JP2017077200A - HUMAN PKCη GENE EXPRESSION INHIBITION siRNA AND MEDICINAL PRODUCT CONTAINING THE SAME - Google Patents

Abstract

PROBLEM TO BE SOLVED: To provide a method for suppressing the expression of human protein kinase Cη(PKCη)mRNA and protein.SOLUTION: The present invention provides a method in which the expression of PKCη is suppressed by RNA interference of a gene encoding PKCη. The method utilizes a double stranded RNA for the RNA interference. The double stranded RNA comprises: a sense oligonucleotide chain consisting of oligonucleotides of a specific base sequence, another specific base sequence, and still another specific base sequence; and an anti-sense oligonucleotide chain consisting of oligonucleotides complementary thereto.SELECTED DRAWING: None

Description

The present invention relates to a method for suppressing the expression of human protein kinase Cη (PKCη) mRNA and protein. More specifically, the present invention relates to PKCη mRNA, a short interfering RNA (siRNA) sequence that effectively suppresses protein expression.

  The PKCη gene is a gene isolated and identified by Nagata et al. From a mouse skin-derived cDNA library as PKC showing epithelial cell-specific expression (Non-patent Document 1). PKC is a protein phosphorylase activated by a lipid metabolite present in the cell membrane, and PKCα, PKCβ1, PKCβ2, PKCγ, PKCδ, PKCε, PKCη, PKCθ, PKCζ, and PKCζ have been used as related genes. (Non-patent Document 2). PKC is roughly divided into three types according to its activation mode. That is, PKC (PKCα, PKCβ1, PKCβ2, PKCγ) that requires calcium ion, phosphorylated lipid and diacylglycerol for activation, calcium ion is not required for activation, phosphorylated lipid, diacylglycerol Novel PKC (PKCδ, PKCε, PKCη, PKCθ) requiring a phospholipid, and atypical PKC (PKCζ, PKCλ) requiring only phosphorylated lipid.

  PKCη belonging to novel PKC is PKC expressed in epithelial cells of squamous epithelial tissues including skin, esophagus and tongue, and single-layer epithelial cells constituting the small intestine, and specifically expressed in epithelial tissue differentiation layers. In the skin, it is localized in the epidermal granule layer (Non-patent Document 3). In addition to epithelial tissues, it is highly expressed in osteoclasts, T cells, CD4 positive thymocytes, CD8 positive thymocytes, and macrophages (Non-patent Document 4). As shown in Non-Patent Document 5, the intracellular localization is mainly rough endoplasmic reticulum and Golgi apparatus, but it has also been reported that localization to the cell membrane is caused by differentiation of epidermal keratinocytes (Non-Patent Document). 6)

PKCη is an enzyme that induces terminal differentiation of epidermal keratinocytes. The overexpression inhibits the growth of human epidermal keratinocytes, flattenes the morphology, and increases the enzyme activity of transglutaminase 1, which is the final differentiation marker protein. Moreover, the above-mentioned index of epidermal differentiation is suppressed by the kinase-deficient mutant (Non-patent Document 7). PKCη induces innate immunity in human keratinocytes and secretes inflammatory cytokines such as IL-1α and IL-6 and chemokines such as IL-8 and MIP-3. The skin of transgenic mice with PKCη shows a remarkable inflammatory response morphologically and histopathologically, and migration and infiltration of granulocytes and T cells into the dermis occurs. In addition, Th2-inducible cytokines such as IL-4 are released with growth, and the skin barrier is destroyed, making it vulnerable to external stimuli and accelerating the symptoms, resulting in atopy in the first few months of life. Symptoms similar to atopic dermatitis appear. In addition, PKC eta protein is highly expressed in psoriatic skin, which is a chronic inflammatory disease in human skin, compared to normal cells (Non-patent Document 8). These facts indicate that PKCη is involved in the onset and maintenance of inflammatory diseases.

