WO2005089800A1

WO2005089800A1 - PHARMACEUTICAL COMPOSITION CONTAINING hsHRD3

Info

Publication number: WO2005089800A1
Application number: PCT/JP2005/005311
Authority: WO
Inventors: Toshihiro Nakajima; Tetsuya Amano; Satoshi Yamasaki; Naoko Yagishita; Ken Sasaki; Yukihiro Kato; Lei Zhang
Original assignee: Locomogene, Inc.
Priority date: 2004-03-17
Filing date: 2005-03-16
Publication date: 2005-09-29
Also published as: JPWO2005089800A1; US20070238677A1

Abstract

A pharmaceutical composition containing a substance capable of suppressing the multiplication of synovial tissue or synovial cells and the production of interleukin 6. There is provided a pharmaceutical composition capable of suppressing the multiplication of synovial tissue or synovial cells and the production of interleukin 6, which pharmaceutical composition is useful for diagnosing or treating of at least one disease selected from among rheumatism, fibrosis, arthritis, cancer and cranial nerve disorder. Further, there is provided a method of suppressing the multiplication of synovial cells and the production of interleukin 6, characterized in that the expression of hsHRD3 in synovial cells is suppressed.

Description

Pharmaceutical composition containing hsHRD3

The present invention relates to a pharmaceutical composition comprising human Hrd3 ortholog (isHRD3) which forms a complex with synopiolin, in particular, a pharmaceutical composition for diagnosing or treating rheumatism. Light

Background art

Rheumatoid arthritis (RA) is a systemic inflammatory disease with abnormal proliferation of synovial tissue in joints. The present inventor has identified the synoviolin gene as a gene essential for abnormal growth of synovial tissue (W document O 02/052007).

Synoviolin is a membrane protein present in synovial cells from RA patients, and encodes an E3 upicitin ligase having a RING finger motif. This motif plays an important role in protein ubiquitination, but in fact, it has been shown to have auto-ubiquitination activity and to cause ubiquitination of P4HA1, a protein essential for collagen synthesis (WO 02 Recently, it has been found that synopiolin is also involved in the development of fibrosis, cancer or cranial nerve disease (Genes Dev. 2003 Vol. 17, ρ.2436 · 49).

Synoviolin is highly conserved from yeast to humans, and detailed analysis has been performed on budding yeast. Hrdlp (HMG-CoA Reductase Degradation 1), a gene involved in the degradation of cholesterol reductase, a budding yeast ortholog of synopiolin, forms a functional complex with the budding yeast Hrd3p (HMG-CoA Reductase Degradation 3). It has been found to be involved in the degradation of abnormal proteins in the endoplasmic reticulum (JCB 2000. Vol.151, ρ.69 · 82). However, the function of Hrd3p is not clear.

Interleukin-6, together with interleukin-1 and TNF-α, is called an inflammatory site, and is a site that causes various inflammatory reactions. Usually produced by cells of the immune system, but various proliferative factors such as rheumatoid synovial cells, leukemia, and myeloma

1

II Corrected Paper (Rule 91) It is also produced by disease-causing cells and is essential for their growth. Diseases involving In-Yu-Ichiguchi-6 include rheumatism, multiple myeloma, Castleman's disease, Crohn's disease, systemic juvenile idiopathic arthritis, systemic lupus erythematosus, and osteoporosis. Interleukin-6 may bind to interleukin-6 receptor expressed on the cell surface, or may bind to receptor released from the cell surface and bind to cells that do not express the receptor, resulting in inflammation. In some cases, it induces a reaction. Inflammation of leukin-6 includes differentiation of B cells into antibody-producing cells, increased production of C-reactive protein in liver, induction of platelets in bone marrow, induction of immune system cells to inflammatory sites, leukocytes And the induction of blood vessels through the induction of VEGF. Recently, an anti-interleukin-6 receptor antibody, which inhibits the binding of interleukin-6 to its receptor, has been produced, and is effective against rheumatism, myeloma, and Crohn's disease. Disclosure of the invention

The present invention provides a pharmaceutical composition comprising a substance that suppresses abnormal growth of synovial cells and production of interleukin-6, and a method for suppressing synovial cell growth, which comprises suppressing hsHRD3. As an issue.

The present inventor has conducted intensive studies in order to solve the above problems. In the hrd3-disrupted strain of S. cerevisiae, the Hrdlp protein is unstable and decreased, and it has been reported that the substrate is physiologically stabilized and increased.Therefore, the human Hrd3p ortholog is also similar to Synoviolin. It was found to be essential for the production of abnormal growth of interleukin-6 in synovial tissue. The present inventors considered that hsHRD3 is effective for suppressing new inflammatory reactions and for developing diagnostic and therapeutic methods for rheumatism, fibrosis, arthropathy, cancer and cranial nerve diseases, and completed the present invention. Was.

That is, the present invention is as follows.

(1) A pharmaceutical composition comprising a substance that suppresses the growth of synovial cells.

Examples of the substance that suppresses the growth of synovial cells include a Synoviolin expression inhibitor. A substance inhibiting the expression of synoviolin is a substance that suppresses the expression of a gene encoding hsHRD3, preferably a substance that inhibits the expression of a gene encoding hsHRD3. Examples include siRNA (small interfering RNA) or shRNA (sliort hairpin UNA).

Specifically, the gene encoding hsHRD3 contains the following DNA (a) or (b). That is,

(a) DNA comprising the nucleotide sequence of SEQ ID NO: 1

(b) DNA that hybridizes with a DNA consisting of a nucleotide sequence complementary to a DNA consisting of the nucleotide sequence of SEQ ID NO: 1 under stringent conditions, and encodes a protein having hsHRD3 activity.

Furthermore, the siRNA may target a part of the base sequence shown in SEQ ID NO: 1.

The pharmaceutical composition of the present invention is used for diagnosing or treating at least one disease selected from rheumatism, fibrosis, arthritis, cancer and cranial nerve disease.

(2) A method for suppressing synovial cell proliferation, which comprises suppressing the expression of hsHRD3 in synovial cells.

(3) A method for inducing apoptosis in synovial cells, cancer cells, leukemias or malignant tumors, comprising suppressing the expression of hsHRD3 in synovial cells.

(4) A method for suppressing the production of collagen in synovial cells, lung fibrosis or cirrhosis, which comprises suppressing the expression of hsHRD3 in synovial cells.

(5) From the group consisting of synovial cells, cancer cells, leukemia cells, osteosarcoma cells, malignant tumor cells, immune system cells, and osteoclasts, characterized by inhibiting the expression of hsHRD3 in synovial cells A method for suppressing the production of insulin-leukin-6 from at least one selected cell.

(6) A pharmaceutical composition comprising a substance that suppresses interleukin-6 production.

Examples of the substance that suppresses the production of interleukin-6 include a substance that inhibits the expression of synoviolin. Examples of the substance inhibiting the expression of synoviolin include a substance that suppresses the expression of a gene encoding hsHRD3, preferably an siRNA or shRNA against a gene encoding hsHRD3.

Specifically, the gene encoding hsHRD3 contains the following DNA (a) or (b). That is, (a) DNA comprising the nucleotide sequence of SEQ ID NO: 1

(b) DNA that hybridizes with a DNA consisting of a nucleotide sequence complementary to the DNA consisting of the nucleotide sequence shown in SEQ ID NO: 1 under stringent conditions, and encodes a protein having hsHRD3 activity.

