JP2016513470A - Ribonucleic acids having 4'-thio-modified nucleotides and related methods - Google Patents

Abstract

To produce messenger RNA molecules and related compositions that incorporate a 4'-thio modification within the furanose ring of at least one nucleotide residue, and encoded therapeutic proteins in vivo, and to treat or prevent a disease or disorder Discloses methods of using these mRNAs. In certain embodiments, the 4'-thio-modified mRNA provides improved stability and / or reduced immunogenicity in in vivo therapy.

Description

  This application claims the benefit of US Patent Application No. 61 / 785,098, filed March 14, 2013, under 35 USC 119 (e), the entirety of which is incorporated herein by reference. Incorporated by reference.

  The present invention relates to messenger ribonucleic acids (mRNA) comprising 4'-thio-modified nucleotide residues, compositions comprising these mRNAs, and methods of making and using them.

Gene therapy using messenger RNA has been proposed as an approach for the treatment of various diseases. The concept of messenger RNA (mRNA) introduction as a means of protein production in the host has been previously reported. Yamamoto, A .; et al. Eur. J. et al. Pharm. 71: 484-489 (2009), Debus, H. et al. et al. J. et al. Control Rel. 148: 334-343 (2010). However, successful administration of mRNA for protein production in vivo typically required that the mRNA be packaged (eg, mRNA complexed with a polymer or lipid carrier). For example, see International Patent Application Publication Nos. WO2011 / 06810 and WO2012 / 170930. Administration of unpackaged (naked) mRNA required that chemically modified nucleotides be incorporated into the mRNA in order to provide a more stable and beneficial treatment. For example, M.M. Kormann et al. Nature Biotech. 29: 154-159 (2011), K.M. See Kariko, Molecular Therapy 16 (11): 1833-1840 (2008).
Administration of mRNA encoding a therapeutic protein that can be produced in vivo can provide significant advantages over administration of DNA encoding the therapeutic protein and direct administration of the therapeutic protein. However, while the development of therapeutic mRNAs that encode therapeutic proteins represents a promising advance in medical therapy, the usefulness of such therapies is the poor stability of mRNA, particularly mRNA encoding full-length proteins, in vivo. It can still be limited by gender.
In particular, poor stability of mRNA used in gene replacement therapy can lead to in vivo poor or less optimal production of the encoded therapeutic protein. Following administration of mRNA encoding a therapeutic protein, the mRNA can undergo degradation upon, for example, in vivo exposure to one or more nucleases. Ribonucleases (eg, endoribonucleases and exoribonucleases) represent a class of nuclease enzymes that can catalyze the degradation of RNA into smaller components, thereby making it impossible to produce therapeutic proteins in mRNA. Thus, nuclease enzymes (eg, ribonucleases) can shorten the circulating half-life of mRNA prepared, for example, synthetically or recombinantly. After degradation by nucleolysis, mRNA is not translated, thus preventing its intended therapeutic benefit from being exerted, which can significantly reduce the effectiveness of mRNA gene therapy.

International Publication No. 2011/06810 International Publication No. 2012/170930

Yamamoto, A .; et al. Eur. J. et al. Pharm. 71: 484-489 (2009) Debus, H.C. et al. J. et al. Control Rel. 148: 334-343 (2010) M.M. Kormann et al. Nature Biotech. 29: 154-159 (2011) K. Kariko, Molecular Therapy 16 (11): 1833-1840 (2008)

  The present invention provides improved modified mRNAs for more stable, robust, and sustained in vivo protein production. In part, the present invention further improves the stability of mRNA used to produce therapeutic proteins in vivo by incorporating modified ribonucleotides in which the 4 ′ oxygen in the ribose moiety is replaced by sulfur. Based on the recognition that it can be improved. Replacement of the 4 'oxygen with sulfur in the ribose portion of the ribonucleotide is described in S.H. Hoshika et al. (Nuc.Ac.Res.Supp.3: 209-210 (2003)) and M.M. Takahashi, M .; et al. (Nuc. Ac. Res. 37: 1353-1362 (2009)), both reports contain up to 15 residues long 4′-thio residues for RNA interference Short RNA fragments 19-19 residues long, including 4'-thio-modified nucleotides, and RNA interference (Dande et al., J. Med. Chem. 49: 1624-1634 ( 2006)) and aptamer expression (up to 59 residues long; Hoshika et al., Nuc. Ac. Res. 32: 3815-3825 (2004), Kato et al., Nuc. Ac. Res. 33: 2942-2951 (2005), Minagawa et al., Bioorg.Med.Chem.16: 9450-9456 (200). 8)) has been reported. However, these reports generally have a much longer length than any interfering RNA or aptamer tested in the prior art, do not exist in a uniform double stranded state, are large non-helical and / or 4′-thioribo to full-length mRNA (ie, mRNA encoding a full-length functional therapeutic protein and optionally containing one or more non-coding regions) that can take the form of a three-dimensional structure having a single chain component. The effect of nucleotide incorporation is not predictive. More importantly, prior to the present invention, it was unclear whether mRNA incorporating 4'-thio-modified nucleotides could be successfully used for protein production in vivo. As described herein, including the Examples, we have added one or more 4′-thio-modified nucleotides (eg, 4′-thio-ATP, 4′-thio-UTP, 4 We have successfully synthesized full-length mRNA incorporating '-thio-GTP and / or 4'-thio-CTP). Despite concerns about the length of the mRNA, we have up to 100% 4'-thio-ATP, 100% 4'-thio-UTP, 100% 4'-thio-GTP, and / or Alternatively, full-length mRNA incorporating 100% 4′-thio-CTP could be synthesized. As shown in the examples, such modified mRNAs are more stable than unmodified mRNAs, and surprisingly, such extensive modifications do not affect the ability of the modified mRNAs to be effectively translated in vivo. It seems.

  Accordingly, the present invention provides, for example, mRNAs that allow better control over mRNA stability, immunogenicity, and translation efficiency, and compositions comprising these mRNAs and optionally carriers, and these mRNAs and compositions Are used to induce in vivo expression of therapeutic proteins for the treatment of diseases and / or disorders.

  In some embodiments, the invention provides an mRNA molecule having a coding region and optionally one or more non-coding regions, wherein the mRNA incorporates a 4′-thio-substituted furanose ring. An mRNA molecule is provided. In some embodiments, provided mRNA comprises at least about 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, incorporating a 4′-thio-substituted furanose ring. 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% nucleotide residues contains. In some embodiments, provided mRNA contains 100% nucleotide residues that incorporate a 4'-thio-substituted furanose ring. In some embodiments, provided mRNA is up to 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, Contains 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% 4'-thio-ATP. In some embodiments, provided mRNA is up to 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, Contains 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% 4'-thio-UTP. In some embodiments, provided mRNA is up to 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, Contains 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% 4'-thio-GTP. In some embodiments, provided mRNA is up to 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, Contains 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% 4'-thio-CTP. In some embodiments, provided mRNAs contain various 4'-thio-modified NTP combinations described herein.

  In some embodiments, the provided mRNA comprises a non-coding region. In some embodiments, the provided mRNA comprises a poly-A and / or poly-U tail. In some embodiments, the provided mRNA comprises a 5 'cap structure.

  In some embodiments, provided mRNA further comprises at least one non-standard nucleotide residue. In some embodiments, the at least one non-standard nucleotide residue is selected from one or more of 5-methyl-cytidine, pseudouridine, and 2-thio-uridine. In some embodiments, at least one non-standard nucleotide residue incorporates a 4'-thio-furanose ring. In some embodiments, up to 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% of the non-standard nucleotide residues incorporate a 4'-thio-furanose ring.

  In some embodiments, provided mRNA is at least 60 residues long. In some embodiments, the provided mRNA is at least about 70, about 80, about 90, about 100, about 150, about 200, about 300, about 400, about 500, about 1,000, about 1,500. , About 2,000, about 2,500, about 3,000, about 3,500, about 4,000, about 4,500, or about 5,000 residues long.

  A further embodiment of the invention is a composition comprising at least one mRNA molecule having a coding region and optionally one or more non-coding regions, wherein the mRNA comprises a 4′-thio-substituted furanose ring and a carrier. Compositions are provided that comprise at least one nucleotide residue to be incorporated. In some embodiments, provided compositions are at least one mRNA having a coding region and optionally one or more non-coding regions, wherein the mRNA comprises a 4′-thio-substituted furanose ring and a carrier. It includes at least one nucleotide residue to be incorporated, and the mRNA is at least 60 residues long. In certain embodiments, the composition of the invention comprises at least one mRNA molecule having a coding region and optionally one or more non-coding regions, wherein the mRNA incorporates a 4′-thio-substituted furanose ring. Includes mRNA molecules containing one nucleotide residue and complexed with a polymer-based carrier or lipid nanoparticles.

  The present invention relates to at least one mRNA molecule having a coding region and optionally one or more non-coding regions, wherein the mRNA comprises at least one nucleotide residue incorporating a 4'-thio-substituted furanose ring. Further provided is a method of producing a therapeutic protein in vivo comprising administering to a subject a molecule, or a composition comprising such mRNA and a carrier. The present invention also provides at least one mRNA molecule having a coding region and optionally a non-coding region, wherein the mRNA comprises at least one nucleotide residue that incorporates a 4′-thio-substituted furanose ring, or There is provided a method of treating a subject in need of a therapeutic protein comprising administering a composition comprising such mRNA and a carrier. In some embodiments, the mRNA administered in the provided methods is at least 60 residues long. The various modified mRNAs described herein can be used for the production of therapeutic proteins or for the treatment of various diseases, disorders, or conditions.

  In some embodiments, the present invention provides methods for producing proteins using the modified mRNAs described herein. Such methods of protein production can be used in in vitro cell-free systems, in vitro cell-based systems, or in vivo systems. In various embodiments, a suitable mRNA comprises at least one nucleotide residue that incorporates a 4'-thio-substituted furanose ring. In some embodiments, a suitable mRNA incorporates a 4′-thio-substituted furanose ring, up to about 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45 %, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% nucleotide residues Groups (eg, ATP, CTP, GTP, UTP, and / or non-standard NTP). In some embodiments, the provided mRNA comprises a poly (A) or poly (U) tail. In some embodiments, provided mRNA is at least 60 residues long.

  In some embodiments, the present invention provides the use of provided mRNA molecules for the manufacture of a drug capable of producing a therapeutic protein in vivo.

  In some other embodiments, the present invention provides a method of making the provided mRNA. In some other embodiments, the present invention provides methods for in vitro synthesis of provided mRNAs. In some other embodiments, the invention incorporates a 4′-thio-substituted furanose ring, up to about 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% nucleotides Methods are provided for making (eg, synthesizing in vitro) the provided mRNA containing residues (eg, ATP, CTP, GTP, UTP, and / or non-standard NTP). In some embodiments, the invention provides at least about 60, about 70, about 80, about 90, about 100, about 150, about 200, about 300, about 400, about 500, about 1,000, about 1, Make the provided mRNA of 500, about 2,000, about 2,500, about 3,000, about 3,500, about 4,000, about 4,500, or about 5,000 residues long ( For example, a method for synthesizing in vitro is provided.

  Additional objects and advantages of the invention will be set forth in part in the description which follows, and in part will be obvious from the description, or may be learned by practice of the invention. The objects and advantages of the invention will be realized and attained by means of the elements and combinations particularly pointed out in the appended claims.

  It is to be understood that both the foregoing general description and the following detailed description are exemplary and explanatory only and are not restrictive of the claimed invention. The accompanying drawings, which are incorporated in and constitute a part of this specification, illustrate several embodiments of the invention and, together with the description, serve to further explain the principles of the invention.

  The drawings are for illustration purposes only and not for limitation.

Exemplary 4′-thio RNA bases, 4′-thio-adenosine, 4′-thio-guanosine, 4′-thio-cytidine, 4′-thio-uridine, 4′-thio-5-methyl-cytidine, 4 The molecular structures of '-thio-pseudouridine and 4'-thio-2-thiouridine are shown. Figure 3 shows luciferase detection from FFL luciferase production in HEK293T cells after gene transfer of modified and unmodified FFL mRNA. Results of stability studies of modified and unmodified FFL mRNA are shown. Figure 3 shows luciferase detection from FFL luciferase production in mouse liver after administration of modified and unmodified FFL mRNA.

  As used herein, the term “mRNA” is used to refer to modified and / or unmodified RNA, including coding regions and optionally non-coding regions. The term “coding region” refers to a chain or chain of amino acids, ie, a portion or region of an mRNA that can be translated into two or more amino acids joined by peptide bonds. A chain of amino acids can also be referred to as a peptide or polypeptide that can be folded into a protein (eg, a therapeutic protein). The term “non-coding region” refers to a portion or region of mRNA that is typically not translated. The non-coding region typically includes a 5 'untranslated region and / or a 3' untranslated region, including but not limited to a poly (A) or poly (U) tail.

  A “nonstandard nucleobase” is a base moiety other than the natural bases adenine (A), cytosine (C), guanine (G), thymine (T), or uracil (U). With the exception that analogs of T are also analogs of U in general and vice versa, non-standard nucleobases can become nucleic acid duplexes (during transcription of DNA templates by RNA polymerase). Incorporation by DNA or RNA polymerase within (including local RNA-DNA helices such as those formed), the base pairing properties within the nucleic acid duplex and loci of the five nucleobases already listed An analog of a particular nucleobase (A, C, G, T, or U) when most similar to one. The term “non-standard” used in conjunction with the term “nucleoside”, “base”, “nucleotide”, or “residue” is used in conjunction with “nucleobase”. It should be interpreted in the same manner as the case.

  As used herein, the term “therapeutic protein” includes any protein that, when administered to a subject, provides a beneficial effect on the health and well being of the subject. In some embodiments, deficiency, lack, or aberrant expression of the protein in the subject results in a disease or condition. “Therapeutic protein” can also refer to a protein that is not normally present in a subject, or usually not present in sufficient amount, to achieve a desired therapeutic effect.

  The term “helper lipid” as used herein refers to any neutral or zwitterionic lipid material including cholesterol. While not wishing to be bound by any particular theory, helper lipids may add stability, stiffness, and / or fluidity within the lipid bilayer / nanoparticle.

  In order to replace the mRNA of the present invention with a messenger ribonucleic acid molecule and improve its biological properties when administered to a subject, the 4 ′ oxygen in the ribose portion of the nucleotide residue is replaced with sulfur. Certain chemically modified bases are used. Exemplary 4'-thio modified nucleotide residues for incorporation into the mRNA of the invention are depicted in Figure 1 (showing modified nucleotide residues containing a thio-substituted furanose ring). In some embodiments, 4'-thio modification of the furanose ring provides improved resistance to exonucleases, endonucleases, and / or other RNases in human serum. Such stability can provide increased RNA half-life. Thus, for example, administration of mRNA having a 4'-thio modification in the furanose ring or a composition comprising such mRNA may result in improved biological properties such as increased protein production in turn in vivo. Results in cellular uptake of mRNA with an increased half-life that contributes to

  In certain embodiments, at least 1% of the adenosine nucleotide residues in the RNA have a 4'-thio modification in the furanose ring. For example, about 1-5%, 5-15%, 15-30%, 30-50%, 50-75%, 75-90%, 90-99%, or 99-100% of adenosine in mRNA Can be 4'-thio-adenosine.