  Genetic polymorphism affects the prevalence of various diseases and the degree of malignancy among individuals. single nucleotide polymorphism: Single nucleotide polymorphisms (SNPs) are the smallest polymorphisms in the genome, and their definition is "variation in which single nucleotides are mutated in the genome base sequence of a certain species population. Is called a single nucleotide polymorphism when it is found in the population with a frequency of 1% or more. " It has been reported that there is a strong correlation between SNPs that affect the activity of PKCη and the prevalence of chronic intractable inflammatory diseases such as cerebral infarction, rheumatoid arthritis, and atrophic gastritis. That is, by increasing the enzyme activity of PKCη, the morbidity and malignancy of the inflammatory diseases shown above are increased (Non-Patent Documents 9, 10, and 11).

  PKCη is highly expressed in malignant tumors, that is, cancer cells. Breast cancer, lung cancer, glioma, and myeloid leukemia have been reported as cancer types that highly express PKCη (Non-Patent Documents 12, 13, and 14). In particular, in lung cancer, a strong correlation between the malignancy and prognosis was observed (Non-patent Document 15). Furthermore, the growth of human adenocarcinoma cell lines PC9, NCI-H1975, A549 is significantly inhibited by suppressing the expression of PKCη. In particular, apoptosis is significantly induced in lung adenocarcinoma cells having a mutation in the epidermal growth factor receptor.

From the above, it can be said that PKCη is a very attractive target for intractable chronic inflammatory diseases and molecular target therapy strategies for cancer, and devising a method for suppressing the expression of PKCη is an intractable chronic inflammatory disease and It is thought to contribute greatly to the treatment or prevention of cancer.

Since the PKCη protein is localized in cells such as the Golgi apparatus, rough endoplasmic reticulum, or cell membrane as described above, a strategy for inhibiting its action with an antibody or the like is not established unlike a growth factor receptor. It is essential to suppress the biosynthesis of proteins and proteins.

A phorbol ester receptor / protein kinase, nPKC eta, a new member of the protein kinase C family predominantly expressed in lung and skin.Osada S, Mizuno K, Saido TC, Akita Y, Suzuki K, Kuroki T, Ohno S. J Biol Chem. 1990; 265 (36): 22434-40. Intracellular signaling by hydrolysis of phospholipids and activation of protein kinase C. Nishizuka Y. Science. 1992 23; 258 (5082): 607-14. Review. Predominant expression of nPKC eta, a Ca (2 +)-independent isoform of protein kinase C in epithelial tissues, in association with epithelial differentiation.Osada S, Hashimoto Y, Nomura S, Kohno Y, Chida K, Tajima O, Kubo K, Akimoto K, Koizumi H, Kitamura Y, et al. Cell Growth Differ. 1993 4 (3): 167-75. The role of protein kinase ceta in T cell biology. Fu G, Gascoigne NR. Front Immunol. 2012; 3: 177. PKCeta is localized in the Golgi, ER and nuclear envelope and translocates to the nuclear envelope upon PMA activation and serum-starvation: C1b domain and the pseudosubstrate containing fragment target PKCeta to the Golgi and the nuclear envelope.Maissel A, Marom M, Shtutman M , Shahaf G, Livneh E. Cell Signal. 2006 18 (8): 1127-39. PKC-eta / Fyn-dependent pathway leading to keratinocyte growth arrest and differentiation. Cabodi S, Calautti E, Talora C, Kuroki T, Stein PL, Dotto GP. Mol Cell. 2000; 6 (5): 1121-9. Induction of differentiation in normal human keratinocytes by adenovirus-mediated introduction of the eta and delta isoforms of protein kinase C. Ohba M, Ishino K, Kashiwagi M, Kawabe S, Chida K, Huh NH, Kuroki T. Mol Cell Biol. 1998 Sep ; 18 (9): 5199-207. Differentiation-associated localization of nPKC eta, a Ca (++)-independent protein kinase C, in normal human skin and skin diseases.Koizumi H, Kohno Y, Osada S, Ohno S, Ohkawara A, Kuroki T. J Invest Dermatol. 1993 Dec; 101 (6): 858-63. A nonsynonymous SNP in PRKCH (protein kinase C eta) increases the risk of cerebral infarction. , Ibayashi S, Sueishi K, Iida M, Nakamura Y, Kiyohara Y. Nat Genet. 2007 39 (2): 212-7. Association between PRKCH gene polymorphisms and subcortical silent brain infarction.Serizawa M, Nabika T, Ochiai Y, Takahashi K, Yamaguchi S, Makaya M, Kobayashi S, Kato N. Atherosclerosis. 2008 Aug; 199 (2): 340-5. PRKCH gene polymorphism is associated with the risk of severe gastric atrophy.Goto Y, Hishida A, Matsuo K, Tajima K, Morita E, Naito M, Wakai K, Hamajima N. Gastric Cancer. 2010 13 (2): 90-4. The unique protein kinase Ceta: implications for breast cancer (review) .Pal D, Basu A. Int J Oncol. 2014 Aug; 45 (2): 493-8. PKCeta is a novel prognostic marker in non-small cell lung cancer.Krasnitsky E, Baumfeld Y, Freedman J, Sion-Vardy N, Ariad S, Novack V, Livneh E. Anticancer Res. 2012 Apr; 32 (4): 1507- 13. PKC eta as a therapeutic target in glioblastoma multiforme.Martin PM, Hussaini IM. Expert Opin Ther Targets. 2005 Apr; 9 (2): 299-313. Review. PKCeta is a novel prognostic marker in non-small cell lung cancer.Krasnitsky E, Baumfeld Y, Freedman J, Sion-Vardy N, Ariad S, Novack V, Livneh E. Anticancer Res. 2012 Apr; 32 (4): 1507- 13.

