JP2016208937A - Marker and kit for detecting intraductal papillary mucinous neoplasm - Google Patents

Abstract

PROBLEM TO BE SOLVED: To provide evaluation means for a liquid biopsy to perform detection and diagnosis of intraductal papillary mucinous neoplasm leading to the onset of pancreatic ductal adenocarcinoma which occupies most pancreatic cancers.SOLUTION: The present invention relates to a marker for detecting intraductal papillary mucinous neoplasm containing miR-30e-3p and/or miR-451a, as well as to a microarray and the like for detecting intraductal papillary mucinous neoplasm mounting a probe capable of binding to miR-30e-3p and/or miR-451a.SELECTED DRAWING: None

Description

The present invention relates to a marker for detecting intraductal papillary mucinous tumor, a diagnostic agent for intraductal papillary mucinous tumor, a microarray for detecting intraductal papillary mucinous tumor, and the like.
Specifically, the present invention provides the above marker, diagnostic agent, and microarray for detecting and diagnosing intraductal papillary mucinous tumor by liquid biopsy leading to the development of pancreatic ductal adenocarcinoma, which accounts for the majority of pancreatic cancer Etc.

Conventionally, there is pancreatic cancer as a disease for which a method capable of early detection is required. Various types of diagnostic imaging and blood tests that detect tumor markers are used to test pancreatic cancer, but diagnostic imaging requires large-scale equipment and expensive equipment and is widely used. I can't say that. Moreover, the tumor markers used so far cannot be said to have sufficient sensitivity and specificity, and none of them are suitable for early detection because many do not increase unless cancer progresses to some extent.
Pancreatic cancer is an intractable cancer that is difficult to detect early because it has few initial symptoms, and has a fast progression and poor prognosis. Early detection is very important for reducing pancreatic cancer mortality because pancreatic cancer has a lower chance of being cured.

According to the pancreatic cancer clinical practice guideline, a definitive diagnosis before the start of pancreatic cancer treatment is desirable. Among them, an ultrasonic endoscopic puncture aspiration biopsy for a pancreatic mass has a correct diagnosis rate of 85 to 91%, but it is a problem that approximately 10% cannot be correctly diagnosed. In addition, the facilities where this biopsy can be performed are limited, and the accuracy rate of biomarkers for current pancreatic cancer is not satisfactory at about 70%. Therefore, there is a need for the development of surrogate markers for pancreatic cancer.
The majority of pancreatic cancers are of the type pancreatic ductal adenocarcinoma (PDAC), and pancreatic ductal adenocarcinoma is considered to be an increased malignancy of the tumor called “intraductal papillary mucinous tumor (IPMN)” I can do it.

  However, IPMN does not all become pancreatic cancer, and there are some that can be left alone, and others that have a high risk of cancer and should be removed by surgery. Recently, IPMN has been discovered by chance due to advances in diagnostic imaging, but it is very difficult to determine. Against this background, finding IPMN early and identifying it before it progresses to pancreatic cancer is an important indicator for treatment policy.

  MicroRNA (hereinafter sometimes referred to as “miRNA”) is one of the small non-coding RNAs in cells composed of about 22 bases, and is an essential factor for the control of individual development and cell differentiation. It is. MiRNA dysfunction is found in many human diseases. In particular, abnormal expression of miRNA in cancer is observed in most cancer types, and it is considered that abnormal function of miRNA and carcinogenesis are strongly linked. In recent years, it has been clarified that miRNA is released (secreted) out of the cell in the form of being embedded in an exosome that is an inner membrane vesicle. In addition to elucidating the molecular mechanisms of cancer development, miRNA research is expected to be applied to therapeutic and diagnostic agents.

  Many research groups are searching for miRNAs for the early detection of diseases. A research group is analyzing whether miRNA can be used to determine the risk of cancer derived from IPMN. According to the results, the amount of six miRNAs (miR-100, miR-99b, miR-99a, miR-342-3p, miR-126, miR-130a) is reduced in IPMN at high risk of cancer. (Non-Patent Document 1).

  In this study, IPMN tissues that were surgically removed from a total of 28 people were examined, but it was very difficult to obtain patient-derived samples by actual surgery, and at the same time the burden on the patient was very large . Under such circumstances, biopsy (Biopsy) using a specimen with low patient burden for collection, such as blood, saliva, urine, etc., instead of conventional tissue examination, in recent years, regarding the genetic mutation status of cancer molecules in patients. Attention has been focused on the evaluation method using Liquid Biopsy, which realizes the same inspection performance as the above. The evaluation with liquid biopsy does not require surgical tissue removal or biopsy, and can realize risk assessment leading to cancer and selection of the optimal cancer therapeutic agent by genetic testing in blood. Furthermore, genetic testing using blood can be repeated even in patients who have difficulty collecting cancer tissue. Among the evaluation methods used in liquid biopsy, miRNAs in blood samples, which are particularly less invasive, are currently attracting attention, and many studies have been conducted on their relationship with diseases.

