JP2016161390A - Method for diagnosing rheumatoid arthritis - Google Patents

Abstract

PROBLEM TO BE SOLVED: To provide a method for diagnosing rheumatoid arthritis that can objectively predict or estimate therapeutic effects of a biological drug product.SOLUTION: The present invention relates to a method for diagnosing rheumatoid arthritis, characterized by including a step of measuring the concentration of soluble FRβ in a blood sample. The present invention also relates to a method for predicting or estimating therapeutic effects of an antitumor necrotizing factor α(anti-TNFα) biological drug product for rheumatoid arthritis, characterized by including the step of measuring the concentration of soluble FRβ in a blood sample.SELECTED DRAWING: Figure 3

Description

  The present invention relates to a method for diagnosing rheumatoid arthritis. The present invention also relates to a method for predicting or evaluating the therapeutic effect of an anti-tumor necrosis factor α (anti-TNFα) biologic on rheumatoid arthritis.

  Rheumatoid arthritis (RA) is a disease in which chronic inflammation mainly consisting of lymphocytes and macrophages occurs in a plurality of joint synovial membranes, resulting in destruction of cartilage bone.

  In the treatment of rheumatoid arthritis, methotrexate, which is a folic acid antagonist, and various biological products are expected to exert high therapeutic effects. Biological preparations are pharmaceuticals produced by biotechnology. As biological agents used for the treatment of rheumatoid arthritis, anti-tumor necrosis factor α (TNFα) antibody, anti-IL-6 receptor antibody, T cell selection are used. Co-stimulatory agents. These biologics have a strong joint destruction effect compared to conventional drugs, but they are expensive, require a large amount of biologics in advanced rheumatoid arthritis, and have an immunosuppressive effect. There are problems such as the possibility of serious side effects such as infections. In addition, anti-TNFα biological preparations are known to exert therapeutic effects after injury to synovial macrophages (Non-Patent Document 1). For markers that predict the effects of anti-TNFα biological preparations, However, it is difficult to say that there is something to decide (Non-Patent Documents 2 and 3).

  One of diagnostic criteria for rheumatoid arthritis is DAS28-CRP. DAS28-CRP is intended to express the activity of RA with absolute numerical values, and is a method of evaluating by the number of painful joints, the number of swollen joints in the whole body 28 joints, comprehensive evaluation by patients, and CRP. However, such judgment based on clinical symptoms is not objective because it depends on the empirical rules of patients and healthcare professionals.

Davignon JL et al., Targeting monocytes / macrophages in the treatment of rheumatoid arthritis. Rheumatology (Oxford). 2013 Apr; 52 (4): 590-8. Cuchacovich M et al., Clinical parameters and biomarkers for anti-TNF treatment prognosis in rheumatoid arthritis patients.Clin Rheumatol. 2014 Dec; 33 (12): 1707-14. Choi IY et al., MRP8 / 14 serum levels as a strong predictor of response to biological treatments in patients with rheumatoid arthritis. Ann Rheum Dis. 2013 Dec 2. doi: 10.1136 / annrheumdis-2013-203923.

  As described above, the conventional diagnostic methods for rheumatoid arthritis cannot objectively predict or evaluate the therapeutic effects of biological products. Therefore, an object of the present invention is to provide a method for diagnosing rheumatoid arthritis that can objectively predict or evaluate the therapeutic effect of a biological preparation.

  As a result of various studies on means for solving the above problems, the present inventors have measured the blood concentration of soluble folate receptor (hereinafter referred to as FR) β, thereby improving the therapeutic effect of biological preparations on rheumatoid arthritis. The present invention has been completed by finding that it can be objectively predicted or evaluated.

That is, the gist of the present invention is as follows.
(1) A method for diagnosing rheumatoid arthritis, comprising measuring the blood concentration of soluble FRβ present in collected blood.
(2) A method for predicting the therapeutic effect of antitumor necrosis factor α (anti-TNFα) biologic on rheumatoid arthritis, characterized by measuring the blood concentration of soluble FRβ in the collected blood.
(3) A method for evaluating the therapeutic effect of antitumor necrosis factor α (anti-TNFα) biologic on rheumatoid arthritis, characterized by measuring the blood concentration of soluble FRβ in the collected blood.

  The present invention provides a method for diagnosing rheumatoid arthritis that can objectively predict or evaluate the therapeutic effect of a biologic.