  In some embodiments, at least about 1%, about 5%, about 10%, about 15%, about 20%, about 25%, about 30%, about 35%, about 35% of adenosine residues in the mRNA. 40%, about 45%, about 50%, about 55%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 96% , About 97%, about 98%, or about 99% is 4'-thio-adenosine. In some embodiments, about 100% of the adenosine residues in the mRNA are 4'-thio-adenosine.

  In certain embodiments, at least 1% of the guanosine nucleotide residues in the RNA have a 4'-thio modification in the furanose ring. For example, about 1-5%, 5-15%, 15-30%, 30-50%, 50-75%, 75-90%, 90-99%, or 99-100% of guanosine in mRNA Can be 4'-thio-guanosine.

  In some embodiments, at least about 1%, about 5%, about 10%, about 15%, about 20%, about 25%, about 30%, about 35%, about 35% of guanosine residues in the mRNA. 40%, about 45%, about 50%, about 55%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 96% , About 97%, about 98%, or about 99% is 4'-thio-guanosine. In some embodiments, about 100% of the guanosine residues in the mRNA are 4'-thio-guanosine.

  In certain embodiments, at least 1% of the uridine nucleotide residues in the RNA have a 4'-thio modification in the furanose ring. For example, about 1-5%, 5-15%, 15-30%, 30-50%, 50-75%, 75-90%, 90-99%, or 99-100% of the uridine of mRNA is It can be 4'-thio-uridine.

  In some embodiments, at least about 1%, about 5%, about 10%, about 15%, about 20%, about 25%, about 30%, about 35%, about 35% of uridine residues in the mRNA. 40%, about 45%, about 50%, about 55%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 96% , About 97%, about 98%, or about 99% is 4'-thio-uridine. In some embodiments, about 100% of the uridine residues in the mRNA are 4'-thio-uridine.

  In certain embodiments, at least 1% of the cytidine nucleotide residues in the RNA have a 4'-thio modification in the furanose ring. For example, about 1-5%, 5-15%, 15-30%, 30-50%, 50-75%, 75-90%, 90-99%, or 99-100% of cytidine in mRNA Can be 4'-thio-cytidine.

  In some embodiments, at least about 1%, about 5%, about 10%, about 15%, about 20%, about 25%, about 30%, about 35%, about 35% of the cytidine residues in the mRNA. 40%, about 45%, about 50%, about 55%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 96% , About 97%, about 98%, or about 99% is 4′-thio-cytidine. In some embodiments, about 100% of the cytidine residues in the mRNA are 4'-thio-cytidine.

  In some embodiments, each 4'-thio-modified nucleotide in the provided mRNA is 4'-thio-uridine. In some embodiments, each 4'-thio-modified nucleotide in the provided mRNA is 4'-thio-cytidine. In some embodiments, each 4'-thio-modified nucleotide in the provided mRNA is independently 4'-thio-uridine or 4'-thio-cytidine. In some embodiments, provided mRNA is at least 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, including 100 or more 4'-thio-uridine or 4'-thio-cytidine. In some embodiments, provided mRNA comprises at least one 4'-thio-adenosine residue. In some embodiments, provided mRNA comprises at least one 4'-thio-guanosine residue. In some embodiments, provided mRNA comprises at least one 4'-thio-guanosine or 4'-thio-adenosine residue. In some embodiments, provided mRNA is at least 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, containing more than 100 4'-thio-guanosine or 4'-thio-adenosine residues.

  In certain embodiments, a fraction of nucleotide residues of one base type (eg, adenosine, guanosine, uridine, or cytidine) that have a 4′-thio modification in the furanose ring may be modified nucleotides of other base types. It varies independently of the fraction of residues.

  In certain embodiments, less than 10% of the nucleotide residues have 4'-thio modifications in the furanose ring. For example, about 1-5%, 5-10%, 3-5%, 1-3%, 0.1-1%, or 0.01-0.1% of nucleotide residues are 4′- A thio-substituted furanose ring may be incorporated.

  In other embodiments, more than 10% of the nucleotide residues have 4'-thio modifications in the furanose ring. For example, about 10-15%, 15-20%, 20-25%, 25-30%, 30-35%, 35-40%, 40-45%, or 45-50% of the nucleotide residues are A 4'-thio-substituted furanose ring may be incorporated. In some embodiments, greater than 50% of the nucleotide residues have 4'-thioRNA modifications in the furanose ring. For example, about 50-55% of nucleotide residues, 55-60%, 60-65%, 65-70%, 70-75%, 75-80%, 80-85%, 85-90%, 90 ~ 95%, 95-100%, 95-97%, 97-98%, 98-99%, 99-99.9%, or 99.9-100% incorporate a 4'-thio-substituted furanose ring .

  In some embodiments, at least about 1%, 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55% of the nucleotide residues. , 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% incorporate a 4'-thio-substituted furanose ring. In some embodiments, about 100% nucleotide residues can incorporate a 4'-thio-substituted furanose ring.

  Coding and non-coding regions within the mRNA of the invention can include non-contiguous regions of sequence. Any non-coding region may include one or more of a 5 ′ untranslated region (UTR), a 3 ′ UTR, a poly-A, poly-U, or poly-C tail, and / or a 5 ′ cap structure. . In some embodiments, the provided mRNA comprises a non-coding region. In some embodiments, the provided mRNA comprises a 5 'UTR. In some embodiments, the provided mRNA comprises a 3'UTR. In some embodiments, the provided mRNA comprises a 5 'cap structure. In some embodiments, the provided mRNA comprises a poly A tail. In some embodiments, provided mRNA comprises a 5'-UTR sequence, a 3'-UTR sequence, and a poly A tail. In some embodiments, provided mRNA comprises a 5'-UTR sequence, a coding region, a 3'-UTR sequence, and a poly A tail. In some embodiments, provided mRNA comprises a 5'-UTR sequence, a 5 'cap, a 3'-UTR sequence, and a poly A tail. In some embodiments, provided mRNA comprises a 5'-UTR sequence, a 5 'cap, a coding region, a 3'-UTR sequence, and a poly A tail.

  In certain embodiments, the poly-A, poly-U, or poly-C tail comprises nucleotide residues that incorporate a 4'-thio-substituted furanose ring. In some embodiments, only the poly-A, poly-U, or poly-C tail, or other components of the non-coding region, incorporate nucleotide residues having 4′-thio substitutions within the furanose ring. The remainder of the nucleotide residues in the mRNA molecule do not contain 4′-thio-furanose modifications. In some embodiments, the coding region comprises nucleotide residues that incorporate a 4'-thio-substituted furanose ring. In certain embodiments, both the coding and non-coding regions (if present) incorporate nucleotide residues with 4'-thio substitutions within the furanose ring. In certain embodiments, the length of the poly-A, poly-U, or poly-C tail can vary. For example, the length of the poly-A, poly-U, or poly-C tail can be at least about 50, 70, 90, 100, 150, 200, 250, 300, 400, or 500 nucleotides in length. In some embodiments, the length of the poly-A, poly-U, or poly-C tail can be less than about 90, 100, 150, 200, 250, 300, 400, or 500 nucleotides in length. In certain embodiments, the mRNA molecule may contain other modifications in addition to the 4'-thio-substituted furanose ring. For example, the molecule can incorporate non-standard nucleobases. Specific embodiments include 5-methyl-cytidine (“5mC”), pseudouridine (“ψU”), 2-thio-uridine (“2sU”), 5-methylcytosine, isocytosine, pseudoisocytosine, 5-bromo Nucleotide residue modifications such as uracil, 5-propynyluracil, 6-aminopurine, 2-aminopurine, inosine, diaminopurine, and 2-chloro-6-aminopurine cytosine, and combinations of these modifications, and other nucleotides Residue modifications may be included. Certain embodiments may further comprise additional modifications to other parts of the furanose ring or nucleotide residues, eg, nucleobases. For example, in some embodiments, a 4'-thio-substituted furanose ring can be included within an unmodified base or modified base such as, for example, pseudouridine, 2-thiouridine, and 5-methylcytidine. In certain embodiments, any of these modifications are 0-100% of nucleotide residues, such as greater than 0%, greater than 1%, greater than 10%, greater than 50%, greater than 90%, or greater than 95%, Alternatively, it can be present at 100% of the nucleotide residues individually or in combination. In some embodiments, the provided mRNA comprises at least one non-standard nucleotide residue. In some embodiments, the at least one non-standard nucleotide residue is selected from one or more of 5-methyl-cytidine, pseudouridine, and 2-thio-uridine. In some embodiments, at least one non-standard nucleotide residue in 5-methyl-cytidine. In some embodiments, at least one non-standard nucleotide residue incorporates a 4'-thio-furanose ring. In some embodiments, up to 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% of the non-standard nucleotide residues incorporate a 4'-thio-furanose ring.

  Additional modifications can include, for example, sugar modifications or sugar substitutions (eg, one or more of 2'-O-alkyl modifications, locked nucleic acids (LNA)). In embodiments where the sugar modification is a 2′-O-alkyl modification, such modification is a 2′-deoxy-2′-fluoro modification, 2′-O-methyl modification, 2′-O-methoxyethyl modification, And 2'-deoxy modifications.

  In certain embodiments, 0-100% of the mRNA can be single stranded. In certain embodiments, 0-100% of the RNA can take the form of a non-helical conformation.

  In certain embodiments, the compositions of the invention comprise mRNA in which about 100% of uridine residues are replaced with 4'-thio-uridine.

  In certain embodiments, the composition of the invention comprises an mRNA in which about 100% of uridine residues are replaced with 4′-thio-uridine and about 100% of cytidine residues are replaced with 5-methyl-cytidine. including.

  In certain embodiments, the compositions of the invention comprise mRNA in which about 100% of uridine residues are replaced with 4'-thio-pseudouridine.

  In certain embodiments, the composition of the invention comprises an mRNA in which about 100% of uridine residues are replaced with 4′-thio-pseudouridine and about 100% of cytidine residues are replaced with 5-methyl-cytidine. including.

  In some embodiments, the provided mRNA provides a beneficial biological effect, such as increased stability, improved protein production rate, and compared to the corresponding native mRNA, for example. Including, but not limited to, higher protein yields. In some embodiments, provided mRNAs have increased stability (eg, longer) when administered in vivo compared to the corresponding native mRNA (ie, the corresponding mRNA without modification). Serum half-life).

  The mRNA of the invention has an increase in the amount of therapeutic protein translated from the mRNA transcript upon administration to a subject of at least about 2.5%, 5%, compared to the corresponding mRNA without modification, 7.5%, 10%, 15%, 20%, 25%, 30%, 33%, 36%, 40%, 50%, 60%, 70%, 75%, 80%, 90%, 95%, 99%, 100%, 110%, 120%, 125%, 150%, 175%, 200%, 250%, 300%, 400%, 500%, 600%, 700%, 750%, 800%, 900% , Or 1,000%, can be more resistant to nuclease (eg, endonuclease) degradation to the extent that it results.

  In certain embodiments, the length of the modified mRNA molecule within the composition of the invention is at least 200 nucleotide residues in length. For example, the mRNA can be at least about 200, 300, 400, 400, 1000, 2000, 3000, 4000, or 5000 nucleotide residues in length. In some embodiments, provided mRNA is at least 60 residues long. In some embodiments, provided mRNA is at least about 70, about 80, about 90, about 100, about 150, about 200, about 300, about 400, about 500, about 600, about 700, about 800, About 900, about 1,000, about 1,500, about 2,000, about 2,500, about 3,000, about 4,000, about 5,000, about 6,000, or about 7000 residues long is there.

  In some embodiments of the invention, the therapeutic protein encoded by the mRNA of the invention can be any protein whose deficiency, lack, or aberrant expression results in a disease and / or condition. . In some embodiments, the therapeutic protein can be an enzyme. In other embodiments, the therapeutic protein is one that is not normally present or usually not present in sufficient amount to achieve the desired therapeutic effect.

  For example, non-limiting selections of suitable therapeutic proteins include erythropoietin, insulin, human growth hormone, cystic fibrosis membrane conductance regulator (CFTR), insulin, alpha-galactosidase A, alpha-L-iduronidase, iduronate- 2-sulfatase, N-acetylglucosamine-1-phosphate transferase, N-acetylglucosaminidase, alpha-glucosaminide acetyltransferase, N-acetylglucosamine 6-sulfatase, N-acetylgalactosamine-4-sulfatase, beta-glucosidase, galactose -6-sulfate sulfatase, beta-galactosidase, beta-glucuronidase, glucocerebrosidase, heparance sulfamidase, hyaluronidase Galactocerebrosidase, ornithine transcarbamylase (OTC), carbamoyl-phosphate synthetase 1 (CPS1), argininosuccinate synthetase (ASS1), argininosuccinate lyase (ASL), arginase 1 (ARG1), glucose-6-phosphatase, glucose- 6-phosphate translocase, glycogen debranching enzyme, lysosomal alpha-glucosidase, 1,4-alpha-glucan branching enzyme, glycogen phosphorylase, phosphofructokinase, liver phosphorylase, GLUT-2, UDP glycogen synthase, alpha -L-iduronidase, iduronate sulfate sulfatase, heparan sulfate sulfamidase, alpha-N-acetylglucose amida , Alpha-glucosaminide-N-acetyltransferase, N-acetylglucosamine-6-sulfate sulfatase, apolipoprotein E, low density lipoprotein receptor (LDLR), for example, clotting factors such as factor VIII and factor IX, Includes spinal motor neuron 1 (SMN1), phenylalanine hydroxylase, propionyl-CoA carboxylase, porphobilinogen deaminase, methylmalonyl-CoA mutase, urate oxidase, C1 esterase inhibitor, and acid alpha-glucosidase.

  In certain embodiments, the mRNA molecules of the invention can be administered as naked or unpackaged mRNA. In some embodiments, administration of mRNA within the compositions of the invention can be facilitated by the inclusion of a suitable carrier. In certain embodiments, the carrier is selected based on its ability to promote gene transfer of target cells having one or more mRNAs.