Furthermore, the siRNA may target a partial sequence of the nucleotide sequence of the gene encoding hsHRD3.

The pharmaceutical composition of the present invention is used for diagnosing or treating at least one disease selected from rheumatism, multiple myeloma, Castleman's disease, Crohn's disease, systemic juvenile idiopathic arthritis, systemic lupus erythematosus and osteoporosis. used. Further, the pharmaceutical composition of the present invention can also suppress an inflammatory response.

In the methods described in the above (2) to (5), the expression of hsHRD3 in synovial cells can be suppressed, for example, by inhibiting the binding of hsHRD3 to synoviolin. Brief Description of Drawings

FIG. 1 is a diagram showing the domain structures of Hi'd3p and SELlL / hsHRD3.

FIG. 2 is a diagram showing that expression of SEIL / hsHRD3 by siRNA was suppressed.

FIG. 3 is a diagram showing that the proliferative activity of synovial cells was suppressed by suppressing the expression of SEIL / hsHRD3.

FIG. 4 is a diagram showing that apoptosis of synovial cells was induced by suppressing the expression of SEIL / hsHRD3.

FIG. 5 shows that apoptosis to synovial cells was induced by suppressing the expression of SEIL / hsHRD3.

FIG. 6 is a diagram showing that synoviolin protein in synovial cells was reduced by suppressing the expression of SEIL / hsHRD3.

FIG. 7 is a diagram showing that collagen production of synovial cells was suppressed by suppressing the expression of SEIL / hsHRD3.

FIG. 8 is a view showing that SEIL / hsHRD3 and synopiolin formed a complex. FIG. 9 is a diagram showing that SEIL / hsHRD3 and synoviolin co-localize in the endoplasmic reticulum.

FIG. 10 is a diagram showing that the production of interleukin-6 in synovial cells was suppressed by suppressing the expression of SELlL / hsHRD3.

FIG. 11 is a diagram showing that expression of both proteins was suppressed by suppressing expression of SELlL / hsHRD3 and synoviolin.

FIG. 12A shows that SELlL / hsHRD3 is unstable in the absence of synoviolin.

FIG. 12B shows that SELlL / hsHRD3 is unstable in the absence of Synoviolin. BEST MODE FOR CARRYING OUT THE INVENTION

Hereinafter, the present invention will be described in detail.

The present invention relates to a pharmaceutical composition effective for diagnosing and treating diseases such as rheumatism, which comprises a substance that suppresses the expression of hsHRD3 and suppresses abnormal growth of synovial cells and production of interleukin-6.

Synopiolin is highly conserved from yeast to humans, and detailed analysis has been performed on budding yeast. Hrdlp, a budding yeast ortholog of synoviolin, has been found to form a functional complex with Hrd3p and is involved in the degradation of abnormal proteins in the endoplasmic reticulum. In hrd3-disrupted strains of S. cerevisiae, Hi'dlp was destabilized and decreased, and stabilization and increase of physiological substrates were reported. This suggests that the human Hrd3p ortholog (hsHRD3), like synoviolin, is essential for the abnormal proliferation of synovial tissue and is effective in diagnosing new joint diseases and developing therapeutic methods.

Thus, in the present invention, a homologous search was first performed using the amino acid sequence of budding yeast Hrd3p, and as a result, a known gene called SEL1L was found. The amino acid sequence homology between Hi'd3p and SEL1L is 30%, the similarity is 45%, and the difference is not high, but the specific repeating structure and transmembrane domain are preserved. Therefore, SEL1L was determined to be an ortholog of Hrd3p (FIG. 1). Then double stranded It was confirmed that treatment of synovial cells with RNA (siRNA) can suppress hsHRD3 expression (Fig. 2). Under these conditions, the cell proliferation activity of synovial cells was markedly reduced (Fig. 3). Approximately 30% of the cells had apoptosis (Figs. 4 and 5).

In budding yeast, Hrd3p is essential for stabilizing Hrdlp. When the Synoviolin protein was detected by Western blot, the Synoviolin protein was significantly reduced under hsHRD3 suppression (Fig. 6). When the expression of Synoviolin is suppressed, the amount of collagen production also decreases. Then, when the amount of collagen in the cells was measured, it was also reduced compared to the control (Fig. 7). Furthermore, it was revealed that hsHD3 forms a complex with synopiolin in cells (Fig. 8), and both are localized in the endoplasmic reticulum (Fig. 9). Interleukin-6, which plays an important role in synovial cell proliferation, also decreased to 63.2% (Figure 10). When no Synoviolin protein was present in the cells, hsHRD3 was significantly reduced (FIG. 11), and was very unstable (FIGS. 12A and 12B).

These results indicate that the approach targeting hsHRD3 is effective in developing new diagnostics and therapeutics for RA and other arthritis, fibrosis, cancer and cranial nerve diseases. In particular, it is useful for the development of drugs based on the mechanism of action that controls the expression and function of Synoviolin through the control of the expression and function of SELlL / hsHRD3.

1. Synovial cell growth inhibition

In the present invention, “synovial cells” refers to a series of cells that are abnormally proliferating in a joint site of a rheumatic patient, and includes synovial tissue.

In the present invention, “hsHRD3” is a human ortholog of a protein called “Hrd3p” that binds to yeast synoviolin Hrdlp to form a functional complex and is involved in the degradation of abnormal proteins in the endoplasmic reticulum. Say. Synopolin is highly conserved from yeast to humans, and detailed analysis has been performed especially on budding yeast. Hrd3p, the ortholog of S. cerevisiae, has a homology of 30% homology with the amino acid homology and 45% similarity.A gene called SEL1L, which has a specific repetitive structure and a conserved transmembrane domain, was found. HsHRD3 later Was. This hsHRD3 consists of the nucleotide sequence shown in SEQ ID NO: 1 and a nucleotide sequence substantially identical to such a sequence. A substantially identical nucleotide sequence refers to a nucleotide sequence that hybridizes under stringent conditions with a DNA consisting of a nucleotide sequence complementary to the DNA consisting of SEQ ID NO: 1 and encodes a protein having hsHRD3 activity. . “HsHRD3 activity” refers to the activity of degrading abnormal proteins in the endoplasmic reticulum. Such a DNA encoding hsHRD3 is prepared by preparing a probe by using an appropriate fragment by a method known to those skilled in the art, and using this probe for colony hybridization, plaque hybridization, and Southern blot. It can be obtained from a cDNA library and a genomic library by a known hybridization method. Stringent conditions in the above hybridization include, for example, a salt concentration of 100 to 500 mM, preferably 150 to 300 mM during washing in the hybridization, and a temperature of 50 to 70 ° C, preferably 55 to 70 ° C. ~ 65 ° C.

The amino acid sequence of hsHRD3 is shown in SEQ ID NO: 2, and the amino acid sequence of Hrd3p is shown in SEQ ID NO: 3.

When the expression of hsHKD3 is suppressed, the proliferation activity of synovial cells is remarkably suppressed. Synovial cells are cells that serve as normal joint components, and that produce synovial fluid that fills the inner layer of the joint cavity.

