JP2016199554A - ANTIBODY AGAINST MUTANT α-ACTININ-4 - Google Patents

Abstract

PROBLEM TO BE SOLVED: To provide a specific monoclonal antibody reacting with mutant α-actinin-4 and not reacting with α-actinin-4 that is constantly expressed, and to provide cell lines generating the antibody.SOLUTION: The invention relates to an antibody against mutant α-actinin-4 having the amino acid sequence in which at least one amino acid residue in the region from the 245th to 263rd of an amino acid sequence of α-actinin-4 is substituted by another amino acid residue, the antibody recognizing all or a part of substituted amino acid residues in the region. The antibody is a monoclonal antibody.SELECTED DRAWING: None

Description

  The present invention is an antibody against mutant α-actinin-4, and particularly relates to a monoclonal antibody against a novel splice variant of α-actinin-4 protein.

  α-actinin-4 (hereinafter also referred to as ACTN4) is one of α-actinin and has a globular actin-binding domain at the N-terminus and a calcium-binding motif (referred to as the EF hand domain) at the C-terminus. Yes. ACTN4 forms a dimer using a rod domain in the center to form a dumbbell, and actin is cross-linked and bundled using actin-binding domains at both ends (Non-Patent Document 1). .

  Four types of mammalian α-actinins, actinin-1 to 4 have been identified, actinin-1 and -4 are non-muscular, and actinin-2 and -3 are muscular (Non-Patent Documents 1 and 2) , 3, 4).

  ACTN4 is an actin-binding protein that is involved in actin bundling and promotes cell motility, and it has been confirmed that it is concentrated in cell processes thought to have increased cell motility. Furthermore, there is a possibility that some positive contribution to cancer invasion has been suggested (Non-patent Document 2).

  In addition, an alternative splice variant that skips exon 8 in which a gene mutation is found in a familial glomerular sclerosis family and inserts a new exon 8 ′ that has not been known so far is used in small cell lung cancer. Since it is expressed specifically and can only be confirmed in the testis from normal tissues, it is suggested that it may be a cancer testis antigen (Non-patent Document 5).

  On the other hand, lung cancer is classified into two types, small cell lung cancer (referred to as SCLC) and non-small cell lung cancer (referred to as non-SCLC), based on the histological findings. SCLC accounts for 20% of primary lung cancers, and because of its rapid growth rate, it is often found in progressive forms with multiple organ metastases, and is known for "high grade" and "poor prognosis" (non-prognosis) Patent Document 5).

  In terms of treatment, non-SCLC and SCLC, where adenocarcinoma and squamous cell carcinoma are the majority, are treated differently. It is characterized by the fact that surgical treatment cannot be applied to SCLC that has progressed as much as possible, and that chemotherapy is less effective for non-SCLC. Therefore, it has been considered that it is important to distinguish the two at an early stage in order to perform an accurate treatment.

  In addition, a large cell carcinoma subtype included in non-SCLC, large cell neuroendocrine cancer (referred to as LCNEC), accounts for 3% of primary lung cancer, and has a “poor prognosis” like SCLC. Both have a high neuroendocrine character unlike other lung cancers (Non-Patent Document 6).

  Traditionally, SCLC and LCNEC are called primary high-grade neuroendocrine tumors (HGNT), and as one of the diagnostic methods, neuroendocrine markers (Chromogranin, Synaptophysin, neural-cell-adhesion) -molecule (NCAM)) has been performed (Non-patent Document 7).

  However, the positive rate of these three markers is never high, and the high false positive rate has been regarded as a problem. Therefore, development of a new tumor marker having high specificity for small cell lung cancer and large cell neuroendocrine cancer and capable of early detection is desired.

Cell Motil. Cytoskeleton. 58, 104-111, 2004 J. Cell Biol. 140, 1383-1393, 1998 Am. J. Hum. Genet. 47, 62-71, 1990 J. Biol. Chem. 267, 9281-9288, 1992 Oncogene, 23, 5257-5262, 2004 Mod Pathol. 19,1358-68, 2006 Am J Surg Pathol. 31, 26-32, 2007

  The present invention is an ACTN4-Va-specific monoclonal antibody that reacts with a mutant ACTN4 (hereinafter referred to as ACTN4-Va) such as a novel splice variant protein of ACTN4 but does not react with constitutively expressed ACTN4 (hereinafter referred to as ACTN4-Ub) And a cell line producing the antibody. Another object of the present invention is to provide a method for detecting the ACTN4-Va, a detection reagent, and the like.

  The present inventor has intensively studied to solve the above problems. ACTN4-Va or polypeptide is used as an antigen, ACTN4-Ub or polypeptide is used for screening, and the antigen is immunized to an anti-affinity antibody-producing transgenic non-human mammal to produce ACTN4-Va and The present inventors have succeeded in obtaining an antibody that reacts and does not react with ACTN4-Ub, that is, a monoclonal antibody capable of distinguishing between ACTN4-Va and ACTN4-Ub, and completed the present invention.

That is, the present invention is as follows.
(1) against mutant α-actinin-4 having an amino acid sequence in which at least one of the amino acid residues in the 245th to 263th regions of the amino acid sequence of α-actinin-4 is substituted with another amino acid residue An antibody that recognizes all or part of the substituted amino acid residues in the region.
(2) The antibody according to (1), wherein the mutant α-actinin-4 is a splice variant derived from exon 8 ′ of DNA encoding α-actinin-4.
(3) The substituted amino acid residue is at least one selected from the group consisting of the 248th glycine, the 250th leucine and the 263rd cysteine of the amino acid sequence of α-actinin-4 (1) The antibody described.
(4) The antibody according to (1), wherein the amino acid sequence containing the substituted amino acid residue is represented by DIVGTLRPDEKAIMTYVSC (SEQ ID NO: 4).
(5) The antibody according to (1), wherein the antibody is a monoclonal antibody.
(6) The antibody according to (5), which is produced by a hybridoma whose receipt number is NITE ABP-1140.
(7) An antibody that binds to an antigenic determinant to which the antibody according to (5) or (6) binds.
(8) The antibody according to (5) or (6), wherein the antibody is a chimeric antibody, a humanized antibody or a humanized antibody.
(9) The antibody fragment according to any one of (1) to (8) above.
(10) A hybridoma that produces the antibody according to (5) or (6) above.
(11) A hybridoma whose receipt number is NITE ABP-1140.
(12) A method for producing an antibody against mutant α-actinin-4,
(a) a partial peptide comprising the amino acid sequence of the 245th to 263th region of the amino acid sequence of α-actinin-4, wherein at least one of the amino acid residues in the region is substituted with another amino acid residue Immunizing a non-human mammal with a partial peptide having an amino acid sequence; and
(b) The method comprising collecting an antibody from the non-human mammal.
(13) A method for producing a monoclonal antibody against mutant α-actinin-4,
(a) a partial peptide comprising the amino acid sequence of the 245th to 263th region of the amino acid sequence of α-actinin-4, wherein at least one of the amino acid residues in the region is substituted with another amino acid residue Immunizing a non-human mammal with a partial peptide having an amino acid sequence;
(b) collecting antibody-producing cells from the immunized non-human mammal;
(c) fusing the antibody-producing cells obtained in step (b) with myeloma cells, and
(d) The said method including the process of extract | collecting an antibody from the fusion cell obtained at the process (c).
(14) The method according to (12) or (13), wherein the non-human mammal is a GANP transgenic non-human mammal.
(15) A mutant type characterized in that the mutant α-actinin-4 is detected by reacting the antibody or fragment thereof according to any one of (1) to (9) above with a biological sample. Detection method of α-actinin-4.
(16) A mutant α-actinin-4 comprising an amino acid sequence in which at least one of the amino acid residues in the 245th to 263th regions of the amino acid sequence of α-actinin-4 is substituted with another amino acid residue, A method for detecting a gene to be encoded, wherein the gene is detected by reacting a probe for a polynucleotide encoding the substitution amino acid sequence or a primer for amplification of the polynucleotide with a biological sample.
(17) The method according to (16), wherein the gene encoding mutant α-actinin-4 is a splice variant mRNA derived from exon 8 ′ of DNA encoding α-actinin-4.
(18) A method for detecting a tumor using the detection result obtained by the method according to any one of (15) to (17).
(19) A method for evaluating the state of a tumor or the state of prognosis using the result detected by the method according to any one of (15) to (18) as an index.
(20) A reagent for detecting or diagnosing a tumor comprising the antibody or fragment thereof according to any one of (1) to (9) above.
(21) a probe for a polynucleotide encoding an amino acid sequence in which at least one of the amino acid residues in the 245th to 263th regions of the amino acid sequence of α-actinin-4 is substituted with another amino acid residue, or the poly A reagent for detecting or diagnosing a tumor, comprising a primer for nucleotide amplification.
(22) The method according to (18) or (19), wherein the tumor is a lung primary high-grade neuroendocrine tumor.
(23) The reagent according to (20) or (21), wherein the tumor is a lung primary high-grade neuroendocrine tumor.
(24) The mutant α-actinin-4 having an amino acid sequence in which at least one of the amino acid residues in the 245th to 263th regions of the amino acid sequence of α-actinin-4 is substituted with another amino acid residue An antitumor pharmaceutical composition comprising a substance that inhibits function.
(25) The substance that inhibits the function of mutant α-actinin-4 is the antibody or fragment thereof according to any one of (1) to (9), or a gene encoding mutant α-actinin-4 The pharmaceutical composition according to (24), which is an inhibitory nucleic acid.
(26) The pharmaceutical composition according to claim 24 or 25, wherein the tumor is a lung primary high-grade neuroendocrine tumor.

  The present invention provides an antibody against mutant ACTN4, more specifically, an antibody specific to ACTN4-Va, and a cell line producing the antibody. The present invention also provides a method for detecting ACTN4-Va and a reagent for detecting ACTN4-Va, characterized by reacting the antibody with a biological sample.

  The monoclonal antibody that reacts with ACTN4-Va of the present invention can detect ACTN4-Va in tissues, cells, blood, and other specimens with high sensitivity and specificity, and is useful for diagnosis of tumors, preferably cancer.