  As used herein, the term “carrier” refers to any standard pharmaceutical carrier, vehicle, diluent, excipient that is generally intended for use with the administration of biologically active agents, including mRNA. Includes forms and the like. The compositions described herein, and in particular carriers, can deliver and / or stabilize a variety of sizes of mRNA to their target cells or tissues. In certain embodiments, the compositions of the invention comprise large mRNA (eg, at least 5 kDa, 10 kDa, 12 kDa, 15 kDa, 20 kDa, 25 kDa, 30 kDa, or more mRNA, or at least 60, 70, 80, 90, 100 150, 200, 300, 400, 500, 600, 700, 800, 900, 1,000, 1,500, 2,000, 2,500, 3,000, 3,500, 4,000, 4,500 , 5,000, 5,500, 6,000, 6,500, or 7,000 residues long mRNA). The mRNA according to the invention can be synthesized according to any of various known methods. For example, mRNA according to the present invention can be synthesized by in vitro transcription (IVT). Briefly, an IVT provides a desired amount (s) of 4′-thio-modified standard and / or non-standard ribonucleotides (eg, one or more desired 4′-thio-NTP (s)). Typically implemented with linear or circular DNA templates containing a promoter that is a reservoir of ribonucleotide triphosphate containing, DTT and magnesium ions, and a suitable RNA polymerase (eg, T3, T7, or SP6 RNA polymerase) Optionally mixed with unmodified ribonucleotide triphosphate, which is a buffer system that may contain deoxyribonuclease I, and / or ribonuclease inhibitors. The exact conditions will vary according to the particular application. It is observed that 4'-thio-modified standards and / or non-standard ribonucleotides can be effectively incorporated into full length mRNA of any length.

  In some embodiments, the DNA template is transcribed in vitro for the preparation of mRNA according to the present invention. Suitable DNA templates typically have a promoter, such as a T3, T7, or SP6 promoter, for in vitro transcription, followed by the desired nucleotide sequence to encode the protein of interest and a termination signal. Typically, mRNA synthesis involves the addition of a “cap” at the end of the N-terminus (5 ′) and the addition of a “tail” at the end of the C-terminus (3 ′). The presence of the cap is important in providing resistance to nucleases found in most eukaryotic cells. The presence of the “tail” serves to protect the mRNA from exonuclease degradation.

  Thus, in some embodiments, mRNA according to the present invention comprises a 5 'cap structure. The 5 'cap is typically added as follows. First, RNA terminal phosphatase removes one of the terminal phosphate groups from the 5 'nucleotide, leaving two terminal phosphates. Subsequently, guanosine triphosphate (GTP) is added to the terminal phosphate by guanylyltransferase to produce a 5'5'5 triphosphate linkage. Thereafter, the 7-nitrogen of guanine is methylated by methyltransferase. Examples of cap structures include, but are not limited to, m7G (5 ') ppp (5' (A, G (5 ') ppp (5') A and G (5 ') ppp (5') G.

  In some embodiments, the mRNA according to the invention comprises a 3 'tail structure. Suitable 3 'tail structures include, but are not limited to, poly-A, poly-U, and / or poly-C tails. Exemplary suitable poly-A, poly-U, and poly-C tails are described above. A poly-U or poly-C tail may be added to the poly A tail or may replace the poly A tail.

  In some embodiments, mRNA according to the present invention comprises 5 'and / or 3' untranslated regions. In some embodiments, the 5 'untranslated region includes one or more elements that affect mRNA stability or translation, eg, iron responsive elements. In some embodiments, the 5 ′ untranslated region is about 50-500 nucleotides long (eg, about 50-400 nucleotides long, about 50-300 nucleotides long, about 50-200 nucleotides long, or about 50-100 nucleotides). Long).

  In certain embodiments of the invention, the carrier can be selected and / or prepared to optimize delivery of mRNA to the target cell, tissue, or organ. For example, if the target cell is a lung cell, the properties of the carrier (eg, size, charge and / or pH) effectively deliver such carrier to the target cell or organ, reduce immune clearance, and / Or may be optimized to facilitate its maintenance in the target organ. Alternatively, if the target tissue is the central nervous system, the selection and preparation of a carrier (eg, to facilitate delivery of mRNA polynucleotides to the target brain region (s) or spinal cord tissue) And / or maintenance within it and / or the use of alternative means of delivering such a carrier directly to such a target tissue. In certain embodiments, the compositions of the invention facilitate the transfer of exogenous polynucleotides from a local tissue or organ to the location where such composition is administered to one or more peripheral target organs or tissues. Can be combined with the drug.

  In certain embodiments, the carriers used within the compositions of the invention can include liposomal vesicles or other means for promoting the transfer of mRNA to target cells and tissues. Suitable carriers include polyethyleneimine (PEI), lipid nanoparticles, and liposomes, nanoliposomes, ceramide-containing nanoliposomes, proteoliposomes, both natural and synthetically derived exosomes, natural, synthetic and semi-synthetic lamellar bodies, nanoparticles, Calcium phosphor-silicate nanoparticles, sol-gel, calcium phosphate nanoparticles, silicon dioxide nanoparticles, nanocrystalline particles, semiconductor nanoparticles, poly (D-arginine), nanodendrimers, starch-based delivery systems, micelles, emulsions , Carriers, based on polymers such as, but not limited to, neosomes, plasmids, viruses, calcium phosphate nucleotides, aptamers, peptides, and other vector tags. The use of bionanocapsules and other viral capsid protein assemblies as suitable carriers is also contemplated. (Hum. Gene Ther. 19 (9): 887-95 (2008)).

  In certain embodiments of the invention, the carrier is formulated using the polymer as a carrier, alone or in combination with other carriers. Suitable polymers are, for example, polyacrylates, polyalkylcyanoacrylates, polylactic acid, polylactic acid-polyglycolide copolymers, polycaprolactone, dextran, albumin, gelatin, alginic acid, collagen, chitosan, cyclodextrin, protamine, pegylated protamine, Polyethyleneimine (PEI) may be included, including but not limited to PLL, pegylated PLL, and branched PEI (25 kDa). In some embodiments, the polymer can be one or more multi-domain block polymers. In some embodiments, the polymer can comprise a dry powder formulation of the polymer or polymers.

  The use of liposomal carriers to facilitate delivery of polynucleotides to target cells is also contemplated by the present invention. Liposomes (eg, liposomal lipid nanoparticles) are generally useful in a variety of research, industrial, and pharmaceutical applications, particularly for their use in vivo as a carrier for diagnostic or therapeutic compounds. (Lasic et al., Trends Biotechnol., 16: 307-321 (1998), Drummond et al., Pharmacol. Rev., 51: 691-743 (1999)), usually by one or more bilayer membranes Characterized as microscopic vesicles with internal water gaps isolated from external media. Liposomal bilayer membranes are typically formed by amphiphilic molecules, such as lipids of synthetic or natural origin, containing spatially separated hydrophilic and hydrophobic domains. Liposomal bilayer membranes can also be formed by amphiphilic polymers and surfactants (eg, polymerosomes, niosomes, etc.).

  In certain embodiments, mRNA molecules are complexed with lipid nanoparticles to facilitate delivery to target cells. Examples of suitable lipids include, for example, phosphatidyl compounds (eg, phosphatidylglycerol, phosphatidylcholine, phosphatidylserine, phosphatidylethanolamine, sphingolipids, cerebrosides, and gangliosides). In certain embodiments, the mRNA molecules and compositions of the invention employ one or more cationic lipids, helper lipids, and PEGylated lipids designed to encapsulate various nucleic acid based materials. It can be combined with various ratios of multicomponent lipid mixtures.

Cationic lipids include DOTAP (1,2-dioleyl-3-trimethylammonium propane), DODAP (1,2-dioleyl-3-dimethylammonium propane), cKK-E12 (3,6-bis (4- (bis (2-hydroxydodecyl) amino) butyl) piperazine-2,5-dione), dialkylamino based, imidazole based, guanidinium based, XTC (2,2-Dilinoleyl-4-dimethylaminoethyl- [ 1,3] -dioxolane), MC3 (((6Z, 9Z, 28Z, 31Z) -heptatriconta-6,9,28,31-tetraen-19-yl 4- (dimethylamino) butanoic acid), ALNY- 100 ((3aR, 5s, 6aS) -N, N-dimethyl-2,2-di ((9Z, 2Z) -octadeca-9,12-dienyl) tetrahydro-3aH-cyclopenta [d] [1,3] dioxol-5-amine)), NC98-5 (4,7,13-tris (3-oxo-3- (Undecylamino) propyl) -N1, N16-diundecyl-4,7,10,13-tetraazahexadecane-1,16-diamide), HGT4003, the entire teachings of which are incorporated herein by reference, WO2012 / 170889), ICE (the entire teaching of which is incorporated herein by reference, WO2011 / 068810,), HGT5000 (the entire teaching of which is incorporated herein by reference). 61 / 617,468) or HGT5001 (cis or trans) (provisional patent application 61 617,468), amino alcohol lipids such as those disclosed in WO2010 / 053572, DOTAP (1,2-dioleyl-3-trimethylammoniumpropane), DOTMA (1,2-di-O-octadecenyl-3) -Trimethylammoniumpropane), DLinDMA (Heyes, et al., J. Contr. Rel. 107: 276-287 (2005)), DLin-KC2-DMA (Sample, et al., Nature Biotech. 28: 172-176). (2010)), C12-200 (Love, et al., Proc. Nat'l. Acad. Sci. 107: 1864-1869 (2010)). In some embodiments, the cationic lipid is cKK-E12:

It is.

  Suitable helper lipids include DSPC (1,2-distearoyl-sn-glycero-3-phosphocholine), DPPC (1,2-dipalmitoyl-sn-glycero-3-phosphocholine), DOPE (1,2-dioleyl- sn-glycero-3-phosphoethanolamine), DPPE (1,2-dipalmitoyl-sn-glycero-3-phosphoethanolamine), DMPE (1,2-dimyristoyl-sn-glycero-3-phosphoethanolamine) , DOPG (, 2-dioleoyl-sn-glycero-3-phospho- (1′-rac-glycerol)), and cholesterol.

  PEGylated lipids for use in nanoparticle formulations are poly (ethylene) glycol chains up to 5 kDa in length, DMG-, covalently attached to the lipids with alkyl chain (s) of C6-C20 length. Including but not limited to PEG2K, PEG-DSG, PEG-DMG, and PEG-ceramide.

In certain embodiments, the lipid nanoparticle carrier comprises one of the following lipid formulations:
C12-200, DOPE, cholesterol, DMG-PEG2K;
DODAP, DOPE, cholesterol, DMG-PEG2K;
HGT5000, DOPE, cholesterol, DMG-PEG2K;
HGT5001, DOPE, cholesterol, DMG-PEG2K;
XTC, DSPC, cholesterol, PEG-DMG;
MC3, DSPC, cholesterol, PEG-DMG;
ALNY-100, DSPC, cholesterol, PEG-DSG.

  In certain embodiments, the mRNAs and compositions of the invention comprising these mRNAs are directed to the target tissue in a localized rather than systemic manner, for example, preferably in a sustained release formulation. Administration can be by direct injection of the pharmaceutical composition. Local delivery can be shaped in a variety of ways, depending on the targeted tissue. For example, an aerosol containing the mRNA and composition of the invention can be inhaled (for nasal, tracheal, or bronchial delivery). The mRNA and composition of the present invention can be injected into sites of injury, disease manifestation, pain, for example. The composition may be provided in a lozenge for oral, tracheal, or esophageal application. Can be supplied in the form of liquids, tablets, or capsules for administration to the stomach or intestines, can be supplied in the form of suppositories for rectal or vaginal application, or by use of creams, drops Or even by injection, can be delivered to the eye.

  Also contemplated herein are lyophilized pharmaceutical compositions comprising one or more of the liposomal nanoparticles disclosed herein, and for example, the entire teachings of which are incorporated herein by reference. A related method for the use of such lyophilized compositions, as disclosed in International Patent Publication No. WO2012 / 170889, incorporated by reference. For example, the lyophilized mRNA and compositions of the invention can be reconstituted prior to administration or can be reconstituted in vivo. For example, the lyophilized mRNA and / or composition is formulated in a suitable dosage form (eg, an intradermal dosage form such as a disc, rod, or membrane) that is in vivo by an individual's body fluid. It can be administered to rehydrate over time.

  In certain embodiments, a method of treating a subject comprising administering an mRNA or composition of the invention is also contemplated. For example, certain embodiments of the present invention provide methods for treating or preventing conditions in which a particular protein is produced and / or where a particular protein is underutilized or susceptible. In some embodiments, the present invention provides a method of modulating (eg, increasing, improving, or otherwise improving) the translation efficiency of one or more mRNAs in a target cell. As used herein, the phrase “translation efficiency” refers to the extent to which mRNA is translated and the encoded therapeutic protein is produced.

  In certain embodiments, an mRNA molecule of the invention, or a composition comprising such mRNA, is administered to a patient.

  In some embodiments, the mRNA molecules of the invention, or compositions comprising such mRNA, are used for protein production in in vitro or in vivo systems. Suitable in vitro systems I am an in vitro cell-free system or an in vitro cell-based system. A suitable in vivo system can be any living organism, such as a non-human animal (eg, rat, mouse, pig, dog, chicken, sheep, non-human primate, etc.), or human.

  The following specific examples should be construed as illustrative only and should not be construed as limiting the scope of the present disclosure. Without further refinement, it is believed that one skilled in the art can utilize the present invention to its fullest extent based on the description herein.

Example 1: Synthesis and expression of mRNA incorporating a 4'-thio-substituted furanose ring An mRNA encoding a protein is synthesized. The mRNA contains at least one 4'-thio-substituted furanose ring. The mRNA is formulated into a pharmaceutical composition and administered to the subject. The mRNA exhibits a longer half-life and can result in the synthesis of a larger amount of the protein encoded by the mRNA than a control mRNA that does not contain a 4′-thio-substituted furanose ring.

I. Experimental details of the formulation:
IA. Messenger RNA material Firefly luciferase (FFL), human erythropoietin (EPO), and human alpha-galactosidase (GLA) are synthesized by in vitro transcription from a plasmid DNA template encoding the gene and determined by gel electrophoresis. Continue the addition of the cap structure (Cap 1) (Fechter and Brownlee, J. Gen. Virology 86: 1239-1249 (2005)) and a 3 ′ poly (A) tail about 200 nucleotides long. The 5 ′ and 3 ′ untranslated regions present in each mRNA product were represented as X and Y, respectively, and were defined as described (see below).