In order to suppress the expression of the Synoviolin gene, a method of suppressing the expression of hsHRD3 is adopted. To suppress the expression of hsHRD3, a phenomenon called RNAi can be used, but site-directed mutagenesis using genetic engineering techniques, antisense nucleotides, and lipozymes may also be used.

RNAi is a phenomenon in which dsRNA (double-strand RNA) binds specifically and selectively to a target gene, and the expression of the target gene is efficiently inhibited by cleaving the target gene. For example, when dsRNA is introduced into a cell, expression of a gene having a sequence homologous to that RNA is suppressed (knocked down).

In order to cause the above-mentioned RNAi, for example, siRNA or shRNA for the synoviolin gene may be designed and synthesized, and then used. Alternatively, suppressing the expression of the gene encoding hsHRD3 does not suppress the expression of Synoviolin. it can.

The design criteria for siRNA are as follows.

(a) Select a region 100 nucleotides downstream from the start codon of the gene encoding Synoviolin.

(b) From the selected region, take a sequence of 15 to 30 consecutive bases, preferably 19 bases, starting with AA, and select a sequence having a GC content of 30 to 70%, preferably 35 to 45%. select.

Specifically, those having the following nucleotide sequences can be used as siRNA.

Sense strand: CUUGAUAUGGACCAGCUUUTT (SEQ ID NO: 4) Antisense strand: AAAGCUGGUCCAUAUCAAGTT (SEQ ID NO: 5) In order to introduce siRNA into synovial cells, a method in which siRNA synthesized in vitro is ligated to plasmid DNA and introduced into cells Alternatively, a method of annealing double-stranded RNA can be employed.

Thus, treating the synovial cells with the siRNA suppresses the expression of hsmiD3.

The present invention can also use shRNA to produce an RNAi effect. shRNA is an RNA molecule having a stem-loop structure because a part of a single strand forms a complementary strand with another area, which is called a short hairpin RNA. shRNAs can be designed so that part of them form a stem-loop structure. For example, assuming that the sequence of a certain region is sequence A and the complementary strand to sequence A is sequence B, sequence A, spacer, and sequence B are such that these sequences are present in one RNA strand. Ligation is designed so that the total length is 45-60 bases. Sequence A is a sequence of a partial region of the hsHRD3 gene (SEQ ID NO: 1) to be a target, and the target region is not particularly limited, and any region can be a candidate. The length of sequence A is 19 to 25 bases, preferably 19 to 21 bases. To measure the proliferation of synovial cells, add an appropriate amount of alamarBlue to the culture medium, and measure the fluorescence intensity at 590 nm with the excitation wavelength at 540 nm several hours later.

Furthermore, suppresses the expression of the synoviolin gene or the gene encoding hsHRD3 For example, site-directed mutagenesis can be used. Site-directed mutagenesis is well known in the art and is commercially available, for example,

GeneTailor ™ Site-Directed Mutagenesis System (Invitrogen), TaKaRa Site-Directed Mutagenesis System (utan-K, Mutan-Super Express Km, etc. (Yukara Bio Inc.)) can be used.

The present invention provides a method for suppressing the expression of Synoviolin by inhibiting the formation of a complex localized in the endoplasmic reticulum formed by binding of hsHRD3 and Synoviolin.

When sHRD3 and synopiolin combine to form a complex, the expression of synopiolin increases. In this case, the complex of hsHKD3 and synopiolin is located in the endoplasmic reticulum. Proteins undergoing biosynthesis in the lumen of the endoplasmic reticulum are unstable and are exposed to various physicochemical stresses (eg, ischemia, hypoxia, heat shock, amino acid starvation, genetic mutation, etc.). Such stress is called endoplasmic reticulum stress (ER stress) and increases the frequency of the appearance of unfolded proteins with abnormally folded structures in the endoplasmic reticulum. Defective or damaged proteins that have an abnormal conformation due to lack of an appropriate higher-order structure do not exit the endoplasmic reticulum and are not transported to the Golgi apparatus, and as such, defective proteins accumulate in the endoplasmic reticulum. In response to these ER stresses, cells respond to UPR (Unfolded Protein Response) and ERAD (Endplasmic Reticulum-Associated Degradation) by using the endoplasmic reticulum-specific stress response mechanism called defective proteins. By controlling the quality of the endoplasmic reticulum by preventing the endoplasmic reticulum from decomposing and accumulating such defective proteins, it maintains cell function homeostasis. In the hrd3-disrupted strain of S. cerevisiae, Hrdlp protein is unstable and decreased, and the substrate is physiologically stabilized and increased. HsHRD3, which forms a part of this, is considered to be involved in this quality control function.

In other words, when the expression of hsHRD3 is suppressed, the amount of hsHRD3 that binds to synoviolin decreases, and as a result, the expression of synoviolin is also suppressed.

Also, when synoviolin expression increases, ERAD is enhanced, Decreased susceptibility to apoptosis due to ER stress, and conversely, suppression of synoviolin expression increases susceptibility to apoptosis. Therefore, when hsHRD3 expression is suppressed, the function of synoviolin also decreases, and as a result, apoptosis increases.

On the other hand, for collagen, synoviolin plays an essential role in collagen synthesis by maintaining its quality as an enzyme through ubiquitination of P4HA1, a protein essential for collagen synthesis. When synoviolin expression is suppressed, the enzymatic activity of P4HA1 decreases, and collagen synthesis decreases. Therefore, when hsHRD3 expression is suppressed, the function of synoviolin also decreases, and as a result, collagen synthesis decreases.

Therefore, hsHRD3 is also essential for abnormal growth of synovial tissue, similar to synopiolin, and by suppressing hsHRD3 expression, suppressing synovial cell proliferation, synovial cells, cancer cells, leukemia or malignant It can induce tumor apoptosis and inhibit the production of collagen in synovial cells, lung fibrosis or cirrhosis, so that new rheumatism, fibrosis, arthropathy, cancer and cranial nerve disease diagnosis, And therapies can be developed.

The above-mentioned synoviolin expression inhibitory substance which suppresses the proliferation of synovial cells is also a substance which suppresses the production of intitanic Dikin-6.

Interleukin-6 not only plays a key role in B lymphocyte proliferation and differentiation, but also plays an important role in the immune response, hematopoietic response, inflammatory response, and proliferation / differentiation of nervous system cells, or their function. Is a typical site power-in to have. Its effects include the induction of platelets in the bone marrow, the induction of immune system cells to sites of inflammation, the contribution of leukocyte resistance to apoptosis, the induction of blood vessels through the induction of VEGF, the differentiation of B cells into antibody-producing cells, Increasing production of C-reactive protein in the liver. Inulin-leukin-6 is normally produced by cells of the immune system, but is also produced by rheumatoid synovial cells, cells that cause various proliferative diseases such as leukemia and myeloma, and is essential for their growth. Diseases involving interleukin-6 include rheumatism, multiple myeloma, Castleman's disease, Crohn's disease, systemic juvenile idiopathic arthritis, systemic lupus erythematosus, and osteoporosis. In addition, for chronic inflammatory proliferative diseases It is known that interleukin-6 plays an important role in the formation of pathological conditions, and abnormal expression of the interleukin-6 gene causes autoimmune diseases such as rheumatism and blood It has been clarified that the onset of multiple myeloma and plasmacytoma such as leukemia caused by the transformation of these cells into cancer is induced. For example, interleukin-6 is significantly increased in synovial fluid in rheumatoid patients, the growth factor of plasmacytoma / multiple myeloma is interleukin-6 itself, and interleukin-6 is myeloid. It acts on leukemia cells, suppresses proliferation, and induces differentiation into macrophages.