FIG. 1 is a diagram showing an outline of an immunization method. FIG. 2A shows the results of a specificity confirmation test for purified antibodies derived from clones “13G9” and “11H2”. FIG. 2B shows the results of a specificity confirmation test for purified antibodies derived from clones “9B3”, “15H2” and “10E10”. FIG. 3 is a view showing the results of a specificity confirmation test by Western blotting for ACTN4-Va in monoclonal antibodies derived from clones “13G9”, “11H2”, “9B3”, “15H2”, and “10E10”. The symbols in the figure are as follows. (Circled number 1): MCF7-derived extract (circled number 2): H69-derived extract (circled number 3): BxPC-3-derived extract I: ACTN4-Va antibody (11H2) II: ACTN4 -Va antibody (15H2) III: ACTN4-Va antibody (10E10) IV: ACTN4-Va antibody (13G9) V: ACTN4-Va antibody (9B3) M: Size marker P: Positive control ACTN4-N antibody (13G9) FIG. 4 shows the results of a specificity confirmation test by Western blotting using ACTN4-Va gene-introduced cells using a monoclonal antibody derived from clone “15H2”. FIG. 5 shows the results of a diagnostic adaptation test by immunohistochemical staining for ACTN4-Va in HGNT using a monoclonal antibody derived from clone “15H2”. FIG. 6 is a diagram showing the protein expression of ACTN4-Va and the prognosis analysis results of HGNT, SCLC, and LCNEC patients. FIG. 7 is a diagram showing the results of suppressing the expression of ACTN4-Va by siRNA.

  The present invention relates to a mutant α-actinin-4 having an amino acid sequence in which at least one of the amino acid residues in the 245th to 263th regions of the amino acid sequence of α-actinin-4 is substituted with another amino acid residue. The antibody of the present invention recognizes all or part of amino acid residues (substituted amino acid residues) substituted in the 245th to 263rd regions. In one embodiment of the present invention, mutant α-actinin-4 recognized by the antibody of the present invention is a splice variant derived from exon 8 'of DNA encoding α-actinin-4.

  Furthermore, the present invention relates to an antibody that recognizes and binds ACTN4-Va, which reacts with ACTN4-Va but does not react with ACTN4-Ub.

1. Antibody of the Present Invention The antibody of the present invention is an antibody against mutant ACTN4 (protein or polypeptide) comprising an amino acid sequence in which amino acid residues in the ACTN4 molecule are substituted.

  Here, in this specification, terms such as “α-actinin-4”, “ACTN4”, “mutant actinin-4”, “ACTN4-Va”, “splice variant”, “ACTN4-Ub” Unless otherwise stated, all of full-length proteins, partial polypeptides and partial peptides are included. Therefore, for example, when the expression “the antibody of the present invention recognizes ACTN4-Va” is expressed, the antibody of the present invention recognizes the full-length protein of ACTN4-Va (for example, a splice variant of ACTN4), or ACTN4-Va It means to recognize a partial polypeptide (for example, a partial polypeptide containing a region in which an amino acid substitution of a splice variant derived from exon 8 ′ of ACTN4 has occurred).

In a preferred embodiment of the present invention, the antibody of the present invention has at least one property selected from the following (i) to (iii).
(i) An antibody against ACTN4-Va, which satisfies the conditions for recognizing all or any of the newly inserted exon 8′-derived amino acid sequence substitutions.
(ii) The amino acid substitution is the 248th glycine (G), 250th leucine (L), or 263th cysteine (C: cysteine) in the amino acid sequence.
(iii) The amino acid sequence of the antigen is represented by DIVGTLRPDEKAIMTYVSC (SEQ ID NO: 1).

  The substitution site of the amino acid residue and the substituted amino acid residue are at least one amino acid residue in the amino acid sequence from the 245th aspartic acid to the 263th serine. Preferably, the amino acid sequence of ACTN4 is the 248th glycine, the 250th leucine and the 263rd cysteine, and has a substituted amino acid residue of one or a combination of two or more thereof.

  Here, the amino acid sequence of ACTN4 is shown in SEQ ID NO: 2. In SEQ ID NO: 2, the amino acid sequence derived from exon 8 is the amino acid sequence from the 245th aspartic acid to the 263th serine (DIVNTARPDEKAIMTYVSS (SEQ ID NO: 3)).

  Therefore, in the present invention, the mutant ACTN4 is one in which at least one amino acid residue in the amino acid sequence from the 245th aspartic acid to the 263th serine is substituted with another amino acid residue. Preferably, the 248th valine of the amino acid sequence of wild type ACTN4 is mutated to glycine, the 250th alanine is mutated to leucine, and the 263rd serine is mutated to cysteine, or one of these or Two are mutated. This mutation includes a mutation caused by insertion of exon 8 'instead of exon 8, that is, a splice variant (Non-patent Document 5). In this specification, substitution of an amino acid that causes such mutation is also referred to as “ACTN4-Va-specific amino acid sequence substitution”.

  Therefore, in a more preferred embodiment of the present invention, the antibody of the present invention comprises an amino acid sequence in which the amino acid residue of the newly inserted exon 8′-derived splice variant portion of the amino acid sequence of ACTN4-Va is substituted. It is a highly specific antibody that specifically binds to a partial fragment or full length. Hereinafter, in the present specification, an antibody against mutant ACTN4 (including an antibody against splice variant) is also referred to as “anti-ACTN4-Va antibody”.

   In the present invention, “specifically binds” or “recognizes” binds to mutant ACTN4 (ACTN4-Va), for example, all or one (at least one) of substituted amino acid residues ( Reacts) but does not bind (does not react) to ACTN4-Ub without mutation. The region to which the antibody of the present invention binds or recognizes is not limited to a substituted amino acid residue, but includes other regions as long as it includes a substituted amino acid residue. That is, the region where the antibody of the present invention binds or recognizes does not exclude the region of the amino acid sequence that is not substituted.

  Confirmation of whether the binding is specific or not can be confirmed by immunological techniques such as ELISA, Western blotting, or immunohistological staining.

2. Next, a method for producing the antibody of the present invention will be described.

2-1. Antigen preparation
ACTN4-Va is expressed only in tissues of patients with small cell lung cancer, cell lines derived from small cell lung cancer, or normal testis. The target antigenic site is any one of the above three types of amino acids derived from amino acid sequence substitution present in the novel splice variant. For this reason, when preparing an immune antigen for obtaining the target antibody, a tissue or cell-derived antigen protein containing a full-length sequence is not suitable as an immune antigen. Therefore, it is necessary to synthesize an immune antigen containing a sequence with amino acid substitution.

  In the present invention, a partial peptide of ACTN4-Va is synthesized and used as an immunizing antigen. However, the synthetic peptide is a low molecular weight, and it is difficult to obtain an antibody even if a mouse is immunized as it is. Therefore, the synthetic peptide and carrier protein are disulfide bonded by the MBS method to produce an immunizing antigen.

  In the present invention, an immunizing antigen can be prepared according to a known method (Fmoc method, Kunio Fujiwara. Et al., Journal of Immunological Methods, 61, 217-226 (1983)).

  Chemical synthesis of peptides can be performed by methods known to those skilled in the art, such as Fmoc method (fluorenylmethyloxycarbonyl method) and tBoc method (t-butyloxycarbonyl method).

  As the carrier protein, in addition to BSA (Bovin serum albumin), for example, KLH (Keyhole Limpet Hemocyanin), OVA (Ovalbumin) and the like can be used. Those skilled in the art can prepare immunizing antigens by known methods.

  The basic amino acid sequence for synthesizing the antigen peptide is a partial sequence in ACTN4-Va, and 10 to 50, preferably 10 to 30, more preferably 15 to 20 consecutively from the amino acid sequence. The amino acid sequence of the length is selected. The selection criterion requires that the amino acid sequence contains at least one ACTN4-Va specific amino acid sequence substitution. A peptide is synthesized using these amino acid residues.

  The peptide that can be used as an antigen is preferably a peptide in the region from the 245th to the 263th amino acid sequence of the amino acid sequence shown in SEQ ID NO: 2. Peptides in which at least one amino acid residue in the sequence is substituted with another amino acid residue can be used. Preferably, a peptide in which at least one of 248th valine, 250th alanine, and 263rd serine in the above region is substituted with another amino acid is used. Furthermore, a substitution mutation based on the insertion of exon 8 ′, that is, the 248th asparagine in the amino acid sequence shown in SEQ ID NO: 2 is glycine (N248G), the 250th alanine is leucine (A250L), and the 263rd It is preferable to use a partial peptide of ACTN4-Va (for example, DIVGTLRPDEKAIMTYVSC (SEQ ID NO: 4)) containing an amino acid residue in which the serine of cysteine is mutated to cysteine (S263C).

  However, ACTN4-Va specific amino acid sequence substitution is not limited to the above N248G, A250L and S263C, and the amino acid residue after substitution is 18th amino acid other than N and G at the 248th place. Residue (A, R, D, C, Q, E, H, I, L, K, M, F, P, S, T, W, Y or V), except for A and L at the 250th position 18 types of amino acid residues (R, N, D, C, Q, E, G, H, I, K, M, F, P, S, T, W, Y or V), and in the 263rd 18 other amino acid residues except S and C (A, R, N, D, Q, E, G, H, I, L, K, M, F, P, T, W, Y or V) It may be.

2-2. Production of polyclonal antibody Immunization is carried out by administering the partial peptide prepared as described above to a non-human mammal with itself or together with a carrier and a diluent, and the antibody titer is measured.

  The type of non-human mammal to be immunized is not particularly limited, and examples include mice, rats, guinea pigs, rabbits, dogs, goats, etc., with mice being preferred.

  In a preferred embodiment of the present invention, in order to produce the antibody of the present invention, a transgenic non-human mammal called “GANP (registered trademark)” having a high-specificity antibody-producing ability as an animal to be immunized (WO2004 / 040971) Can also be used.

  A GANP (registered trademark) transgenic non-human mammal is a non-human mammal into which a gene encoding a germinal center-associated nuclear protein has been introduced, and the animal is immunized with a predetermined antigen. By doing so, it is an animal that can produce a high-affinity or high-specificity antibody against the antigen (WO00 / 50611, Sakaguchi N. et al., J Immunol. 2005 Apr 15; 174 (8 ): 4485-94.).