  An object of the present invention is to provide a substance that specifically and strongly suppresses human PKCη mRNA synthesis and protein synthesis.

  In order to inhibit biosynthesis of a specific protein, it is conceivable to target mRNA that directs biosynthesis of the protein. That is, a strategy that suppresses the action of mRNA of the target gene and leads to degradation of the mRNA itself, that is, a gene expression control system based on RNA interference was selected. The phenomenon of RNA interference was reported in 1998 by Fire et al. It has become widely known through the announcement that it has successfully knocked down specific genes in vivo by introducing double-stranded RNA into elegans. The specificity of the used double-stranded RNA to the target gene was very high, and the double-stranded RNA not complementary to the target sequence did not show any expression control effect. Next, an attempt was made to apply this experimental system to mammals. However, since the interferon action associated with the introduction of double-stranded RNA works, double-stranded RNA targeting mammalian cell genes cannot be used. It became a big problem. After that, Tuschl's research group researched the double-stranded RNA that knocks down genes most efficiently, and when using a short 21-mer double-strand with 3 base ends, mammalian cells Reported that RNAi can be functioned without causing the interferon action which has been a problem. Such a short double-stranded RNA is called a small interfering RNA (siRNA). The applicant has found the base sequence of siRNA that acts on human PKCη and specifically suppresses PKCCh mRNA synthesis and protein synthesis.

That is, the present invention comprises determination of siRNA sequences that strongly suppress the biosynthesis of human PKCη mRNA and protein.

According to the present invention, there are provided siRNA and shRNA characterized by inhibiting the function of human PKCη.

The siRNA and shRNA of the present invention have the base sequence represented by SEQ ID NO: 1, 2, or 3 as a target sequence.

According to another aspect of the present invention, an expression vector capable of expressing the above-described siRNA and shRNA of the present invention is provided.

The present inventors paid attention to the role of PKCη in chronic inflammatory diseases and malignant tumors, and repeated studies on siRNA specific to PKCη. As a result, a double-stranded siRNA that does not show homology to other genes was found and the present invention was achieved.