Therefore, by suppressing the production of interleukin-6 in synovial cells, cancer cells, leukemia cells, osteosarcoma cells, malignant tumor cells, immune cells and osteoclasts, these rheumatism It can suppress the onset of autoimmune diseases, multiple myeloma, leukemia, etc., which occur when cells in the blood become cancerous.

In order to suppress the production of interleukin-6, the above-mentioned substance inhibiting the expression of synopolin that suppresses the proliferation of synovial cells can be used. Specifically, siRNA or shRNA against the gene encoding hsHRD3, which is a substance that suppresses the expression of the gene encoding hsHRD3, can be used.

2. Pharmaceutical composition

(1) a pharmaceutical composition comprising a substance that suppresses the growth of synovial cells

The diseases to which the pharmaceutical composition of the present invention can be applied include cell proliferative diseases such as rheumatism, fibrosis, arthritis, and cancer, and cranial nerve diseases.The disease can be applied singly or in combination with a plurality of diseases. .

When the pharmaceutical composition of the present invention is used as a therapeutic agent for cancer, the site of application is not particularly limited. Brain tumor, tongue cancer, pharyngeal cancer, lung cancer, breast cancer, esophagus cancer, stomach cancer, knee cancer, biliary tract cancer, gallbladder Cancer, duodenal cancer, colorectal cancer, liver cancer, uterine cancer, ovarian cancer, prostate cancer, renal cancer, bladder cancer, rhabdomyosarcoma, fibrosarcoma, osteosarcoma, chondrosarcoma, skin cancer, various leukemias (eg acute bone marrow Applicable for leukemia, acute lymphocytic leukemia, chronic myelogenous leukemia, chronic lymphocytic leukemia, adult T-cell leukemia, malignant lymphoma), etc.

The above cancers, whether they were primary or metastatic, were associated with other diseases It may be something.

Examples of the cerebral nervous system disease include Alzheimer's disease, Parkinson's disease, and Polydalmin's disease.

(2) a pharmaceutical composition comprising a substance that suppresses interleukin-6 production

The diseases to which the pharmaceutical composition of the present invention is applied include rheumatism, multiple myeloma, Castleman's disease, Crohn's disease, systemic juvenile idiopathic arthritis, systemic lupus erythematosus, osteoporosis and the like.

Interleukin 6 is also a site that causes many of the symptoms associated with inflammation (pain, fever, etc.). Therefore, the pharmaceutical composition of the present invention can also suppress an inflammatory response. The inflammatory response refers to a local tissue reaction caused by infection, trauma, burns, or allergens in a living body, and also includes a systemic phenomenon associated with the local reaction. Specifically, it is 50 years of inflammation by adding dysfunction to redness, fever, pain, and swelling. These show the gross features of acute inflammation, but this phenomenon is due to local vascular changes: vasodilation, increased permeability, and leukocyte infiltration.

The dosage form of the pharmaceutical composition of the present invention containing a substance that suppresses the production of abnormally growing interleukin-6 in synovial tissue as an active ingredient can be any of oral and parenteral administration. In the case of oral administration, it can be administered as a liquid or in an appropriate dosage form. In the case of parenteral administration, examples include a pulmonary dosage form (for example, using a nephrizer), a nasal dosage form, a transdermal dosage form (eg, an ointment, a cream), an injection dosage form, and the like. . In the case of an injection, it can be administered systemically or locally, for example, by intravenous injection such as infusion, intramuscular injection, intraperitoneal injection, subcutaneous injection and the like.

When the pharmaceutical composition of the present invention is used as a gene therapy agent, there are mentioned a method of directly administering the pharmaceutical composition of the present invention by injection, and a method of administering a vector into which a nucleic acid has been incorporated. Examples of the above vectors include an adenovirus vector, an adeno-associated virus vector, a herpes virus vector, a vaccinia virus vector, a retrovirus vector, a lentivirus vector, and the like. Can be administered more efficiently.

Further, the pharmaceutical composition of the present invention is introduced into phospholipid vesicles such as ribosomes, It is also possible to administer the endoplasmic reticulum. The endoplasmic reticulum retaining the pharmaceutical composition of the present invention is introduced into predetermined cells by the lipofection method. Then, the obtained cells are systemically administered, for example, from a vein or an artery. It can also be administered locally to the brain and the like. To introduce the pharmaceutical composition of the present invention into a target tissue or organ, a commercially available gene transfer kit (for example, AdenoExpress: Clonetech) can also be used. The pharmaceutical composition of the present invention can be formulated according to a conventional method, and may contain a pharmaceutically acceptable carrier or additive. Such carriers and additives include water, pharmaceutically acceptable organic solvents, collagen, polyvinyl alcohol, polyvinylpyrrolidone, lipoxyvinyl polymer, sodium carboxymethylcell sodium, sodium polyacrylate, Sodium alginate, water-soluble dextran, sodium carboxymethyl starch, pectin, methylcellulose, ethylcellulose, xanthan gum, gum arabic, casein, agar, polyethylene lendalicol, diglycerin, glycerin, propylene glycol, petrolatum, paraffin, stearyl alcohol, Stearic acid, human serum albumin, mannitol, sorbitol, lactose, surfactants acceptable as pharmaceutical additives and the like.

The above-mentioned additives are selected singly or in appropriate combination from the above depending on the dosage form of the therapeutic agent of the present invention. For example, when used as an injectable preparation, a substance that inhibits the abnormal growth of purified synovial tissue is dissolved in a solvent (eg, physiological saline, buffer, glucose solution, etc.), and Tween 80 and Tween 20 are added. , Gelatin, human serum albumin and the like can be used. Alternatively, it may be freeze-dried to give a dosage form that dissolves before use. As the lyophilization excipient, for example, sugar alcohols and sugars such as mannitol and glucose can be used.

The dose of the pharmaceutical composition of the present invention varies depending on age, sex, symptoms, administration route, administration frequency, and dosage form. The administration method is appropriately selected according to the age and symptoms of the patient. The effective dose is Ol / ig lOOmg / kg body weight per dose, preferably l-10g. However, the above therapeutic agent is not limited to these doses. The dosage in the case of Adenou-virus 10 ⁶ ~ per day: a 101 ³ or so, is administered at 1-8 week intervals. However, the pharmaceutical composition of the present invention is limited to these dosages. There is no. When the siRNA is mixed, the dose is 0.01 to:! 0 zg / ml, preferably 0.1 to 1 II g / ml.

Hereinafter, the present invention will be described more specifically with reference to examples. However, the present invention is not limited to these examples.

(Example 1)

Homology search using budding yeast Hrd3p

A homology search was performed using the amino acid sequence of the budding yeast Hrd3p / Ylr207wp.

As a result, a protein corresponding to the amino acid sequence encoded by the nucleotide sequence shown in SEQ ID NO: 1, which is a human ortholog of yeast Hrd3p, was identified, and the SEL1L gene was found. The amino acid sequence of Hrd3p is shown in SEQ ID NO: 3. The amino acid sequence homology between Hrd3p and SEL1L is 30% and the similarity is 45%. Both are not high, but the specific repeating structure and transmembrane domain are conserved. Therefore, SEL1L was determined to be an ortholog of Hrd3p (Figure 1).