Permuth-Wey J et al., A Genome-Wide Investigation of MicroRNA Expression Identifies Biologically-Meaningful MicroRNAs That Distinguish between High-Risk and Low-Risk Intraductal Papillary Mucinous Neoplasms of the Pancreas., PLoS One., 2015; 10: e0116869.

  The problem to be solved by the present invention is to provide an evaluation means for detecting and diagnosing intraductal papillary mucinous tumor by liquid biopsy leading to the development of pancreatic ductal adenocarcinoma, which accounts for the majority of pancreatic cancer It is in.

  The present inventors have intensively studied to solve the above problems. As a result, we created a profile of serum exosome miRNA derived from patients with intraductal papillary mucinous tumor (IPMN) and a profile of miRNA from patients with other pancreatic diseases, and found miRNA in serum specific to IPMN patients. In addition, using clinical blood specimens, it was confirmed that the profile differs from that of healthy individuals, and hsa-miR-30e-3p was found to be specifically detected from blood samples of IPMN patients, thereby completing the present invention. It came.

That is, the present invention is as follows.
(1) A marker for detecting intraductal papillary mucinous tumor, comprising miR-30e-3p and / or miR-451a.
(2) An intrapancreatic papillary mucinous tumor diagnostic agent comprising a probe capable of binding to miR-30e-3p and / or miR-451a.
(3) An intrapancreatic papillary mucinous tumor diagnostic agent comprising a probe capable of binding to miR-30e-3p and / or a probe capable of binding to miR-451a.

(4) A microarray for detecting an intrapancreatic papillary mucinous tumor, which is equipped with a probe capable of binding to miR-30e-3p and / or miR-451a.
(5) A microarray for detecting an intrapancreatic papillary mucinous tumor equipped with a probe capable of binding to miR-30e-3p and / or a probe capable of binding to miR-451a.
(6) At least one of a probe fixed to a single body and capable of binding to miR-30e-3p and / or miR-451a, a probe capable of binding to miR-30e-3p, and a probe capable of binding to miR-451a A kit for diagnosis or detection of intraductal papillary mucinous tumor, comprising a probe.

(7) miR-30e-3p and / or miR-451a is detected in a sample collected from a living body, and the presence or absence of an intrapancreatic papillary mucinous tumor is determined based on the detection result. A method to aid diagnosis.
(8) A method for diagnosing intraductal papillary mucinous tumor using the detection result of miR-30e-3p and / or miR-451a in a test animal as an index.
(9) Use of miR-30e-3p and / or miR-451a in the diagnosis of intraductal papillary mucinous tumor.

  According to the present invention, by measuring a specific miRNA in a subject's liquid biopsy, an intraductal papillary mucinous tumor that is a risk of pancreatic cancer (pancreatic ductal adenocarcinoma, which accounts for the majority) can be easily obtained. It can be detected or diagnosed.

FIG. 1-1 is a scatter plot showing the results of comparing microRNA profiles of a control sample and each pancreatic disease sample.

FIG. 1-2 is a scatter plot showing the result of comparing the microRNA profiles of the control specimen and each pancreatic disease specimen, as in FIG. 1-1.

FIG. 2 is a diagram showing microRNAs specifically expressed by making each data in Table 1 in the Examples described later into a histogram.

Hereinafter, although an embodiment of the present invention is described in detail, this embodiment is an example for explaining the present invention, and the present invention is not limited only to this embodiment.
It should be noted that all publications cited in the present specification, for example, prior art documents, publications, patent publications and other patent documents are incorporated herein by reference.

1. Marker for detecting intraductal papillary mucinous tumor According to the present invention, the marker for detecting intraductal papillary mucinous tumor (IPMN) includes miR-30e-3p and / or miR-451a as described above.
Here, miR-30e-3p and miR-451a are both miRNAs in serum specific to IPMN patients. “MiR-30e-3p” is published in miRBase (the microRNA database; http://www.mirbase.org/ ) as Accession number: MIMAT0000693, ID: hsa-miR-30e-3p. Is a 22-base RNA consisting of the base sequence (cuuucagucggauguuuacagc) represented by SEQ ID NO: 1. Similarly, “miR-451a” is disclosed as accession number: MIMAT0001631 and ID: hsa-miR-451a in miRBase, and specifically consists of the base sequence (aaaccguuaccauuacugaguu) represented by SEQ ID NO: 2. It is a base RNA.