According to the double-stranded siRNA of the present invention, since the sequence selected as a target sequence is a sequence that does not show homology to other genes, it is specific for the PKCη gene and can be used while avoiding the off-target effect. Therefore, the double-stranded siRNA of the present invention can be applied clinically. For example, treatment of inflammatory diseases / malignant tumors, prevention of inflammatory diseases / malignant tumors, pharmaceutical compositions for treating inflammatory diseases / malignant tumors, inflammation It can be used as a pharmaceutical composition for preventing sexual diseases and malignant tumors, a PKCCh-specific inhibitor, and the like. Among them, since the PKCη gene in which the double-stranded siRNA of the present invention exerts an RNAi effect can be a therapeutic target molecule in dermatitis, the double-stranded siRNA of the present invention is preferably used for treatment or prevention of dermatitis, skin It can be used as a pharmaceutical composition for flames.

Comparison of PKCη mRNA expression level in immortalized keratinocyte cell line HacaT 72 hours after infection with PKCηshRNA expressing lentiviral vector (Example 1) Changes in expression of PKCη mRNA and protein in lung adenocarcinoma cells PC9 72 hours after infection with PKCηshRNA-expressing lentiviral vector (FIG. 2, Example 2).

The present invention relates to siRNA and shRNA that inhibit the function of PKCη. When the siRNA or shRNA of the present invention is administered to a cell, the expression of PKCη can be specifically suppressed by the RNAi effect. That is, when shRNA is introduced into a cell, an RNAi phenomenon occurs and RNA having a homologous sequence is degraded. Such RNAi phenomenon is a phenomenon observed in nematodes, insects, protozoa, hydra, plants, vertebrates (including mammals).

Here, “siRNA” is an abbreviation for short interfering RNA, which is artificially chemically synthesized or biochemically synthesized, synthesized in an organism, or about 40 bases. This is a double-stranded RNA of 10 base pairs or more produced by degrading the above double-stranded RNA in the body. The length of siRNA is generally about 10 to 30 bases, preferably about 15 to 25 bases, more preferably about 19 to 23 bases. siRNA usually has a 5′-phosphate, 3′-OH structure, and the 3 ′ end protrudes by about 2 bases. A protein specific to the siRNA is bound to form RISC (RNA-induced-silencing-complex). This complex recognizes and binds to mRNA having the same sequence as siRNA, and cleaves mRNA at the center of siRNA by RNaseIII-like enzyme activity. As described above, siRNA can suppress its expression by degrading mRNA of its target gene (in the present invention, PKCη gene).

In the present invention, siRNA may be used, and shRNA (short hairpin RNA) that generates the siRNA or an expression vector that can express them can be used. When the shRNA of the present invention or an expression vector thereof is administered to a cell, siRNA is produced in the cell. The shRNA, siRNA or expression vector that expresses it used in the present invention may be in any form as long as it can cause RNAi.

According to an example of the present invention, shRNA can be used. shRNA refers to a molecule of about 20 base pairs or more that has a double-stranded structure in a molecule and has a hairpin-like structure by including a partially palindromic base sequence in a single-stranded RNA. . Such shRNA, after being introduced into the cell, is degraded to a length of about 20 bases (typically, for example, 21 bases, 22 bases, 23 bases) in the cell, and causes RNAi similarly to siRNA. be able to. As described above, shRNA causes RNAi similarly to siRNA, and thus can be used effectively in the present invention.

The sequence of PKCη mRNA targeted by the present invention is available from the National Biotechnology Information Center (NCBI) Nucleotide database, registration number NM_006255. Further, the PKCη gene targeted by the double-stranded siRNA of the present invention includes single nucleotide polymorphism (SNP), other polymorphisms, and mutants.