Fig. 1 (A) is a flow cytometry diagram showing the reactivity of anti-human FR rat monoclonal antibody (antibody No. 5) to FRα and FRβ. FIG. 1 (B) is a flow cytometry diagram showing the reactivity of anti-human FRβ rat monoclonal antibody (antibody No. 2) to FRα and FRβ. FIG. 1C shows biotinylated No. It is a figure of the flow cytometry which shows the reactivity with respect to FR (beta) of 2 antibodies. Antibody No. 5 reacts with human FRα and FRβ (FIG. 1 (A)), whereas antibody No. 5 2 is specific for human FRβ (FIG. 1 (B)). Furthermore, from the result of FIG. The reactivity with respect to FRβ exhibited by the antibody 2 is F (ab ′) ₂ fragmentation no. It is not affected by the presence of 5 antibodies. FIG. 2 is a diagram showing a standard curve using recombinant soluble FRβ protein. FIG. 3 shows the arthritis activity index (DAS28-CRP) and blood soluble FRβ levels (high and low) before administration of anti-TNFα biologics and 10 months after administration of rheumatoid arthritis patients (10 patients). Is a comparison of responding and non-responding patients with anti-TNFα biologics. All patients in the high group (4) responded to anti-TNFα biologics compared to the mean soluble FRβ value of 10 patients, and 3 in the low group (6) had 3 anti-TNFα organisms Responded to the clinical formulation. FIG. 4 is a graph comparing the blood soluble FRβ concentration in patients with rheumatoid arthritis before and 3 months after administration of anti-TNFα biologics in patients with and without response to anti-TNFα biologics. . Of the 7 patients who responded to the anti-TNFα biologic, 6 decreased the blood concentration of soluble FRβ 3 months after administration. On the other hand, the blood concentration of soluble FRβ increased in unresponsive patients.

  Hereinafter, the present invention will be described in detail.

1. TECHNICAL FIELD The present invention relates to a method for diagnosing rheumatoid arthritis. In the method of the present invention, rheumatoid arthritis is diagnosed by measuring the blood concentration of soluble FRβ in blood collected from a subject suffering from rheumatoid arthritis. In the diagnostic method of the present invention, the therapeutic effect of the biological product can be objectively determined, and in particular, the therapeutic effect of the anti-tumor necrosis factor α (anti-TNFα) biological product is objectively predicted or evaluated. be able to. Moreover, since the diagnostic method of the present invention evaluates blood, it is advantageous in terms of the ease of obtaining a specimen and the burden on the patient as compared with the method of evaluating synovial fluid.

  As used herein, the term “soluble FRβ” means FRβ released from synovial macrophages and dissolved in body fluids such as blood and synovial fluid. FRβ is a GPI-anchored membrane protein and is usually exposed to the cell membrane. Although the mechanism by which membrane-type FRβ changes to soluble FRβ is unclear, high expression is observed in synovial macrophages, which are sources of inflammatory cytokines such as TNFα and IL-6, in rheumatoid arthritis pathologies.

  As used herein, the term “subject” includes mammals such as primates including humans, domestic animals such as cattle, pigs, horses, goats and sheep, and pet animals such as dogs and cats. A preferred subject is a human.

  Examples of blood as a test specimen include blood collected from a subject, and preferably serum obtained separately from the blood is used as a specimen. The serum is not particularly limited, and can be obtained by, for example, a normal method for separating serum obtained from blood as a specimen for clinical examination. Specifically, it can be obtained from a supernatant after leaving a blood sample, a supernatant obtained by centrifugation, or the like.

  In the diagnostic method of the present invention, the blood concentration of soluble FRβ is preferably measured by an immunoassay, for example, using an anti-FRβ antibody and using an antigen-antibody reaction with soluble FRβ. Is mentioned. Specifically, an anti-FRβ antibody is immobilized on a solid phase carrier, a test sample is brought into contact with the solid phase carrier, soluble FRβ in the sample is captured with the anti-FRβ antibody, and the captured soluble FRβ is labeled with a labeling substance. The method of using and measuring is mentioned. The anti-FRβ antibody used in the present invention is an antibody or a fragment thereof capable of recognizing and binding to the FRβ protein, and the type and form of the antibody are not limited.

  More specifically, examples of the immunological measurement method used in the diagnostic method of the present invention include radioimmunoassay, enzyme immunoassay, fluorescent immunoassay, luminescence immunoassay, immunoprecipitation method, immunoturbidimetric method, and the like. Preferably, ELISA (enzyme-linked immunosorbent assay) is more preferable because soluble FRβ can be detected with high sensitivity and a large number of specimens can be automatically measured. Among the ELISA methods, the sandwich ELISA method is particularly preferable.