  The amount of miR-30e-3p and / or miR-451a in a subject's biological sample (especially blood) is miR-30e- in a biological sample (especially blood) of a healthy person (who does not show the above-mentioned tumor pathology). If significantly more or less than 3p and / or miR-451a is detected, the subject can be determined to have or is likely to develop IPMN and thus pancreatic cancer. . Specifically, miR-30e-3p is different from the other four types of pancreatic diseases (pancreatic cancer (PC), pancreatic endocrine tumor (P-NET), chronic pancreatitis (CP), autoimmune pancreatitis (AIP)) It is detected at a significantly higher value in serum samples from IPMN patients than in healthy controls. On the other hand, unlike the other four types of pancreatic diseases described above, miR-451a is detected in a serum sample of an IPMN patient at a lower value than that of a healthy person as a control.

Since the detection target sample of miR-30e-3p and / or miR-451a that is an IPMN detection marker is substantially blood / serum among biological samples, the IPMN detection marker of the present invention is blood A medium marker is preferred. The IPMN detection marker of the present invention can also be used as an IPMN diagnostic marker.
What is detected or diagnosed using the marker of the present invention is an intrapancreatic papillary mucinous tumor (IPMN). As described above, IPMN is an onset of pancreatic ductal adenocarcinoma that accounts for the majority of pancreatic cancer. It leads to Therefore, the detection / diagnosis of IPMN in the present invention can be replaced with detection / diagnosis of pancreatic ductal adenocarcinoma, and in turn, detection / diagnosis of pancreatic cancer. Although it can be replaced by detection and evaluation of pancreatic cancer, there is no particular limitation.

2. Probes or probe sets for detecting or diagnosing intraductal papillary mucinous tumors Probes are generally nucleic acids (mRNA, mRNA or cDNA or cRNA, or their antisense strands in a sample (test sample). (ARNA or aDNA)) is captured by hybridization and used to detect the target nucleic acid. The probe is usually a nucleic acid probe, but as the “nucleic acid” constituting the probe, DNA, RNA, PNA or the like can be generally used, and DNA is particularly preferable.
In the present invention, examples of probes (or probe sets) for use in diagnosis and detection of intraductal papillary mucinous tumors include the following nucleic acids (a) to (d) or (a) to (d), respectively. The thing containing a part of base sequence is mentioned.

(A) Complementary to the base sequence constituting miR-30e-3p and / or the base sequence constituting miR-451a (base sequence represented by SEQ ID NO: 1 and / or base sequence represented by SEQ ID NO: 2) Nucleic acid comprising a base sequence (b) Nucleic acid comprising a base sequence obtained by substituting thymine (T) for uracil (U) in the base sequence of the nucleic acid (ie RNA) of (a) above (ie DNA)
(C) Hybridizes with a nucleic acid comprising a base sequence complementary to the nucleic acid (a) or (b) under stringent conditions, and detects miR-30e-3p and / or miR-451a A nucleic acid (d) comprising a nucleotide sequence having a nucleotide sequence identity (homology) of 80% or more with the nucleic acid (a) or (b), and miR-30e-3p and / or miR- Nucleic acid capable of detecting 451a

  Here, in the nucleic acid of the above (c), the “nucleic acid hybridizing under stringent conditions” means, for example, a nucleic acid comprising a base sequence complementary to the base sequence of the nucleic acid of the above (a) or (b) A nucleic acid obtained by using a colony hybridization method, a plaque hybridization method, a Southern hybridization method, or the like using all or a part of the probe as a probe. Examples of hybridization methods include “Sambrook & Russell, Molecular Cloning: A Laboratory Manual Vol. 3, Cold Spring Harbor, Laboratory Press 2001”, “Ausubel, Current Protocols in Molecular Biology, John Wiley & Sons 1987-1997”. Can be used.

The “stringent conditions” may be any of low stringent conditions, medium stringent conditions, and high stringent conditions. Examples of “low stringent conditions” include conditions of 5 × SSC, 5 × Denhardt's solution, 0.5% SDS, 50% formamide, and 32 ° C. Examples of “medium stringent conditions” include conditions of 5 × SSC, 5 × Denhardt's solution, 0.5% SDS, 50% formamide, and 42 ° C. Examples of “high stringent conditions” include conditions of 5 × SSC, 5 × Denhardt's solution, 0.5% SDS, 50% formamide, and 50 ° C. In the present invention, specifically, “stringent conditions” are, for example, 0.24 M TNT buffer, 0.12 M TNT buffer, 1 × SSC solution (1 × SSC is 0.15 M NaCl, 15 mM citric acid Examples of conditions for washing at 45 to 65 ° C. in sodium) are not limited thereto. Stringency can be controlled by salt concentration (ionic strength), temperature, and the like. Under higher stringency conditions, i.e., lower salt concentration and higher temperature, washing removes the background due to non-specific hybridization, leaving only the specifically hybridized nucleic acid. A person skilled in the art will adjust the temperature and salt concentration. Alternatively, stringent conditions can be appropriately selected by multi-stage washing as shown in WO2006 / 083040.