Human erythropoietin (EPO) mRNA (SEQ ID NO _1): X _{1 AUGGGGGUGCACGAAUGUCCUGCCUGGCUGUGGCUUCUCCUGUCCCUGCUGUCGCUCCCUCUGGGCCUCCCAGUCCUGGGCGCCCCACCACGCCUCAUCUGUGACAGCCGAGUCCUGGAGAGGUACCUCUUGGAGGCCAAGGAGGCCGAGAAUAUCACGACGGGCUGUGCUGAACACUGCAGCUUGAAUGAGAAUAUCACUGUCCCAGACACCAAAGUUAAUUUCUAUGCCUGGAAGAGGAUGGAGGUCGGGCAGCAGGCCGUAGAAGUCUGGCAGGGCCUGGCCCUGCUGUCGGAAGCUGUC} UGCGGGGCCAGGCCCUGUUGGUCAACUCUUCCCAGCCGUGGGAGCCCCUGCAGCUGCAUGUGGAUAAAGCCGUCAGUGGCCUUCGCAGCCUCACCACUCUGCUUCGGGCUCUGGGAGCCCAGAAGGAAGCCAUCUCCCCUCCAGAUGCGGCCUCAGCUGCUCCACUCCGAACAAUCACUGCUGACACUUUCCGCAAACUCUUCCGAGUCUACUCCAAUUUCCUCCGGGGAAAGCUGAAGCUGUACACAGGGGAGGCCUGCAGGACAGGGGACAGAUGAY ₁

Human alpha - galactosidase (GLA) mRNA (SEQ ID NO _2): X 1 _{AUGCAGCUGAGGAACCCAGAACUACAUCUGGGCUGCGCGCUUGCGCUUCGCUUCCUGGCCCUCGUUUCCUGGGACAUCCCUGGGGCUAGAGCACUGGACAAUGGAUUGGCAAGGACGCCUACCAUGGGCUGGCUGCACUGGGAGCGCUUCAUGUGCAACCUUGACUGCCAGGAAGAGCCAGAUUCCUGCAUCAGUGAGAAGCUCUUCAUGGAGAUGGCAGAGCUCAUGGUCUCAGAAGGCUGGAAGGAUGCAGGUUAUGAGUACCUCUGCAUUGAUGACUGUUGGAUGGCUCCCCAAA} AGAUUCAGAAGGCAGACUUCAGGCAGACCCUCAGCGCUUUCCUCAUGGGAUUCGCCAGCUAGCUAAUUAUGUUCACAGCAAAGGACUGAAGCUAGGGAUUUAUGCAGAUGUUGGAAAUAAAACCUGCGCAGGCUUCCCUGGGAGUUUUGGAUACUACGACAUUGAUGCCCAGACCUUUGCUGACUGGGGAGUAGAUCUGCUAAAAUUUGAUGGUUGUUACUGUGACAGUUUGGAAAAUUUGGCAGAUGGUUAUAAGCACAUGUCCUUGGCCCUGAAUAGGACUGGCAGAAGCAUUGUGUACUCCUGUGAGUGGCCUCUUUAUAUGUGGCCCUU UCAAAAGCCCAAUUAUACAGAAAUCCGACAGUACUGCAAUCACUGGCGAAAUUUUGCUGACAUUGAUGAUUCCUGGAAAAGUAUAAAGAGUAUCUUGGACUGGACAUCUUUUAACCAGGAGAGAAUUGUUGAUGUUGCUGGACCAGGGGGUUGGAAUGACCCAGAUAUGUUAGUGAUUGGCAACUUUGGCCUCAGCUGGAAUCAGCAAGUAACUCAGAUGGCCCUCUGGGCUAUCAUGGCUGCUCCUUUAUUCAUGUCUAAUGACCUCCGACACAUCAGCCCUCAAGCCAAAGCUCUCCUUCAGGAUAAGGACGUAAUUGCCAUCAAUCAGGA CCCUUGGGCAAGCAAGGGUACCAGCUUAGACAGGGAGACAACUUUGAAGUGUGGGAACGACCUCUCUCAGGCUUAGCCUGGGCUGUAGCUAUGAUAAACCGGCAGGAGAUUGGUGGACCUCGCUCUUAUACCAUCGCAGUUGCUUCCCUGGGUAAAGGAGUGGCCUGUAAUCCUGCCUGCUUCAUCACACAGCUCCUCCCUGUGAAAAGGAAGCUAGGGUUCUAUGAAUGGACUUCAAGGUUAAGAAGUCACAUAAAUCCCACAGGCACUGUUUUGCUUCAGCUAGAAAAUACAAUGCAGAUGUCAUUAAAAGACUUACUUUAAY ₁

Codon optimized firefly luciferase (FFL) mRNA (SEQ ID NO _3): X 2 _{AUGGAAGAUGCCAAAAACAUUAAGAAGGGCCCAGCGCCAUUCUACCCACUCGAAGACGGGACCGCCGGCGAGCAGCUGCACAAAGCCAUGAAGCGCUACGCCCUGGUGCCCGGCACCAUCGCCUUUACCGACGCACAUAUCGAGGUGGACAUUACCUACGCCGAGUACUUCGAGAUGAGCGUUCGGCUGGCAGAAGCUAUGAAGCGCUAUGGGCUGAAUACAAACCAUCGGAUCGUGGUGUGCAGCGAGAAUAGCUUGCAGUUCUUCAUGCCCGUGUUGGGUGCCCUGUUCAUCGGU} UGGCUGUGGCCCCAGCUAACGACAUCUACAACGAGCGCGAGCUGCUGAACAGCAUGGGCAUCAGCCAGCCCACCGUCGUAUUCGUGAGCAAGAAAGGGCUGCAAAAGAUCCUCAACGUGCAAAAGAAGCUACCGAUCAUACAAAAGAUCAUCAUCAUGGAUAGCAAGACCGACUACCAGGGCUUCCAAAGCAUGUACACCUUCGUGACUUCCCAUUUGCCACCCGGCUUCAACGAGUACGACUUCGUGCCCGAGAGCUUCGACCGGGACAAAACCAUCGCCCUGAUCAUGAACAGUAGUGGCAGUACCGGAUUGCCCAAGGGCGUAGCCCUAC CGCACCGCACCGCUUGUGUCCGAUUCAGUCAUGCCCGCGACCCCAUCUUCGGCAACCAGAUCAUCCCCGACACCGCUAUCCUCAGCGUGGUGCCAUUUCACCACGGCUUCGGCAUGUUCACCACGCUGGGCUACUUGAUCUGCGGCUUUCGGGUCGUGCUCAUGUACCGCUUCGAGGAGGAGCUAUUCUUGCGCAGCUUGCAAGACUAUAAGAUUCAAUCUGCCCUGCUGGUGCCCACACUAUUUAGCUUCUUCGCUAAGAGCACUCUCAUCGACAAGUACGACCUAAGCAACUUGCACGAGAUCGCCAGCGGCGGGGCGCCGCUCAGCAAGG GGUAGGUGAGGCCGUGGCCAAACGCUUCCACCUACCAGGCAUCCGCCAGGGCUACGGCCUGACAGAAACAACCAGCGCCAUUCUGAUCACCCCCGAAGGGGACGACAAGCCUGGCGCAGUAGGCAAGGUGGUGCCCUUCUUCGAGGCUAAGGUGGUGGACUUGGACACCGGUAAGACACUGGGUGUGAACCAGCGCGGCGAGCUGUGCGUCCGUGGCCCCAUGAUCAUGAGCGGCUACGUUAACAACCCCGAGGCUACAAACGCUCUCAUCGACAAGGACGGCUGGCUGCACAGCGGCGACAUCGCCUACUGGGACGAGGACGAGCACUUCU CAUCGUGGACCGGCUGAAGAGCCUGAUCAAAUACAAGGGCUACCAGGUAGCCCCAGCCGAACUGGAGAGCAUCCUGCUGCAACACCCCAACAUCUUCGACGCCGGGGUCGCCGGCCUGCCCGACGACGAUGCCGGCGAGCUGCCCGCCGCAGUCGUCGUGCUGGAACACGGUAAAACCAUGACCGAGAAGGAGAUCGUGGACUAUGUGGCCAGCCAGGUUACAACCGCCAAGAAGCUGCGCGGUGGUGUUGUGUUCGUGGACGAGGUGCCUAAAGGACUGACCGGCAAGUUGGACGCCCGCAAGAUCCGCGAGAUUCUCAUUAAGGCCAAGAA GGGGCGCAAGAUCGCCGUGUY ₂

X ₁ (5 ′ untranslated sequence) (SEQ ID NO: 4): GGACAGAUCGCCCUGGAGAGCCCAUCCACGCUGUUUGACCUCCCAUAGAAGACACCCGGACCGAUCCAGCUCCCGCGGCGCGGAACGGUGACUGCCAUCGCCUG

X ₂ (5 ′ untranslated sequence) (SEQ ID NO: 5):
GGGAUCCCUACC

Y ₁ (3 ′ untranslated sequence) (SEQ ID NO: 6):
CGGGUGGCAUCCCUGUGACCCCUCCCCCAGUGCCUCUCCUGGCCUCUGGAAGUGUGCCACUCCAGUCGCCCACCAGCCUUGUCCUAAAUAAAAAUUAAGUGUGCAUC

Y ₂ (3 ′ untranslated sequence) (SEQ ID NO: 7):
UUUGAAOUU

Ib. Formulation Protocol Protocol A: Aliquots of a 50 mg / mL ethanolic solution of C12-200, DOPE, cholesterol, and DMG-PEG2K are mixed and diluted with ethanol to a final volume of 3 mL. Separately, an aqueous buffer of GLA mRNA (10 mM citrate / 150 mM NaCl, pH 4.5) is prepared from a 1 mg / mL stock. The lipid solution is rapidly injected into the aqueous mRNA solution and shaken to give a final suspension in 20% ethanol. The resulting nanoparticle suspension is filtered, diafiltered with 1 × PBS (pH 7.4), concentrated and stored at 2-8 ° C. Final concentration = 0.85 mg / mL GLA mRNA (encapsulation). Z average = 81.2 nm (deviation (50) = 63.2 nm; deviation (90) = 104 nm).

  Protocol B: Aliquots of 50 mg / mL ethanolic solution of DODAP, DOPE, cholesterol, and DMG-PEG2K are mixed and diluted with ethanol to a final volume of 3 mL. Separately, an aqueous buffer of EPO mRNA (10 mM citrate / 150 mM NaCl, pH 4.5) is prepared from a 1 mg / mL stock. The lipid solution is rapidly injected into the aqueous mRNA solution and shaken to give a final suspension in 20% ethanol. The resulting nanoparticle suspension was filtered, diafiltered with 1 × PBS (pH 7.4), concentrated and stored at 2-8 ° C. Final concentration = 1.35 mg / mL EPO mRNA (encapsulation). Z average = 75.9 nm (deviation (50) = 57.3 nm; deviation (90) = 92.1 nm).

  Protocol C: An aliquot of 2.0 mg / mL aqueous solution PEI (branched, 25 kDa) is mixed with an aqueous solution of CFTR mRNA (1.0 mg / mL). The resulting complex mixture is pipetted up and down several times and left for 20 minutes before injection. Final concentration = 0.60 mg / mL CFTR mRNA (encapsulation). Z average = 75.9 nm (deviation (50) = 57.3 nm; deviation (90) = 92.1 nm).

II. Analysis of modified messenger RNA versus unmodified mRNA:
II-a. Quantification of modified bases in messenger RNA constructs 4′-thioNTP modified messenger RNA is subjected to ribonuclease I or nuclease P1 for various periods of time to fully degrade. Upon completion, the resulting monophosphate nucleotide is further degraded with alkaline phosphatase to provide the respective nucleoside. The nucleoside mixture is applied to an Amicon spin column (30,000 MWCO) for efficient enzyme removal. The resulting nucleoside solution is analyzed by HPLC and quantified by peak area comparison with each unmodified nucleoside.

II-b. Stability of 4′-thioNTP modified messenger RNA constructs 4′-thioNTP modified messenger RNA is subjected to ribonuclease I or nuclease P1 for various periods to assess resistance to nuclease degradation. Similarly, 4′-thioNTP modified messenger RNA was treated with serum (containing nuclease) for various periods to assess nuclease degradation. At designated time points, the nuclease reaction is quenched with an inhibitor and the resulting solution is applied to an Amicon spin column (30,000 MWCO) for efficient enzyme removal. Upon completion, the remainder is applied to an agarose gel and analyzed for mRNA construct viability (size, degradation products, etc.). The same experiment can be performed on unmodified mRNA, leading to direct comparison and inference.

II-c. Effect of 4'-thioNTP modified messenger RNA on protein production In vitro studies: In vitro gene transfer of 4'-thioNTP modified mRNA and unmodified mRNA is performed using HEK293T cells. Gene transfer of 1 microgram of each mRNA construct is performed using Lipofectamine in separate wells. Cells are collected at selected time points (eg, 4 hours, 8 hours, 24 hours, 48 hours, 72 hours, etc.) and analyzed for their respective protein production. Cell lysates are analyzed for luciferase production by bioluminescence assay in FFL mRNA. In EPO and GLA mRNA studies, cell supernatants are obtained and analyzed for EPO and GLA proteins, respectively, using an ELISA-based method. A comparison of protein production over time of unmodified versus 4′-thioNTP modified mRNA can be made.

  In vivo studies: Comparison of protein production over time is delivered in wild-type mice (CD-1) by injection of 4'thioNTP-modified mRNA-encapsulated nanoparticles (lipids or polymers) versus the same manner Performed with unmodified mRNA. Serum and organs are collected at selected time points (eg, 6 hours, 12 hours, 24 hours, 48 hours, 72 hours, etc.) and the respective protein levels are monitored. Liver homogenates are analyzed for luciferase production by bioluminescence assay in FFL mRNA. In EPO and GLA mRNA studies, mouse sera are obtained and analyzed for EPO and GLA proteins, respectively, using an ELISA-based method. A comparison of protein production over time of unmodified versus 4'-thioNTP modified mRNA is made.

  Similarly, unencapsulated (naked) 4'thioNTP modified mRNA and unmodified mRNA are injected by either intravenous, subcutaneous, or intratracheal administration to assess differences in stability and protein production. To do so, the same analysis as described above can be performed.

III. Analysis of FFL, EPO and GLA proteins produced by administered naked modified mRNA or mRNA-loaded nanoparticles:
III-a. Injection Protocol All studies are performed using male CD-1 mice approximately 6-8 weeks old at the start of each experiment. Samples are introduced by single bolus tail vein injection of 30-200 micrograms of equivalent total dose of unencapsulated or encapsulated FFL, EPO, or GLA mRNA (modified or unmodified). Mice are sacrificed at the designated time points and perfused with saline.

III-b. Isolation of organ tissue for analysis The liver and spleen of each mouse is collected and distributed in three parts and stored in 10% neutral buffered formalin for analysis, or snap frozen, Either store at 80 ° C.

III-c. Serum Isolation for Analysis All animals are euthanized 48 hours after dose administration (± 5%) by CO ₂ asphyxiation, and thoracotomy and terminal heart blood collection are continued. Whole heart (maximum obtainable volume) is collected in a serum separation tube by cardiac puncture to euthanized animals, allowed to clot at least 30 minutes at room temperature, and centrifuged at 9300 g for 10 minutes at 22 ° C. ± 5 ° C. The serum is then extracted. For intermediate blood collection, approximately 40-50 μL of whole blood is collected by facial venipuncture or tail resection. Samples taken from untreated animals are used as baseline GLA levels for comparison with study animals.