(Example 2)

Examination of suppression of SELlL / hsHRD3 expression

(DRA synovial cells were transfected with double-stranded RNA (siRNA) for each gene, and the cells were collected 96 hours later. RNA was extracted and the expression level of each gene was quantified by RT-PCR.

That is, on the day before the transfusion, synovial cells isolated from a rheumatic patient were placed on a 6 cm dish, and 1 × 104 cells were seeded. One dish was seeded for each of the three RNAi oligos and the RNA oligo-free (negative control) sample, for a total of four seeds. The medium used was 3 ml of DMEM (Dulbecco's Modified Eagle's Medium, Sigma D6046) containing 10% FBS (fetal calf serum) and no antibiotic. Twenty-four hours later, the cells were washed once with 3 ml of serum-free and antibiotic-free DMEM, and 1.6 ml of the same DMEM was added.

Thereafter, a transfection reagent was added. The transfection reagent is Was adjusted as follows. For RNAi targeting Gi, hsHRD3, and Synoviolin, the RNA oligos shown in the following sequence (SEQ ID NOs: 4 to 9) were dissolved in TE to a final concentration of IOOM.

Sense strand of siRNA targeting hsHRD3: CUUGAUAUGGACCAGCUUUTT (SEQ ID NO: 4)

Antisense strand of siRNA targeting sHRD3: AAAGCUGGUCCAUAUCAA GTT (SEQ ID NO: 5)

Sense siRNA strand targeting GFP: GGCUACGUCCAGGAGCGCATT (SEQ ID NO: 6)

Antisense strand of siRNA targeting GFP: UGCGCUCCUGGACGUAGCCT T (SEQ ID NO: 7)

SiRNA C sense strand targeting Synoviolin: GGUGUUCUUUGGGCAACU GAGTT (SEQ ID NO: 8)

Antisense strand of siRNA targeting synoviolin: CUCAGUUGCCCAAAG AACACCTT (SEQ ID NO: 9) The sense strand and antisense strand of the RNA oligo for each gene were mixed at 20 × M. After heat denaturation at 90 ° C for 2 minutes, both oligos were annealed by gentle cooling at 37 ° C for 1 hour. Solution A was prepared by mixing the annealed 20 z M RNA oligo 101 with 350 l of Optimem. Next, 8 liters of Oligofectamine ™ Reagent (In vitrogen, Cat. No. l2252-01l) was mixed with Optimen 321 to prepare solution B. After incubating solution A and solution B for 5 minutes, they were mixed and incubated for another 15 minutes. The whole amount of the mixed solution 400 1 was added to each dish in which the medium was replaced. Four hours later, 200/21 FBS was added.

96 hours after the addition of the transfusion reagent, total RNA was extracted from the cells by the phenol extraction method and used for RT-PCH. For RT-PCR, SUPERSCRIPT ™ One-Step RT-PCT 100 Reactions (Invitogen Cat. No.10928-042) was used. That is, mix 2 x RXN mixture 50 1, RT / Platinum 2 h DEPC water 28 1, each of the following amplification primers 3.2 l / M solution 10 l x 2, total lOO l, 10 l / l 05 005311

Dispensed into PCR tubes. Then, 1 / l of RNA was added as RT-PCR type II to start the PCR reaction.

Oligomer for hsHRD3 amplification (5 '-> 3 ゥ: GGCTGAACAGGGCTATG (SEQ ID NO: 10)) Oligomer for hsHRD3 amplification (3'-> 5 '): CCGCTCGAGTTACTGTGGTGGCTGCTG CTC (SEQ ID NO: 11)

Oligomers for synoviolin amplification (5,-> 3,): AGCTGGTGTTTGGCTTTGAG (SEQ ID NO: 12)

Oligomers for synoviolin amplification (3 '-> 5'): GGGTGGCCCCTGATCCGCAG (SEQ ID NO: 13)

hGAPDH Amplification oligomer (5 '-> 3,): AGGTGAAGGTCGGAGTCAACGGA (SEQ ID NO: 14)

hGAPDH Amplification oligomer (3 '-> 5'): AGTCCTTCCACGATACCAAAGTTG (SEQ ID NO: 15)

100, 50, 10 ng RNA without RNA oligo and lOOng RNA. The cycle was performed once at 50 ° C for 30 minutes and at 94 ° C for 2 minutes for the cDNA extension reaction, followed by 94 ^ 30 seconds, 50 ° C for 30 seconds, and 72 ° C for 30 times for the PCR amplification reaction, and finally at 72 ° C. After performing a final extension reaction for 5 minutes, the mixture was stored at 4 ° C. To this PCR reaction solution, 21 6X sample buffer was added, and the whole amount was electrophoresed with 0.8% agarose at 100 ports for 30 minutes to detect a PCR product by UV illuminator overnight.

As a result, the expression of SEIL / hsHRD3 was suppressed by the siRNA (FIG. 2). In Figure 2, RNAi of hsHRD3 reduced the amount of PCR product to the same level as without 10 ng oligo (negative control), indicating that the expression level of hsHRD3 mRNA was suppressed to 10% or less. . At this time, synoviolin mRNA was at the same level as lOOng of oligo-free GFP RNAi, indicating that suppression of hsHRD3 expression did not affect the transcription of synoviolin.

(2) RA synovial cells were transfected with double-stranded RNA (siRNA) for each gene, and alamarBlue ™ was added 48 hours later. After 48 hours, the cell growth activity was measured. In other words, the day before transfusion, synovial cells isolated from rheumatic patients were

Each well of a 96-well plate was seeded with 160 cells. The medium contained 10 l of DMEM (Dulbecco's Modified Eagle's Medium, Sigma D6046) containing 10% FBS (fetal calf serum) and no antibiotics. Twenty-four hours later, the cells were washed once with 100 l of DMEM containing neither serum nor antibiotics, and 80 l of the same DMEM was added. Thereafter, 20 ml of the transfection reagent prepared in the same manner as in Example 2 (1) was added to each well in which the medium was replaced. After an additional 4 hours, FBS was added 10/21. Forty-eight hours after the addition of the Transfection Reagent, 10 ml of alamarBlue ™ was added to each well. After incubating at 37 ° C for 48 hours, the fluorescence intensity at 590 nm when excited at 560 nm was measured.

As a result, suppression of SEIL / hsHRD3 expression suppressed synovial cell proliferation activity to about 60% (Fig. 3).

This means that hsHRD3, like Synoviolin, is important for cell proliferation of RA synovial cells, and suppression of its expression causes a decrease in cell proliferation.

(3) RA synovial cells were transfected with double-stranded RNA (siRNA) for each gene, and the cells were collected 120 hours later. The recovered cells were stained with propidium iodide, and the DNA content was measured by FACS.