SiRNA or shRNA used in the present invention is PKCηsi # 1 5′-GGA TTC AAA GAT TGC AGA ACA-3 ′ (mRNA target site: nucleotide sequence 998th to 1018th: SEQ ID NO: 1), PKCηsi # 2 5′- GGT AAA TGC GGT GGA ACT TGC-3 ′ (mRNA target site: nucleotide sequence 1193 to 1213: SEQ ID NO: 2), PKCηsi # 3 5′-GCT TCTATG CTG CAG AAA TCA-3 ′ (mRNA target site: nucleotide sequence 1675th to 1695th: SEQ ID NO: 3)

As described above, in the present invention, siRNA, shRNA, or an expression vector thereof can be used as a factor that can suppress the expression of PKCη by RNAi. The advantages of siRNA are as follows: (1) Since RNA itself is not integrated into the chromosome of normal cells even when introduced into cells, it is not a treatment that causes mutations transmitted to offspring, and is highly safe, and ( 2) Short double-stranded RNA is relatively easy to chemically synthesize and is more stable when double-stranded. Further, as an advantage of shRNA, when treatment is performed by suppressing gene expression for a long period of time, a vector that transcribes shRNA in a cell can be prepared and introduced into the cell.

The siRNA or shRNA used in the present invention may be artificially chemically synthesized, or RNA is synthesized in vitro by T7 RNA polymerase using a DNA having a hairpin structure in which the DNA sequences of the sense strand and antisense strand are linked in the reverse direction. It is also possible to produce it. For synthesis in vitro, antisense and sense RNAs can be synthesized from template DNA using T7 RNA polymerase and T7 promoter. When these are annealed in vitro and then introduced into cells, RNAi is caused and PKCη expression is suppressed. Here, such RNA can be introduced into cells using, for example, various transfection reagents such as Lipofectamine 2000 (Invitrogen) and Xstream siRNA transfection reagent (Roche).

The siRNA, shRNA, or expression vector thereof of the present invention can specifically inhibit PKCη by producing an RNAi effect in the cell. That is, the siRNA, shRNA, or expression vector thereof of the present invention is useful as a PKCη inhibitor.

The method of administering the agent of the present invention includes oral administration, parenteral administration (for example, intravenous administration, intramuscular administration, subcutaneous administration, intradermal administration, mucosal administration, rectal administration, intravaginal administration, local administration to the affected area, Skin administration, etc.).

When the agent of the present invention is used as a pharmaceutical composition, a pharmaceutically acceptable additive can be blended as necessary. Specific examples of pharmaceutically acceptable additives include antioxidants, preservatives, colorants, flavors, and diluents, emulsifiers, suspending agents, solvents, fillers, bulking agents, buffers, delivery vehicles. , Diluents, carriers, excipients and / or pharmaceutical adjuvants and the like.

Although the formulation form of the chemical | medical agent of this invention is not specifically limited, For example, a liquid agent, an injection, a sustained release agent etc. are mentioned. The solvent used for formulating the drug of the present invention as the above-mentioned preparation may be either aqueous or non-aqueous.

Injections can be prepared by methods well known in the art. For example, after dissolving in an appropriate solvent (physiological saline, buffer solution such as PBS, sterilized water, etc.), sterilized by filtration with a filter, and then filled into a sterile container (eg, ampoule) Can be prepared. This injection may contain a conventional pharmaceutical carrier, if necessary. Administration methods using non-invasive catheters can also be used. Examples of the carrier that can be used in the present invention include neutral buffered physiological saline or physiological saline mixed with serum albumin.

Furthermore, siRNA and shRNA which are active ingredients of the drug of the present invention can be administered in the form of a non-viral vector or a viral vector. Such administration forms are known in the art, and include, for example, separate experimental medicine “Basic technology of gene therapy” Yodosha, 1996; separate experiment medicine “Gene transfer & expression analysis experimental method” Yodosha, 1997, etc. It is described in.

Furthermore, according to the present invention, there is provided an expression vector comprising a nucleic acid sequence encoding siRNA or shRNA capable of suppressing the expression of PKCη by RNAi. Furthermore, according to the present invention, a cell containing the above-described expression vector is provided. The cell of the present invention may transiently or stably express a factor that causes RNAi. The expression vector and cell type described above are not particularly limited, but are preferably those that can be used for therapy.