  For example, a GANP transgenic non-human mammal (for example, mouse) can be prepared by the method described in the above publication or Sakaguchi et al., Or a commercially available GANP (registered trademark) mouse (Transgenic Inc.). ) Can be obtained.

  The total dose of the antigen per animal is 10 to 2000 μg. When immunizing an antigen, an adjuvant and an antigen solution are generally mixed. Examples of the adjuvant include Freund's complete adjuvant (FCA), Freund's incomplete adjuvant (FIA), and aluminum hydroxide adjuvant. Immunization is performed mainly by injecting intravenously, subcutaneously, intraperitoneally, intramuscularly, subcutaneously into the footpad, or the like. The immunization interval is not particularly limited, and immunization is performed 1 to 10 times, preferably 2 to 5 times, at intervals of several days to several weeks, preferably at intervals of 2 to 3 weeks.

  After the antibody titer has increased by 2 or more at the absorbance level due to immunization, the antibody titer is decreased to 0.05 to 1, preferably 0.05 to 0.5, more preferably 0.05 to the absorbance level, for 2 to 6 months, preferably 4 to 6 Leave the animal for months, more preferably 6 months. In addition, the dilution rate of the serum which shows the said light absorbency level is 27,000 times, for example.

  When immunizing a GANP transgenic non-human mammal, it is not necessary to leave it until the absorbance level is lowered, and it is sufficient to perform the final immunization according to the immunization interval of a general monoclonal antibody production method.

  The antibody titer can be examined using blood collected from the immunized animal. The collected blood is preferably centrifuged at a low temperature after blood collection, and quickly centrifuged to separate serum. The obtained serum can be serially diluted, and the antibody titer can be measured by enzyme immunoassay (ELISA (enzyme-linked immunosorbent assay) or EIA (enzyme immunoassay)), radioimmunoassay (RIA (radioimmuno assay)), etc. it can. When the antibody titer is measured by ELISA or EIA, the absorbance can be measured with a spectrophotometer.

  As a result of the measurement, an animal having a high antibody titer against ACTN4-Va is subjected to final immunization. However, the immunity of the antigen and the measurement of the antibody titer are not limited to the above measurement methods.

  Thereafter, immunocompetent cells (such as spleen cells) are removed several days after the final immunization day, preferably 3 to 5 days later. In addition, when an antigen is injected subcutaneously into the footpad of an animal, the number of final immunization is one, 7-13 days after immunization, preferably 8-10 days later, immunocompetent cells such as spleen cells or regional lymph Remove the knot. The interval between blood collections is 1 to 4 weeks, preferably 1 to 2 weeks after immunization.

  In the present invention, when obtaining a polyclonal antibody, blood is collected on the day when the desired antibody titer is shown to obtain an antiserum. When antibody purification is required, purify by selecting a known method such as ammonium sulfate salting-out method, ion exchange chromatography, gel filtration chromatography, affinity chromatography, or a combination thereof. Can do. Thereafter, the reactivity of the polyclonal antibody in the antiserum is measured by ELISA or the like.

2-3. Production of Monoclonal Antibody Against ACTN4-Va Hereinafter, a method for producing a monoclonal antibody against ACTN4-Va will be described, but it is not limited thereto.

  As a method for obtaining the monoclonal antibody of the present invention (“anti-ACTN4-Va antibody”), first, an animal such as a GANP transgenic non-human mammal is immunized with an amino acid sequence peptide in which amino acid residues of a novel splice variant are substituted. Then, antibody-producing cells (eg, B cells) are collected from the immunized animal, and the antibody-producing cells and myeloma cells are fused to produce a hybridoma (fusion cell line). And the target monoclonal antibody can be obtained by extract | collecting the antibody produced from this hybridoma.

  Anti-ACTN4-Va antibodies are so-called hapten antibodies, but when making such hapten antibodies, the molecular structure design of the hapten-carrier complex has a huge impact on the performance of specific antibodies. give.

(1) Preparation of antibody-producing cells Antibody-producing cells are prepared from spleen cells or the like of immunized animals such as non-human mammals or regional lymph nodes. Even when a GANP transgenic non-human mammal is used, antibody-producing cells can be collected from spleen cells and lymph nodes in the same manner as described above.

  Examples of lymph nodes include inguinal lymph nodes and mediastinal lymph nodes. Although it is not necessary to separate the antibody-producing cells from the collected cell population, it is desirable to separate only antibody-producing cells from the cell population. In preparing antibody-producing cells, it is preferable to remove tissue debris and erythrocytes as much as possible. As a method of removing erythrocytes, a method of using a commercially available erythrocyte removal solution or a method of preparing and using a neutral buffer prepared with ammonium chloride and Tris is preferably employed. The prepared antibody-producing cells may deteriorate if the next operation is not started immediately after preparation, so if it takes time until the next operation after preparation, it should be left on ice. preferable.

(2) Cell fusion Cell fusion is an operation performed to fuse the antibody-producing cells and myeloma cells (myeloma cells) to produce cells (hybridomas) that continue to grow semipermanently while producing antibodies. . As myeloma cells to be fused with antibody-producing cells, generally available cell lines of animals such as mice can be used. The cell line to be used is preferably one that has the property that it cannot survive in a HAT selective medium (medium containing hypoxanthine, thymidine, and aminopterin) and can survive only in a state fused with antibody-producing cells. Examples of myeloma cells include P3X63-Ag.8.U1 (P3U1) and P3 / NS I / 1-Ag4-1 (NS I).

Cell fusion is a commercially available medium such as DMEM or RPMI1640 medium that does not contain fetal calf serum (FCS), etc., and 1 × 10 ⁶ to 1 × 10 ⁷ cells / mL of spleen cells and / or lymph node cells 1 × 10 ⁵ to 1 × 10 ⁶ cells / mL myeloma cells are mixed (the ratio of spleen cells and / or lymph node cells to myeloma cells is preferably 5: 1) in the presence of a cell fusion promoter. Perform fusion. As the cell fusion promoter, polyethylene glycol having an average molecular weight of 200 to 20,000 daltons can be used.

  Moreover, it can also fuse | melt using the commercially available cell fusion apparatus using electrical stimulation (for example, electroporation). Furthermore, cells can be fused using Sendai virus. A person skilled in the art can fuse the antibody-producing cells and myeloma cells using a known cell fusion method.

After the fusion, for example, dilute the cells with HAT medium made with 10-20% (preferably 20%) FCS-containing RPMI1640 medium, and then inoculate 0.5- 3 x 10 ⁵ cells into each well of a 96-well culture plate. Incubate in a CO ₂ incubator.

(3) Establishment of hybridoma Next, a hybridoma producing the target antibody is selected from the cells after cell fusion treatment. Ten to 14 days after cell fusion, cells selected in HAT medium as described above form colonies. The culture supernatant of each well of the colony positive 96-well culture plate is collected and the antibody titer against ACTN4-Va is confirmed. As a confirmation method, enzyme immunoassay (ELISA), radioimmunoassay (RIA) or the like is performed. At this time, antibodies produced from cells include antibodies against carrier proteins KLH and BSA. Therefore, by measuring the antibody titer against KLH, etc., remove wells with high KLH antibody-positive wells against KLH etc. Can do. After confirming positive wells for antibody production against ACTN4-Va, transfer the cells to 24-well or 12-well culture plates.

  Here, the medium is preferably replaced with an HT medium (a medium containing hypoxanthine and thymidine) excluding aminopterin. HT medium is used as a recovery medium for hybridomas that continue to supply purine and pyrimidine precursors to the salvage pathway during the influence of aminopterin remaining in the cells. After culturing in HT medium for a while, the antibody titer in the culture supernatant is confirmed again. The hybridoma is unstable because it is a fused cell, and it is highly possible that the antibody-producing ability is immediately lost. Therefore, it is preferable to confirm the antibody titer for the second time. As described above, in the present invention, it is necessary to obtain a hybridoma that does not cross-react with ACTN4-Ub and has high specificity for ACTN4-Va. Cross-reactivity with other ACTN4-Ub at the clearing level is confirmed by ELISA or RIA.

  The cells in the final selected well are cloned to make a single cell. For cloning, for example, after appropriately diluting the cell suspension with RPMI1640 medium containing 10 to 20% FCS (preferably 20%), seed the cells so that 0.3 to 2 cells are added to each well of a 96-well culture plate. . In order to increase the probability that the number of cells in each well of the 96-well culture plate is one cell, it is preferable to seed one cell in each well. After cell seeding, the culture supernatant of the colony-positive well is collected 7 to 10 days later. At this time, it is preferable to confirm that it is a single colony after 3 to 5 days. The collected culture supernatant is checked for antibody titer. Again, clones are selected that have high specificity for ACTN4-Va and low cross-reactivity for ACTN4-Ub. Further, the number of cells in the selected well is increased to some extent to establish a hybridoma strain. Cloning may be performed several times as necessary.

(4) Preparation of monoclonal antibody ACTN4-Va specific monoclonal antibody is purified and collected from the established hybridoma strain by the following method. That is, a method of preparing an antibody from a culture supernatant cultured in a medium with reduced serum concentration, a method of preparing an antibody from a culture supernatant cultured in a commercially available serum-free medium, or injecting a hybridoma into the abdominal cavity of an animal. There is a method of collecting ascites and preparing antibodies from the ascites. The culture supernatant is collected from cells prepared at 0.1-4 × 10 ⁵ cells / mL and cultured for 1-2 weeks. In the case of ascites, 0.1 to 1 × 10 ⁷ hybridomas are administered into the abdominal cavity of a myeloma cell-derived mammal and the same type of animal, and the hybridomas are proliferated in large quantities. And ascitic fluid is collected after 1-2 weeks.

Examples of the culture method include a method using a culture flask, a method using a spinner flask, a method using a shaker flask, and a method using a bioreactor. Antibody purification methods include protein G affinity column or protein A affinity column purification method, ACTN4-Va affinity column purification method, ammonium sulfate salting-out fraction purification method using gel filtration chromatography, and ion exchange chromatography. There are methods for purification, etc., and these known methods can be appropriately selected, or can be purified by combining them. When purifying mouse IgG ₁ using a protein A affinity column, it is effective to use a buffer or the like in which binding conditions are optimized, and those skilled in the art appropriately select the optimal conditions, Can be purified.