Under such “stringent conditions”, nucleic acids having high identity (homology) can be efficiently obtained as the temperature is raised. However, factors affecting the stringency of hybridization may include multiple factors such as temperature, probe concentration, probe length, reaction time, ionic strength, salt concentration, and those skilled in the art will select these factors as appropriate. It is possible to achieve the same stringency.
In the hybridization, when a commercially available kit is used, for example, Alkphos Direct Labeling Reagents (manufactured by Amersham Pharmacia) can be used. In this case, follow the protocol attached to the kit, incubate with the labeled probe overnight, and then wash the membrane with a primary wash buffer containing 0.1% (w / v) SDS at 55 ° C. The hybridized nucleic acid can be detected.

  Examples of nucleic acids that can hybridize other than the above include, for example, the nucleic acid of the above (d), and when calculated using the default parameters by homology search software such as FASTA and BLAST, (B) the nucleic acid base sequence and 80% or more, 81% or more, 82% or more, 83% or more, 84% or more, 85% or more, 86% or more, 87% or more, 88% or more, 89% or more, 90% or more, 91% or more, 92% or more, 93% or more, 94% or more, 95% or more, 96% or more, 97% or more, 98% or more, 99% or more, 99.1% or more, 99.2% or more, 99.3% As mentioned above, there can be mentioned nucleic acids consisting of base sequences having 99.4% or more, 99.5% or more, 99.6% or more, 99.7% or more, 99.8% or more, or 99.9% or more of identity (homology).

  The identity (homology) of the nucleotide sequence is determined by the algorithm BLAST (Proc. Natl. Acad. Sci. USA, vol. 87, p. 2264-2268, 1990; Proc. Natl. Acad. Sci by Carlin and Arthur. USA, vol. 90, p. 5873, 1993). Programs called BLASTN and BLASTX based on the BLAST algorithm have been developed (Altschul SF, et al., J. Mol. Biol., Vol. 215, p. 403, 1990). When analyzing a base sequence using BLASTN, parameters are set to, for example, score = 100 and word length = 12. When using BLAST and Gapped BLAST programs, the default parameters of each program are used.

  Examples of the nucleic acids (c) and (d) include those in which one or two bases are deleted, added or substituted in the base sequence of the nucleic acid (a) or (b). The site to be deleted, added or substituted may be the 5 'end or 3' end of the nucleic acid (a) or (b), or may be a portion other than the end. In the nucleic acid of (d) and (e), “miR-30e-3p and / or miR-451a can be detected” means that the nucleic acid base sequence of (a) or (b) is hybridized. Means that it can be captured by.

The lengths of the nucleic acids (c) and (d) are not particularly limited, but are preferably 15 to 30 bases, 17 to 25 bases, and 18 to 22 bases, for example.
The nucleic acids (a) to (d) are not limited to the full length of the nucleic acid, and a part thereof can be used as a probe.
The method for obtaining various nucleic acids used in the probes or probe sets described in the present specification is not particularly limited, and can be obtained by a known genetic engineering technique or a known synthesis technique. For example, commercially available DNA It can also be obtained using a synthesizer.

In addition, various nucleic acids used in the probe or probe set may be appropriately modified, for example, those that have been terminal vinylated (acryloylated or methacryloylated) or terminal aminated, or bases that serve as linkers. Examples thereof include those modified with (poly T or the like). In addition, another base may be inserted into a part of the base sequence of various nucleic acids, a part of the base sequence may be deleted, replaced with another base, or replaced with a substance other than the base. Can also be used. Here, examples of the substance other than the base include dyes (fluorescent dyes, intercalators), quenching groups, and base crosslinking agents.

3. Intrapancreatic papillary mucinous tumor diagnostic agent The intrapancreatic papillary mucinous tumor diagnostic agent according to the present invention is, as described above, a probe capable of binding to miR-30e-3p and / or miR-451a, or miR-30e-3p And / or a probe capable of binding to miR-451a. That is, the diagnostic agent may contain a probe that can bind to both miR-30e-3p and miR-451a, or can bind to either miR-30e-3p or miR-451a. A probe may be included, and a combination of a probe capable of binding to miR-30e-3p and a probe capable of binding to miR-451a may be included, and is not particularly limited. More specifically, the various probes and probe sets described in the above section 2 can also be used for the diagnostic agent of the present invention.

In addition, the present invention can also provide a diagnostic kit or a detection kit for intraductal papillary mucinous tumor containing the various probes.
In the diagnostic agent and various kits of the present invention, the various probes are dissolved in a powder state or a solution state (pure water, buffer, physiological saline, etc.) in consideration of stability (storage stability) and ease of use. And stored under conditions of refrigeration or freezing (-30 ° C to -80 ° C). Moreover, the diagnostic agent and various kits of the present invention may contain other components in addition to the various probes, and examples of the other components include a chromogenic substrate.

The diagnostic agent and various kits of the present invention only need to have at least the various probes as constituent elements. Therefore, all of the components essential for the diagnosis and detection of the intraductal papillary mucinous tumor may be provided together with the above-mentioned various probes or not, and there is no limitation.