III-d. Enzyme-linked immunosorbent assay (ELISA) analysis EPO ELISA: Quantification of EPO protein is performed according to the procedure reported for the human EPO ELISA kit (Quantikine IVD, R & D Systems, catalog # Dep-00). Positive controls that can be used consist of ultra-high purity and tissue culture grade recombinant human erythropoietin protein (R & D Systems, catalog # 286-EP and 287-TC, respectively). Blood samples are taken at designated time points and processed as described above. Detection is monitored by absorption (450 nm) on a Molecular Device Flex Station instrument.

GLA ELISA: Standard ELISA procedures were followed (Shire Human Genetic Therapies) using sheep anti-REPLAGAL® G-188 IgG as capture antibody and rabbit anti-REPLAGAL® TK-88 IgG as secondary (detection) antibody. ). Horseradish peroxidase (HRP) conjugated goat anti-rabbit IgG is used for activation of the 3,3 ′, 5,5′-tetramethylbenzidine (TMB) substrate solution. The reaction is quenched after 20 minutes using 2N H ₂ SO ₄ . Detection is monitored by absorption (450 nm) on a Molecular Device Flex Station instrument. Untreated mouse serum and human REPLAGAL® protein are used as negative and positive controls, respectively.

III-e. Bioluminescence analysis Luciferase assay: Bioluminescence assay is performed using Promega Luciferase Assay System (item # E1500). The Luciferase Assay Reagent is prepared by adding 10 mL of luciferase assay buffer to the luciferase assay substrate and mixed by vortexing. Approximately 20 uL of the homogenate sample is loaded onto a 96-well plate and 20 uL plate control is continued for each sample. Separately, 120 uL of Luciferase Assay Reagent (prepared as described above) is added to each well of a 96 well flat bottom plate. Then, using a Molecular Device Flex Station apparatus, each flat plate is inserted into an appropriate chamber, and light emission is measured (measured in relative light units (RLU)).

Example 2.4 Exemplary Liposome Formulation for Delivery and Expression of mRNA with 4′-Thio Modification This example is illustrative for effective delivery and expression of 4′-thio modification mRNA in vivo. Liposome formulations are provided.

Lipid Materials The formulations described herein are one or more cationic lipids, helper lipids (eg, non-cationic lipids and / or designed to encapsulate various nucleic acid based materials. Cholesterol-based lipids), as well as various ratios of multicomponent lipid mixtures using PEGylated lipids. Cationic lipids include DOTAP (1,2-dioleyl-3-trimethylammonium propane), DODAP (1,2-dioleyl-3-dimethylammonium propane), DOTMA (1,2-di-O-octadecenyl-3- Trimethylammoniumpropane), DLinDMA (Heies, J .; Palmer, L .; Bremner, K .; MacLachlan, I. “Catalytic lipid saturation influenza intracellular of encapsulated. 287), DLin-KC2-DMA (Sample, SC et al. “Rational Design of C”). attic Lipids for siRNA Delivery “Nature Biotech. 2010, 28, 172-176), C12-200 (Love, KT et al.“ Lipid-like materials for low-dose in vivo 10 ” -1869), HGT4003, HGT5000, HGT5001, MC3, cKK-E12 (3,6-bis (4- (bis (2-hydroxydodecyl) amino) butyl) piperazine-2,5-dione), ICE, dialkylamino Based, imidazole based, guanidinium based, and the like (but not exclusively). Helper lipids include DSPC (1,2-distearoyl-sn-glycero-3-phosphocholine), DPPC (1,2-dipalmitoyl-sn-glycero-3-phosphocholine), DOPE (1,2-dioleyl-sn- Glycero-3-phosphoethanolamine), DPPE (1,2-dipalmitoyl-sn-glycero-3-phosphoethanolamine), DMPE (1,2-dimyristoyl-sn-glycero-3-phosphoethanolamine), DOPG (, 2-dioleoyl-sn-glycero-3-phospho- (1′-rac-glycerol)), cholesterol and the like (but not exclusively). Pegylated lipids can include poly (ethylene) glycol chains up to 5 kDa in length (but not exclusively) covalently attached to the lipid by C ₆ -C ₂₀ length alkyl chain (s). Absent).

Polymeric Materials Additional formulations described herein may include branched polyethyleneimine (PEI) (25 kDa) (Sigma # 408727), protamine, pegylated protamine, PLL, pegylated PLL, etc. (but exclusive) A variety of charged polymeric materials.

mRNA material Firefly luciferase (FFL), human erythropoietin (EPO), and human alpha-galactosidase (GLA) are synthesized by in vitro transcription from a plasmid DNA template encoding the gene and determined by gel electrophoresis Structure (Cap 1) (Fechter, P .; Brownlee, GG “Recognition of mRNA cap structures by viral and cellular proteins” J. Gen. Virology 2005, 86, 1239-1249) and about 200 nucleotides in length. (A) Tail addition continued. The 5 ′ and 3 ′ untranslated regions present in each mRNA product were represented as X and Y, respectively, and were defined as described (see below).

  Exemplary mRNA sequences for human erythropoietin (EPO), human alpha-galactosidase (GLA), and codon optimized firefly luciferase (FFL) are depicted in SEQ ID NOs: 1, 2, and 3, respectively. Exemplary 5 'and 3' UTR sequences are set forth in SEQ ID NOs: 4, 5, 6, and 7.

Exemplary Formulation Protocol A. C12-200 and GLA
Aliquots of a 50 mg / mL ethanolic solution of C12-200, DOPE, cholesterol, and DMG-PEG2K were mixed and diluted to a final volume of 3 mL with ethanol. Separately, an aqueous buffer of GLA mRNA (10 mM citrate / 150 mM NaCl, pH 4.5) was prepared from a 1 mg / mL stock. The lipid solution was rapidly injected into the aqueous mRNA solution and shaken to give a final suspension in 20% ethanol. The resulting nanoparticle suspension was filtered, diafiltered with 1 × PBS (pH 7.4), concentrated and stored at 2-8 ° C. Final concentration = 0.85 mg / mL GLA mRNA (encapsulation). Z _average = 81.2 nm (deviation ₍₅₀₎ = 63.2 nm; deviation ₍₉₀₎ = 104 nm).

B. DODAP and EPO
Aliquots of 50 mg / mL ethanolic solution of DODAP, DOPE, cholesterol, and DMG-PEG2K were mixed and diluted with ethanol to a final volume of 3 mL. Separately, an aqueous buffer of EPO mRNA (10 mM citrate / 150 mM NaCl, pH 4.5) was prepared from a 1 mg / mL stock. The lipid solution was rapidly injected into the aqueous mRNA solution and shaken to give a final suspension in 20% ethanol. The resulting nanoparticle suspension was filtered, diafiltered with 1 × PBS (pH 7.4), concentrated and stored at 2-8 ° C. Final concentration = 1.35 mg / mL EPO mRNA (encapsulation). Z _average = 75.9 nm (deviation ₍₅₀₎ = 57.3 nm; deviation ₍₉₀₎ = 92.1 nm).

C. PEI and CFTR
An aliquot of 2.0 mg / mL aqueous solution PEI (branched, 25 kDa) was mixed with an aqueous solution of CFTR mRNA (1.0 mg / mL). The resulting complex mixture was pipetted up and down several times and left for 20 minutes before injection. Final concentration = 0.60 mg / mL CFTR mRNA (encapsulation). Z _average = 75.9 nm (deviation ₍₅₀₎ = 57.3 nm; deviation ₍₉₀₎ = 92.1 nm).

Example 3 Analysis of In Vivo Stability and Protein Production of Modified vs. Unmodified mRNA This example is illustrative to analyze the stability of modified mRNA and protein expression in vivo in various target tissues An exemplary method is illustrated.

Quantification of modified bases in mRNA constructs 4'-thioNTP modified mRNA was subjected to ribonuclease I or nuclease P1 for various periods of time to fully degrade. Upon completion, the resulting monophosphate nucleotide was further degraded with alkaline phosphatase to provide the respective nucleoside. The nucleoside mixture was applied to an Amicon spin column (30,000 MWCO) for efficient enzyme removal. The resulting nucleoside solution was analyzed by HPLC and quantified by peak area comparison with each unmodified nucleoside.

Stability of 4′-thioNTP modified mRNA constructs 4′-thioNTP modified mRNA was subjected to ribonuclease I or nuclease P1 for various periods of time to assess resistance to nuclease degradation. At designated time points, the nuclease reaction was quenched with inhibitor and the resulting solution was applied to an Amicon spin column (30,000 MWCO) for efficient enzyme removal. Upon completion, the remainder was applied to an agarose gel and analyzed for mRNA construct viability (size, degradation products, etc.). The same experiment was performed on unmodified mRNA, leading to direct comparison and inference.

  Effect of 4'-thioNTP modified mRNA on protein production

In vitro studies:
In vitro gene transfer of 4′-thioNTP modified mRNA and unmodified mRNA was performed using HEK293T cells. Gene transfer of 1 microgram of each mRNA construct was performed using Lipofectamine in separate wells. Cells were collected at selected time points (eg, 4 hours, 8 hours, 32 hours, 48 hours, 56 hours, 80 hours, etc.) and analyzed for their respective protein production. Cell lysates were analyzed for luciferase production by bioluminescence assay in FFL mRNA. In EPO and GLA mRNA studies, cell supernatants were obtained and analyzed for EPO and GLA proteins, respectively, using an ELISA-based method. Comparison of protein production over time of unmodified versus 4′-thioNTP modified mRNA was performed. Exemplary results are shown in FIG.

In vivo studies:
Comparison of protein production over time is performed by injection of 4'thioNTP modified mRNA-encapsulated nanoparticles (lipid or polymer) into wild type mice (CD-1) vs unmodified mRNA delivered in the same manner It was. Serum and organs were collected at selected time points (eg 6 hours, 12 hours, 24 hours, 48 hours, 72 hours, etc.) and their respective protein levels were monitored. Liver homogenates were analyzed for luciferase production by bioluminescence assay in FFL mRNA. In EPO and GLA mRNA studies, mouse sera were obtained and analyzed for EPO and GLA proteins using an ELISA-based method, respectively. Comparison of protein production over time of unmodified versus 4′-thioNTP modified mRNA was performed.

  Similarly, unencapsulated (naked) 4'thioNTP modified mRNA and unmodified mRNA are infused by either intravenous, subcutaneous, or intratracheal administration to assess differences in stability and protein production. In order to do this, the same analysis as described above was performed.

Example 4 Analysis of FFL, EPO, and GLA protein production after administration of naked modified mRNA or mRNA-loaded nanoparticles This example illustrates the following after administration of either naked, modified, mRNA or mRNA-loaded nanoparticles. An exemplary protocol for analyzing protein production is described, demonstrating mRNA stability and protein production for 4'-thio-modified mRNA compared to unmodified mRNA.

  All studies were performed using male CD-1 mice approximately 6-8 weeks old at the start of each experiment. Samples were introduced by single bolus tail vein injection of 30-200 micrograms of equivalent total doses of unencapsulated or encapsulated FFL, EPO, or GLA mRNA (modified or unmodified). Mice were sacrificed at the designated time points and perfused with saline.

  Either the liver and spleen of each mouse is collected, divided into three parts and stored in 10% neutral buffered formalin for analysis or snap frozen and stored at -80 ° C. I made it.

All animals were euthanized 48 hours after dose administration (± 5%) by CO ₂ asphyxiation and continued thoracotomy and terminal heart blood collection. Whole blood (maximum obtainable volume) is collected from a euthanized animal by cardiac puncture in a serum separation tube, allowed to clot at least 30 minutes at room temperature, centrifuged at 9300 g for 10 minutes at 22 ° C. ± 5 ° C., Serum was then extracted. Approximately 40-50 μL of whole blood was collected by facial venipuncture or tail resection for intermediate blood collection. Samples taken from untreated animals were used as baseline GLA levels for comparison with study animals.

Enzyme-linked immunosorbent assay (ELISA) analysis EPO protein quantification was performed according to the procedure reported for the human EPO ELISA kit (Quantikine IVD, R & D Systems, catalog # Dep-00). The positive control used consisted of ultra high purity and tissue culture grade recombinant human erythropoietin protein (R & D Systems, catalog # 286-EP and 287-TC, respectively). Blood samples were collected at designated time points and processed as described above. Detection was monitored by absorption (450 nm) on a Molecular Device Flex Station instrument.

For analysis of the GLA protein, standard ELISA procedures were followed using sheep anti-Replugal G-188 IgG as the capture antibody and rabbit anti-Replugal IgG as the secondary (detection) antibody. Horseradish peroxidase (HRP) conjugated goat anti-rabbit IgG was used for activation of the 3,3 ′, 5,5′-tetramethylbenzidine (TMB) substrate solution. The reaction was quenched after 20 minutes using 2N H ₂ SO ₄ . Detection was monitored by absorption (450 nm) on a Molecular Device Flex Station instrument. Untreated mouse serum and human Replagal® protein were used as negative and positive controls, respectively.

Bioluminescence analysis A bioluminescence assay was performed using the Promega Luciferase Assay System (item # E1500). Luciferase Assay Reagent was prepared by adding 10 mL of luciferase assay buffer to the luciferase assay substrate and mixed by vortexing. 20 uL of the homogenate sample was loaded onto a 96 well plate and 20 uL plate control was continued for each sample. Separately, 120 uL of Luciferase Assay Reagent (prepared as described above) was loaded into each well of a 96 well flat bottom plate. Then, using a Molecular Device Flex Station apparatus, each flat plate was inserted into an appropriate chamber, and luminescence was measured (measured in relative light units (RLU)).

Exemplary Results Production of FFL protein by gene transfer of 4′-thio-modified or unmodified FFL mRNA was tested in HEK293T cells. FIG. 2 represents weighted relative fluorescence unit (RLU) scores obtained at 4, 8, 32, 56, and 80 hours after gene transfer. At each time point, gene transfer with either 25% 4'-thiouridine (25% 4'-SU) or 100% 4'-thiouridine (100% 4'-SU) FFL mRNA Cells had a higher weighted RLU score than cells transfected with either SNIM® FFL or commercially available FFL.

  The stability over time of 4'-thio-modified and unmodified FFL mRNA was also tested. Three micrograms of mRNA were exposed to mouse serum and monitored for 1 hour. As can be seen in FIG. 3, 4′-thio modified mRNA, especially 100% 4′-thiouridine (100% 4′-SU) compared to SNIM® FFL and commercially available FFL mRNA. FFL mRNA appears to be more stable over time.

