JP2016147837A - External preparation for skin characterized by containing cytoglobin - Google Patents

Abstract

PROBLEM TO BE SOLVED: To provide a novel external preparation for skin that is excellent in whitening effect, anti-wrinkle effect, and melanoma therapeutic effect.SOLUTION: Disclosed herein are external preparations for skin characterized by containing cytoglobin. Cytoglobin has an excellent melanin generation inhibitory effect, hyaluronic-acid synthesis accelerating effect, and melanoma growth inhibitory effect, and also is excellent in safety. Cytoglobin can be utilized not only in cosmetic fields, such as skin anti-aging and whitening, but in medical fields, such as the prevention and therapy of cancer, and is expected to be applied to cosmetics, quasi drugs, pharmaceuticals, and the like.SELECTED DRAWING: None

Description

  The present invention relates to a novel skin external preparation excellent in whitening effect, anti-wrinkle effect and melanoma treatment effect.

  In general, skin pigmentation seen in spots, buckwheat, sunburn, etc. is caused by hormonal abnormalities and stimulation of ultraviolet rays, and melanin pigment-producing cells (melanocytes) in the skin produce excessive amounts of melanin. It is thought to be caused by deposition. As one method for preventing such pigmentation, a method for suppressing excessive production of melanin is known. Conventionally, arbutin, hydroquinone, ellagic acid, kojic acid and derivatives thereof have been used for the treatment of pigmentation that suppresses excessive production of melanin.

  However, various problems remain in the external preparation for skin containing these components, and there is a problem in terms of practicality. For example, hydroquinone has safety problems such as rash and rash.

  Therefore, there has been a demand for a component that exhibits a further excellent whitening effect and has high safety against the skin.

  Hyaluronic acid is known as a high-molecular polysaccharide that is widely distributed in connective tissues, has a gel-like form in the dermis, and maintains the elasticity of the skin. Therefore, it is considered that alteration or reduction of hyaluronic acid is important as a cause of skin aging. Further, since hyaluronic acid is a polymer, there is a problem that it is difficult to absorb even if a cosmetic containing it is directly applied to the skin. Thus, an external preparation for skin that can promote the synthesis of hyaluronic acid by activating fibroblasts has been sought (Patent Document 1). Conventionally, retinoic acid (vitamin A) has been known to promote hyaluronic acid synthesis, but has strong side effects such as strong skin irritation and skin thickening, so it is effective in general pharmaceuticals, quasi drugs and cosmetics. It is difficult to use as a component. For these reasons, it has been desired to develop an active ingredient that is highly safe and has an effect of promoting hyaluronic acid synthesis.

  Melanoma (malignant melanoma) is a malignant tumor that results from cancerous melanocytes. It is known as a highly malignant tumor because it tends to cause metastasis from an early stage and is resistant to chemotherapy and radiation therapy (Non-patent Documents 1 and 2). Therefore, the development of new therapies is awaited.

  Cytoglobin is a protein containing heme consisting of iron and IX type protoporphyrin, also called STAP (slate cell-activation associated protein), and there are four globins (hemoglobin, myoglobin, neuroglobin, Cytoglobin). In addition, it is a heme protein having high homology with myoglobin and is known to bind to oxygen and carbon monoxide (Non-patent Document 3). Cytoglobin is also expressed in visceral fibroblasts including the liver, and it has become clear that expression is enhanced with organ fibrosis and that cells are protected from oxidative stress when overexpressed. (Patent Documents 2 and 3).

  As known documents of cytoglobin, screening tools (Patent Documents 2 and 3) useful for treatment, diagnosis, drug discovery, etc. of cancer are known, but these lack the function of the cytoglobin gene. Model animal, not using cytoglobin protein.

  The function of cytoglobin in the skin is unknown, and the effects of cytoglobin on melanogenesis suppression in melanocytes, hyaluronic acid synthesis promotion in fibroblasts, and growth suppression in melanoma have not been studied.

Japanese Patent Laid-Open No. 2007-1924 JP 2010-051277 A JP 2011-185789 A

“Area of Chemotherapy”, 2003, S-1, Vol. 19, p. 224-231. “Oncogene”, 2003, Vol. 22, p. 3138-3151. Sawai H, Kawada N, Yoshizato K, Nakajima H, Aono S, Shiro Y. Characteristic of the helm environmental structure of cytoglobin, a fourth globe in humans. Biochemistry. 2003. 42.5133-5142.

  This invention makes it a subject to provide the novel skin external preparation which was excellent in safety | security, and was excellent in the whitening effect, the anti-wrinkle effect, and the melanoma treatment effect.

  As a result of intensive studies to solve this problem, the present inventors have found that cytoglobin has an excellent melanin production inhibitory effect, hyaluronic acid synthesis promoting effect and melanoma growth inhibitory effect, and is also excellent in safety. I found it. Furthermore, the present inventors have found that a topical skin preparation containing cytoglobin is safe and has excellent whitening effect, anti-wrinkle effect and melanoma treatment effect, and has completed the present invention.

  That is, this invention consists of the following (1)-(4).

(1) A skin external preparation characterized by containing cytoglobin.
(2) A whitening skin external preparation characterized by containing cytoglobin.
(3) An anti-aging skin external preparation characterized by containing cytoglobin.
(4) A skin external preparation for treating melanoma, characterized by containing cytoglobin.

  The cytoglobin of the present invention has excellent melanin production inhibitory effect, hyaluronic acid synthesis promoting effect and melanoma growth inhibitory effect, and can contribute to the fields of pharmaceuticals, quasi drugs and cosmetics.

  The present invention will be described in detail below.