4). Microarray for detection of intraductal papillary mucinous tumor A nucleic acid microarray is obtained by immobilizing a large number of nucleic acid probes on a carrier independently at high density. The nucleic acid microarray is a system used to comprehensively analyze the expression level related to a plurality of nucleobase sequences and the sequence of a specific nucleobase sequence itself.
The microarray for detecting intraductal papillary mucinous tumors (nucleic acid microarray for detecting intraductal papillary mucinous tumors) according to the present invention includes the various probes (or probe sets) of the present invention described in Sections 2 and 3 above. It is installed. The microarray of the present invention is not particularly limited as long as the various probes are fixed on a support.

  The form of the support for the nucleic acid microarray is not particularly limited, and any form such as a flat plate, a rod, or a bead can be used. When a flat plate is used as the support, a predetermined probe can be fixed on the flat plate with a predetermined interval for each type (see, for example, spotting method; Science, 270, 467-470 (1995)). ). It is also possible to sequentially synthesize a predetermined probe for each type at a specific position on the flat plate (see, for example, photolithography method; Science, 251, 767-773 (1991)).

  Other preferred support forms include those using hollow fibers. When using hollow fibers as a support, a nucleic acid microarray obtained by fixing probes to each hollow fiber for each type, converging and fixing all hollow fibers, and then repeating cutting in the longitudinal direction of the fibers is preferable. It can be illustrated. This nucleic acid microarray can be described as a type in which a probe is immobilized on a through-hole substrate, and is also referred to as a so-called “through-hole type microarray” (Japanese Patent No. 3510882).

  The method for immobilizing the probe to the support is not particularly limited, and any binding mode may be used. Moreover, it is not limited to immobilizing directly to a support body, For example, a support body can be previously coated with polymers, such as polylysine, and a probe can also be fixed to the support body after a process. Furthermore, when a tubular body such as a hollow fiber is used as the support, the tubular body can hold a gel-like material, and the probe can be immobilized on the gel-like material.

  Hereinafter, the through-hole type nucleic acid microarray using hollow fibers will be described in detail. This microarray can be manufactured through the following steps (step i) to (step iv), for example.

(Step i) Step of producing an array by arranging a plurality of hollow fibers in three dimensions so that the longitudinal direction of the hollow fibers is the same direction (Step ii) Embedding the array, Step of manufacturing (Step iii) Step of introducing a gel precursor polymerizable solution containing a probe into the hollow portion of each hollow fiber of the block body to perform a polymerization reaction, and holding the gel-like material containing the probe in the hollow portion ( Step iv) A step of cutting the block body into pieces by cutting in a direction intersecting the longitudinal direction of the hollow fiber

Although it does not limit as a material used for a hollow fiber, For example, the material as described in Unexamined-Japanese-Patent No. 2004-163211 etc. is mentioned preferably.
The hollow fibers are arranged three-dimensionally so that the lengths in the longitudinal direction are the same (step i). As an arrangement method, for example, a plurality of hollow fibers are arranged in parallel at a predetermined interval on a sheet-like material such as a pressure-sensitive adhesive sheet, and the sheet is formed into a sheet, and then the sheet is wound up in a spiral shape (Japanese Patent Laid-Open No. Hei 11- No. 108928), or two perforated plates each having a plurality of holes provided at predetermined intervals are overlapped so that the holes coincide with each other, and the hollow fibers are passed through the holes, and then the two porous Examples include a method of temporarily fixing the plate with a gap between the plates, filling the periphery of the hollow fiber between the two porous plates with a curable resin material (see JP 2001-133453 A), and the like.

The manufactured array is embedded so that the array is not disturbed (step ii). Examples of the embedding method include a method in which a polyurethane resin, an epoxy resin, or the like is poured into a gap between fibers, and a method in which fibers are bonded together by heat fusion.
The embedded array is filled with a gel precursor polymerizable solution (gel-forming solution) containing a probe in the hollow part of each hollow fiber, and a polymerization reaction is performed in the hollow part (step iii). Thereby, the gel-like thing with which the probe was fixed can be hold | maintained in the hollow part of each hollow fiber.

The gel precursor polymerizable solution is a solution containing a reactive substance such as a gel-forming polymerizable monomer, and the solution can be converted into a gel by polymerizing and crosslinking the monomer. Say. Examples of such monomers include acrylamide, dimethylacrylamide, vinyl pyrrolidone, methylene bisacrylamide and the like. In this case, the solution may contain a polymerization initiator or the like. After fixing the probe in the hollow fiber, the block body is cut into a thin piece in a direction intersecting with the longitudinal direction of the hollow fiber (preferably a direction orthogonal) (step iv). The flakes thus obtained can be used as a nucleic acid microarray. The thickness of the array is preferably about 0.01 mm to 1 mm. The block body can be cut by, for example, a microtome and a laser. Preferred examples of the through-hole type microarray include a nucleic acid microarray (Genopal ^™ (Genopal (registered trademark))) manufactured by Mitsubishi Rayon Co., Ltd.