  In the present invention, when the blood concentration of soluble FRβ is measured by sandwich ELISA, for example, anti-FRβ immobilized on a solid phase carrier such as synthetic resin (polystyrene, polyethylene, polypropylene, etc.), polysaccharide, glass, metal, etc. Measurement is performed by a known sandwich ELISA method using an antibody (capture antibody) and a labeled anti-FRβ antibody (detection antibody).

  As the capture antibody, an anti-FRβ antibody is preferably used. The anti-FRβ antibody is an antibody or a fragment thereof capable of recognizing and binding to the FRβ protein, and the type and form of the antibody are not limited. An anti-FRβ antibody binds to FRβ by immunological reaction, but binds to FRβ or a mutant protein having sequence identity of 90% or more, preferably 95% or more, more preferably 98% or more. There may be.

  The anti-FRβ antibody may be of any immunoglobulin (Ig) class (IgA, IgG, IgE, IgD, IgM, IgY, etc.) and subclass (IgG1, IgG2, IgG3, IgG4, IgA1, IgA2, etc.). . The light chain of the immunoglobulin may be either a kappa chain or a lambda chain.

  Specifically, the anti-FRβ antibody includes, for example, an antibody having a complete structure of the above class or subclass or a fragment thereof, a recombinant antibody, a single chain antibody (scFv), a multispecific antibody (for example, a bispecific antibody, Diabodies, triabodies, ScDb (single chain diabody), dsFv-dsFv, etc.), chimeric antibodies, humanized antibodies, antibodies such as human antibodies or fragments thereof, and polymer antibodies obtained by polymer crosslinking these fragments.

  The fragment of an antibody that can be used in the present invention is capable of binding to an FRβ protein antigen epitope having 7 or more, more preferably 8 to 12 or more consecutive amino acids.

Antibody fragments include, for example, Fab, Fab ′, F (ab ′) ₂ , Fv, Fd, Fabc and the like. A method for producing such a fragment is known in the art, and can be obtained, for example, by digesting an antibody molecule with a protease such as papain or pepsin, or by a known genetic engineering technique. In the present invention, it is preferable to use an F (ab ′) ₂ antibody fragment excluding the Fc region of an antibody to which a rheumatoid factor present in the blood of a rheumatoid arthritis patient binds.

  The capture antibody is not particularly limited as long as it does not cause competitive inhibition between the detection antibody described later and the ligand FR, and examples thereof include the following.

Amino acid sequence (SEQ ID NO: 24, corresponding base sequence: SEQ ID NO: 23) of heavy chain variable region (VH) derived from anti-human FR rat monoclonal antibody (clone name: No. 5) in the following Examples, and light chain variable Antibody or fragment thereof comprising the amino acid sequence of region (VL) (SEQ ID NO: 32, corresponding base sequence: SEQ ID NO: 31):
CDRH1, CDRH2 and CDRH3 amino acid sequences of heavy chain variable region (VH) derived from anti-human FR rat monoclonal antibody (clone name: No. 5) (SEQ ID NO: 18, SEQ ID NO: 20, SEQ ID NO: 22 respectively) and light chain An antibody or fragment thereof comprising the variable region (VL) CDRL1, CDRL2 and CDRL3 amino acid sequences (SEQ ID NO: 26, SEQ ID NO: 28, SEQ ID NO: 30 respectively):
The amino acid glycine at position 44 was mutated to cysteine in the amino acid sequence (SEQ ID NO: 24, corresponding base sequence: SEQ ID NO: 23) of the heavy chain variable region (VH) derived from the anti-human FR rat monoclonal antibody (clone name: No. 5). Amino acid sequence (SEQ ID NO: 34, its corresponding base sequence: SEQ ID NO: 33) and amino acid sequence of the light chain variable region (VL) (SEQ ID NO: 32, corresponding base sequence: SEQ ID NO: 31) An antibody or fragment thereof comprising an amino acid sequence in which glycine is mutated to cysteine (SEQ ID NO: 36, its corresponding nucleotide sequence: SEQ ID NO: 35):
CDRH1, CDRH2 and CDRH3 amino acid sequences of heavy chain variable region (VH) (SEQ ID NO: 18, SEQ ID NO: 20, SEQ ID NO: 22 respectively), and light chain variable region (VL) CDRL1, CDRL2 and CDRL3 amino acid sequences (respectively, A humanized antibody or fragment thereof comprising SEQ ID NO: 26, SEQ ID NO: 28, SEQ ID NO: 30).