(5) Deposit of microorganisms The cell line (hybridoma) producing the monoclonal antibody of the present invention is called “Anti ACTN4-Va MAb (Clone No. 15H2)” and was evaluated by an independent administrative agency product as of August 31, 2011. Deposited internationally at the Technology Microorganisms Patent Microorganisms Deposit Center (Nara Biotechnology Headquarters, Patent Microorganisms Deposit Center 2-5-8 Kazusa Kamashitsu, Kisarazu City, Chiba Prefecture 292-0818). The receipt number (indicated on the receipt) indicating the receipt number is NITE ABP-1140. NITE ABP-1140 is a clone established as “15H2” in Example 1.

(6) Properties of monoclonal antibody The monoclonal antibody of the present invention specifically binds to ACTN4-Va and exhibits high specificity. The specificity of the antigen-antibody reaction system using the cell extract of human small cell lung cancer-derived cancer cell line H69 that specifically expressed ACTN4-Va in the reaction system between ACTN4-Va and antibody in Western blotting However, compared to the antigen-antibody reaction system when using cell extracts of the non-expressing human pancreatic adenocarcinoma cell line BxPC-3 and the human breast cancer cell line MCF7, ACTN4-Va By detecting this band, the condition that can show the specificity is satisfied.

For example,
(i) First, an extract of a human small cell lung cancer-derived cancer cell line H69 containing ACTN4-Va containing a newly inserted exon 8′-derived amino acid sequence substitution (hereinafter referred to as “antigen 1”) Use for blotting. Similarly, cell extracts of human pancreatic adenocarcinoma-derived cell line BxPC-3 and human breast cancer-derived cell line MCF7 containing ACTN4-Ub without amino acid sequence substitution derived from newly inserted exon 8 ' Antigen 2 ”and“ Antigen 3 ”) are subjected to Western blotting.
(ii) Next, an antibody against the antigen is reacted with each antigen at the same concentration.
The antigen molecule (antigen 1) in the antigen-antibody reaction of (i) above has an amino acid sequence substitution derived from the newly inserted exon 8 ′ in its amino acid sequence, and the monoclonal antibody of the present invention has a newly inserted exon. It specifically binds to immobilized antigen 1 containing an 8'-derived amino acid sequence substitution. Therefore, it can be detected as a protein band with a molecular weight of about 100 KDa by Western blot.

  Further, in the above reaction system, when the immobilized antigen is antigen 2 and antigen 3, since the newly inserted exon 8′-derived amino acid sequence substitution is not present, the immobilized antigens 2 and 3 and the present invention It cannot bind specifically to the monoclonal antibody. Therefore, it cannot be detected as a protein band with a molecular weight of about 100 KDa by Western blot.

  The antibody of the present invention has a detection concentration of anti-ACTN4-Va antibody of at least 10 μg / ml, preferably when the migration amount of antigens 1, 2 and 3 is 10 μg / lane when the antigen-antibody reaction test is performed. It satisfies the detection condition of 5 μg / ml or less, more preferably 2.5 μg / ml or less, particularly preferably 1 μg / ml or less, and has extremely high specificity for antigen 1.

  Alternatively, the specificity of this monoclonal antibody may be shown by Western blotting using an expression cell-derived antigen into which ACTN4-Va has been introduced.

  Its specificity can be detected as follows.

  In the reaction system of ACTN4-Va and antibody in Western blotting, a plasmid vector in which GFP (green fluorescent protein) was added to the N-terminus of ACTN4-Va was prepared and introduced into the human renal epithelial cell line HEK293 (referred to as HEK293) An antigen-antibody reaction system when an extract derived from an expressed cell is used (referred to as reaction system 1). On the other hand, a plasmid vector in which GFP (green fluorescent protein) is added to the N-terminus of ACTN4-Ub is prepared, and an antigen-antibody reaction system is performed using an extract derived from an expression cell that has been transfected into HEK293 (reaction system). 2).

  Next, the reaction system 1 and the reaction system 2 are compared to detect whether or not an ACTN4-Va band appears at the position of the target molecular weight in the reaction system 1.

(7) Antibody fragment The above antibody fragment is also included in the antibody of the present invention. Here, the antibody fragment of the present invention is an antibody against ACTN4-Va, similar to the antibody of the present invention, which recognizes all or any of the newly inserted exon 8′-derived amino acid sequence substitutions. It is what has.

The antibody fragment means a partial region of the antibody of the present invention. For example, Fab (antigen-binding fragment), Fab ′, F (ab ′) ₂ , Fv, diabody (dibodies), dsFv, linear antibody , ScFv (single chain Fv), peptides containing at least part of a complementarity determining region (CDR), and the like. The antibody fragment can be obtained by cleaving the antibody of the present invention with various proteolytic enzymes according to the purpose.

For example, Fab can be obtained by treating antibody molecules with papain, and F (ab ′) ₂ can be obtained by treating antibody molecules with pepsin. Fab ′ can be obtained by cleaving the disulfide bond in the hinge region of F (ab ′) ₂ .

  In the case of scFv, cDNA encoding VH and VL of the antibody is obtained, and DNA encoding scFv is constructed. By inserting this DNA into an expression vector and introducing the expression vector into a host organism for expression, scFv can be produced.

  In the case of a diabody, cDNA encoding the antibody VH and VL is obtained, and a DNA encoding scFv is constructed so that the length of the amino acid sequence of the peptide linker is 8 residues or less. A diabody can be produced by inserting this DNA into an expression vector and introducing the expression vector into a host organism for expression.

  In the case of dsFv, cDNAs encoding antibody VH and VL are obtained, and DNAs encoding dsFv are constructed. By inserting this DNA into an expression vector and introducing the expression vector into a host organism for expression, dsFv can be produced.

  In the case of a peptide containing CDR, DNA encoding the CDR of antibody VH and VL is constructed. By inserting this DNA into an expression vector and introducing the expression vector into a host organism for expression, a peptide containing CDR can be produced. Peptides containing CDR can also be produced by chemical synthesis methods such as Fmoc method and tBoc method.

  Even if the amino acid sequence of the antibody is modified, such an antibody is included in the scope of the present invention as long as it can specifically bind to the mutant ACTN4.

(8) Recombinant antibody As a preferred embodiment of the antibody against ACTN4-Va of the present invention, a recombinant antibody can be mentioned. Examples of the recombinant antibody include, but are not limited to, chimeric antibodies, humanized antibodies, and humanized antibodies.

  A chimeric antibody (ie, a human chimeric antibody) is an antibody obtained by linking (joining) a variable region of a mouse-derived antibody to a human-derived constant region (Proc. Natl. Acad. Sci. USA 81, 6851-6855, (1984). ), Etc.), when producing a chimera, it can be constructed by genetic recombination techniques so as to obtain an antibody so linked.

  When producing a humanized antibody, a so-called CDR grafting (CDR grafting) method can be employed. CDR grafting refers to transplanting the complementarity determining region (CDR) from the variable region of a mouse antibody into a human variable region, the framework region (FR) is derived from a human and the CDR is derived from a mouse. This is a method for producing a configured variable region. These humanized reshaped human variable regions are then linked to human constant regions. Methods for producing such humanized antibodies are well known in the art (see, for example, Nature, 321, 522-525 (1986); J. Mol. Biol., 196, 901-917 (1987)). .

  Humanized antibodies (fully human antibodies) generally have the same structure as the human antibody in the hypervariable region, which is the antigen binding site of the V region, the rest of the V region, and the constant region. It is. However, the hypervariable site may be derived from another animal. Techniques for producing humanized antibodies are also known, and methods for producing gene sequences common to humans by genetic engineering techniques have been established. The humanized antibody can be obtained, for example, by a method using a human antibody-producing mouse having a human chromosome fragment containing the H chain and L chain genes of a human antibody (Tomizuka, K. et al., Nature Genetics, (1977) 16, 133. -143; Kuroiwa, Y. et.al., Nuc. Acids Res., (1998) 26, 3447-3448; Yoshida, H. et.al., Animal Cell Technology: Basic and Applied Aspects, (1999) 10, 69-73 (Kitagawa, Y., Matuda, T. and Iijima, S. eds.), Kluwer Academic Publishers; Tomizuka, K. et.al., Proc. Natl. Acad. Sci. USA, (2000) 97, 722-727 etc.) and methods for obtaining human antibodies derived from phage display selected from human antibody libraries (Wormstone, IMet.al, Investigative Ophthalmology & Visual Science., (2002) 43 (7), 2301 -8; Carmen, S. et.al., Briefings in Functional Genomics and Proteomics, (2002) 1 (2), 189-203; Siriwardena, D. et.al., Opthalmology, (2002) 109 (3), 427-431 etc.).

  Further, in the present invention, a chimeric antibody or a humanized antibody according to the above-mentioned well-known method using the hybridoma of the present invention (for example, the hybridoma having the receipt number NITE ABP-1140) or DNA or RNA extracted from the hybridoma as a raw material. Antibodies and humanized antibodies can be prepared.

(9) An antibody that binds to an antigenic determinant to which the antibody of the present invention binds. Further, as an anti-ACTN4-Va antibody of the present invention, for example, a monoclonal antibody produced by a hybridoma whose receipt number is NITE ABP-1140 binds An antibody that binds to (recognizes) a site (for example, an epitope) is also preferred. Examples of the epitope include those exemplified below.

  The epitope (antigenic determinant) of the anti-ACTN4-Va antibody of the present invention is not limited as long as it is at least a part of the antigen ACTN4-Va. For example, the amino acid sequence of 245 to 263 of ACTN4 is used. Wherein the 248th, 250th and 263rd amino acid sequences are substituted with other amino acid residues, preferably glycine, leucine and cysteine, respectively. The amino acid sequence of such an epitope is represented by D IVGTLRPDEKAIMTYVSC (SEQ ID NO: 4).

3. Detection method
Since ACTN4-Va can be used as a clinical marker (tumor marker) for cancer, the antibody of the present invention is reacted with a biological sample, and ACTN4-Va in the biological sample is measured to indicate the measurement result as an index. As a tumor can be detected or diagnosed.

  Therefore, the present invention provides a method for detecting mutant α-actinin-4, which comprises reacting the antibody of the present invention or a fragment thereof with a biological sample to detect mutant α-actinin-4. To do.

