The VZV vaccine of claim 13, wherein the variant VZV gE polypeptide has a Y582G mutation relative to SEQ ID NO: 10.   14. The VZV vaccine of claim 13, wherein the variant VZV gE polypeptide has a Y569A mutation relative to SEQ ID NO: 10.   14. The VZV vaccine of claim 13, wherein the variant VZV gE polypeptide has a Y582G mutation and a Y569A mutation relative to SEQ ID NO: 10.   13. The VZV vaccine of claim 12, wherein the VZV antigenic fragment has a Y569A mutation relative to SEQ ID NO: 10.   18. The VZV vaccine according to claim 6 or any one of claims 13 to 17, wherein the variant VZV gE polypeptide has an AEAAADA sequence (SEQ ID NO: 58).   The VZV vaccine according to claim 6 or any one of claims 13 to 17, wherein the variant VZV gE polypeptide has an Igκ sequence at the C-terminus.   The VZV vaccine according to claim 11 or 12, wherein the VZV gE antigenic fragment has an Igκ sequence at the C-terminus.   6. The VZV vaccine of claim 5, wherein the at least one RNA polynucleotide encodes VZV gE and gI antigenic polypeptides.   The VZV vaccine according to claim 6 or any one of claims 8 to 21, comprising at least one RNA polynucleotide having an open reading frame encoding a gI antigenic polypeptide.   23. Any of claims 6 or 8-21 comprising at least one RNA polynucleotide having an open reading frame encoding an antigenic polypeptide selected from VZV gB, gH, gK, gL, gC, gN and gM. The VZV vaccine according to claim 1.   5. The at least one RNA polynucleotide has an open reading frame encoding a VZV antigenic polypeptide selected from VZV gE, gI, gB, gH, gK, gL, gC, gN and gM. VZV vaccine.   26. The VZV vaccine according to any one of claims 5 to 25, further comprising live attenuated VZV, fully inactivated VZV or VZV VLP.   Said at least one RNA polynucleotide is SEQ ID NO: 1-8 37, 39, 41, 60, 62, 64, 66, 68, 70, 72, 74, 76, 78, 80, 82, 84, 86, 88 or Encoded by at least one of the nucleic acid sequences, at least one fragment of the nucleic acid sequence or at least one epitope of the nucleic acid sequence selected from 90, or the at least one RNA polynucleotide is SEQ ID NO: 6, 37, 39, VZV according to any one of claims 1 to 3, which is encoded by at least one of the nucleic acid sequences, at least one fragment of the nucleic acid sequence or at least one epitope sequence of the nucleic acid sequence selected from 84 or 86. vaccine.   The VZV vaccine according to any one of claims 1 to 3, wherein the at least one RNA polynucleotide comprises a sequence selected from SEQ ID NOs: 92-108 and 123-131.   4. The method of claim 1, wherein the at least one RNA polynucleotide comprises at least one fragment of a nucleic acid sequence or at least one epitope of an mRNA sequence selected from SEQ ID NOs: 92-108 and 123-131. VZV vaccine according to item.   The VZV vaccine of claim 6, wherein the at least one RNA polynucleotide is encoded by SEQ ID NO: 1.   8. The VZV vaccine of claim 7, wherein the at least one RNA polynucleotide is encoded by SEQ ID NO: 2.   12. The VZV vaccine of claim 11, wherein the at least one RNA polynucleotide is encoded by SEQ ID NO: 3.   13. The VZV vaccine of claim 12, wherein the at least one RNA polynucleotide is encoded by SEQ ID NO: 5.   19. The VZV vaccine of claim 18, wherein the at least one RNA polynucleotide is encoded by SEQ ID NO: 6, 37, 39, 84 or 86.   20. The VZV vaccine of claim 19, wherein the at least one RNA polynucleotide is encoded by SEQ ID NO: 7.   20. The VZV vaccine of claim 19, wherein the RNA polynucleotide is encoded by SEQ ID NO: 8.   The at least one RNA polynucleotide encodes an antigenic polypeptide having at least 90% identity to any amino acid sequence of SEQ ID NOs: 10, 14, 26, 30, 42, and 45-55 The VZV vaccine according to claim 3.   An antigenic polypeptide wherein the at least one RNA polynucleotide has at least 95% identity to any amino acid sequence of SEQ ID NOs: 10, 14, 26, 30, 38, 42 and 45-55; 4. The VZV vaccine of claim 3 that encodes.   An antigenic polypeptide wherein the at least one RNA polynucleotide has at least 96% identity to any amino acid sequence of SEQ ID NOs: 10, 14, 26, 30, 38, 42 and 45-55; 4. The VZV vaccine of claim 3 that encodes.   An antigenic polypeptide wherein the at least one RNA polynucleotide has at least 97% identity to any amino acid sequence of SEQ ID NOs: 10, 14, 26, 30, 38, 42 and 45-55; 4. The VZV vaccine of claim 3 that encodes.   An antigenic polypeptide wherein the at least one RNA polynucleotide has at least 98% identity to the amino acid sequence of any of SEQ ID NOs: 10, 14, 26, 30, 38, 42 and 45-55; 4. The VZV vaccine of claim 3 that encodes.   