  The detection antibody is not particularly limited as long as it does not cause competitive inhibition between the capture antibody and the ligand FR, and includes, for example, an enzyme (for example, peroxidase, alkaline phosphatase, etc.), a fluorophore, and the like. (For example, FITC, tetramethylrhodamine, Texas red, etc.), a dye, a label such as a radioisotope, or the like can be used. As the detection antibody, an anti-FRβ antibody that recognizes the FRβ protein and specifically binds to this protein is preferably used. The label binding includes a chemical binding method, a binding method using a biotin- (strept) avidin system, and the like.

2. Method for predicting therapeutic effect of anti-TNFα biologic on rheumatoid arthritis The present invention measures anti-TNFα, which is characterized by measuring the blood concentration of soluble FRβ in blood collected from a subject suffering from rheumatoid arthritis. It also relates to a method for predicting the therapeutic effect of a biologic on rheumatoid arthritis.

  The blood concentration of soluble FRβ in blood collected from a subject can be measured as described above.

  The anti-TNFα biological agent whose therapeutic effect can be predicted by the prediction method of the present invention may be an antibody having a variable region that recognizes TNFα as an antigen and binds to TNFα, or a TNFα-specific receptor. Examples of commercially available anti-TNFα biologics include golimumab, adalimumab, infliximab, etanercept, and the like.

  In the prediction method of the present invention, blood is collected from a subject before the start of administration of an anti-TNFα biologic, and the blood concentration of soluble FRβ in the collected blood (preferably serum) is measured. The timing of collecting blood from the subject is not particularly limited as long as it is before the start of administration of the anti-TNFα biological product, but is usually immediately before the start of administration of the anti-TNFα biological product (at the start of administration).

  In the prediction method of the present invention, if the blood concentration of soluble FRβ in blood collected from the subject before the start of administration of the anti-TNFα biological product is high, the reactivity of the anti-TNFα biological product in the subject is high, and the anti-TNFα It can be predicted that the therapeutic effect of the biologic agent on rheumatoid arthritis is high. Specifically, in the prediction method of the present invention, if the blood concentration of soluble FRβ collected from the subject before the start of administration of the anti-TNFα biological product is high, the subject after administration of the anti-TNFα biological product DAS28-CRP decreases.

  In the prediction method of the present invention, the case where the blood concentration of soluble FRβ collected from a subject is high means, for example, that the soluble FRβ concentration is higher than the average blood concentration of soluble FRβ collected from a plurality of subjects. A case with blood concentration. In the examples below, a subject having a blood concentration of soluble FRβ that is higher than the mean value has a blood concentration of soluble FRβ that is greater than or equal to 19.0 ng / ml.

3. The present invention relates to an anti-TNFα characterized by measuring the blood concentration of soluble FRβ in blood collected from a subject suffering from rheumatoid arthritis. It also relates to a method for evaluating the therapeutic effect of a biologic on rheumatoid arthritis.

  In the evaluation method of the present invention, blood of a subject is collected after administering an anti-TNFα biological product to a subject suffering from rheumatoid arthritis, and the blood concentration of soluble FRβ in the blood (preferably serum) is measured. To do. The timing of collecting blood from the subject is not particularly limited as long as it is after administration of the anti-TNFα biologic, but is, for example, 3 months after administration of the anti-TNFα biologic.

  The blood concentration of soluble FRβ in blood collected from a subject can be measured as described above.

  The anti-TNFα biological product whose therapeutic effect can be evaluated by the evaluation method of the present invention may be an antibody that recognizes TNFα as an antigen and has a variable region that binds to TNFα, or a TNFα-specific receptor. Examples of commercially available anti-TNFα biologics include golimumab, adalimumab, infliximab, etanercept, and the like.

  In the evaluation method of the present invention, if the blood concentration of soluble FRβ in the blood collected from the subject after administration of the anti-TNFα biological product is lower than that before administration, the reactivity of the anti-TNFα biological product in the subject is reduced. It can be evaluated that the anti-TNFα biological preparation has a high therapeutic effect on rheumatoid arthritis. In the evaluation method of the present invention, the anti-TNFα biological product is treated for rheumatoid arthritis as the blood FRβ concentration in the blood collected from the subject after administration of the anti-TNFα biological product is lower than that before administration. It can be evaluated that the effect is high.

Example 1 Preparation of Anti-FR Antibody A vector containing human FRβ gene (pEF-BOS) was prepared according to the method of Nagayoshi et al. (Nagayoshi R et al., Arthritis Rheum. 2005 Sep; 52 (9): 2666-75). . Next, the gene was introduced into rat RBL2H3 cells and mouse B300-19 cells. That is, 1 μg of FRβ gene-containing vector mixed with 20 μL of lipofectamine (GibcoBRL) was added to each cell previously adjusted to 1 × 10 ⁵ cells, and added to the cells. In order to acquire the antibiotic G418 resistance, the transfected B300-19 mouse cells were selectively cultured in a medium containing G418 at a concentration of 1 mg / mL.