In the case of the above Genopal (registered trademark), oligonucleotide probes complementary to each corresponding sequence are immobilized at high density, and double-stranded cDNA synthesis is performed from RNA derived from a biological sample using T7 oligo dT primer. Then, aRNA is synthesized by in vitro transcription. Biotin is incorporated during aRNA synthesis and the sample is labeled. Biotin-labeled aRNA is fragmented and hybridized to the DNA array. After hybridization, aRNA is detected with streptavidin or the like modified with a fluorescent dye. The fluorescence can be read with a fluorescence detector, the array image obtained can be digitized, and the expression level of each gene can be compared and quantified. The nucleic acid microarray to be used is not limited to the above-described method, and the same analysis can be performed using a plurality of types of nucleic acid microarrays available to those skilled in the art.

5. In the present invention, in the present invention, a method for diagnosing intraductal papillary mucinous tumor using the detection result of miR-30e-3p and / or miR-451a in a test animal as an index A method for detecting the tumor can be provided.
In the present invention, the intraductal papillae that detect miR-30e-3p and / or miR-451a in a sample collected from a living body and determine the presence or absence of intraductal papillary mucinous tumor based on the detection result Methods can also be provided to aid in the diagnosis of mucinous tumors.
Furthermore, the present invention can also provide the use of miR-30e-3p and / or miR-451a in the diagnosis or detection of intraductal papillary mucinous tumors.

  In these methods of the present invention, miR-30e-3p and / or miR-451a is detected in a biological sample (blood sample, particularly serum or plasma) derived from a test animal (mammal, particularly a human (subject)). When the detection amount of miR-30e-3p in the test animal is significantly higher than the detection amount of healthy subjects, and / or when the detection amount of miR-451a in the test animals is significantly lower than the detection amount of healthy subjects In addition, it can be determined that the subject animal has or is highly likely to have an intrapancreatic papillary mucinous tumor. Furthermore, in the above case, it is determined that the subject animal has a high risk of developing pancreatic ductal adenocarcinoma, and thus pancreatic cancer, or the subject animal has already developed pancreatic ductal adenocarcinoma, and thus pancreatic cancer. It can be judged that there is a high possibility that

The method for measuring miRNA (miR-30e-3p, miR-451a) in a biological sample is not particularly limited, and any method that can detect and measure RNA having a specific base sequence from a sample can be used. Examples of such methods include Northern hybridization, RNase protection assay, quantitative PCR such as RT-PCR and real-time PCR, and methods using DNA microarrays.
In the diagnostic method and detection method of the present invention, the amount of at least one miRNA of miR-30e-3p and miR-451a may be measured. In other words, either miRNA may be measured or both miRNAs may be measured.

In the present specification, detecting the target miRNA (miR-30e-3p, miR-451a) (measuring the abundance) means accurately measuring the miRNA concentration in a sample derived from a living body. Alternatively, the concentration may not be accurately measured as long as it can be confirmed that the concentration in the biological sample is significantly higher or lower than the level of a healthy person.
In miRNA detection, the concentration of each target miRNA (miR-30e-3p, miR-451a) may be determined, or the expression profile (expression pattern) of multiple miRNAs contained in a biological sample And the miRNA expression profile in healthy persons as a whole, and the similarity may be evaluated.

In Northern hybridization, the extracted miRNA is developed on a gel by electrophoresis such as agarose electrophoresis, transferred to a membrane such as nitrocellulose membrane or nylon membrane, and then the target miRNA (miR-30e-3p, miR-451a The miRNA is detected using a probe that hybridizes with a). For labeling the probe, radioactive isotopes such as ³² P, digoxigenin (DIG) and antibodies can be used.
In the RNase protection assay, an RNA probe labeled with a radioisotope or DIG is hybridized with a target miRNA (miR-30e-3p, miR-451a) and then targeted using a single strand-specific RNase. In this method, after digesting a probe region that has not hybridized with miRNA, the probe portion protected by hybridization is detected by electrophoresis or the like.

In RT-PCR, cDNA is obtained from miRNA in a biological sample using reverse transcriptase, PCR is performed using this cDNA as a template and appropriate primers are used, and the amplification product is quantified by electrophoresis or the like. This is a method for determining the amount of RNA.
Real-time PCR is a method for detecting PCR amplification products. There are an intercalation method using a fluorescent label specifically inserted into a double-stranded nucleic acid typified by SYBR Green, and a method using a fluorescently labeled sequence-specific probe typified by a TaqMan probe. Even in the case of using the real-time PCR method, cDNA can be obtained from miRNA in a sample with reverse transcriptase and used as a template.