That is, the day before the transfusion, 1 × 10 ⁴ cells were seeded on a 6 cm dish of synovial cells isolated from a rheumatic patient. Three samples of each of the three RNAi oligos and one without the RNA oligo (negative control) were seeded on one dish each, for a total of four. The medium used was 3 ml of DMEM (Dulbecco, s Modified Eagle's Medium, Sigma D6046) containing 10% FBS (fetal calf serum) and no antibiotics. Twenty-four hours later, the cells were washed once with 3 ml of DMEM containing neither serum nor antibiotics, and 1.6 ml of the same DMEM was added. Thereafter, a total of 400 l of the transfusion reagent prepared in the same manner as in Example 2 (1) was added to each dish in which the medium was replaced. After a further 4 hours, 200 ^ 1 of FBS was added.

After 120 hours from the addition of the Transfection reagent, all cells were collected, solubilized with 0.5 ml of PBS (-) / 0.2 Triton X-100, and the cell mass was removed through a mesh. 1 ml of 50 ig / ml RNase / PBS (-) and lral of 100 ig / ml propidium iodide P / PBS (-) was added, mixed, and stored on ice. The amount of fluorescence of each cell was measured by FACSCalibur (BECTON DICKINSON) and analyzed by CELLQuest. As a result, as shown in FIG. 4, the cell group having a DNA content of 2n or less, which is considered to have undergone apoptosis, was increased to 30% or more by RNAi of hsHI D3. This ratio was as high as RNAi for synoviolin (Fig. 5). This means that hsHRD3 is an essential gene for synovial cell proliferation like Synoviolin, and its suppression suppresses a high frequency of apoptosis.

(Example 3)

(1) Detection of Synoviolin using Western plot under suppression of SELlL / hsHRD3 expression

RA synovial cells were transfected with double-stranded RNA (siRNA) for each gene, and the cells were collected 48 hours later. The total extract was extracted, and each protein was detected by Western plot.

That is, the day before the transfusion, synovial cells isolated from a rheumatic patient were placed in a 10 cm dish, and 9 × 10 ⁴ cells were seeded. One dish was seeded for each of the three types of RNAi oligos and no RNA oligo (negative control), for a total of four seeds. The medium used was 10 ml of DMEM (Dulbecco's Modified Eagle's Medium, Sigma D6046) containing 10% FBS (fetal calf serum) and no antibiotics. Twenty-four hours later, the cells were washed once with 10 ml of serum-free and antibiotic-free DMEM, and 9 ml of the same DMEM was added. Thereafter, 1.2 ml of a three-fold amount of the transfection reagent prepared in the same manner as in Example 2 (1) was added to each dish in which the medium was replaced. Four hours later, 1 ml of FBS was added.

Forty-eight hours after the addition of the Transfection Reagent, harvest all cells and extract 50 1 extraction buffer IV (50 mM Tris-HCl pH 7.5, 2 mM EDTA, 0.1% Triton Χ100, 1% NP-40, 500 mM NaCL lmM After resuspending in PMSF, 0.1% aprotinin, 0.5 g / ml lupeptin A (PepstatinA), 1 g / ml leupeptin), place on ice for 30 minutes, 14000 rpm, 4 Centrifugation was performed at 30 ° C for 30 minutes. The supernatant was transferred to Bio-Rad DC Protein Assay Reagent (BIO-RAD Cat. To measure the protein concentration, 15 xl of 4X SDS buffer was added to the remaining 451, and the mixture was heated at 100 ° C for 5 minutes. The cell extract equivalent to lO ^ g was electrophoresed and separated on two 7.5% acrylamide gels, and plotted on a nitrocellulose membrane (OPTITRAN BA-S 85 REINFORCED NC, Schleicher & SchuelL Cat. No.10 439196). Blocked with Luk for 30 minutes.

The cells were incubated with a 1000-fold diluted anti-sinopiolin monoclonal antibody (lODa) or anti-CREB-1 antibody (Santa Cruze, Cat. No. sc-58) as a primary antibody for 30 minutes. HRP-conjugated stake-mouse IgG (Amersham Biosciences Cat.No.NA931V) diluted 2000-fold was used as the secondary antibody of the anti-Synoviolin monoclonal antibody, and HRP-conjugated anti-Egret diluted 3000-fold was used as the anti-CREB-1 antibody. Incubation was performed for 30 minutes using IgG (Amersham Biosciences, Cat. No. NA931V). For the detection, Home-made ECL (44 l of 90 mM coumaric acid, 100 l of 250 mM luminol, 6 ml of hydrogen peroxide mixed with 20 ml of lOOmM Tris pH 8.5) was used. As a result, synopiolin protein was significantly reduced under SELlL / hsHRD3 suppression (Fig. 6). In other words, it was revealed that suppression of hsHRD3 expression causes destabilization of synopiolin protein.

(2) Examination of collagen production under suppression of Synoviolin expression

RA synovial cells were transfected with double-stranded RNA (siRNA) for each gene, and cells were harvested 48 hours later. A total extract was prepared and the amount of intracellular collagen was measured.

That is, a transfection and cell extract were prepared in the same manner as in Example 3 (1), 30 g of the extract was adjusted to 100 1 with extraction buffer IV, and then SIRCOL Collagen Assay Kit (QBS / The amount of collagen was measured using Funakoshi Cat. No. S 1111).

As a result, cells knocked out of hsHRD3 had an intracellular collagen content reduced to about 70% as compared to the control (GFP) (FIG. 7).

That is, hsHRD3 promotes collagen production through stabilization of synoviolin protein. By suppressing the expression of hsHRD3, the amount of synoviolin protein decreases, and the amount of collagen production can be reduced. (Example 4)

Intracellular complex formation of SELlL / hsHRD3 and Synoviolin

HEK293 cells were transfected with plasmids of SP-HA-lisHRD3B and FLAG-Synobiolin. After 48 hours, the cells were collected and the total extract was prepared. Immunoprecipitation was performed with anti-FLAG antibody (a) or anti-HA antibody (b), and Western blotting was performed with each antibody.

That is, immediately after the hsHRD3B signal peptide (SP), a plasmid (SP-HA-hsHRD3B) constructed so that an HA-tag is inserted between amino acids 26 and 27 of the amino acid sequence shown in SEQ ID NO: 1 ) Was cloned into pcDNA3-vector-1.

8 × 105 HEK293 cells were seeded on four 10 cm dishes. Twenty-four hours later, four combinations of the following plasmids (c) to (f) were transfected.

(c) 10 g of SP-HA-hsHRD3B / pcDNA3 and 3 g of pCAGGS-vector

(d) 10 si of SP-HA-hsH D3B / pcDNA3 and 3 ng of FLAG-Synobiolin / pCAGGS

(e) FLAG-Synobiolin / pCAGGS with 10 g pcDNA3-vector

(f) l0 xg of SP-HA-hsHRD3B / pcDNA3 and 3 g of FLAG-Synobiolin / pCAGGS.After 48 hours of transfection, cells were collected and 200 xl of extraction buffer 11 (10 mM Tris-HCl pH7.5). , 150 mM NaCL 0.5% NP'40, 10 mM MgCl 2 10% glycerol 5 mM EGTA, 20 mM NaF, 50 mM] 3 - glycerin port phosphate _{(glycerophosphate), 1 mM Na 3} V0 4, 10 mM NEM (Ν 'Ethylmaleimide), 1 mM PMSF, 1 mM DTT, 0.1% aprotinin, 0.5 g / ml leptin A, 1 xg / ml leptin), and incubate on ice for 30 minutes. And centrifuged at 4 ° C for 30 minutes. The extract equivalent to 100 g of protein was adjusted to 1 ml with Extraction Buffer II. At this time, bovine serum albumin was added at a final concentration of 0.5%. Next, 4.9 mg of anti-FLAG antibody (M2, SIGMA, Cat. No. F3165) was added to the extract from transfusion (c) (d), and 2.4 g to the extract from (e) (f). mg of anti-HA antibody (12CA5, Roche, Cat. No. 583 816) was added, and the mixture was allowed to infiltrate at 4 ° C. while penetrating. The next day, 60 ^ 1 of 50% slurry protein-G Sepharose beads was added, and the mixture was further incubated at 4 ° C for 1 hour. Wash the beads twice with 0.5 ml of Extraction Buffer II and twice with 0.5 ml of Extraction Buffer II + 150 mM NaCl (final concentration 300 mM NaCl), add 30 1 2X SDS sample buffer, and heat at 100 ° C. Adsorbed protein was eluted by heating for 5 minutes. SDS-PAGE and Western plot were performed in the same manner as in Example 3 (1) to detect immunoprecipitated proteins.