Anti-FRβ-expressing cells adjusted to 1 × 10 ⁷ were suspended in 100 μl of complete Freund's adjuvant and immunized to the soles of Wister rats. Monoclonal antibodies were produced according to the method of Kohler (Kohler & Milstein, Nature (1975) 256: 495-96). That is, antibody-producing cells obtained from the intraperitoneal lymph nodes after 16 days and NS1 cells derived from myeloma were mixed at a ratio of 4 to 1, and fused with 50% polyethylene glycol (PEG 1500, Roche, Mannheim, Germany) A hybridoma was produced. The hybridoma was cultured in an IMDM medium (GibcoBRL) cell culture medium containing 10% FBS and 1% HAT (Life Technologies). Among the antibodies secreted into the culture supernatant, those that react with the FRβ-expressing cells and the FRα-expressing KB cell line (Human epidermoid carcinoma) were selected. Hybridomas in which antibody production was observed were cloned by limiting dilution culture adjusted to 1 cell per well of a 96-well plate.

  Collection of antibodies using cloned hybridomas is IMDM medium (Gibco) including 10% FCS, 10% NCTC-109 medium (Gibco), 1% HT Supplement (Gibco) and 1% Antibiotic / Antilytic Mixed (Nakarai) And purified with goat anti-rat immunoglobulin agarose (Rockland).

  Thus, it reacts with a purified antibody (anti-human FRβ rat monoclonal antibody: hereinafter referred to as “antibody No. 2”) of a clone specific to FRβ (clone name: No. 2) and both FRα and FRβ. The purified antibody (clone name: No. 5) purified antibody (anti-human FR rat monoclonal antibody: hereinafter referred to as “antibody No. 5”) was obtained.

[Antibody No. 2 and antibody no. Determination of 5 antibody genes]
Antibody No. 2 and antibody no. The rat hybridoma clones producing 5 were each adjusted to 1 × 10 ⁷ and cDNA was synthesized by cDNA synthesis kit (Invitrogen). Next, using primers designed for cloning of Ig-Prime Kit and rat antibody heavy chain region: caccatggagttacttttgag (SEQ ID NO: 37), heavy chain (hereinafter “VH”) and light chain (hereinafter “VL”) genes Amplified by PCR.

  The amplified PCR product of VH gene and VL gene was ligated to plasmid PCR2.1-TOPO (Invitrogen), and the gene was introduced into E. coli (TOP10F '). Next, the plasmid was purified from E. coli, and the base sequences of the VH gene and VL gene were determined. The base sequence was determined by PCR using the BigDye Terminator V3.1 cycle sequencing kit (ABI) and analyzed with the ABI 310 DNA sequencer.

  In this way, antibody No. As the antibody gene of 2, VH gene (base sequence: SEQ ID NO: 7 and its corresponding amino acid sequence: SEQ ID NO: 8), CDRH1 gene (base sequence: SEQ ID NO: 1 and its corresponding amino acid sequence: SEQ ID NO: 2), CDRH2 gene (base) Sequence: SEQ ID NO: 3 and its corresponding amino acid sequence: SEQ ID NO: 4) and CDRH3 gene (base sequence: SEQ ID NO: 5 and its corresponding amino acid sequence: SEQ ID NO: 6), and VL gene (base sequence: SEQ ID NO: 15 and its corresponding amino acid) Sequence: SEQ ID NO: 16), CDRL1 gene (base sequence: SEQ ID NO: 9 and its corresponding amino acid sequence: SEQ ID NO: 10), CDRL2 gene (base sequence: SEQ ID NO: 11 and its corresponding amino acid sequence: SEQ ID NO: 12) and CDRL3 gene ( Nucleotide sequence: SEQ ID NO: 13 and its corresponding amino acid sequence: SEQ ID NO: 14)In addition, antibody No. As the antibody gene of No. 5, VH gene (base sequence: SEQ ID NO: 23 and its corresponding amino acid sequence: SEQ ID NO: 24), CDRH1 gene (base sequence: SEQ ID NO: 17 and its corresponding amino acid sequence: SEQ ID NO: 18), CDRH2 gene (base) Sequence: SEQ ID NO: 19 and corresponding amino acid sequence: SEQ ID NO: 20) and CDRH3 gene (base sequence: SEQ ID NO: 21 and corresponding amino acid sequence: SEQ ID NO: 22), and VL gene (base sequence: SEQ ID NO: 31 and corresponding amino acid) Sequence: SEQ ID NO: 32), CDRL1 gene (base sequence: SEQ ID NO: 25 and its corresponding amino acid sequence: SEQ ID NO: 26), CDRL2 gene (base sequence: SEQ ID NO: 27 and its corresponding amino acid sequence: SEQ ID NO: 28) and CDRL3 gene ( Base sequence: SEQ ID NO: 29 and its corresponding amino acid sequence: SEQ ID NO: 30) were determined.