  A method using a DNA microarray (nucleic acid microarray) is a method in which a DNA probe that hybridizes with all or part of a target miRNA (miR-30e-3p, miR-451a) is immobilized on a solid phase carrier and brought into contact with a sample. This is a method for detecting a hybridized target miRNA. It is suitable for comprehensive measurement of miRNA expression profiles (expression level profiles) in biological samples. Design a part of the miRNA to hybridize to the probe immobilized on the solid support, and detect the target miRNA by hybridizing the remaining part of the miRNA to the labeled second DNA probe. You can also. The expression profile means, for example, measuring the amount of various miRNAs in a collected biological sample, and indicating the measured expression level of each miRNA as an absolute value and / or a relative value.

In the diagnostic method and detection method of the present invention, the sample derived from the test animal (subject), that is, the sample collected from the living body is not particularly limited, but is preferably a blood sample, particularly serum or plasma. As a control sample of a healthy person for comparison, serum or plasma derived from a healthy person can be used, or serum or plasma derived from a purchased healthy person can also be used.
In addition, the exosome fraction may be concentrated from serum or plasma before miRNA detection or measurement. The method of concentrating is not limited to the ultracentrifugation method, and may be performed by a method of preparing with a membrane, a method of preparing with an antibody, or a method using a reagent that specifically concentrates exosomes. Furthermore, miRNA may be extracted from the exosome fraction. These steps can be carried out by those skilled in the art according to conventional methods.

In the present specification, “pancreatic cancer”, “pancreatic ductal adenocarcinoma (PDAC)” and “intraductal papillary mucinous tumor (IPMN)” are used in the usual sense, and pathological classification, morphology This includes pancreatic cancer, pancreatic ductal adenocarcinoma, and intraductal papillary mucinous tumor of any state, regardless of the stage of progression, depth of progression, etc.
In the present specification, “detection” means examining a sample collected from a subject in order to obtain information necessary for diagnosis. In the present invention, “detection” is a stage in which the risk of pancreatic ductal adenocarcinoma and thus pancreatic cancer is examined by confirming whether or not the patient has an intraductal papillary mucinous tumor. Screening for the possibility of developing ductal adenocarcinoma and thus pancreatic cancer.

In addition, in the diagnostic method and detection method of this invention, you may carry out in combination with the test method by a tumor marker currently used for the conventionally well-known test | inspection, image diagnosis, etc.
In this specification, “significant” means “statistically significant”. For example, a value indicating a change in the expression level when compared with a control sample is a standard deviation centered on an average value. A method that shows a change of 3 times or more is possible. Other statistical processing test methods are not particularly limited as long as a known test method capable of determining the presence or absence of significance is appropriately used. For example, Student's t test or multiple comparison test can be used.

6). Kit for diagnosis or detection of intraductal papillary mucinous tumor The present invention also includes a kit for carrying out the above-described diagnosis method and detection method of the present invention, or a method for assisting diagnosis.
One embodiment of the kit of the present invention includes a carrier on which a DNA (probe) capable of hybridizing with a predetermined miRNA (miR-30e-3p, miR-451a) is immobilized. The carrier is not particularly limited as long as the carrier can immobilize the probe DNA. Examples of the carrier include microtiter plates made of glass, metal, resin, etc., substrates, beads, gels, nitrocellulose membranes, nylon membranes, PVDF membranes, and the like. Can be mentioned. Probe DNA can be fixed to these carriers by a known method. The kit may further include, for example, various reaction / detection reagents, buffers, instruction manuals, and the like.

As another embodiment of the kit of the present invention, a primer set necessary for amplifying a predetermined miRNA (miR-30e-3p, miR-451a) or a nucleic acid comprising a complementary base sequence by the PCR method Including. In a method of measuring the amount of target miRNA (miR-30e-3p, miR-451a) in a biological sample by PCR, it is common to first prepare cDNA with reverse transcriptase. Therefore, the kit of the present invention may include a primer set capable of amplifying a target miRNA or a DNA consisting of a base sequence complementary thereto. Such a primer set can be appropriately designed by those skilled in the art based on the sequence of the target miRNA.
When the kit of the present invention includes a DNA microarray (nucleic acid microarray), a reagent for directly labeling the target miRNA may be provided. As a labeling reagent, a technique common to those skilled in the art such as a fluorescent substance, biotin, a radioactive isotope such as ³² P, digoxigenin, and the like can be used. Such a kit may further include, for example, a reverse transcriptase, various reaction / detection reagents, a buffer, an instruction manual, and the like, but is not particularly limited.

  EXAMPLES Hereinafter, the present invention will be described with reference to specific examples, but the present invention is not limited to the following examples.