  Production of FFL protein by gene transfer of 4'-thio-modified or unmodified FFL mRNA was tested in wild-type mice. A 1.0 mg / kg dose of C12-200 loaded lipid nanoparticles was administered intravenously and animals were sacrificed and their livers removed for analysis as described above. FIG. 4 represents the RLU / mg total protein score obtained 6 hours after administration. Livers from mice treated with 25% 4'-thiouridine (25% 4'-SU) and 100% 4'-thiouridine (100% 4'-SU) were treated with unmodified mRNA. Has a higher RLU / mg score than liver from treated mice.

  In particular, the exemplary results described herein show that the provided mRNA comprising 4′-thio-modified nucleotides can be successfully synthesized, have increased stability, and intracellularly. It has been demonstrated that it can be successfully used to produce proteins.

Example 5.4 Exemplary Synthesis of 4′-Thio-Modified Nucleotides Synthetic Procedure:

Preparation of intermediates:

Synthesis of 2,3-O-isopropylidene-D-ribbonic acid-1,4-lactone

Carbohydrate Research 2008, 1790-1800

A solution of D-ribbonic acid-1,4-lactone (270.0 g, 1.823 mol) and sulfuric acid (18.0 g, 0.182 mol, 0.1 eq) in acetone (2.79 L) was added at room temperature for 3 Stir for days. The reaction mixture was quenched by the addition of solid sodium bicarbonate (ca. 450 g), filtered and the filtrate evaporated. The remainder was partitioned between ethyl acetate and water. The aqueous layer was extracted with ethyl acetate. The combined organic layers were dried over magnesium sulfate, filtered and concentrated under reduced pressure to give the desired product as a white solid (318.8 g, 93%). ¹ H NMR (300 MHz, CDCl ₃ ) δ 4.83 (d, J = 5.5 Hz, 1H), 4.77 (d, J = 5.5 Hz, 1H), 4.64 to 4.62 (m, 1H ), 3.99 (ddd, J = 2.3, 5.5, and 12.4 Hz, 1H), 3.81 (ddd, J = 2.3, 5.5, and 12.4 Hz, 1H), 2.67 (t, J = 5.5 Hz, 1H), 1.46 (s, 3H), 1.37 (s, 3H).

Synthesis of 5-O-methanesulfonyl-2,3-O-isopropylidene-D-ribbonic acid-1,4-lactone

Organic Process Research and Development 2006, 487-492

Methanesulfonyl chloride (116.0 g, 1.014 mol, 1.2 eq.) Was added 2,3-O-isopropylidene-D-ribbonic acid-1,4-lactone (0,4 L) in dichloromethane (2.43 L) at 0 ° C. 159.0 g, 0.845 mol) and triethylamine (128.0 g, 1.267 mol) was added dropwise. The reaction mixture was stirred at room temperature for 1 hour, then diluted with dichloromethane and washed with water, saturated aqueous NaHCO ₃ , and brine. The organic layer is dried over magnesium sulfate, filtered and concentrated under reduced pressure to give 5-O-methanesulfonyl-2,3-O-isopropylidene-D-ribbonic acid-1,4-lactone as an orange oil. (231.0 g, about 100%). ¹ H NMR (300 MHz, CDCl ₃ ) δ 4.82 to 4.77 (m, 3H), 4.49 to 4.41 (m, 2H), 3.04 (s, 3H), 1.47 (s, 3H), 1.38 (s, 3H).

Synthesis of 2,3-O-isopropylidene-L-lyxonic acid-1,4-lactone

Organic Process Research and Development 2006, 487-492

In water (1.1 L), potassium hydroxide (137.0 g, 2.45 mol) was added to 5-O-methanesulfonyl-2,3-O-isopropylidene-D-ribbonic acid-1,4-lactone (225). 0.0 g, 0.85 mol) and stirred at room temperature for 18 hours. The reaction mixture was acidified to pH 3 with 2M aqueous HCl (using a pH meter) and then evaporated. The remainder was heated and refluxed into acetone and the acetone was decanted (x3). The combined extracts were dried over magnesium sulfate, filtered and concentrated under reduced pressure to give 2,3-O-isopropylidene-L-lyxonic acid-1,4-lactone as a pale yellow solid (115.4 g, 73%). ¹ H NMR (300 MHz, CDCl ₃ ) δ 4.89 to 4.84 (m, 2H), 4.63 to 4.59 (m, 1H), 4.08 to 3.91 (m, 2H), 1. 46 (s, 3H), 1.38 (s, 3H).

Synthesis of 5-O-tert-butyldimethylsilyl-2,3-O-isopropylidene-L-lyxonic acid-1,4-lactone

Carbohydrate Research 2008, 1790-1800

A solution of 2,3-O-isopropylidene-L-lyxonic acid-1,4-lactone (5.0 g, 0.027 mol) in dichloromethane (85.0 mL) followed by imidazole (2.2 g, 32 mmol). Tert-butyldimethylsilyl chloride (4.4 g, 29 mmol, 1.1 eq) was added and the reaction mixture was stirred at room temperature for 1.5 hours. The reaction mixture is diluted with dichloromethane, washed with saturated aqueous NaHCO ₃ , brine, dried over magnesium sulfate, filtered and concentrated under reduced pressure to give 5-O-tert-butyldimethylsilyl-2,3- O-isopropylidene-L-lyxonic acid-1,4-lactone was produced as a pale yellow oil (7.3 g, 89%). ¹ H NMR (300 MHz, CDCl ₃ ) δ 4.79 (s, 2H), 4.54 to 4.49 (m, 1H), 4.00 to 3.86 (m, 2H), 1.45 (s, 3H), 1.38 (s, 3H), 0.89 (s, 9H), 0.08 (s, 6H).

Synthesis of 5-O-tert-butyldimethylsilyl-2,3-O-isopropylidene-L-lyxitol

Carbohydrate Research 2008, 1790-1800

To a solution of 5-O-tert-butyldimethylsilyl-2,3-O-isopropylidene-L-lyxonic acid-1,4-lactone (7.2 g, 24 mmol) in tetrahydrofuran (63 mL) and methanol (13 mL). Sodium borohydride (1.4 g, 0.036 mol, 1.5 eq) was added in portions at room temperature. The reaction mixture was stirred at room temperature for 1 hour and then concentrated under reduced pressure. The remainder was partitioned between ethyl acetate and 1M aqueous citric acid. The organic layer was washed with 1M aqueous citric acid solution, brine, dried over magnesium sulfate, filtered and concentrated under reduced pressure to give 5-O-tert-butyldimethylsilyl-2,3-O-isopropylidene-L. -Lixitol was produced as a colorless oil that crystallized on standing (6.3 g, 86%). ¹ H NMR (300 MHz, CDCl ₃ ) δ 4.26 to 4.20 (m, 2H), 3.84 to 3.59 (m, 5H), 1.51 (s, 3H), 1.37 (s, 3H), 0.89 (s, 9H), 0.07 (s, 6H).

Synthesis of 5-O-tert-butyldimethylsilyl-2,3-O-isopropylidene-1,4-di-O-methanesulfonyl-L-lyxitol

Carbohydrate Research 2008, 1790-1800

Methanesulfonyl chloride (15.2 mL, 0.196 mol, 10 equiv) was added dropwise to pyridine (15.8 mL, 0.196 mol, 10 equiv) at <10 ° C. A solution of 5-O-tert-butyldimethylsilyl-2,3-O-isopropylidene-L-lyxitol (6 g, 0.0196 mol) in dichloromethane (16 mL) was added dropwise below 10 ° C. The reaction mixture was stirred at room temperature for 2 hours. The cooling bath was changed and the excess of methanesulfonyl chloride was hydrolyzed by the addition of ice. The reaction mixture was then poured into water (300 mL) and extracted with Et ₂ O (3 × 50 mL). The combined organic layers were washed with 1M aqueous citric acid solution, saturated aqueous NaHCO ₃ solution and brine, dried (MgSO ₄ ), filtered and concentrated under reduced pressure. The crude product was purified by flash chromatography on silica gel with 1: 6 ethyl acetate / heptane to give 5-O-tert-butyldimethylsilyl-2,3-O-isopropylidene-1,4-di -O-Methanesulfonyl-L-lyxitol was produced as a yellow oil (8 g, 91%). ¹ H NMR (300 MHz, CDCl ₃ ) δ 4.76-4.69 (m, 1H), 4.46-4.34 (m, 4H), 3.95 (dd, J = 5.5 and 11.0 Hz) 1H), 3.82 (dd, J = 6.0 and 11.0 Hz, 1H), 3.11 (s, 3H), 3.07 (s, 3H), 1.51 (s, 3H), 1.37 (s, 3H), 0.89 (s, 9H), 0.09 (s, 6H).

Synthesis of tert-butyl (((3aS, 4R, 6aR) -2,2-dimethyltetrahydrothieno [3,4-d] [1,3] dioxol-4-yl) methoxy) dimethylsilane

Of 5-O-tert-butyldimethylsilyl-2,3-O-isopropylidene-1,4-di-O-methanesulfonyl-L-lyxitol (25.1 g, 0.056 mol) in dimethylformamide (250 mL). To the solution, Na ₂ S. 9H ₂ O (16.1 g, 0.067 mol, 1.2 eq) was added and the reaction mixture was heated at 80 ° C. for 3 h. The reaction mixture was cooled to room temperature and partitioned between water and ethyl acetate. The layers were separated and the aqueous layer was extracted with ethyl acetate. The combined organic layers were dried (MgSO ₄ ), filtered and concentrated under reduced pressure. The crude product was purified by flash chromatography on silica gel with ethyl acetate / heptane (10: 1) to give tert-butyl (((3aS, 4R, 6aR) -2,2-dimethyltetrahydrothieno [3, 4-d] [1,3] dioxol-4-yl) methoxy) -dimethyl-silane (10.3 g, 60%) was produced. ¹ H NMR (300 MHz, CDCl ₃ ) δ 4.89 (dt, J = 1.4 and 4.6 Hz, 1H), 4.79 (d, J = 6.0 Hz, 1H), 3.80 (dd, J = 5.0 and 10.5 Hz, 1H), 3.60 (dd, J = 6.4 and 10.6 Hz, 1H), 3.33 (t, J = 5.0 Hz, 1H), 3.16 ( dd, J = 5.0 and 12.4 Hz, 1H), 2.85 (dd, J = 0.9 and 12.8 Hz, 1H), 1.52 (s, 3H), 1.32 (s, 3H) ), 0.89 (s, 9H), 0.06 (s, 6H).

(3aS, 4R, 5R, 6aR) -4-(((tert-butyldimethylsilyl) oxy) methyl) -2,2-dimethyltetrahydrothieno [3,4-d] [1,3] dioxole 5-oxide Synthesis of

  A solution of about 70% m-chloroperbenzoic acid (16 g, 66 mmol) in dichloromethane (150 mL) was dried over magnesium sulfate and filtered. After washing with dichloromethane (50 mL), the combined filtrates were washed with tert-butyl (((3aS, 4R, 6aR) -2,2-dimethyltetrahydrothieno [3,4-d in dichloromethane (400 mL) at −78 ° C. ] [1,3] dioxol-4-yl) methoxy) dimethylsilane (20 g, 66 mmol) was added dropwise. After stirring at −78 ° C. for 1 hour, the reaction was quenched with saturated sodium bicarbonate solution and diluted with dichloromethane. The layers were separated and the organic layer was washed with brine, dried over magnesium sulfate, filtered and concentrated. The residue obtained is purified by flash chromatography (silica gel / dichloromethane: diethyl ether (30: 1) to give (3aS, 4R, 5S, 6aR) -4-(((tert-butyldimethylsilyl) oxy) methyl) -2,2-Dimethyltetrahydrothieno [3,4-d] [1,3] dioxole 5-oxide (8.8 g, 42%) and (3aS, 4R, 5R, 6aR) -4-(((( tert-Butyldimethylsilyl) oxy) methyl) -2,2-dimethyltetra-hydrothieno [3,4-d] [1,3] dioxole 5-oxide (7.3 g, 35%) was produced.

  Synthesis of nucleoside intermediates:

1-((3aR, 4R, 6R, 6aS) -6- (hydroxymethyl) -2,2-dimethyltetrahydrothieno [3,4-d] [1,3] dioxol-4-yl) pyrimidine-2,4 (1H, 3H) -Dione

1-((3aR, 4R, 6R, 6aS) -6-(((tert-butyldimethylsilyl) oxy) methyl) -2,2-dimethyl-tetrahydrothieno [3,4-d] [1,3] dioxole Synthesis of -4-yl) pyrimidine-2,4 (1H, 3H) -dione

To a suspension of uracil (140 g, 12.5 mmol) in toluene (62 mL) was added triethylamine (3.5 mL, 2.53 g, 25 mmol) and trimethylsilyl trifluoromethanesulfonic acid (9.01 mL, 11, 1 g, 50 mmol). Added. After stirring at room temperature for 1 hour, dichloromethane (34 mL) was added to the biphasic mixture to give a solution. This was then taken up in dichloromethane (34 mL) in (3aS, 4R, 5R, 6aR) -4-(((tert-butyldimethylsilyl) oxy) methyl) -2,2-dimethyltetrahydrothieno [3,4-d]. To a solution of [1,3] dioxole 5-oxide (2.0 g, 6.25 mmol) was added dropwise followed by triethylamine (3.5 mL, 25 mmol). After stirring at room temperature for 90 minutes, the reaction was quenched with ice and then diluted with ethyl acetate. The layers were separated and the organic layer was washed with saturated sodium bicarbonate solution (x2) followed by brine. After drying over magnesium sulfate, concentration under reduced pressure yielded the crude product, which was purified by flash chromatography (silica gel, ethyl acetate: dichloromethane 1: 5) to give 1-((3aR, 4R , 6R, 6aS) -6-(((tert-butyldimethylsilyl) oxy) methyl) -2,2-dimethyl-tetrahydrothieno [3,4-d] [1,3] dioxol-4-yl) pyrimidine- This gave 2,4 (1H, 3H) -dione (1.55 g, 60%). ¹ H NMR (300 MHz, CDCl ₃ ) δ 8.43 (s, 1H), 7.96 (d, J = 8.3 Hz, 1H), 6.12 (d, J = 2.3 Hz, 1H), 5. 74 (dd, J = 1.9 and 7.8 Hz, 1H), 4.71 (m, 2H), 3.89 (m, 2H), 3.74 (m, 1H), 1.60 (s, 3H), 1.32 (s, 3H), 0.92 (s, 9H), 0, 11 (s, 3H), 0.10 (s, 3H).