An antigenic polypeptide wherein the at least one RNA polynucleotide has at least 99% identity to the amino acid sequence of any of SEQ ID NOs: 10, 14, 26, 30, 38, 42 and 45-55; 4. The VZV vaccine of claim 3 that encodes.   43. The VZV vaccine of any one of claims 1-42, wherein the open reading frame in which the polynucleotide is encoded is codon optimized.   The VZV vaccine according to any one of claims 1 to 43, which is multivalent.   44. The VZV vaccine of any one of claims 1-43, wherein the RNA polynucleotide comprises at least one chemical modification.   46. The VZV vaccine of claim 45, further comprising a second chemical modification.   The chemical modification is pseudouridine, N1-methyl pseudouridine, N1-ethyl pseudouridine, 2-thiouridine, 4′-thiouridine, 5-methylcytosine, 2-thio-1-methyl-1-deaza-pseudouridine, 2 -Thio-1-methyl-pseudouridine, 2-thio-5-aza-uridine, 2-thio-dihydropseuduridine, 2-thio-dihydrouridine, 2-thio-pseudouridine, 4-methoxy-2-thio-pseudouridine 4-methoxy-pseudouridine, 4-thio-1-methyl-pseudouridine, 4-thio-pseudouridine, 5-aza-uridine, dihydropseudouridine, 5-methoxyuridine, and 2′-O-methyluridine The VZV wax according to claim 45 or 46, which is selected. Down.   46. The VZV vaccine of claim 45, wherein 80% of uracil in the open reading frame has a chemical modification.   49. The VZV vaccine of claim 48, wherein 100% of uracil in the open reading frame has a chemical modification.   50. The VZV vaccine of any one of claims 45 to 49, wherein the chemical modification is at position 5 of the uracil.   51. The VZV vaccine of claim 50, wherein the chemical modification is N1-methyl pseudouridine.   52. The VZV vaccine according to any one of claims 1 to 51, formulated in cationic lipid nanoparticles.   53. The VZV vaccine of claim 52, wherein the cationic lipid nanoparticles comprise a cationic lipid, a PEG-modified lipid, a sterol, and a non-cationic lipid.   54. The VZV vaccine of claim 53, wherein the cationic lipid is an ionic cationic lipid, the non-cationic lipid is a neutral lipid, and the sterol is cholesterol.   The cationic lipid is 2,2-dilinoleyl-4-dimethylaminoethyl- [1,3] -dioxolane (DLin-KC2-DMA), dilinoleyl-methyl-4-dimethylaminobutyrate (DLin-MC3-DMA). 53. selected from the group consisting of: di ((Z) -non-2-en-1-yl) 9-((4- (dimethylamino) butanoyl) oxy) heptadecandioate (L319); The VZV vaccine described.   The cationic lipid nanoparticles have a molar ratio of about 20-60% cationic lipid, about 5-25% non-cationic lipid, about 25-55% sterol and about 0.5-15% PEG-modified lipid; 55. The VZV vaccine of claim 54.   53. The VZV vaccine of claim 52, wherein the nanoparticles have a polydispersity value of less than 0.4.   53. The VZV vaccine of claim 52, wherein the nanoparticles have a neutral net charge at neutral pH.   53. The VZV vaccine of claim 52, wherein the nanoparticles have an average diameter of 50-200 nm.   60. A VZV vaccine according to any one of claims 1 to 59 for use in a method for inducing an antigen-specific immune response in a subject, said method being effective for producing an antigen-specific immune response. Said VZV vaccine comprising administering said vaccine to said subject in any amount.   60. Use of a VZV vaccine according to any one of claims 1 to 59 in the manufacture of a medicament for use in a method for inducing an antigen-specific immune response in a subject, said method comprising antigen-specific immunity The use comprising administering to the subject the vaccine in an amount effective to produce a response.   60. A method for preventing or treating VZV infection comprising administering to a subject the vaccine of any one of claims 1-59.   60. A method of inducing an antigen-specific immune response in a subject, wherein the vaccine according to any one of claims 1-59 is applied to said subject in an amount effective to produce an antigen-specific immune response in said subject. Said method comprising administering.   64. The method of claim 63, wherein the antigen-specific immune response comprises a T cell response or a B cell response.   65. The method of claim 63 or 64, wherein the subject receives a single dose of the vaccine.   66. The method of claim 63 or 64, wherein the subject receives an initial dose and a second (booster) dose of the vaccine.   67. The method of any one of claims 63 to 66, wherein the vaccine is administered to the subject by intradermal or intramuscular injection.   