[Antibody No. 2 and No. Experiment of reaction to FRα and FRβ by flow cytometer (FACS) 5]
Antibody No. 1 adjusted to a final concentration of 1 μg / ml was applied to FRα-expressing KB cells and FRβ-expressing B300-19 cells adjusted to 1 × 10 ⁵ . 2. Antibody No. 5. A negative control antibody (isotype control Rat IgG2a, Southern Biotech) was reacted. The reaction was further carried out with an anti-rat antibody labeled with APC. The dyeability after completion of the reaction was measured with a flow cytometer. As shown in FIG. 5 reacts with both FRβ-expressing B300-19 cells and FRα-expressing KB cells (FIG. 1 (A)), whereas antibody No. 5 responds. 2 reacted only with FRβ-expressing B300-19 cells (FIG. 1 (B)).

Example 2 Measurement of Soluble FRβ in Human Rheumatoid Arthritis Serum [F (ab ′) ₂ Fragmentation No. Production of 5 antibodies]
Rheumatoid factor present in the blood of patients with rheumatoid arthritis has the property of binding to the Fc region of the antibody, and therefore, antibody No. 2 which captures soluble FRβ on the plate by sandwich ELISA. Five F (ab ′) ₂ fragments were performed. First, 1 L of the obtained hybridoma culture solution was reacted with 2 ml of goat anti-rat IgG-agarose affinity chromatography (Rockland Inc., Gilbertsville, PA, USA) overnight using a glycine buffer (0.1 M). glycine, 0.15 M NaCl, pH 2.4) 5 was eluted to obtain 0.5 mg of antibody. This operation was performed 10 times to obtain a total of 5 mg of antibody.

Purified antibody No. 5 was adjusted to a final concentration of 5 mg / ml using an acetate buffer (0.07 M Acidic acid, 0.05 M NaCl, 0.1% NaN ₃ ), and then 15 mg of pepsin-agarose (Sigma-Aldrich, St. Louis). , MO, USA) (0.6 mg as pepsin) was added and reacted at 37 ° C. for 18 hours. Five F (ab ′) ₂ fragments were performed. After completion of the reaction, F (ab ′) ₂ was purified by gel filtration chromatography TSK-SW3000 (Tosoh) (hereinafter, F (ab ′) ₂ fragmented No. 5 antibody is referred to as “capture antibody”).

[Preparation of biotinylated anti-FRβ antibody]
No. 2 L of the culture solution obtained from 2 hybridomas was reacted overnight with 2 ml of goat anti-rat IgG-agarose affinity chromatography (Rockland Inc., Gilbertsville, PA, USA) using a peristaltic pump. 1M glycine, 0.15M NaCl, pH 2.4) 2 was eluted to obtain 0.3 mg of antibody. This operation was performed 5 times, and a total of 1.5 mg of antibody No. 2 was obtained.

  Purified antibody No. 2 was adjusted to a final concentration of 5 mg / ml using phosphate buffered saline (PBS), 1 mg of Sulfo-NHS-LC-Biotin (Thermo Scientific) was added, and the mixture was reacted at 4 ° C. for 18 hours. The released biotin was removed with a desalting column (PD-10, GE) (hereinafter, the biotinylated No. 2 antibody is referred to as “detection antibody”).

[Reactivity of detection antibody to cells expressing FRβ]
The reactivity of the detection antibody to the FRβ-expressing cells was measured with a flow cytometer in the presence of the capture antibody. That is, biotinylated No. 1 was added to FRβ-expressing B300-19 cells adjusted to 1 × 10 ⁵ . 2 antibody plus F (ab ′) ₂ fragmentation no. Five antibodies were reacted. After the reaction, APC-labeled streptavidin (BioLegend) was added, and a biotin-streptavidin reaction was performed. The dyeability after completion of the reaction was measured with a flow cytometer. From FIG. 1C, the detection antibody showed the same result as FIG. 1B even in the presence of the capture antibody. From this, antibody No. 2 and antibody no. It was suggested that the epitope regions of FRβ recognized by 5 are different.