1-((3aR, 4R, 6R, 6aS) -6- (hydroxymethyl) -2,2-dimethyltetrahydrothieno [3,4-d] [1,3] dioxol-4-yl) pyrimidine-2,4 Synthesis of (1H, 3H) -dione

1-((3aR, 4R, 6R, 6aS) -6-(((tert-butyldimethylsilyl) oxy) methyl) -2,2-dimethyl-tetrahydrothieno [3,4-d] in tetrahydrofuran (85 mL) A solution of [1,3] dioxol-4-yl) pyrimidine-2,4 (1H, 3H) -dione (3.70 g, 8.92 mmol) was cooled in an ice bath under argon. A solution of 1M tetrabutylammonium fluoride in tetrahydrofuran (10.7 mL, 10.7 mmol) was added and the mixture was stirred at room temperature for 2 hours. The crude product was collected by filtration, washed with tetrahydrofuran and purified by flash chromatography (silica gel; methanol: dichloromethane 1:30) to give 1-((3aR, 4R, 6R, 6aS) -6- (hydroxymethyl). ) -2,2-dimethyltetrahydrothieno [3,4-d] [1,3] dioxol-4-yl) pyrimidin-2,4 (1H, 3H) -dione (2.30 g, 86%). It was. ¹ H NMR (300 MHz, CDCl ₃ ) δ 8.97 (brs, 1H), 7.76 (d, J = 8.3 Hz, 1H), 5.93 (s, 1H), 5.76 (d, J = 8.3 Hz), 4.91 (s, 2H), 3.96 (dd, J = 4.6 and 11.0 Hz, 1H), 3.89 (dd, J = 4.6 and 11.0 Hz, 1H) ), 3.79 (t, J = 4.6 Hz, 1H), 2.64 (brs, 1H), 1.59 (s, 3H), 1.33 (s, 3H).

4-Amino-1-((3aR, 4R, 6R, 6aS) -6- (hydroxymethyl) -2,2-dimethyltetrahydrothieno [3,4-d] [1,3] dioxol-4-yl)- 5-Methylpyrimidin-2 (1H) -one

  Similar to the following, but using a procedure in which cytosine was replaced with thymine, 4-amino-1-((3aR, 4R, 6R, 6aS) -6- (hydroxymethyl) -2,2-dimethyltetra-hydrothieno [3,4-d] [1,3] dioxol-4-yl) pyrimidin-2 (1H) -one (13.1) can be synthesized.

1-((3aR, 4R, 6R, 6aS) -6-(((tert-butyldimethylsilyl) oxy) methyl) -2,2-dimethyltetrahydrothieno [3,4-d] [1,3] dioxole- Synthesis of 4-yl) -5-methylpyrimidine-2,4 (1H, 3H) -dione

To a suspension of thymine (2.60 g, 20.6 mmol) in toluene (112 mL) was added triethylamine (4.17 g, 41.2 mmol) and trimethylsilyl trifluoromethanesulfonic acid (18.3 g, 82.5 mmol). . After stirring at room temperature for 1 hour, dichloromethane (34 mL) was added to the biphasic mixture to give a solution. This was then taken up in dichloromethane (56 mL) in (3aS, 4R, 5R, 6aR) -4-(((tert-butyldimethylsilyl) oxy) methyl) -2,2-dimethyltetrahydrothieno [3,4-d]. To a solution of [1,3] dioxole 5-oxide (3.30 g, 10.3 mmol) was added dropwise, followed by triethylamine (4.17 g, 41.2 mmol). After stirring at room temperature for 60 minutes, the reaction was quenched with ice and then diluted with ethyl acetate. The layers were separated and the organic layer was washed with saturated sodium bicarbonate solution (x2) followed by brine. After drying over magnesium sulfate, concentration under reduced pressure yielded the crude product, which was purified by flash chromatography (silica gel, ethyl acetate: heptane 0-50%) to give 1-((3aR, 4R, 6R, 6aS) -6-(((tert-butyldimethylsilyl) oxy) methyl) -2,2-dimethyltetrahydrothieno [3,4-d] [1,3] dioxol-4-yl) -5 This gave -methylpyrimidine-2,4 (1H, 3H) -dione (2.9 g, 66%). ¹ H NMR (300 MHz, CDCl ₃ ) δ 8.43 (s, 1H), 7.46 (d, J = 1.4 Hz, 1H), 6.07 (d, J = 32 Hz, 1H), 5.72 ( m, 2H), 3.87 (m, 2H), 3.71 (m, 1H), 1.93 (s, 3H), 1.59 (s, 3H), 1.32 (s, 3H), 0.92 (s, 9H), 0.10 (s, 3H), 0.09 (s, 3H).

4-Amino-1-((3aR, 4R, 6R, 6aS) -6-(((tert-butyldimethylsilyl) oxy) methyl) -2,2-dimethyltetrahydrothieno [3,4-d] [1, 3] Synthesis of dioxol-4-yl) -5-methylpyrimidin-2 (1H) -one

A suspension of 1,2,4-triazole (6.55 g, 94.8 mmol) in acetonitrile (140 mL) was cooled to 0 ° C. in an ice batch. Phosphorus oxychloride (2.53 mL, 27.1 mmol) was added dropwise followed by triethylamine (18.9 mL, 135 mmol). The mixture was stirred at 0 ° C. for 30 minutes, then 1-((3aR, 4R, 6R, 6aS) -6-(((tert-butyldimethylsilyl) oxy) methyl) -2,2- in acetonitrile (25 mL). A solution of dimethyltetrahydrothieno [3,4-d] [1,3] dioxol-4-yl) -5-methylpyrimidine-2,4 (1H, 3H) -dione (2.9 g, 6.77 mmol) was added dropwise. Added. The reaction was warmed to room temperature and stirred for 150 minutes, then partitioned between ethyl acetate and saturated sodium bicarbonate solution. The organic layer was washed with brine, dried over magnesium sulfate, filtered and concentrated. The obtained residue was dissolved in dioxane (62 mL) in an autoclave. Ammonium hydroxide (62 mL) was added and the vessel was sealed and stirred at room temperature overnight. The reaction mixture was partitioned between ethyl acetate and water. The organic layer was washed with brine, dried over magnesium sulfate and concentrated under reduced pressure. Purification by flash chromatography (silica gel: methanol: ethyl acetate 1:10) gave amino-1-((3aR, 4R, 6R, 6aS) -6-(((tert-butyldimethylsilyl) oxy) methyl) -2 , 2-dimethyltetrahydrothieno [3,4-d] [1,3] dioxol-4-yl) -5-methylpyrimidin-2 (1H) -one (2.60 g, 90%). ¹ H NMR (300 MHz, CDCl ₃ ) δ 8.74 (brs, 2H), 7.49 (s, 1H), 6.00 (d, J = 2.3 Hz, 1H), 4.82 (dd, J = 2.3 and 5.5 Hz, 1H), 4.74 (dd, J = 3.2 and 5.5 Hz, 1H), 3.91 (dd, J = 5.5 and 10.5 Hz, 1H), 3 .81 (dd, J = 6.4 and 10.5 Hz, 1H), 3.65 (m, 1H), 1.91 (s, 3H), 1.56 (s, 3H), 1.27 (s) 3H) 0.89 (s, 9H), 0.07 (s, 3H), 0.06 (s, 3H).

4-Amino-1-((3aR, 4R, 6R, 6aS) -6- (hydroxymethyl) -2,2-dimethyltetrahydrothieno [3,4-d] [1,3] dioxol-4-yl)- Synthesis of 5-methylpyrimidin-2 (1H) -one

4-Amino-1-((3aR, 4R, 6R, 6aS) -6-(((tert-butyldimethylsilyl) oxy) methyl) -2,2-dimethyltetrahydrothieno [3 in tetrahydrofuran (1.4 mL) , 4-d] [1,3] dioxol-4-yl) -5-methylpyrimidin-2 (1H) -one (500 mg, 1.17 mmol) was cooled in an ice bath under argon. A solution of 1M tetrabutylammonium fluoride in tetrahydrofuran (1.4 mL, 1.90 mmol) was added and the mixture was stirred at room temperature for 2 hours. The crude product was collected by filtration, washed with tetrahydrofuran and purified by flash chromatography (silica gel; methanol: ethyl acetate 1:10) to give 4-amino-1-((3aR, 4R, 6R, 6aS)- 6- (hydroxymethyl) -2,2-dimethyltetrahydrothieno [3,4-d] [1,3] dioxol-4-yl) -5-methylpyrimidin-2 (1H) -one (436 mg, amount). Was generated. ¹ H NMR (300 MHz, DMSO) δ 7.64 (s, 1H), 7.38 (brs, 1H), 6.85 (brs, 1H), 5.97 (d, J = 2.8 Hz, 1H), 5.19 (t, J = 5.5 Hz, 1H), 4.88 (dd, J = 2.8 and 5.35 Hz, 1H), 4.80 (dd, J = 3.2 and 5.9 Hz, 1H), 3.67 (m, 1H), 3.54 (m, 1H), 3.47 (td, J = 2.8 and 6.4 Hz, 1H), 1.80 (s, 3H), 1 .43 (s, 3H), 1.21 (s, 3H).

Synthesis of nucleotide targets:
General plan

The synthesis of nucleoside 5'-triphosphate is shown above. Nucleoside A is reacted with phosphoramidite reagent in the presence of imidazole HCl / imidazole in dimethylformamide, followed by subsequent oxidation of phosphorous acid with H ₂ O ₂ in good yield (column on silica gel After purification by chromatography, yield B in a typical yield of 60-83%. Cleavage of the protecting group by treatment with trifluoroacetic acid in H ₂ O / dichloromethane yields monophosphate C, typically in quantitative yield. Finally, Bogachev (Bogachev, Synthesis of deoxynucleoside 5'-triphosphates using trifluoretic anhydrate as activation reagent.Rus. Obtain acid D.

  General experimental procedure:

Synthesis of B

Di-tert-butyldiisopropyl phosphoramidite in a solution of A (1 eq), imidazole HCl (1.5 eq), and imidazole (1 eq) in dimethylformamide (3 mL / mmol of A) at room temperature under argon. (1.5 eq) is added dropwise. The reaction mixture is stirred (LC-MS or TLC) until complete consumption of the starting material is observed (typically 30-90 minutes). The reaction mixture is then cooled in an ice-water bath and treated dropwise with 35% H ₂ O ₂ (2.6 eq). The reaction mixture is warmed to room temperature and stirred until complete reaction is observed (LC-MS or TLC). It is then cooled in an ice-water bath and carefully quenched with saturated aqueous sodium thiosulfate. The product is extracted with ethyl acetate. The organic layer is washed with brine, dried over magnesium sulfate, filtered and concentrated under reduced pressure. Purification by column chromatography on silica gel with an appropriate eluent (generally methanol / dichloromethane) gives B typically in 60-85% yield.

Synthesis of C

  A mixture of B (1 eq) in dichloromethane (2 mL / mmol of B), water (3 mL / mmol of B), and trifluoroacetic acid (3 mL / mmol of B) is stirred at room temperature overnight. The reaction mixture is concentrated under reduced pressure (water bath, <50 ° C.) to yield C, typically in quantitative yield.

Synthesis of D

  A cooled solution (ice water bath) of trifluoroacetic anhydride (5 eq) in acetonitrile (0.3 mL / mmol of trifluoroacetic anhydride) was added acetonitrile (4 mL / mmol of C), triethylamine (1 eq) under argon. And dropwise to a cooled suspension of C (1 eq) in N, N-dimethylaniline (4 eq). The reaction is then warmed to room temperature, stirred at room temperature for 30 minutes, and volatiles are removed under reduced pressure.

  The resulting syrup is dissolved in acetonitrile (4 mL / mmol of C), cooled in an ice-water bath and 1-methylimidazole (3 eq) and triethylamine (5 eq) are added under argon. The reaction mixture is stirred for 15 minutes and then warmed to room temperature.

  A solution of tris (tetrabutylammonium) pyrophosphate (1.5 eq) in acetonitrile (1 mL / mmol of pyrophosphate) is added dropwise at room temperature under argon and the mixture is stirred at room temperature for 45 minutes. The reaction is then quenched with deionized water (about 10-15 mL / mmol of C) and stirred for 1 hour. The mixture is washed with chloroform (3 × 10 mL) and the combined organic layers are back extracted once with deionized water (5 mL). The combined aqueous layers are loaded directly onto a column packed with DEAE Sepharose Fast Flow and eluted with a gradient of 0.01 M to 0.5 M triethylammonium bicarbonate buffer. Fractions containing product are combined and lyophilized. The resulting nucleoside triphosphate triethylamine salt is dissolved in deionized water and then applied to a Dowex 50W8 ion exchange column. Fractions exhibiting UV activity are combined and water is removed by lyophilization to generate nucleoside 5'-triphosphate as its sodium salt.

((2R, 3S, 4R, 5R) -5- (2,4-dioxo-3,4-dihydropyrimidin-1 (2H) -yl) -3,4-dihydroxytetra-hydrothiophen-2-yl) methyl Triphosphate sodium salt

Using the method described above for the conversion of A to B, 10 (935 mg, 3.11 mmol) was converted to 14 (1.25 g, 81%). ¹ H NMR (300 MHz, CDCl ₃ ) δ 8.38 (brs, 1H), 7.74 (d, J = 8.3 Hz, 1H), 6.05 (s, 1H), 5.79 (d, J = 8.3 Hz), 4.85 (m, 2H), 4.19 (m, 2H), 3.83 (t, J = 5.0 Hz, 1H), 1.54 (s, 3H), 1.49. (S, 18H), 1.31 (s, 3H).

Using the method described above for the conversion of B to C, 14 (1.25 g, 2.58 mmol) was converted to 15 (0.9 g, amount). ¹ H NMR (300 MHz, D ₂ O) δ 8.13 (d, J = 7.8 Hz, 1H), 5.81 (d, J = 5.5 Hz, 1H), 5.76 (d, J = 8. 3 Hz, 1 H), 4.24 (dd, J = 4.1 and 6.0 Hz, 1 H), 4.11 (t, J = 4.1 Hz, 1 H), 3.98 (m, 2 H), 3. 43 (m, 1H).

Using the method described above for the conversion of C to D, 15 (200 mg, 0.59 mmol) was converted to 4′-thio-UTP (215 mg, 62% (in the case of 4Na + salt)). ¹ H NMR (300 MHz, D ₂ O) δ 8.14 (d, J = 8.3 Hz, 1H), 5.85 (d, J = 6.4 Hz, 1H), 5.81 (d, J = 7. 8 Hz, 1 H), 4.31 (dd, J = 3.7 and 6.4 Hz, 1 H), 4.24 (t, J = 3.7 Hz, 1 H), 4.12 (m, 1 H), 4. 00 (m, 1H), 3.44 (m, 1H). _{^{31 P NMR (300MHz, D 2}} O) δ-8.57 (d), - 10.91 (d), - 22.09 (t). HPLC / MS: RT 9.638 min, m / z 501 (M + H) ^<+> .