When the siRNA of the present invention is used, for example, for the treatment of atopic dermatitis, any drug delivery system known in the art can be used. RNA itself is an unstable substance. For example, when it is injected into blood, it is degraded by an RNA degrading enzyme. Also, RNA usually cannot pass through the skin keratinized layer. Therefore, a nanoparticle substrate such as nanoegg or nanocube (inc. Enclose in a nano-egg). Alternatively, siRNA can be modified by, for example, binding a target-inducing molecule such as an adhesion factor or an antibody molecule or PEG to both ends of the siRNA, thereby increasing the stability in the cell.

As another method for effectively expressing and acting on siRNA in the body, there is an expression vector for the siRNA of the present invention, that is, an expression DNA vector obtained by incorporating a DNA corresponding to the siRNA as a foreign DNA fragment. As such an expression vector, an appropriate vector system known to those skilled in the art can be appropriately selected and prepared by an appropriate method known in the art. Such a DNA fragment corresponding to the siRNA of the present invention can also be easily prepared by any method known to those skilled in the art.

  In such an expression vector, a “hairpin type” or “stem” in which a DNA sequence corresponding to the sense strand of siRNA and a DNA sequence corresponding to the antisense strand are encoded in one DNA downstream of the promoter. There is a type called "loop type". This is transcribed in the body into hairpin (stem loop) RNA, and then undergoes an enzymatic reaction to produce siRNA.

Specific examples of such expression vectors include various viral vectors such as adenoviral vectors and lentiviral vectors. Adenovirus vectors are capable of gene introduction into a wide range of cells including primary cultured cell cells such as epidermal keratinocytes, which are generally considered to be extremely difficult to introduce, and the introduction efficiency is almost 100%. Transgenes usually reside outside the host cell chromosome and are rarely integrated into the chromosome. Therefore, the expression of the transgene is transient and usually 1 to 4 weeks. In addition, gene transfer efficiency in vivo is extremely high. For example, for mouse skin, adenovirus is contacted for several hours after repeated adhesion and detachment with cellophane tape (tape stripping), and almost 100 times into the epidermis. % Gene transfer is possible. Lentiviral vectors can also be introduced into non-dividing cells such as nerve cells, and furthermore, since the transgene is integrated into the host chromosome, a system capable of long-term expression of the transgene for more than one year is possible. It is.

  A carrier containing the above siRNA as an active ingredient and an siRNA expression vector can be prepared by methods known to those skilled in the art. Moreover, the composition containing these contains arbitrary components known to those skilled in the art, such as buffers and adjuvants, depending on the purpose, components and the like, and further, depending on the use and administration method thereof. It can be in any form such as a solution, suspension or emulsion.

  In the method of the present invention, transfection of cells can be performed by any method known to those skilled in the art. For example, transfection can be performed in vivo by administering the above-described composition of the present invention into an animal body including a human by an appropriate route using an appropriate means such as injection. In such a case, the method of the present invention functions as a gene therapy method for patients with atopic dermatitis. Alternatively, as shown in the examples below, transfection can be performed in vitro on various cultured cell lines.

The present invention will be described below with reference to examples, but the present invention is not limited to these examples.