68. The method of any one of claims 63-67, wherein the titer of anti-antigenic polypeptide antibody produced in the subject is increased by at least 1 log compared to a control.   69. The method of any one of claims 63 to 68, wherein the titer of anti-antigenic polypeptide antibody produced in the subject is increased by 1 to 3 logs compared to a control.   70. The method of any one of claims 63-69, wherein the titer of anti-antigenic polypeptide antibody produced in the subject is increased by at least 2-fold compared to a control.   71. The method of any one of claims 63-70, wherein the titer of anti-antigenic polypeptide antibody produced in the subject is increased by at least 2-10 fold compared to a control.   72. The method of any one of claims 68 to 71, wherein the control is a titer of an anti-antigenic polypeptide antibody produced in a subject who has never received a vaccine against the virus.   72. The control according to any one of claims 68 to 71, wherein the control is a titer of an anti-antigenic polypeptide antibody produced in a subject who has been administered a live attenuated or inactivated vaccine against the virus. The method described in 1.   72. Any one of claims 68 to 71, wherein the control is a titer of an anti-antigenic polypeptide antibody produced in a subject who has been administered a recombinant protein vaccine or purified protein vaccine against the virus. The method according to item.   72. The method of any one of claims 68 to 71, wherein the control is a titer of an anti-antigenic polypeptide antibody produced in a subject who has been administered a VLP vaccine against the virus.   The effective amount is a dose equivalent to a dose of a standard therapeutic dose of a recombinant protein vaccine or purified protein vaccine against the virus reduced by at least 1/2, and the anti-antigenic polypeptide antibody produced in the subject 76. The titer is equivalent to that of an anti-antigenic polypeptide antibody produced in a control subject, respectively, administered a standard therapeutic dose of a recombinant protein vaccine or purified protein vaccine against the virus. The method as described in any one of.   The effective amount is a dose equivalent to a dose obtained by reducing the standard therapeutic dose of an attenuated live or inactivated vaccine against the virus by at least 1/2, and the potency of the anti-antigenic polypeptide antibody produced in the subject. 76. Any of claims 63-75, wherein the titer is equivalent to the titer of the anti-antigenic polypeptide antibody produced in a control subject, respectively, administered a standard therapeutic dose of live attenuated or inactivated vaccine against the virus. The method according to claim 1.   The effective amount is a dose equivalent to a dose that reduces the standard therapeutic dose of a VLP vaccine against the virus by at least 1/2, and the titer of the anti-antigenic polypeptide antibody produced in the subject is 76. The method of any one of claims 63-75, which is equivalent to the titer of anti-antigenic polypeptide antibody produced in a control subject administered a standard therapeutic dose of a VLP vaccine.   79. A method according to any one of claims 63 to 78, wherein the effective amount is a total dose of 50 [mu] g to 1000 [mu] g.   80. The method of claim 79, wherein the effective amount is a 25 [mu] g, 100 [mu] g, 400 [mu] g or 500 [mu] g dose administered to the subject a total of two times.   81. The method of any one of claims 63-80, wherein the effectiveness of the vaccine against the virus is greater than 65%.   82. The method of any one of claims 63-81, wherein the vaccine immunizes the subject against the virus for up to 2 years.   82. The method of any one of claims 63-81, wherein the vaccine immunizes the subject against the virus for more than 2 years.   84. The method of any one of claims 63-83, wherein the subject is between 1 and about 10 years of age.   85. The method of any one of claims 63 to 84, wherein the subject has been exposed to the virus, the subject is infected with the virus, or the subject is at risk of infection with the virus.   86. The method of any one of claims 63 to 85, wherein the subject is immunocompromised.   60. An engineered nucleic acid encoding at least one RNA polynucleotide of the vaccine of any one of claims 1-59.   At least one ribonucleic acid (RNA) polynucleotide, the RNA polynucleotide comprising: (i) a 5 ′ end cap; (ii) an open reading frame encoding at least one VZV antigenic polypeptide; and (iii) VZV vaccine with a 3 ′ poly A tail.   90. The vaccine of claim 88, wherein the at least one mRNA polynucleotide is encoded by a sequence comprising the sequence specified by SEQ ID NO: 6.   