[Preparation of soluble FRβ protein]
CDNA obtained from rheumatoid arthritis synovial macrophages (Nagayoshi R, et al., Arthritis Rheum. 2005 Sep; 52 (9): 2666-75) has the following primer: 5′-agaaagacatggtctggaaatggatg-3 ′ (upstream) (SEQ ID NO: 38 ), 5′-tcaattcacatgcatggctgcagcatagaacc-3 ′ (downstream) (SEQ ID NO: 39) (including amino acid residue 1-230 of FRβ), and incorporated into pCR2.1-TOPO vector (Life Technologies). The KpnI / XhoI-digested insert was further incorporated into pBacPAK9 baculovirus transfer vector (Clontech Laboratories, Inc. Mountain View, CA, USA). 5 μl of pBacPAK9-FRβ (100 ng / μl) dissolved in Tris-EDTA solution, 5 μl of BacPAK6 viral DNA (Clontech) and 86 μl of sterilized water were added, and 4 μl of Bacfectin (Clontech) was added and allowed to stand for 15 minutes. Sf21 cells (about 1 × 10 ⁶ cells) previously cultured in 1.5 ml of BacPAK Complete Medium on the dish were replaced with 2 ml of BacPAK Grace's Basic Medium (clontech) and added to the dish at 27 ° C. for 5 minutes. Incubate for hours. Thereafter, 1.5 ml of BacPAK Complete Medium was added, and the medium was collected after culturing at 27 ° C. for 5 days. For subculture of sf21 cells, a cell vial frozen from liquid nitrogen was taken out, and cultured in a 25 ml flask in 5 ml of BacPAK Complete Medium at 27 ° C. until 80 to 90% confluency (about 4 days). . The recombinant virus was isolated as follows. Remove the 35 mm dish medium in which 1 × 10 ⁶ sf21 cells were monolayer cultured, add 1 ml of virus dilution (diluted 10, 10 ² , 10 ³ times in BacPAK Complete Medium) and incubate at room temperature for 1 hour Then, an equal amount of BacPack Complete Medium was mixed with distilled water containing 2% SeaPlaque agarose cooled to 37 ° C., and 1.5 ml thereof was overlaid on the monolayer cells from which the virus inoculum was removed. After overlaying, 1.5 ml of BacPAK Complete Medium was further added and cultured at 27 ° C. for 7 days. After completion of the culture, 1 ml of PBS containing 0.03% neutral red was added and cultured at 27 ° C. for 3 hours. After completion of the culture, the neutral red solution was removed, the dish was inverted, and left overnight in the dark at room temperature. Next, plaques were collected using a Pasteur pipette and transferred to a mini sentry tube containing 0.5 ml of BacPAK Complete Medium. A total of 10 plaques were collected, and each tube was suspended by vortexing and left overnight in the dark at room temperature. The next day, the plaque pick was infected with a dish to which 5 × 10 ⁵ sf21 cells were attached, and cultured at 27 ° C. for 4 days. This culture was used as a passage virus stock once. 100 μl of single passage virus stock was infected into each dish of sf21 cells and plaque formation was performed as described above. The calculation of the virus titer was calculated by multiplying the number of plaques in each dish by 10 dilutions. The titer of the single passage virus stock was 3 × 10 ⁷ Plaque Forming Unit / ml.

Using this single passage virus stock, recombinant FRβ protein was produced. M.M. O. I. (Multiplicity of Infection) 1.1 ml of virus stock with a titer of 10 was infected with sf21 cells adjusted to 4 × 10 ⁶ in a 75 cm ² culture dish, 10 ml of BacPaK Complete Medium was added, and cultured at 27 ° C. for 2 days. Thus, FRβ protein was produced in the culture supernatant. 100 ml of the culture supernatant was added to NHS-activated Sepharose (GE) with antibody No. 5 was immobilized on an anti-FRβ antibody affinity column, and 1 mg of recombinant FRβ protein was obtained. The purity of the purified protein was 90% or more as confirmed by 7.5-15% SDS-PAGE.

[Measurement of soluble FRβ]
(1) Immobilization and blocking of capture antibody: The capture antibody was adjusted to a concentration of 10 μg / ml with a phosphate buffer, pH 7.4 (PBS), and the ELISA was performed on a 96-well microplate (Maxisorp, Thermo). 100 μl was added to each well and incubated overnight at room temperature to immobilize the capture antibody in the well. Each well was then washed 4 times with PBS containing 0.05% Tween20. After washing, PBS containing 10% fetal bovine serum (FBS) was added and reacted at room temperature for 30 minutes to block each well. After blocking, each well was washed 4 times with PBS containing 0.05% Tween20.