(Example 1: Construction of a PKCηshRNA-expressing lentiviral vector)
In order to stably and constitutively express PKCηshRNA in cultured cells and suppress the expression of PKCη, a PKCshRNA expressing lentiviral vector was constructed.
First, a 56-base sense oligonucleotide (GATCTGGATT CAAAGATTGC AGAACACGAA TGTTCTGCAA TCTTTGAATC CTTTTT: including a 21-base oligonucleotide (GGATTCAAAG ATTGCAGAAC A: SEQ ID NO: 1) complementary to the base sequence number 998 to 1018 of the gene encoding human PKCh: Expression unit shuttle vector (pENTR-H1) Was inserted between the BglII site and the XbaI site of the multiple cloning site. Similarly, a 56-base sense oligonucleotide (GATCTGGTAA ATGCGGTGGA ACTTGCCGA CCGCATTTAC CTTTTT: SEQ ID NO: 6) containing a 21-base oligonucleotide complementary to the base sequence from 1193 to 1213 (GGTAAATGCGGTGGAACTTGC: SEQ ID NO: 2) and complementary thereto 56-base antisense oligonucleotide (CTAGAAAAAG GTAAATGCGG TGGAACTTGC GCTTGCAAGT TCCACCGCAT TTACCA: SEQ ID NO: 7), 21-base oligonucleotide complementary to the 1675th to 1695th base sequences (GCTTCTATGC TGCAGAAA TC A: SEQ ID NO: 3) A 56-nucleotide sense oligonucleotide (GATCTGCTTC TATGCTGCAG AAA TCACGAA TGATTTCTGC AGCATAGAAG CTTTTT: SEQ ID NO: 8) and a 56-base antisense oligonucleotide (CTAGAAAAAG CTTCTATGCT GCAGAAATCA TTCGTGATTT CTGCAGCATA GAAGCA: SEQ ID NO: 9) That , It was inserted into pENTR-H1, were constructed total of three kinds of vectors. In addition, as a negative control, a 56-base sense oligonucleotide (GATCTCAACA AGATGAAGAG CACCAACGAA TTGGTGCTCT TCATCTTGTT GTTTTT: SEQ ID NO: 11) and a 56-base antisense oligonucleotide (CTAGAAAAAC AACAAGATGA AGAGCACCAA TTCGTTGGTG CTCTTCATCT TGTTGA: SEQ ID NO: 12) containing a sequence complementary thereto were also inserted into pENTR-H1 and cloned. These vectors were recombined and cloned into a target gene expression unit vector (CS-CDF-RfA-ETBsdP :) sandwiched between LTR sequences using GatewayLR clone (invitrogen). Each of these four types of unit vectors, a helper vector for expressing HIVgp protein (pCAG-HIVgp) and a helper vector for expressing VSV-G, Rev protein (pCMV-VSV-G-RSV-Rev) Then, 293T cells were transfected using the calcium phosphate method, cultured for 2 to 3 days, and the lentiviral vector produced in the medium was collected. Also, by this process, the constructed PKCηshRNA-expressing lentiviral vector targets the sequence of SEQ ID NO: 1, targets the sequence of shη # 1, SEQ ID NO: 2, and targets the sequence of shη # 2 and SEQ ID NO: 3. The shη # 3, negative control shRNA expression lentiviral vector is designated shScr.

(Example 2. Establishment of PKCη knockdown HacaT cells)
HacaT cells (H. Hans. Et al. Evperimental Cell Reseach 239, 399, 1998) are human immortalized keratinocytes that express PKCh. This cell was infected with the above-mentioned PKCηshRNA-expressing lentiviral vector to establish PKCη knockdown HacaT cells. HacaT cells in a 60mm dish 2.5x10 ⁵ cells / dish
The cells were seeded at a cell density of (fetal bovine serum 10% / DMEM medium) and cultured overnight at 37 ° C. in the presence of 5% CO ₂ . shη # 1, shη # 2, shη # 3 and shScr are added to 2 ml of the medium so that the multi-infectivity becomes 10, and further, protamine sulfate is added so that the final concentration is 6 μg / ml, and the temperature is kept at 37 ° C. for 24 hours. The culture was performed in the presence of 5% CO ₂ . Thereafter, the medium was replaced with 10 ml of fresh medium and further cultured for 48 hours.

  In order to confirm that the expression of PKCη was suppressed, the expression of PKCη mRNA was measured by quantitative real-time PCR as follows.