The present invention also provides a detection or diagnosis of cancer, characterized by reacting the antibody of the present invention with a biological sample to detect ACTN4-Va that reacts with ACTN4-Va but does not react with ACTN4-Ub. Provide a method. Examples of the protein to be detected include ACTN4-Va, and examples of the detection target include the full-length protein of ACTN4-Va or a partial polypeptide of ACTN4-Va (for example, a polypeptide containing the following amino acid sequence). It is done.
DIVGTLRPDEKAIMTYVSC (SEQ ID NO: 4)
Measurement of ACTN4-Va generally immunohistochemical staining carried out: either method of (IHC I mmuno h isto c hemical called staining), or a method known as hapten immunoassay (e.g., ELISA, EIA) such as by There is no particular limitation.

  The cancer is not particularly limited, and for example, brain tumor, salivary gland cancer, esophageal cancer, pharyngeal cancer, oral cancer, lung cancer, stomach cancer, small intestine or duodenal cancer, colon cancer, urinary tract malignant tumor (for example, prostate cancer, Kidney cancer, bladder cancer, testicular tumor), liver cancer, prostate cancer, breast cancer, uterine cancer, ovarian cancer, thyroid cancer, gallbladder cancer, biliary tract cancer, pancreatic cancer, neuroendocrine tumor, sarcoma (eg, osteosarcoma, muscle species, etc.) ) And at least one selected from the group consisting of melanomas, preferably a primary lung high-grade neuroendocrine tumor (HGNT). HGNT includes small cell lung cancer (SCLC) and large cell neuroendocrine cancer (LCNEC), and includes at least one selected from these. The type of cancer to be detected may be one, or two or more types may be combined. The state of cancer is at least one selected from the group consisting of the presence or absence of cancer, the malignancy of cancer, the presence or absence of cancer metastasis, and the presence or absence of cancer recurrence.

  In particular, ACTN4-Va derived from an HGNT patient contains the amino acid sequence of the peptide shown in SEQ ID NO: 4 (a peptide in which an amino acid is substituted). Therefore, the present invention specifically binds to this amino acid sequence. Antibodies are particularly preferred for detecting the aforementioned cancers.

  A biological sample is collected from a subject such as a cancer patient, a patient suspected of cancer, or a health checkup examinee, and an ACTN4-Va measurement sample is prepared. Examples of biological samples include tissues and cells. It is preferable to use a tissue prepared as a tissue section after being collected.

  Next, the measurement sample is reacted with the antibody of the present invention. The detection of ACTN4-Va can be performed by a commonly performed IHC. Here, for convenience of explanation, a mouse-derived antibody is used as the antibody of the present invention.

  For measurement with IHC, after removing paraffin on the section, endogenous peroxidase activity is blocked and the antigen is activated by heat treatment. Block nonspecific protein binding with 2% porcine serum and hybridize with primary antibody (anti-ACTN4-Va antibody) 4 times for 16 hours or more. The primary antibody was washed, hybridized with a biotinylated anti-mouse IgG as a secondary antibody at room temperature for 1 hour, further washed and reacted with an avidin peroxidase-labeled tertiary antibody, and DAB (3,3'-Diaminobenzidine, Color is developed using tetrahydrochloride as a substrate.

  In another embodiment of the present invention, the amount of ACTN4-Va mRNA can be detected, and a tumor can be detected from the detection result.

  Therefore, the present invention detects a gene encoding a mutant ACTN4 comprising an amino acid sequence in which at least one of the amino acid residues in the 245th to 263th regions of the amino acid sequence of ACTN4 is substituted with another amino acid residue Provide a way to do it. The method detects the gene by reacting a probe for a polynucleotide encoding the substituted amino acid sequence or a primer for amplification of the polynucleotide with a biological sample. The detection gene is preferably a splice variant mRNA derived from exon 8 'of DNA encoding ACTN4.

  Measurement of mRNA can be performed, for example, by Northern blotting, RT-PCR, Real-time PCR, microarray, or the like.

  In the gene encoding ACTN4-Va, the base sequence shown in SEQ ID NO: 1 is substituted so as to have a substitution mutation of N248G, A250L or S263C, or a combination thereof. That is, in V248G, “aac” (Asn codon) of 861-863 of the nucleotide sequence shown in SEQ ID NO: 1 is “ggc” (Gly codon), and in A250L, 867-863 of the nucleotide sequence shown in SEQ ID NO: 1. 869 “gcc” (Ala codon) is “cug” (Leu codon), and in S263C, nucleotide sequences 906 to 908 of the nucleotide sequence shown in SEQ ID NO: 1 are “agc” (Ser codon) “ugc "(Cys codon).

  Therefore, when Northern blotting is performed, a probe that hybridizes to the nucleotide containing the mutation site (nucleotide derived from exon 8 ') of the gene encoding ACTN4-Va is designed and synthesized.

  In addition, when performing RT-PCR or Real-time PCR, the primer is designed so that nucleotides containing the above mutation sites (nucleotides derived from exon 8 ') are amplified.

  In the analysis of mRNA, for example, substitution of bases based on insertion of a splice variant corresponding to the ACTN4 gene (SEQ ID NO: 1) shown in the accession number NM_00004924.4, that is, exon 8 'can be comprehensively detected.

  Judgment that ACTN4 is a mutant type or whether it is a tumor is based on the detection of the target band as a result of hybridization with the probe, amplification reaction or sequencing by PCR, or the base of the mutant type. If the sequence is obtained, it can be determined that ACTN4 is mutant.

  In that case, it is preferable to compare with the mRNA expression level derived from a healthy person. For example, the ratio of the mRNA expression level (test value) in a subject-derived sample to the mRNA expression level (control value) in a test sample derived from a healthy subject is compared. Is determined.

  By the way, in the method of the present invention, the level of ACTN4-Va or its mRNA may be measured using biological samples derived from a plurality of subjects. Therefore, the ACTN4-Va or its mRNA amount is measured in a predetermined number of subjects (primary population), and the obtained measurement values are used as basic data, and the basic data and individual detection targets. The amount of ACTN4-Va derived from a biological sample derived from a subject or its mRNA can be compared.

  Furthermore, when the measured data of the test subject is equal to or greater than a predetermined value, it is incorporated into the population value, and the data level of ACTN4-Va or its mRNA amount is processed again (averaging, etc.) You can also increase the number of cases in the population). By increasing the number of cases, the accuracy of the critical value of ACTN4-Va or its mRNA amount can be increased, and in some cases, the critical value can be appropriately corrected to improve the accuracy of cancer detection or diagnosis.

  Furthermore, cancer of the subject can be detected using a method of the present invention on a biological sample individually collected from a subject such as a patient or a health checkup examinee before actually starting treatment. That is, if mRNA is collected from the biological sample and its level or base sequence is examined, and the test result is positive or the target base sequence is analyzed, the probability that the subject has cancer (risk ) Is high.

  The detection result can be, for example, main data or auxiliary data when performing a definitive diagnosis of cancer. More specifically, in the case of performing a cancer test or a definitive diagnosis, in addition to the above detection results, in combination with at least one selected from other test results, for example, biopsy, the level of other cancer markers, Judgment should be made.

4). Cancer Evaluation Method In the present invention, the state of cancer can be evaluated using the detection result obtained by the detection method shown in 3 above as an index. If the detection result exceeds the predetermined reference value ACTN4-Va positive, the one below the predetermined reference value ACTN4-Va negative, if positive, it is determined that there is a possibility of developing cancer, Cancer status can be assessed. The predetermined reference value is appropriately set depending on the type of cancer.

  The state of cancer means the presence or absence or progression of cancer or tumor, and includes the presence or absence of onset of cancer, the malignancy of cancer, the presence or absence of cancer metastasis, and the presence or absence of cancer recurrence. In the above evaluation, one of these cancer states may be selected, or a plurality may be selected in appropriate combination. To evaluate the presence or absence of cancer, it is determined whether or not the patient is afflicted with cancer. Cancer malignancy is an indicator of how far the cancer has progressed, and it is evaluated by classifying the stage (Stage), or by classifying so-called early cancer and advanced cancer It is also possible. Cancer metastasis is evaluated by whether or not a neoplasm has appeared at a site distant from the location of the primary lesion. Recurrence is assessed by whether the cancer reappears after an intermittent period or remission.

5. Kits and Reagents Containing the Antibody of the Present Invention In the present invention, an antibody against ACTN4-Va can be used as a reagent or kit for detecting ACTN4-Va. The reagent or kit of the present invention can be used for the detection of the tumor.

  When the antibody of the present invention (for example, a monoclonal antibody) is used as a cancer detection or diagnostic agent, the monoclonal antibody can be combined with another solvent or solute to form a composition. For example, distilled water, pH buffer reagent, salt, protein, surfactant and the like can be combined. Monoclonal antibodies can be used after enzyme labeling. As a labeling enzyme, in addition to HRP (horseradish peroxidase), alkaline phosphatase, malate dehydrase, α-glucosidase, α-galactosidase, colloidal gold, and the like can be used.

  When using the present invention in a kit, in addition to the antibody of the present invention, the above solvent, solute, enzyme labeling reagent, antigen-immobilized microplate, antibody dilution solution, OPD (orthophenylenediamine) tablet, substrate solution, A reaction stop solution, a concentrated washing solution, instructions for use, and the like can be included. In addition, a reaction medium such as a buffer solution that gives optimum conditions for the reaction, a buffer solution that is useful for stabilizing the reaction product, and a stabilizer for the reaction material may be included in the kit of the present invention.

  In the present invention, probes and primers for detecting ACTN4-Va mRNA can be included in the reagent or kit of the present invention. The region on which the probe or primer design is based is not particularly limited as long as exon 8 'can be detected.

The length of the sequence primer is 18 to 24 bases, preferably 20 to 22 bases. Examples of the base sequence of the sequence primer include the following.
CCGTATAAGAACGTCAATGTGC (SEQ ID NO: 5)
CTGGCCAGCTTCTCGTAGTC (SEQ ID NO: 6)

  In addition, the primer for amplifying ACTN4-Va mRNA by RT-PCR or real-time PCR is not particularly limited as long as exon 8 ′ is amplified. From the upstream region and downstream region of exon 8 ′ A nucleotide having a length of 15 to 24 bases, preferably 16 to 22 bases can be designed and synthesized and used as a primer.