<Preparation of microRNA microarray and labeled microRNA>
Genopearl MICH14 was used for microRNA analysis. The on-board probe for detecting microRNA is described at a predetermined URL (https://www.mrc.co.jp/genome/products/micro_rna.html).
A serum sample was used as a sample. Equal volume of plasma samples from 5 patients each with pancreatic cancer (PC), pancreatic endocrine tumor (P-NET), intraductal papillary mucinous tumor (IPMN), chronic pancreatitis (CP), and autoimmune pancreatitis (AIP) After pooling, 900 μL was separated and exosomes were purified using exoRNeasy Serum / Plasma Midi Kit (Qiagen). Similarly, exosomes were purified using normal human plasma (Kohjin Bio Inc.) as a healthy human sample.

Thereafter, 1 μL of an external control for analysis of Genopal MICH14 was added, and then the microRNA solution was obtained by operating according to the protocol of miRNeasy Serum / Plasma Kit (Qiagen).
16 μL of the obtained microRNA solution was mixed with 2 μL of the buffer solution of Nucleic Acid Labeling Kit, Platinum Bright 647 Infrared (Cleatech) kit and 2 μL of the labeling reagent to make 20 μL, and then incubated at 85 ° C. for 30 minutes. Thereafter, purification was performed using a column attached to the kit to obtain about 20 μL of a fluorescently labeled microRNA solution. Thereafter, 1 μL of the obtained solution was subjected to electrophoresis using Agilent RNA 6000 Pico Kit (Agilent Technology Co., Ltd.), and it was confirmed that short RNA was extracted.

<Hybridization>
The labeled microRNA was prepared so that the final concentration was 0.24 M TNT solution and the solution volume was 200 μL. Hybridization was performed using a miRNA array (Genopal MICH14). Hybridization was performed for 16 hours at 50 ° C. under light shielding conditions.
Washing was carried out at 0.24 M TNT solution at 50 ° C. for 40 minutes, and then at 0.24 M TN solution at 50 ° C. for 10 minutes.
For detection, each probe spot of the microarray after hybridization was imaged and digitized using a cooled CCD camera type fluorescence detection apparatus.

The fluorescence intensity data of the blank spot was subtracted from the fluorescence intensity data of each spot obtained from the detected microarray, and further corrected based on the external control. This was called signal intensity. The resulting scatter plots are shown in FIGS. 1-1 and 1-2.
In the analysis, based on the ratio of the signal intensity to the detected control sample (see Table 1 below), for convenience, it is divided into Tables 1-1 to 1-4. These are collectively shown in Table 1.), specifically detected microRNA was extracted. Table 1 shows the expression ratio of microRNA between the control sample and each pancreatic disease sample (value obtained by converting the ratio by Log with a base of 2).

All the data of the ratios of the five types of pancreatic diseases shown in Table 1 were represented as histograms as shown in FIG. When the average value and the standard deviation of these data were tripled, the average value was -0.37 and 3 x SD: 2.31. About the threshold value specifically changing compared with the control sample, the average value + 3 × SD = 1.94 in the direction in which the expression level increases, and the average value −3 × SD in the direction in which the expression level decreases = -2.68.
When data changing beyond these threshold values was extracted from Table 1, the following four data were extracted.

(1) IPMN plasma hsa-miR-30e-3p 4.52
(2) IPMN plasma hsa-miR-451 -3.06
(3) PC plasma hsa-miR-301 3.96
(4) PC plasma hsa-miR-521 3.07

  Based on the above results, among exosome miRNAs derived from patients with intraductal papillary mucinous tumors, changes in hsa-miR-30e-3p and hsa-miR-451 can be detected specifically, unlike the other four diseases It was shown that.

Claims (9)

  A marker for detecting intraductal papillary mucinous tumor, comprising miR-30e-3p and / or miR-451a.   An intrapancreatic papillary mucinous tumor diagnostic agent comprising a probe capable of binding to miR-30e-3p and / or miR-451a.   An intrapancreatic papillary mucinous tumor diagnostic agent comprising a probe capable of binding to miR-30e-3p and / or a probe capable of binding to miR-451a.   A microarray for detecting intraductal papillary mucinous tumors, which is equipped with a probe capable of binding to miR-30e-3p and / or miR-451a.   A microarray for detecting an intrapancreatic papillary mucinous tumor equipped with a probe capable of binding to miR-30e-3p and / or a probe capable of binding to miR-451a.   A probe that can be bound to miR-30e-3p and / or miR-451a, a probe that can bind to miR-30e-3p, and a probe that can bind to miR-451a, A kit for diagnosis or detection of intraductal papillary mucinous tumor, comprising:   Detects miR-30e-3p and / or miR-451a in samples collected from living organisms, and determines the presence or absence of intraductal papillary mucinous tumors based on the detection results, assisting in the diagnosis of intraductal papillary mucinous tumors how to.   A method for diagnosing intraductal papillary mucinous tumor using the detection result of miR-30e-3p and / or miR-451a in a test animal as an index. Use of miR-30e-3p and / or miR-451a in the diagnosis of intraductal papillary mucinous tumors.