(2) Reaction of sample (standard soluble FRβ protein, rheumatoid arthritis patient serum): Standard soluble FRβ protein was adjusted with PBS containing 10% FBS so as to have a concentration of 900, 300, 100, 33, 11 μg / ml. The serum samples of rheumatoid arthritis patients were prepared by diluting twice with the same solution. After the adjustment, 100 μl of each sample was added to each well and reacted at room temperature for 3 hours. After completion of the reaction, each well was washed 4 times with PBS containing 0.05% Tween20.

(3) Addition and color development of detection antibody: After adjusting the detection antibody with PBS containing 10% FBS so as to have a concentration of 1 μg / ml, 100 μl was added to each well and reacted at room temperature for 2 hours. After completion of the reaction, each well was washed 4 times with PBS containing 0.05% Tween20. After washing, 100 μl of a streptavidin peroxidase solution (Invitrogen, Frederich, MD) diluted 1000 times with PBS was added to each well and allowed to react at room temperature for 1 hour. After completion of the reaction, each well was washed 4 times with PBS containing 0.05% Tween 20, and further washed once with PBS. After washing, 100 μl of ABTS solution (Sigma, St. Louis, MO) was added for color development. The color of each well was measured by measuring the absorbance at 405 nm with an iMark microplate reader (BIO-RAD, Tokyo, Japan). The color development time was in the range where the absorbance of the standard FRβ protein 900 μg / ml solution was 2.0 to 3.0. For soluble FRβ values, the absorbance of standard protein was blotted on a semilogarithmic graph, and the soluble FRβ value of serum was estimated from this curve (FIG. 2).

[Measurement of soluble FRβ in serum of rheumatoid arthritis patients in anti-TNFα biologics treatment]
Rheumatoid arthritis patients (10 patients) were measured for soluble FRβ values of serum collected at the start of administration of anti-TNFα biologics (infliximab, etanercept) and 3 months after administration. The maximum value of the soluble FRβ concentration at the start of administration of the anti-TNFα biological preparation was 22 ng / ml, the minimum value was 16 ng / ml, and the average value was 18.9 ng / ml.

  First, the prediction of the therapeutic effect of anti-TNFα biologics at the soluble FRβ concentration in the blood was examined. First, 4 patients who showed a higher value than the average value were grouped as a high value group, and the remaining 6 people were grouped as a low value group, and then at the start of administration of anti-TNFα biologic and 3 months after administration The clinical symptom score of arthritis (DAS28-CRP) was compared with the reactivity of anti-TNFα biologic (FIG. 3). FIG. 3 shows that all four patients in the high value group with high levels of soluble FRβ responded to the anti-TNFα biologic and three of the six patients in the low value group were anti-TNFα biological. Responded to the formulation.

  Next, for the purpose of evaluating the therapeutic effect of the anti-TNFα biological preparation, the soluble FRβ concentration in blood at the start of administration of the anti-TNFα biological preparation and 3 months after the administration is determined based on the response of the anti-TNFα biological preparation. Comparison was made between patients and unresponsive patients (FIG. 4). In FIG. 4, three patients overlapped with an FRβ concentration of 21 ng / ml at 3 months after administration (indicated as “3 cases”), and two patients overlapped with an FRβ concentration of 14 ng / ml (“2 Example ”). Moreover, in FIG. 4, two responding patients overlapped with an FRβ concentration of 18 ng / ml at the start of administration and an FRβ concentration of 14 ng / ml after 3 months of administration, and two unresponsive patients It overlaps with an FRβ concentration of 18 ng / ml and an FRβ concentration of 21 ng / ml 3 months after administration. From FIG. 4, 6 out of 7 patients to whom the anti-TNFα biologics responded, the soluble FRβ concentration decreased 3 months after administration. On the other hand, soluble FRβ concentrations increased in unresponsive patients.

  From the above results, it was shown that measurement of soluble FRβ concentration in blood is useful in predicting and evaluating the therapeutic effect of anti-TNFα biologics.

Claims (3)

  A method for diagnosing rheumatoid arthritis, comprising measuring the blood concentration of soluble FRβ in collected blood.   A method for predicting the therapeutic effect of antitumor necrosis factor α (anti-TNFα) biologic on rheumatoid arthritis, comprising measuring the blood concentration of soluble FRβ in collected blood.   A method for evaluating the therapeutic effect of antitumor necrosis factor α (anti-TNFα) biologic on rheumatoid arthritis, comprising measuring the blood concentration of soluble FRβ in collected blood.

Images