For example, the following can be illustrated as a base sequence of a primer.
Forward: TGGGCACTCTGAGGCCA (SEQ ID NO: 7)
Reverse: CTTCTGAGCCCCCGAGAAA (SEQ ID NO: 8)

Moreover, the following can be illustrated as a probe (TaqMan probe) which hybridizes.
TGAGAAGGCCATCATG (SEQ ID NO: 9)
Reagents and reaction conditions used for hybridization and PCR are well known to those skilled in the art.

6). Pharmaceutical Composition The pharmaceutical composition of the present invention comprises a substance that inhibits the function of mutant α-actinin-4 (ACTN4-Va), preferably the antibody of the present invention as an active ingredient, It is effective for treatment.

  Therefore, the present invention provides a method for treating a tumor, which comprises administering to a patient a substance that inhibits the function of mutant α-actinin-4.

  The “substance that inhibits the function of mutant α-actinin-4” means a low molecular compound or a function-inhibiting antibody, and preferably encodes an antibody against ACTN4-Va of the present invention and ACTN4-Va. It is an inhibitory nucleic acid of a gene.

  An inhibitory nucleic acid of a gene encoding ACTN4-Va (also referred to as an ACTN4-Va gene) means a nucleic acid that suppresses its gene function or gene expression. For example, antisense nucleic acid, decoy nucleic acid, microRNA, shRNA or siRNA Etc. These inhibitory nucleic acids can suppress the expression of the above gene and can be used as a pharmaceutical composition for tumor gene therapy.

<Antisense nucleic acid>
An antisense nucleic acid is a single-stranded nucleic acid sequence (either RNA or DNA) that can bind to the mRNA (sense) or DNA (antisense) sequence of the ACTN4-Va gene (target gene). The length of the antisense nucleic acid sequence is at least 14 nucleotides, preferably 14-100 nucleotides. Antisense nucleic acid binds to the gene sequence to form a double strand and suppresses transcription or translation.

  Antisense nucleic acids can be produced using chemical synthesis methods or biochemical synthesis methods known in the art. For example, a nucleic acid synthesis method using a DNA synthesizer generally used as a gene recombination technique can be used. Antisense nucleic acids are introduced into cells by, for example, various gene transfection methods such as DNA transfection or electroporation, or by using viral vectors.

<Decoy nucleic acid>
In the present invention, decoy nucleic acid means a short decoy nucleic acid containing a transcription factor binding site, and can bind to a transcription factor of ACTN4-Va gene and suppress promoter activity. When this nucleic acid is introduced into cells and the transcription factor binds to this nucleic acid, the binding of the transcription factor to the original genome binding site is competitively inhibited, and as a result, the expression of the transcription factor is suppressed. . Specifically, a decoy nucleic acid is a nucleic acid that can bind to a target binding sequence or an analog thereof. The decoy nucleic acid of the present invention can be designed as a single strand or a double strand including a complementary strand based on the promoter sequence of the above gene. The length is not particularly limited, and is 15 to 60 bases, preferably 20 to 30 bases.

  The nucleic acid may be DNA or RNA, or may contain a modified nucleic acid and / or pseudo-nucleic acid within the nucleic acid. These nucleic acids may be single-stranded or double-stranded, and may be circular or linear.

  The decoy nucleic acid used in the present invention can be produced using a chemical synthesis method or a biochemical synthesis method known in the art. For example, a nucleic acid synthesis method using a DNA synthesizer generally used as a gene recombination technique can be used. In addition, after isolating or synthesizing a base sequence serving as a template, a PCR method or a gene amplification method using a cloning vector can also be used. Furthermore, the desired nucleic acid may be produced by cleaving the nucleic acid obtained by these methods using a restriction enzyme or the like and binding using a DNA ligase. Furthermore, in order to obtain a more stable decoy nucleic acid in a cell, chemical modification such as alkylation or acylation can be added to a base or the like.

  For analysis of the transcriptional activity of the promoter when decoy nucleic acid is used, a commonly performed luciferase assay, gel shift assay, Western blotting method, FACS analysis method, RT-PCR, etc. can be employed. Kits for performing these assays are also commercially available (eg, promega dual luciferase assay kit).

<RNA interference>
In the present invention, synthetic small nucleic acid molecules that can regulate gene expression by RNA interference (RNAi) in cells, such as siRNA, microRNA (miRNA), and shRNA molecules can be used.

  When siRNA (small interfering RNA) molecules are used, various RNAs corresponding to the ACTN4-Va gene can be targeted. Such RNA includes mRNA, post-transcriptionally modified RNA of ACTN4-Va gene, and the like. Since the gene targeted in the present invention is a splice variant generated by alternative splicing, siRNA molecules can be used to inhibit the expression of the exon part (exon 8 ').

  siRNA molecules can be designed based on criteria well known in the art. For example, as the target segment of the target mRNA, a continuous 15-30 base, preferably 19-25 base segment, preferably starting with AA (most preferred), TA, GA or CA can be selected. The GC ratio of siRNA molecules is 30-70%, preferably 35-55%.

siRNAs can be generated as single stranded hairpin RNA molecules that fold on their nucleic acid to generate a double stranded portion. siRNA molecules can be obtained by conventional chemical synthesis.
Preferred base sequences of siRNA used in the present invention are as follows, for example.
CCAUCAUGACUUACGUGUC (SEQ ID NO: 10)
UUACGUGUCCUGCUUCUAC (SEQ ID NO: 11)
AGAUGAGAAGGCCAUCAUG (SEQ ID NO: 12)

  In the present invention, shRNA can also be used to bring about the RNAi effect. shRNA is called short hairpin RNA, and is an RNA molecule having a stem-loop structure so that a partial region of a single strand forms a complementary strand with another region.

  shRNA can be designed so that a part thereof forms a stem-loop structure. For example, if the sequence of a certain region is set as sequence A and the complementary strand to sequence A is set as sequence B, these sequences are linked in the order of sequence A, spacer, and sequence B so that they are present in one RNA strand. Design to be 45-60 bases in length. The sequence A is a sequence of a partial region of the target gene, and the target region is not particularly limited, and any region can be a candidate. The length of the sequence A is 19 to 25 bases, preferably 19 to 21 bases.

  Furthermore, this invention can suppress the expression of the said gene using microRNA. MicroRNA (miRNA) is a single-stranded RNA with a length of about 20-25 bases that exists in cells, and is considered to have a function to regulate the expression of other genes (non-coding RNA) It is a kind of. miRNAs are produced as a nucleic acid that forms a hairpin structure that is produced by being processed when transcribed into RNA and suppresses the expression of a target sequence.

  Since miRNA is also an inhibitory nucleic acid based on RNAi, it can be designed and synthesized according to shRNA or siRNA.

  The disease to be treated in the present invention is a cancer patient, and the type of cancer is as described above. Among them, neuroendocrine tumors, preferably high-grade neuroendocrine tumors of primary lung (small cell lung cancer or large cell neuroendocrine) ).

  The antibody of the present invention or the inhibitory nucleic acid of ACTN4-Va gene can be administered alone or in combination with a pharmaceutically acceptable carrier or diluent, etc., and can be administered once or several times. Can be divided into two.

  As used herein, “pharmaceutically acceptable carrier” refers to excipients, diluents, extenders, disintegrants, stabilizers, preservatives, buffers, emulsifiers, fragrances, colorants, sweeteners, thickeners. , Flavoring agents, solubilizers or other additives. By using one or more of such carriers, pharmaceuticals in the form of tablets, pills, powders, granules, injections, solutions, capsules, troches, elixirs, suspensions, emulsions or syrups, etc. A composition can be prepared. These pharmaceutical compositions can be administered orally or parenterally.

  In the case of oral administration, various excipients such as microcrystalline cellulose, sodium citrate, calcium carbonate, dipotassium phosphate and glycine can be used together with a disintegrant, a binder and the like. Examples of the disintegrant include starch, alginic acid, and certain types of silicate double salts. Examples of the binder include polyvinylpyrrolidone, sucrose, gelatin, and gum arabic. Further, lubricants such as magnesium stearate, sodium lauryl sulfate, and talc are very effective for tablet formation. When an aqueous suspension or elixir is used for oral administration, an emulsifier and a suspending agent may be used in combination, if necessary, and used with water, ethanol, propylene glycol, glycerin, etc., and diluents that combine them. .

  Other forms for parenteral administration include injections that contain one or more active substances and are prescribed by conventional methods.

In the case of injections, for example, by dissolving or suspending in an pharmaceutically acceptable carrier such as physiological saline or commercially available distilled water for injection to an antibody concentration of 5 mg / ml to 500 mg / ml. Can be manufactured. Injection prepared in this way, a human patient in need of treatment, per body surface area in a single dose at a rate of ^{250mg / m 2 ~375mg / m 2} , preferably 250 mg / m ² ~ It can be administered several times, once a week at a rate of 400 mg / m ² .

  However, the dosage is not limited to this range, and may vary depending on the weight and symptoms of the patient and individual administration routes. The dose may vary depending on the sensitivity of the patient to be treated, the way the drug is prescribed, the period of administration, and the interval between doses. In some cases, a dose lower than the lower limit of the above range may be appropriate. .

  Examples of the administration form include intravenous injection, subcutaneous injection, intradermal injection, and the like, preferably intravenous injection. In addition, injections can be prepared as non-aqueous diluents (for example, propylene glycol, polyethylene glycol, vegetable oils such as olive oil, alcohols such as ethanol), suspensions, or emulsions. Such sterilization of the injection can be performed by filtration sterilization through a bacteria-retaining filter, blending of a bactericide, or irradiation. The injection can be produced as a form prepared at the time of use. That is, it can be used as a sterile solid or powder composition by lyophilization, etc., and dissolved in sterile water for injection or other solvent before use.

  When siRNA, shRNA or miRNA is administered, the effective amount is not particularly limited as long as it is sufficient to cause RNAi-mediated degradation of the target mRNA. One skilled in the art can determine the effective amount to be administered to a patient in view of prescription such as height and weight, age, sex, route of administration, or local or systemic administration. For example, the siRNA, shRNA or miRNA has an intracellular concentration of about 1 pM to about 20 pM, preferably 5 pM to 10 pM, for parenteral administration (eg, intravenous injection).