(((2R, 3S, 4R, 5R) -5- (4-amino-5-methyl-2-oxopyrimidin-1 (2H) -yl) -3,4-dihydroxytetra-hydrothiophen-2-yl) Methyltriphosphate) sodium salt

Using the method described above for the conversion of A to B, 13 (400 mg, 1.28 mmol) was converted to 16 (910 mg, 65%). ¹ H NMR (300 MHz, CDCl ₃ ) δ 8.19 (brs, 2H), 7.45 (s, 1H), 5.92 (d, J = 2.1 Hz, 1H), 4.98 (dd, J = 1.8 and 6.0 Hz, 1H), 4.95 (dd, J = 2.3 and 5.5 Hz, 1H), 4.24 (m, 2H), 3.80 (td, J = 1.8) And 6.0 Hz, 1H), 1.99 (s, 3H), 1.56 (s, 3H), 1.49 (s, 9H), 1.48 (s, 9H), 1.29 (s, 3H).

Using the method described above for conversion of B to C, 16 (180 mg, 0.977 mmol) was converted to 17 (350 mg, amount). ¹ H NMR (300 MHz, D ₂ O) δ 8.16 (s, 1H), 5.80 (d, J = 6.0 Hz, 1H), 4.25 (dd, J = 4.1 and 5.5 Hz, 1H), 4.10 (t, J = 4.6 Hz, 1H), 4.00 (m, 2H), 3.45 (m, 1H), 1.92 (s, 3H). ³¹ P NMR (300 MHz, D ₂ O) δ 0.41.

Using the method described above for the conversion of C to D, 15 (300 mg, 0.849 mmol) was converted to 4′-thio-5-methyl CTP (136 mg, 28% (in the case of 4Na + salt)). . ¹ H NMR (300 MHz, D ₂ O) δ 7.84 (s, 1H), 5.85 (d, J = 6.4 Hz, 1H), 4.23 (m, 2H), 4.09 (m, 1H) ), 3.97 (m, 1H), 3.40 (m, 1H), 1.82 (s, 3H). _{^{31 P NMR (300MHz, D 2}} O) δ-8.96 (d), - 11.00 (d), - 22.28 (t). ¹³ C NMR (300 MHz, D ₂ O) δ 165.52 (Cq), 158.09 (Cq), 139.80 (CH), 105.40 (Cq), 77.26 (CH), 73.25 (CH ), 66.06 (CH), 64.04 (CH2), 50.09 (CH), 12.33 (CH3). HPLC / MS: RT 10.280 min, m / z 514 (M + H) ^<+> .

  Similar to the synthesis of the preceding 4'-thio-5-methyl CTP, but using the procedure in which 13.1 is replaced with 13, 4'-thio-CTP can be made.

((2R, 3S, 4R, 5R) -5- (6-Amino-9H-purin-9-yl) -3,4-dihydroxytetrahydrothiophen-2-yl) methyltriphosphate sodium salt

19 (504 mg, 1.81 mmol) was converted to 20 (444 mg, 52%) using the method described above for the conversion of A to B. ¹ H NMR (300 MHz, CDCl ₃ ) δ 8.24 (s, 1H), 8.19 (brs, 1H), 7.71 (brs, 1H), 7.09 (s, 1H), 6.20 (brs) 2H), 6.01 (d, J = 5.0 Hz, 1H), 4.76 (m, 1H), 4.50 (m, 1H), 4.23 (m, 2H), 3.77 ( m, 1H), 1.48 (s, 18H).

Using the method described above for the conversion of B to C, 20 (430 mg, 0.904 mmol) was converted to 21 (330 mg, amount). ¹ H NMR (300 MHz, D ₂ O) δ 8.64 (s, 1H), 8.26 (s, 1H), 5.86 (d, J = 5.5 Hz, 1H), 4.54 (m, 1H) ), 4.26 (m, 1H), 4.06 (m, 2H), 3.54 (m, 1H).

Using the method described above for the conversion of C to D, 21 (82 mg, 0.162 mmol) was converted to 4′-thio-ATP (36 mg, 26% (in the case of 4Na + salt)). ¹ H NMR (300 MHz, D ₂ O) δ 8.49 (s, 1H), 8.03 (s, 1H), 5.76 (d, J = 5.6 Hz, 1H), 4.54 (dd, J = 3.7 and 5.6 Hz, 1H), 4.35 (t, J = 4.1 Hz, 1H), 4.13 (m, 2H), 3.54 (dd, J = 4.1 and 8. 7Hz, 1H). _{^{31 P NMR (300MHz, D 2}} O) δ-9.07 (d), - 10.81 (d), - 22.15 (t). HPLC / MS: RT 10.467 min, m / z 524 (M + H) ^<+> .

5-((3R, 4S, 5R) -3,4-dihydroxy-5- (hydroxymethyl) tetrahydrothiophen-2-yl) pyrimidine 2,4 (1H, 3H) dione (4′-S-pseudouridine). The compounds can be made according to the following scheme using procedures known to those skilled in the art.

((2R, 3S, 4R, 5S) -5- (2,4-dioxo-1,2,3,4-tetrahydropyrimidin-5-yl) -3,4-dihydroxytetrahydrothiophen-2-yl) methyltrilin Acid sodium salt (4′-thio-ψUTP). The compounds can be made according to the following scheme using procedures known to those skilled in the art.

((2R, 3S, 4R, 5R) -3,4-dihydroxy-5- (4-oxo-2-thioxo-3,4-dihydropyrimidin-1 (2H) -yl) tetrahydrothiophen-2-yl) methyl Tetrahydrogentriphosphate (4'-S-2-S-UTP). The compounds can be made according to the following scheme using procedures known to those skilled in the art.

((2R, 3S, 4R, 5R) -5- (2-amino-6-oxo-1H-purin-9 (6H) -yl) -3,4-dihydroxytetrahydrothiophen-2-yl) methyltetrahydrogentrilin Acid (4'-S-GTP). The compounds can be made according to the following scheme using procedures known to those skilled in the art.
***

  The specification is most thoroughly understood in light of the teachings of the references cited within the specification. The embodiments herein provide an explanation of embodiments of the invention and should not be construed to limit the scope of the invention. Those skilled in the art will readily recognize that many other embodiments are encompassed by the present invention. All publications and patents cited within this disclosure are incorporated by reference in their entirety. To the extent the material incorporated by reference contradicts or is inconsistent with the present specification, the specification replaces any such material. Citation of any reference herein is not an admission that such reference is prior art to the present invention.

  Unless otherwise indicated, all numbers representing amounts of ingredients, reaction conditions, etc., as used herein, including the claims, are to be understood as approximations and are obtained by the present invention. This can vary depending on the desired properties desired. At a minimum, and not as an attempt to limit the application of the claimed equivalent principle, each numerical parameter should be interpreted in the light of significant digits and conventional rounding techniques. The enumeration of a series of numbers with different amounts of significant digits in this specification implies that numbers given fewer significant digits have the same precision as numbers given more significant digits. It should not be interpreted as a thing.

  The use of the word “a” or “an” when used in conjunction with the term “comprising” in the claims and / or the specification means “one” ) ", But it is also consistent with the meaning of" one or more "," at least one ", and" one or more ". Although this disclosure supports alternatives only and definitions that refer to “and / or”, the use of the term “or” in the claims refers to the alternatives only, or alternatives are mutually exclusive. Unless explicitly indicated otherwise, it is used to mean “and / or”.

  Unless otherwise indicated, the term “at least” preceding a series of elements should be understood to refer to all elements in the series. Those skilled in the art will recognize, or be able to ascertain using no more than routine experimentation, many equivalents to the specific embodiments of the invention described herein. Such equivalents are intended to be encompassed by the following claims.

  Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. Although any methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present invention, the preferred methods and materials are now described.

  The publications discussed herein are provided solely for their disclosure prior to the filing date of the present application. Nothing in this specification should be construed as an admission that the invention is not entitled to antedate such publication by virtue of prior invention. Further, the dates of publication provided may be different from the actual publication dates and may need to be confirmed separately.

  Other embodiments of the invention will be apparent to those skilled in the art from consideration of the specification and practice of the invention disclosed herein. It is intended that the specification and examples be considered as exemplary only, with a true scope and spirit of the invention being indicated by the following claims.

Claims (29)

  An mRNA molecule having a coding region and optionally one or more non-coding regions, wherein the mRNA comprises at least one nucleotide residue incorporating a 4'-thio-substituted furanose ring.   2. The mRNA molecule of claim 1, wherein at least 1% of the adenosine nucleotide residues incorporate a 4'-thio-substituted furanose ring.   3. The mRNA molecule of claim 1 or 2, wherein at least 1% of the guanosine residues incorporate a 4'-thio-substituted furanose ring.   4. The mRNA molecule according to any one of claims 1 to 3, wherein at least 1% of the uridine residues incorporate a 4'-thio-substituted furanose ring.   5. The mRNA molecule according to any one of claims 1 to 4, wherein at least 1% of the cytidine residues incorporate a 4'-thio-substituted furanose ring.   6. The mRNA molecule according to any one of claims 1-5, wherein less than 10% of the nucleotide residues incorporate a 4'-thio-substituted furanose ring.   6. The mRNA molecule according to any one of claims 1 to 5, wherein at least 50% of the residues incorporate a 4'-thio-substituted furanose ring.   8. The mRNA molecule according to any one of claims 1-5 or 7, wherein at least 99% of the nucleotide residues incorporate a 4'-thio-substituted furanose ring.   9. The mRNA molecule according to any one of claims 1 to 8, wherein the non-coding region comprises a poly A tail and the poly A tail comprises a 4'-thio-adenosine residue.   10. The mRNA molecule of claim 9, wherein the poly A tail is at least about 90 nucleotide residues in length.   11. The mRNA molecule of claim 9 or claim 10, wherein the poly A tail is at least about 500 nucleotide residues in length.   12. The mRNA molecule according to any one of claims 1 to 11, wherein the mRNA further comprises at least one non-standard nucleotide residue.   13. The mRNA molecule of claim 12, wherein the non-standard nucleotide residue is selected from one or more of 5-methyl-cytidine, pseudouridine, and 2-thio-uridine.   14. The mRNA molecule of claim 13, wherein the one or more non-standard nucleoside residues are further modified to include 4'-thio-furanose.   15. The mRNA molecule according to any one of claims 1 to 14, wherein the molecule comprises at least 200 nucleotide residues.   16. The mRNA molecule according to any one of claims 1 to 15, wherein the molecule comprises at least 5000 nucleotide residues.   The mRNA molecule according to any one of claims 1 to 16, wherein the coding region codes for a therapeutic protein.   The therapeutic protein is erythropoietin, human growth hormone, cystic fibrosis transmembrane conductance regulator (CFTR), insulin, alpha-galactosidase A, alpha-L-iduronidase, iduronate-2-sulfatase, N-acetylglucosamine-1- Phosphate transferase, N-acetylglucosaminidase, alpha-glucosaminide acetyltransferase, N-acetylglucosamine 6-sulfatase, N-acetylgalactosamine-4-sulfatase, beta-glucosidase, galactose-6-sulfate sulfatase, beta-galactosidase, beta -Glucuronidase, glucocerebrosidase, heparans sulfamidase, hyaluronidase, galactocerebrosidase, ornithine Lance carbamylase (OTC), carbamoyl-phosphate synthetase 1 (CPS1), argininosuccinate synthetase (ASS1), argininosuccinate lyase (ASL), and arginase 1 (ARG1), glucose-6-phosphatase, glucose-6-phosphate Translocase, glycogen debranching enzyme, lysosomal alpha-glucosidase, 1,4-alpha-glucan branching enzyme, glycogen phosphorylase, phosphofructokinase, liver phosphorylase, GLUT-2, UDP glycogen synthase, alpha-L-iduronidase , Iduronate sulfate sulfatase, heparan sulfate sulfamidase, alpha-N-acetylglucosamidase, alpha-glucosaminide-N-acetyltransferase , N-acetylglucosamine-6-sulfate sulfatase, apolipoprotein E, low density lipoprotein receptor (LDLR), factor VIII, factor IX, spinal motor neuron 1 (SMN1), phenylalanine hydroxylase, propionyl-CoA 18. The mRNA molecule of claim 17, selected from carboxylase, porphobilinogen deaminase, petylmalonyl-CoA mutase, urate oxidase, C1 esterase inhibitor, and acid alpha-glucosidase.   A composition comprising at least one mRNA molecule according to any one of claims 1 to 18 and a carrier.   20. The composition of claim 19, wherein the carrier comprises a lipid.   21. The composition of claim 20, wherein the mRNA is encapsulated within lipid nanoparticles.   The carrier is XTC (2,2-dilinolei 1-4-dimethylaminoethyl- [1,3] -dioxolane), MC3 (((6Z, 9Z, 28Z, 31Z) -heptatria-6,9,28). , 31-tetraen-19-yl 4- (dimethylamino) butanoic acid), ALNY-100 ((3aR, 5s, 6aS) -N, N-dimethyl-2,2-di ((9Z, 12Z) -octadeca- 9,12-dienyl) tetrahydro-3aH-cyclopenta [d] [1,3] dioxol-5-amine)), NC98-5 (4,7,13-tris (3-oxo-3- (undecylamino)) Propyl) -N1, N16-diundecyl-4,7,10,13-tetraazahexadecane-1,16-diamide), DODAP (1,2-dioleyl-3-dimethylammo) Umpropane), HGT4003, ICE, HGT5000, cis or trans HGT5001, DOTAP (1,2-dioleyl-3-trimethylammoniumpropane), DOTMA (1,2-di-O-octadecenyl-3-trimethylammoniumpropane), DLinDMA 23. The composition of any one of claims 19-21, wherein the composition is a lipid nanoparticle comprising one or more cationic lipids selected from: DLiN-KC2-DMA and C12-200.   The lipid nanoparticles are DSPC (1,2-distearoyl-sn-glycero-3-phosphocholine), DPPC (1,2-dipalmitoyl-sn-glycero-3-phosphocholine), DOPE (1,2-dioleyl- sn-glycero-3-phosphoethanolamine), DPPE (1,2-dipalmitoyl-sn-glycero-3-phosphoethanolamine), DMPE (1,2-dimyristoyl-sn-glycero-3-phosphoethanolamine) 23. One or more helper lipids selected from, DOPG (, 2-dioleoyl-sn-glycero-3-phospho- (1′-rac-glycerol)), and cholesterol. Of said composition.   24. The composition according to any one of claims 21 to 23, wherein the lipid nanoparticles comprise PEGylated lipids.   24. The composition of claim 21, wherein the lipid nanoparticles comprise one or more cationic lipids, one or more helper lipids, and PEGylated lipids.   20. The composition of claim 19, wherein the carrier comprises a polymer.   27. The composition of claim 26, wherein the polymer is polyethyleneimine.   28. A method of producing a protein in vivo comprising administering to the subject the mRNA according to any one of claims 1 to 18, or the composition according to any one of claims 19 to 27.   Use of an mRNA molecule according to any one of claims 1 to 18 for said production of a drug capable of inducing the expression of a therapeutic protein in vivo.