As a result, it was found that SELlL / hsHKD3 forms a complex with synopiolin in cells (Fig. 8).

(2) Co-localization of SELL / hsHRD3 and Synoviolin in cells

HEK293 cells were transfected with the SP-HA-hsHRD3B and FLAG-Sinovirin plasmids. After 24 hours, the cells were fixed, and immunostained with anti-HA antibody and anti-Sinovirin monoclonal antibody.

That is, 2000 HEK293 cells were seeded in each chamber of one chamber slide. Twenty-four hours later, transfection was performed with 0.15 / ig SP-HA-hsHRD3B / pcDNA3 and 0.05 / z g FLAG-Synobiolin. 48 hours after the transfusion, the cells were fixed with 4% paraformaldehyde for 30 minutes, and 1% blocked with 3% BSA / PBS (-). The next day, anti-HA antibody (3F10, Roche, Cat.No. l 867 431) diluted with 0.3% BSA / PBS (-) and anti-Sinovirin monoclonal antibody (10 Da) diluted 100-fold to a final concentration of lng / l ), The anti-HA antibody was detected with an anti-rat Ig FITC antibody (DAKO, Cat. No. F0234), and the anti-Synoviolin antibody was detected with an anti-mouse Ig TRITC antibody (DAKO, Cat. No. R0270). Observation and photographing of the samples were performed with a confocal laser scanning microscope LSM510 (Carl Zeiss Co., Ltd.), and image analysis was performed with LSM510_v3,0.

As a result, SELlL / hsHRD3 and Synoviolin were co-localized in the endoplasmic reticulum (Fig. 9). In Figure 9, the left column shows the localization of hsHRD3 (green), and the middle column shows the synoviolin. The localization diagram (red) and the right column are the superimposed diagrams (yellow).

These results indicated that hsHRD3 forms a complex with synoviolin in the endoplasmic reticulum. (Example 5)

Examination of interleukin-6 production under suppression of SELlL / hsHRD3 expression

(1) RA synovial cells were transfected with double-stranded RNA (siRNA) for each gene, and the medium was replaced with a new one 96 hours later. After a further 24 hours, the medium was recovered, and the amount of ink-leukin-6 contained therein was measured.

That is, on the day before the transfusion, 1 × 10 ⁴ cells were seeded on a 6 cm dish with synovial cells isolated from a rheumatic patient. One dish was used for each of the three samples without RNAi and no RNA oligo (negative control). A total of four dishes were seeded. The medium used was 3 ml of DMEM (Dulbecco's Modified Eagle's Medium, Sigma D6046) containing 10% FBS (fetal calf serum) and no antibiotics. Twenty-four hours later, the cells were washed once with 3 ml of serum-free and antibiotic-free DMEM, and 1.6 ml of the same DMEM was added. Thereafter, the entire amount of 400 / l of the transfection reagent prepared in the same manner as in Example 2 (1) was added to each dish in which the medium was replaced. After another 4 hours, 200 il of FBS was added.

96 hours after the addition of the transfusion reagent, the medium was replaced with a new one. After culturing for 24 hours, the medium was collected and centrifuged at 14000 rpm for 30 min at 4 ° C. The amount of interleukin-6 protein contained in the supernatant was measured with an ELISA Kit (BIOSOURCE Immunoassay Kit for Human IL'6, Cat. # KHC0061). At the same time, cells were collected, and 20 L of extraction buffer 111 (10 mM Tris-HCl pH 7.5, 5 mM EDTA, 1% NONIDET P-40, 0.1% SDS, 200 mM NaCl 10 mM N-ethyl maleimide (NEM ), 1 mM phenylmethylsulfonylfluoride (PMSF), 1 mM dithiothreitol, 0.1% apollotinin, 0.5 g / ml leptatin A, 1 ug / ml leptin) and dissolve on ice. Minutes left. After centrifugation at 14000 rpm for 30 min at 4 ^, the supernatant was used for protein concentration measurement using Bio_Rad DC Protein Assay Reagent (BIO-RAD, Cat. Park mass was calculated. The value obtained by dividing the amount of interleukin-6 protein in the medium by the total protein mass was graphed (FIG. 10).

As a result, suppression of the expression of SELlL / hsHRD3 reduced the production of interleukin-6 protein to 63.2% as compared to control (Fig. 10). That is, it became clear that SELlL / hsHRD3 is an essential factor for interleukin-6 production.

(2) 15 l of 4X SDS buffer was added to 45 / i l of the total cell extract prepared in the above (1), and the mixture was heated at 37 ° C for 10 minutes. The corresponding cell extract was electrophoresed and separated on a 7.5% acrylamide gel, and blotted using a nitrocellulose membrane (ΟΡΤΠΈΑΝ BA-S 85 REINFORCED NC, Schleicher & Schuell, Cat.No. 10 439196). Blocked with milk for 30 minutes.

Incubation was performed for 30 minutes with a 1000-fold diluted anti-SELlL / hsHRD3 peptide antibody as the primary antibody. As a secondary antibody, HHP-conjugated anti-Egret IgG (Amersham Biosciences, Cat. No. NA934V) diluted 10000-fold was used to incubate for 30 minutes. For detection, an ECL plus Western Blotting Detection System (Amersnam Biosciences, Cat. No. RPN2132) was used.

After detection, blocking was performed again, and incubation was performed for 30 minutes using a 1000-fold diluted anti-Synobiolin antibody and a 5000-fold diluted anti-α-tubulin antibody (SIGMA Clone II-5Β-2) as primary antibodies. HRP-conjugated anti-mouse IgG (Amersham Biosciences, Cat. No. NA93lV) diluted 10000-fold was used as the secondary antibody and incubated for 30 minutes. For detection, an ECL plus Western Blotting Detection System (Amersham Biosciences, Cat. No. RPN2132) was used.

As a result, the expression of both proteins was no longer monitored due to the suppression of the expression of SELlL / hsHRD3 and Synoviolin (Fig. 11). That is, it was found that both proteins were mutually stabilized.

(Example 6)

Stability of SELlL / hsHRD3 and the effect of complex formation with Synoviolin

Add SP-HA-lisHRD3B and vector or FLAG-Synobiolin to HEK293 cells Was transfection. Thirty-six hours later, cycloheximide was added to start the Chase Atsey. After 0, 1, 2, 4, and 6 hours, cells were collected and the total extract was prepared. Each protein was detected and quantified by Western plot.