Total RNA was isolated and purified from the cultured cells using RNAspin Mini (GE Healthcare) according to the attached instructions. The expression level of PKCη was determined by quantitative real-time PCR. In brief, total RNA was converted to cDNA using the Goscript Reverse Transcript System (Promega). The material was amplified by carrying out 40 cycles of 2-step PCR using ABI StepOne System (Applied Biosystems) in the presence of SYBR Green real-time PCR reagent FastStartUniversal SYBR Green Master (Roche) and specific primers. Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) was used as an internal standard.

The used primers are as follows.
PKCh:
Sense primer 5'-GGGCCAGACCAGCACCAAGC-3 '(SEQ ID NO: 13)
Antisense primer 5′-GGGTGCAGTTGGCCACGAAGT-3 ′ (SEQ ID NO: 14)

GAPDH:
Sense primer 5′-TGCACCACCAACTGCTTAGC-3 ′ (SEQ ID NO: 15)
Antisense primer 5′-GGCATGGACTGTGGTCATGAG-3 ′ (SEQ ID NO: 16)

As a result, it was revealed that PKCηsh # 1-introduced HaCaT cells were 34%, PKCηsh # 2 54%, and PKCηsh # 3 77% compared to the expression of PKCηmRNA in negative control virus vector shScr-introduced HaCaT cells. (Fig. 1)

(Example 3. PKCη knockdown in human adenocarcinoma cell PC9)
The expression of PKCη protein was analyzed by Western blotting when PKCηshRNA lentiviral vector, PKCηsh # 1, PKCηsh # 2, and PKCηsh # 3 were introduced into human adenocarcinoma cell PC9. PC9 is cultured in a fetal bovine serum 10% / RPMI1640 medium at 37 ° C. in the presence of 5% CO ₂ . PC9 cells were seeded in a 60 mm dish at a cell density of 1 × 10 ⁵ cells / dish and cultured overnight at 37 ° C. in the presence of 5% CO ₂ . PKCηshη # 1, PKCηshη # 2, PKCηsh # 3, and shScr are added to 2 ml of the medium so that the multi-infectivity is 10, and polybrene is added to a final concentration of 6 μg / ml, followed by incubation for 72 hours. did. The resulting culture was washed twice with PBS and then dissolved in 0.2 mL of lysate (50 mM Tris-HCl, 150 mM NaCl, 1 mM EDTA, 1% Triton X-100 at pH 8.0, 1 mM PMSF). Recovered with a scraper. The amount of protein was measured by BCA Protein assay kit (Pierce Biotechnology). Thereafter, centrifugation (10000 g, 15 minutes) was performed, and the supernatant solution was used for Western blot analysis. A fixed amount (20 μg) was applied to a 10% acrylamide gel and subjected to SDS-PAGE. After transferring to the PDVF membrane, blocking, primary antibody reaction (anti-PKCη polyclonal, 1: 1000, Santa Cruz), reaction with horse radish peroxidase labeled secondary antibody, and detection with a chemiluminescence detection reagent. As a result, it was confirmed that PKCη protein was remarkably suppressed by PKCηsh # 1, PKCηsh # 2 and PKCηsh # 3 (FIG. 2).

The siRNA having PKCη as a target sequence of the present invention can be used as a PKCη gene expression inhibitor and a keratinocyte differentiation induction inhibitor to elucidate differentiation of keratinocytes. Furthermore, it can be used as a preventive or therapeutic agent for dermatitis.

Sequence 1-3: Sequence encoding part of human PKCη Sequence 4-9: Artificial base sequence including part of human PKCη 10-11: Sequence sequence not existing on human genome 12, 13: Part of human PKCη Sequence sequences 14 and 15 encoding: a sequence encoding a part of human GAPDH

Claims (1)

A method for suppressing the expression of human PKCη, wherein the expression of PKCη is suppressed by RNA interference of a gene encoding PKCη, and the RNA interference is a sense oligonucleotide comprising the oligonucleotides of SEQ ID NOS: 1, 2, and 3. A method comprising using a double-stranded RNA comprising an antisense oligonucleotide strand consisting of a strand and an oligonucleotide complementary thereto.