90. The vaccine of claim 88, wherein the at least one mRNA polynucleotide is encoded by a sequence comprising the sequence specified by SEQ ID NO: 37.   90. The vaccine of claim 88, wherein the at least one mRNA polynucleotide is encoded by a sequence comprising the sequence specified by SEQ ID NO: 39.   90. The vaccine of claim 88, wherein the at least one mRNA polynucleotide is encoded by a sequence comprising the sequence specified by SEQ ID NO: 84.   90. The vaccine of claim 88, wherein the at least one mRNA polynucleotide is encoded by a sequence comprising the sequence specified by SEQ ID NO: 86.   90. The vaccine of claim 88, wherein the at least one mRNA polynucleotide comprises the sequence specified by SEQ ID NO: 128.   90. The vaccine of claim 88, wherein the at least one mRNA polynucleotide comprises a sequence specified by SEQ ID NO: 99 or 133.   90. The vaccine of claim 88, wherein the at least one mRNA polynucleotide comprises a sequence specified by SEQ ID NO: 107 or 134.   90. The vaccine of claim 88, wherein the at least one VZV antigenic polypeptide comprises the sequence specified by SEQ ID NO: 38.   98. The vaccine of any one of claims 88 to 97, wherein the 5 'end cap is or comprises 7mG (5') ppp (5 ') N1mpNp.   99. The vaccine of any one of claims 88-98, wherein 100% of uracil in the open reading frame is modified to include N1-methyl pseudouridine at position 5 of the uracil.   99. The vaccine according to any one of claims 88 to 99, formulated in lipid nanoparticles.   101. The vaccine of claim 100 further comprising trisodium citrate buffer, sucrose and water.   Comprising (i) a 5 ′ end cap, (ii) an open reading frame encoding a VZV antigenic polypeptide, and (iii) a 3 ′ poly A tail, comprising a nucleic acid sequence identified by SEQ ID NO: 99. A VZV vaccine comprising at least one messenger ribonucleic acid (mRNA) polynucleotide, wherein the 5 'end cap is 7mG (5') ppp (5 ') NlmpNp.   103. The VZV vaccine of claim 102, wherein the uracil nucleotide of the sequence specified by SEQ ID NO: 99 is modified to include an N1-methyl pseudouridine at position 5 of the uracil nucleotide.   Comprising (i) a 5 ′ end cap, (ii) an open reading frame encoding a VZV antigenic polypeptide, and (iii) a 3 ′ polyA tail, comprising a nucleic acid sequence specified by SEQ ID NO: 133. A VZV vaccine comprising at least one messenger ribonucleic acid (mRNA) polynucleotide, wherein the 5 'end cap is 7mG (5') ppp (5 ') NlmpNp.   105. The VZV vaccine of claim 104, wherein the uracil nucleotide of the sequence specified by SEQ ID NO: 133 is modified to include an N1-methyl pseudouridine at position 5 of the uracil nucleotide.   Comprising (i) a 5 ′ end cap, (ii) an open reading frame encoding a VZV antigenic polypeptide, and (iii) a 3 ′ poly A tail, comprising a nucleic acid sequence identified by SEQ ID NO: 107. A VZV vaccine comprising at least one messenger ribonucleic acid (mRNA) polynucleotide, wherein the 5 'end cap is 7mG (5') ppp (5 ') NlmpNp.   107. The VZV vaccine of claim 106, wherein the uracil nucleotide of the sequence specified by SEQ ID NO: 107 is modified to include an N1-methyl pseudouridine at position 5 of the uracil nucleotide.   (I) a 5 ′ end cap, (ii) an open reading frame encoding a VZV antigenic polypeptide, and (iii) a 3 ′ poly A tail, comprising a nucleic acid sequence identified by SEQ ID NO: 134. A VZV vaccine comprising at least one messenger ribonucleic acid (mRNA) polynucleotide, wherein the 5 'end cap is 7mG (5') ppp (5 ') NlmpNp.   109. The VZV vaccine of claim 108, wherein the uracil nucleotide of the sequence specified by SEQ ID NO: 134 is modified to include an N1-methyl pseudouridine at position 5 of the uracil nucleotide. A pharmaceutical composition for use in subject vaccination comprising:
An effective amount of mRNA encoding varicella-zoster virus (VZV) antigen;
The pharmaceutical composition, wherein the effective amount is sufficient to provide a detectable antigen level as measured in the subject's serum 1 to 72 hours after administration.   111. The composition of claim 110, wherein the antigen has a cutoff index of 1-2. A pharmaceutical composition for use in subject vaccination comprising:
An effective amount of mRNA encoding varicella-zoster virus (VZV) antigen;
The effective amount is sufficient to provide a neutralizing titer of 1,000-10,000 provided by neutralizing antibodies against the antigen, as measured in the subject's serum 1-72 hours after administration. Said pharmaceutical composition.