That is, 2 × 105 HEK293 cells were seeded on a 6-well plate. Twenty-four hours later, plasmids of the following two combinations (g) and (li) were transfected.

(g) 0.5 g of SP-HA-hsKRD3B / pcDNA3 and 0.25 g of pcDNA3-vector

(h) 0.5 z g SP-HA-hsHRD3B / pcDNA3 and 0.25 FLAG-Synobiolin / pcDNA3

After 36 hours of transfection, the medium was replaced with fresh one. After a further 2 hours, cycloheximide was added to a final concentration of 30 g / ml. Collect the cells after 0, 1, 2, 4 and 6 hours, and use 50 1 extraction buffer (10 mM Tris-HCl pH 7.5, 5 mM EDTA, 1% NONIDET P-40, 0.1% SDS, 200 mM NaCl 10 mM N.ethylmaleimide (NEM), 1 mM phenylmethylsulfonyl fluoride (PMSF), 1 mM dithiothreitol, 0.1% aprotinin, 0.5 g / ml peptide A, 1 g / ml ruthenium (Peptin) and placed on ice for 30 minutes. After centrifugation at 14000 i'pm for 30 min at 4 ° C, supernatant 11 was used for protein concentration measurement using Bio-Rad DC Protein Assay Reagent (BIO-RAD, Cat. No. 500-0116). To the remaining 45 l, 151 of 4X SDS buffer was added and heated at 37 ° C for 10 minutes. A 10 xg equivalent of cell extract was electrophoresed and separated on a 7.5% acrylamide gel, and blotted using a nitrocellulose membrane (OPTITRAN BA-S 85 REINFORCED NC, Schleicher & Schuell, Cat.No. 10 439196). Blocked with skim milk for 1 晚. The cells were incubated with the 10000-fold diluted anti-HA antibody (3F10, Roche, Cat. No. 867431) as the primary antibody for 30 minutes, and incubated with the 10000-fold diluted HRP-conjugated anti-rat IgG for 30 minutes. For detection, an ECL plus Western blotting Detection System (Amersham Cat. No. RPN2132) was used. Detected bands were quantified with ImageJ Software. For an accurate measurement, a standard curve was prepared using two- and four-fold dilutions of the sample at time 0, and the ratio was estimated based on the standard curve.

As a result, SELlL / hsHRD3 had a half-life of 4.3 hours in the absence of synoviolin. The time was reduced to less than half, 1.8 hours (Fig. 12A, B). In other words, it was found that SELlL / hsHD3 becomes unstable in cells if it cannot form a complex with synoviolin. Industrial applicability

The present invention provides a pharmaceutical composition comprising a substance that suppresses abnormal growth of synovial cells (including synovial tissue) and production of interleukin-6. Since this substance can suppress abnormal growth of synovial tissue or synovial cells, it can be used to diagnose or treat at least one disease selected from rheumatism, fibrosis, arthropathy, cancer and cranial nerve disease. Useful as a product. Sequence listing free text

SEQ ID NO: 4: DNA / RNA binding molecule

SEQ ID NO: 5: DNA / RNA binding molecule

SEQ ID NO: 6: DNA / RNA binding molecule

SEQ ID NO: 7: DNA / RNA binding molecule

SEQ ID NO: 8: DNA / RNA binding molecule

SEQ ID NO: 9: DNA / RNA binding molecule

SEQ ID NO: 10: synthetic DNA

SEQ ID NO: 11: synthetic DNA

SEQ ID NO: 12: synthetic DNA

SEQ ID NO: 13: Synthetic DNA

SEQ ID NO: 14: Synthetic DNA

SEQ ID NO: 15: Synthetic DNA

Claims

The scope of the claims

1. A pharmaceutical composition comprising a substance that suppresses the growth of synovial cells.

2. The pharmaceutical composition according to claim 1, wherein the substance that suppresses the growth of synovial cells is a synopiolin expression inhibitor.

3. Expression inhibitors Shinobiorin The pharmaceutical composition of claim 2, wherein the expression of the gene encoding the h _S HRD3 a suppression win material.

4. The pharmaceutical composition according to claim 3, wherein the substance that suppresses the expression of the gene encoding hsHRD3 is siRNA or shRNA against the gene encoding hsHRD3.

5. The pharmaceutical composition according to claim 3, wherein the gene encoding hsHRD3 comprises the following DNA of (a) or (b).

(a) DNA comprising the nucleotide sequence of SEQ ID NO: 1

(b) DNA that hybridizes with a DNA consisting of a nucleotide sequence complementary to a DNA consisting of the nucleotide sequence shown in SEQ ID NO: 1 under stringent conditions and encodes a protein having hsHRD3 activity

6. The pharmaceutical composition according to claim 4, wherein the siRNA targets a partial sequence of the nucleotide sequence shown in SEQ ID NO: 1.

7. The pharmaceutical composition according to any one of claims 1 to 6, for diagnosing or treating at least one disease selected from rheumatism, fibrosis, arthritis, cancer and cranial nerve disease.

8. A method for suppressing synovial cell proliferation, comprising suppressing hsHRD3 expression in synovial cells.

9. A method for inducing apoptosis of synovial cells, cancer cells, leukemias or bad tumors, comprising suppressing the expression of hsHRD3 in synovial cells.

10. A method for suppressing the production of collagen in synovial cells, lung fibrosis or cirrhosis, which comprises suppressing the expression of hsHRD3 in synovial cells.

1 1. From the group consisting of synovial cells, cancer cells, leukemia cells, osteosarcoma cells, malignant tumor cells, immune system cells and osteoclasts, characterized by inhibiting the expression of hsHRD3 in synovial cells. Production of interleukin-6 from at least one selected cell How to suppress.

12. Inhibition of the expression of hsHRD3 is by inhibition of binding between h _S HID3 and Shinobiorin A method according to any one of claims 8-1 1.

1 3. A pharmaceutical composition comprising a substance that suppresses interleukin-6 production.

14. The pharmaceutical composition according to claim 13, wherein the substance that suppresses the production of interleukin-6 is a Synoviolin expression inhibitor.

15. The pharmaceutical composition according to claim 14, wherein the synopioline expression inhibitor is a substance that suppresses the expression of a gene encoding hsHRD3.

16. The pharmaceutical composition according to claim 15, wherein the substance that suppresses the expression of the gene encoding hsHRD3 is siRNA or shRNA against the gene encoding hsHRD3.

17. The pharmaceutical composition according to claim 15 or 16, wherein the gene encoding hsHRD3 comprises the following DNA (a) or (b).

(a) DNA comprising the nucleotide sequence of SEQ ID NO: 1

18. The pharmaceutical composition according to claim 16, wherein the siRNA targets a part of the base sequence shown in SEQ ID NO: 1.

19. Claim to diagnose or treat at least one disease selected from the group consisting of rheumatism, multiple myeloma, Castleman's disease, Crohn's disease, systemic juvenile idiopathic arthritis, systemic lupus erythematosus and osteoporosis. Item 13. The pharmaceutical composition according to any one of Items 13 to 18.

20. The pharmaceutical composition according to any one of claims 13 to 18, which can suppress an inflammatory response.