  Hereinafter, the present invention will be described more specifically with reference to examples and experimental examples. However, the present invention is not limited to these examples and experimental examples.

[Example 1] Production of monoclonal antibody specific for ACTN4-Va (1) Production of antigen
ACTN4-Va is expressed only in small cell lung cancer patient tissues, cell lines derived from small cell lung cancer, or normal tissue testis. Moreover, even if an immune antigen is prepared from them, the target antigen site is any one of the three amino acids derived from the amino acid sequence substitution present in the novel splice variant. Therefore, a tissue or cell-derived antigenic protein containing a full-length sequence is not suitable as an immunizing antigen as an antigen for obtaining the target antibody. Therefore, an immune antigen (SEQ ID NO: 4) containing an amino acid-substituted sequence was chemically synthesized as a partial peptide.
Next, the synthesized ACTN4-Va partial peptide was used as an immunizing antigen.
Synthetic peptides and carrier protein KLH were disulfide bonded by MBS method to prepare immune antigens.

(2) Immunization to mice An outline of the immunization method is shown in FIG. Immunization was performed by the following method. An equal amount of 1.25 mg / mL of immunizing antigen mixed with FCA and an emulsion formed is administered subcutaneously to the back of the mouse by 160 μL, and then 1.25 mg / mL of immunizing antigen and FIA etc. at 2-week intervals 80 μL of the mixture that was mixed and formed into an emulsion was subcutaneously administered to the back of the mouse. Finally, the antigen was administered a total of 5 times, and the antibody titer was confirmed by ELISA. In contrast to the antibody with a high antibody titer, a mixture of 40 μL of 1.25 mg / mL immune antigen and 460 μL of physiological saline was used. The spleen was removed for cell fusion 3 days later.

(3) Preparation of spleen cells and cell fusion When the extracted spleen was ground and spleen cells containing ACTN4-Va antibody-producing cells were prepared, about 1 × 10 ⁸ spleen cells per mouse could be prepared. On the other hand, P3U1, which is a myeloma cell, was cultured, and P3U1 having a viable cell ratio of 95% or more was prepared on the day of cell fusion. These spleen cells and P3U1 were mixed at 5: 1, and cell fusion was performed with polyethylene glycol having a molecular weight of 1,450 at a concentration of 50%. After the fusion, the cells were washed with a medium and suspended in HAT medium, and cells were seeded at 1 × 10 ⁵ cells / well in each well of a 96-well culture plate.

(4) Screening of antibody production positive wells After cell fusion, the culture supernatant on the 10th day was collected, and antibody production positive wells were screened by the method of Experimental Example 1 described later. 31 out of 1264 wells were ACTN4-Va positive and ACTN4-Ub negative. When the culture supernatants of these selected wells were screened again by the method of Experimental Example 2, 17 wells were finally positive for ACTN4-Va.

(5) Cloning
Seventeen wells with high specificity for ACTN4-Va were cloned by limiting dilution. That is, cells were prepared at 5 cells / mL in RPMI medium containing 10% FCS, and 200 μL was added to each well of two 96-well culture plates. Ten days later, the antibody titer and specificity for ACTN4-Va in the culture supernatant were measured by the method of Experimental Examples 1 and 2 described below, and confirmed to be positive, and 5 clones derived from each well were obtained. It was. The respective established clones were designated as “13G9”, “11H2”, “9B3”, “15H2”, and “10E10”.

<Experimental example 1>
Antibody screening methods
50 μL of ACTN4-Va peptide prepared at 1 μg / mL with PBS (pH 7.0) as a solid phase antigen was added to each well of a 96-well microtiter plate and allowed to stand at 25 ° C. for 1 hour. At the same time, 50 μL of ACTN4-Ub peptide DIVNTARPDEKAIMTYVSS (SEQ ID NO: 3) was added in the same manner for specificity confirmation, and left at 25 ° C. for 1 hour. Next, after washing 3 times with PBS (pH 7.0) (PBST) containing 0.05% Tween20, 200 μL of PBST (blocking solution) containing 0.5% gelatin was added to each well and allowed to stand at 25 ° C. for 1 hour. . After washing, 50 μL of the culture supernatant was added to each well as the stock solution and allowed to stand at 25 ° C. for 1 hour. Next, after washing 3 times with PBST, 50 μL each of HRP-labeled anti-mouse IgG antibody (KPL) diluted 2500-fold was added to each well and allowed to stand at 25 ° C. for 1 hour. Next, after washing 3 times with PBST, 100 μL of o-phenylenediamine solution prepared to 0.5 mg / mL with 0.1 M citrate phosphate buffer (pH 5.0) containing 0.02% hydrogen peroxide is added to each well. After standing at 25 ° C. for 10 minutes, 100 μL of 1M sulfuric acid solution was added to each well to stop the color reaction. The absorbance at 490 nm was then measured with an ELISA reader.

<Experimental example 2>
Screening method and specificity confirmation method by Western blotting After performing SDS-polyacrylamide electrophoresis (referred to as SDS-PAGE) by the following method, Western blotting (referred to as WB) by semi-dry blotting is performed, and a specificity confirmation test is performed. went.

  When using a sample derived from a cancer cell line as a sample for specificity evaluation, human small cell lung cancer-derived cancer cell line H69 that specifically expresses ACTN4-Va and human pancreatic adenocarcinoma-derived cells that do not express it A total of three cell extracts were used: strain BxPC-3 and human breast cancer-derived cell line MCF7. When using extracts derived from expression cells, HEK293 GFP-ACTN4-Va with ACTN4-Va gene introduced and HEK293 GFP-ACTN4-Ub with ACTN4-Ub gene, HEK293 and HEK293 GFP, 4 types in total Was used.

  Further, when screening with the culture supernatant, the evaluation was performed using only the H69 extract, and the confirmation test using the purified antibody was performed using an extract derived from cancer cells or expression cells.

For each preparation, prepare cells of 1 x 10 ⁷ cells or more, mix with T-PER extract (Thermo) at a dilution of 100-fold and add protein inhibitor (Nacalai Tesque) in 500ul or less. Extraction was performed in accordance with the instructions to obtain a sample. The concentration of each sample was measured by the BCA method (Thermo).

  SDS-PAGE was performed using a 10% single concentration polyacrylamide gel (ATTO) and electrophoresis using 1 × SDS-PAGE Running Buffer. Further, the sample was diluted with 6 × Sample Buffer containing 9.3% DTT (dithiothreitol), subjected to thermal reaction treatment at 95 ° C. for 5 minutes, and then subjected to electrophoresis at 10 ug / lane. The electrophoresis conditions at that time were 20 mA and a constant current, and the migration was completed when the bromophenol blue line in the sample, which was added for visualization to the bottom of the gel, moved.

  Next, WB was performed. As a pretreatment, a 9 × 8.5 cm PVDF membrane (referred to as a membrane) (Millipore) was treated with methanol for 1 minute before the electrophoresis was completed, and then permeated again into a blotting buffer containing 20% methanol. Similarly, 6 filter papers cut to the same size as the membrane were permeated into the blotting buffer.

Next, blotting to the membrane was performed. Semi-dry blotting system: three filter paper (GE company formerly Amersham Corporation), PVDF membrane, SDS-PAGE gel sample of the migration has been completed, one on top of the three filter paper, is Tsui圧15V~30V to the membrane in a 1cm ^{2 /} 2mA Thus, electrophoresis was performed at a constant current for 50 minutes.

  Next we performed a Bloking. When the sample is H69, cut the membrane for every 1 lane, and for 3 types including BxPC-3 and MCF7, set 3 types as a set, and then use N101 Blocking buffer (NOF Corporation) diluted 3-fold with milli-Q water The mixture was shaken at 25 ° C. for 1 hour.

  Next, a primary reaction was performed. In the case of screening using the culture supernatant, the culture supernatant was diluted 3 times with a blocking solution (referred to as antibody dilution solution) diluted 10-fold with PBST and allowed to react with the membrane. In the case of confirming the specificity using the purified antibody, the antibody dilution was similarly prepared to 1 μg / ml and reacted with the membrane. Each was shaken at 25 ° C. for 1 hour.

  Next, a secondary reaction was performed. After washing the membrane 3 times with PBST, an HRP-labeled anti-mouse IgG antibody (KPL) diluted 20,000 times with an antibody diluent was prepared and reacted with the membrane by shaking at 25 ° C. for 1 hour.

  Next, a color reaction was performed. After the membrane was washed 3 times with PBST, a color reaction was performed using Chemil Miwan (Nacalai). The method followed the instruction manual. After the color reaction, Chemiluminescence was detected using LAS-3000 (GE).

(6) Purification of antibody The target monoclonal antibody was purified from the 5 clones established in (5) above by the following method. First, established clones were suspended in a commercially available serum-free medium (Hybridoma SFM: Invitrogen) and prepared to 4 × 10 ⁵ cells / mL. 50 mL of the cell suspension was placed in a T225 flask and cultured in a 37 ° C., 5.0% CO ₂ environment for about one week. After culturing, the culture supernatant was collected. The collected culture supernatant was applied to a protein G column and eluted with glycine buffer (pH 3.0) to purify the monoclonal antibody.

  Thereafter, using the purified antibody, the specificity confirmation test for ACTN4-Va was performed again by the methods of Experimental Examples 1 and 2.

  As a result, the same results as in the case of the culture supernatant in 5 clones were obtained (FIGS. 2, 3 and 4).

(7) Diagnosis adaptation test by immunohistochemical staining of established clones With respect to the above 5 clones, a diagnostic adaptation test by immunohistochemical staining of an antibody recognizing ACTN4-Va in living tissue was performed by the method of Experimental Example 3 below. Diagnosis was performed using pulmonary primary HGNT, Ad, and Sq excised pathological specimens (n = 557). As a result, immunostaining in cancer tissues was possible using the specific monoclonal antibody “15H2” against ACTN4-Va (FIG. 5).

The ACTN4-Va positive rate was diagnosed based on the evaluation method of Experimental Example 3. As a result, LCNEC was 47.5% (58/122) and SCLC was 60.0% (42/70). The false positive rate was 0% for both Ad (0/158) and Sq (0/158). The positive rate of carcinoid, a low-grade neuroendocrine tumor of the lung, was 9.8% (5/51), which was lower than that of high-grade neuroendocrine tumors (Table 1).

  Table 1 is a table showing the positive rate diagnosis result of each cancer by immunohistochemical staining using a monoclonal antibody derived from clone “15H2”.

<Experimental example 3>
Diagnosis indication test by immunohistological staining Immunostaining was performed by the following method to confirm the indication of diagnosis.
The sample used was a tissue microarray (Tissue microarray, TMA) prepared from a case excised at the National Cancer Center Central Hospital and stored as a formalin-fixed paraffin block.

  The TMA slice thickness was 4 μm. Automatic immunostaining was performed using Ventana Discovery (Roche). TMA was deparaffinized according to the program in Ventana Discovery, then antigen-activated by heat treatment, and then endogenous peroxidase activity was inhibited.

Next, blocking was performed with 2% porcine serum (Vector).
In the primary reaction, anti-ACTN4-Va antibody was prepared at 5 μg / ml and hybridization was performed at 37 ° C. for 60 minutes.

Biotinylated anti-mouse IgG (Vector) was prepared 100 times as a secondary antibody and hybridized at 37 ° C for 30 minutes.
For color development, TMA was stained according to the Ventana Discovery DAB kit protocol.

  Subsequently, immunohistochemical staining was evaluated separately by two observers. Cases that were strongly expressed in the periplasm of the cell membrane (3+) and those that were strongly expressed in the cytoplasm (2+) (1+) and (0+) are defined as (0+), and (3+) and (2+) cases are positive, (1+) and (0). ) Cases were defined as negative.

(8) Overall survival analysis using immunohistochemical results As a subclass analysis of HGNT and its subclass analysis using the results of (7), regarding the relationship between ACTN4-Va expression and prognosis, Kaplan-Meier method And examined using Cox proportional hazards method. When the overall survival was analyzed by Kaplan-Meier method, the survival of positive patients was significantly shorter in ACTN4-Va positive patients than in negative patients for HGNT, SCLC, and LCNEC (Fig. 6). The Cox proportional hazards assessment of mortality risk showed that ACTN4-Va expression could be an independent factor predicting prognosis in each of HGNT, SCLC, and LCNEC (Table 2).

  Table 2 is a table showing the results of evaluating the risk factors for death of HGNT, SCLC, and LCNEC patients in the expression of ACTN4-Va using the Cox proportional hazards method. In Table 2, since the protein expression of ACTN4-Va has significance in multivariate analysis, it can be said that it is an independent prognostic factor for HGNT, SCLC, and LCNEC.

[Example 2] Inhibition of ACTN4-Va expression by siRNA (1) Preparation of siRNA Preferred siRNAs (SEQ ID NOs: 10, 11, and 12) used in the present invention were generated by chemical synthesis. Silencer (registered trademark) Negative Control # 1 siRNA and Silencer (registered trademark) Negative Control # 2 siRNA (Ambion) were used as negative controls.

(2) Introduction into cells
SiRNA using a cationic lipid for gene transfer was introduced into human small cell lung cancer cell line SBC-3 expressing ACTN4-Va.

SBC-3 was seeded at 3 × 10 ⁵ cells / 2 ml per well of a 6-well culture plate and cultured in a CO 2 incubator for 24 hours.

  A complex used for introduction of siRNA was prepared by reacting two kinds of mixed solutions. The first mixed solution was prepared by mixing 1 μl (10 pmol) of each 10 μM siRNA and 250 μl of Opti-MEM I (Invitrogen). The second mixed solution was prepared by mixing 5 μl of Lipofectamine 2000 (Invitrogen) and 250 μl of Opti-MEM I. These two kinds of mixed solutions were allowed to stand at room temperature for 20 minutes. In preparation of the negative control mixture, 0.5 μl (20 pmol) of 10 μM negative control siRNA was used.

  Next, 500 μl of the complex was added to the SBC-3 culture well and cultured at 37 ° C. for 72 hours in a CO 2 incubator.

(3) Western blotting Western blotting was performed using the SBC-3 extract after the introduction reaction, and ACTN4-Va was detected with the purified antibody 15H2.

(4) Results The results are shown in FIG. In FIG. 7, each lane represents a band when the following siRNA or control is used.

lane 1: CCAUCAUGACUUACGUGUC (SEQ ID NO: 10)
lane 2: UUACGUGUCCUGCUUCUAC (SEQ ID NO: 11)
lane 3: AGAUGAGAAGGCCAUCAUG (SEQ ID NO: 12)
lane 4: Negative control (Silencer (R) Negative Control # 1 siRNA)
lane 5: Negative control (Silencer (R) Negative Control # 2 siRNA)

  In Lanes 1 to 3, since the ACTN4-Va band disappeared, it was shown that the expression of ACTN4-Va can be suppressed by using the siRNA of the present invention. Therefore, the siRNA of the present invention is useful for the treatment of tumors, particularly neuroendocrine tumors.

  The antibody of the present invention can detect ACTN4-Va in samples such as tissues, cells, and blood with high sensitivity and specificity, and is useful for detection and diagnosis of tumors, preferably cancer, and as an antitumor pharmaceutical composition. It is.

Sequence number 5: Synthetic DNA
Sequence number 6: Synthetic DNA
Sequence number 7: Synthetic DNA
Sequence number 8: Synthetic DNA
Sequence number 9: Synthetic DNA
Sequence number 10: Synthetic RNA
Sequence number 11: Synthetic RNA
Sequence number 12: Synthetic RNA

Claims (26)

  An antibody against mutant α-actinin-4 having an amino acid sequence in which at least one of the amino acid residues in the 245th to 263th regions of the amino acid sequence of α-actinin-4 is substituted with another amino acid residue Wherein the antibody recognizes all or part of the substituted amino acid residues in the region.   The antibody according to claim 1, wherein the mutant α-actinin-4 is a splice variant derived from exon 8 'of DNA encoding α-actinin-4.   The antibody according to claim 1, wherein the substituted amino acid residue is at least one selected from the group consisting of the 248th glycine, the 250th leucine and the 263th cysteine of the amino acid sequence of α-actinin-4. .   The antibody according to claim 1, wherein the amino acid sequence including the substituted amino acid residue is represented by DIVGTLRPDEKAIMTYVSC (SEQ ID NO: 4).   The antibody according to claim 1, wherein the antibody is a monoclonal antibody.   6. The antibody of claim 5, wherein the antibody is produced by a hybridoma having a receipt number of NITE ABP-1140.   An antibody that binds to an antigenic determinant to which the antibody of claim 5 or 6 binds.   The antibody according to claim 5 or 6, wherein the antibody is a chimeric antibody, a humanized antibody or a humanized antibody.   The antibody fragment according to any one of claims 1 to 8.   A hybridoma producing the antibody according to claim 5 or 6.   A hybridoma whose receipt number is NITE ABP-1140. A method for producing an antibody against mutant α-actinin-4, comprising:
(a) a partial peptide comprising the amino acid sequence of the 245th to 263th region of the amino acid sequence of α-actinin-4, wherein at least one of the amino acid residues in the region is substituted with another amino acid residue Immunizing a non-human mammal with a partial peptide having an amino acid sequence; and
(b) The method comprising collecting an antibody from the non-human mammal. A method for producing a monoclonal antibody against mutant α-actinin-4, comprising:
(a) a partial peptide comprising the amino acid sequence of the 245th to 263th region of the amino acid sequence of α-actinin-4, wherein at least one of the amino acid residues in the region is substituted with another amino acid residue Immunizing a non-human mammal with a partial peptide having an amino acid sequence;
(b) collecting antibody-producing cells from the immunized non-human mammal;
(c) fusing the antibody-producing cells obtained in step (b) with myeloma cells, and
(d) The said method including the process of extract | collecting an antibody from the fusion cell obtained at the process (c).   The method according to claim 12 or 13, wherein the non-human mammal is a GANP transgenic non-human mammal.   A mutant α-actinin-4 characterized by detecting the mutant α-actinin-4 by reacting the antibody or fragment thereof according to any one of claims 1 to 9 with a biological sample. Detection method.   A gene encoding mutant α-actinin-4 comprising an amino acid sequence in which at least one of the amino acid residues in the 245th to 263th regions of the amino acid sequence of α-actinin-4 is substituted with another amino acid residue A method for detecting a gene by reacting a probe for a polynucleotide encoding the substituted amino acid sequence or a primer for amplification of the polynucleotide with a biological sample.   The method according to claim 16, wherein the gene encoding mutant α-actinin-4 is a splice variant mRNA derived from exon 8 'of DNA encoding α-actinin-4.   The method to detect a tumor using the detection result obtained by the method of any one of Claims 15-17.   A method for evaluating a tumor state or a prognostic state using the result detected by the method according to any one of claims 15 to 18 as an index.   A reagent for detecting or diagnosing a tumor, comprising the antibody or fragment thereof according to any one of claims 1 to 9.   A probe for a polynucleotide encoding an amino acid sequence in which at least one of the amino acid residues in the 245th to 263th regions of the amino acid sequence of α-actinin-4 is substituted with another amino acid residue, or amplification of the polynucleotide A reagent for detecting or diagnosing a tumor, comprising a primer for use.   The method according to claim 18 or 19, wherein the tumor is a primary high-grade neuroendocrine tumor of the lung.   The reagent according to claim 20 or 21, wherein the tumor is a lung primary high-grade neuroendocrine tumor.   Inhibits the function of mutant α-actinin-4 having an amino acid sequence in which at least one of the amino acid residues in the 245th to 263th regions of the amino acid sequence of α-actinin-4 is substituted with another amino acid residue A pharmaceutical composition for antitumor comprising a substance to be treated.   The substance that inhibits the function of mutant α-actinin-4 is the antibody or fragment thereof according to any one of claims 1 to 9, or an inhibitory nucleic acid of a gene encoding mutant α-actinin-4 25. A pharmaceutical composition according to claim 24. 26. The pharmaceutical composition according to claim 24 or 25, wherein the tumor is a primary high-grade neuroendocrine tumor of the lung.