  The cytoglobin in the present invention is a protein containing heme and is one of four globins (hemoglobin, myoglobin, neuroglobin, and cytoglobin) present in mammals. Cytoglobin can be extracted from these cells because it is present in the cells of many tissues such as the liver, kidney, and lung. Commercial products are also available.

  The skin external preparation for whitening in the present invention is used for the purpose of making spots and freckles inconspicuous. Similarly, the anti-aging skin external preparation is used for the purpose of making wrinkles and sagging inconspicuous, and the melanoma therapeutic skin external preparation is used for the purpose of treating melanoma.

  In the external preparation for skin of the present invention, cytoglobin may be used as it is, and fats and oils, waxes, hydrocarbons which are components used in cosmetics, quasi-drugs, pharmaceuticals, etc., as long as the effects are not impaired , Fatty acids, alcohols, esters, surfactants, metal soaps, pH adjusters, preservatives, fragrances, moisturizers, powders, UV absorbers, thickeners, pigments, antioxidants, whitening agents, Components such as chelating agents, excipients, and film agents can also be contained.

  Examples of the dosage form of the present invention include lotions, creams, massage creams, emulsions, gels, aerosols, packs, cleaning agents, bath preparations, foundations, powders, lipsticks, ointments, poultices, pastes, plasters. , Essence and the like.

  The content of cytoglobin used in the present invention is not particularly limited, but is preferably in the range of 0.00001 to 10% by weight, more preferably 0.0001 to 1% by weight. In addition, the addition method may be added in advance or during the production, and may be appropriately selected in consideration of workability.

  Next, in order to describe the present invention in detail, examples of cytoglobin formulation and experimental examples used in the present invention will be given as examples, but the present invention is not limited thereto. % Of content shown in an Example shows weight%.

Experimental Example 1 Melanin Production Inhibitory Effect In melanin production, tyrosinase (TYR), tyrosinase-related protein 1 (TRP1) and tyrosinase-related protein 2 (TRP2) are involved as major enzymes, and microphthalmia is involved in controlling the expression of these enzymes. Related transcription factors (MITF) play an important role. Cytoglobin (Funakoshi Co., Ltd., RPR-842) 0.1, 1 and 10 μg / mL was added to 1.25 × 10 ⁶ normal human melanocytes NHEM, and total RNA was extracted after culturing for 48 hours. Extraction of total RNA from the cells was performed using RNAiso plus (TAKARA), and the total RNA amount was determined by absorbance at 260 nm using a spectrophotometer (NanoDrop). Measurement of mRNA expression level was performed by real-time RT-PCR method based on total RNA extracted from cells. For the real-time RT-PCR method, PrimeScript RT MasterMix (TAKARA) and SYBR Select MasterMix (Life Technologies) were used. That is, 500 ng of total RNA was subjected to a reverse transcription reaction, followed by a PCR reaction (95 ° C .: 15 seconds, 60 ° C .: 60 seconds, 40 cycles). For other operations, the expression levels of TYR, TRP1, TRP2, and MITF were determined as a ratio to the expression level of β-actin mRNA, which is an internal standard, in accordance with a predetermined method. The expression rate of TYR, TRP1, TRP2, and MITF was calculated as the ratio of the expression level of TYR, TRP1, TRP2, and MITF mRNA in the cytoglobin added group to the expression level of TYR, TRP1, TRP2, and MITF mRNA in the control. The primers used for measuring the expression level of each gene are as follows.

Primer set TGCGGTGGGAACAAGAAATC for TYR (SEQ ID NO: 1)
GAAGAATGATGCTGGGCTGAGT (SEQ ID NO: 2)
Primer set CGAAACACAGTGGAAGGTTACAGT for TRP1 (SEQ ID NO: 3)
CTCCTCAGCCCTTCATCAAAAGACT (SEQ ID NO: 4)
Primer set GGAATGCTTTGGAAGGGTTTG for TRP2 (SEQ ID NO: 5)
AAAGCGTTTGTCCCGTTCAG (SEQ ID NO: 6)
Primer set GAGGCAGTGGTTTGGGCTT for MITF (SEQ ID NO: 7)
AATTCTGCACCCGGGAATC (SEQ ID NO: 8)
Primer set CACTCTCCCAGCCCTTCTCTC for β-actin (SEQ ID NO: 9)
GTGTTGCGCGTACAGGTCTTTG (SEQ ID NO: 10)

  The experimental results are shown in Table 1. As a result, the cytoglobin of the present invention suppressed the expression of TYR, TRP1, TRP2, and MITF in a concentration-dependent manner and showed an excellent melanin production inhibitory effect.

Experimental Example 2 Hyaluronic acid synthesis promoting effect 5 × 10 ⁴ human fibroblasts NB1RGB were seeded on a 35 mm dish, and when they became semi-confluent, 0.1, 1 and 10 μg / mL of cytoglobin were added and cultured for 48 hours. Thereafter, total RNA was extracted. Extraction of total RNA from the cells was performed using RNAiso plus (TAKARA), and the total RNA amount was determined by absorbance at 260 nm using a spectrophotometer (NanoDrop). Measurement of mRNA expression level was performed by real-time RT-PCR method based on total RNA extracted from cells. For the real-time RT-PCR method, PrimeScript RT MasterMix (TAKARA) and SYBR Select MasterMix (Life Technologies) were used. That is, 500 ng of total RNA was subjected to a reverse transcription reaction, followed by a PCR reaction (95 ° C .: 15 seconds, 60 ° C .: 60 seconds, 40 cycles). For other operations, the expression level of hyaluronic acid synthase (HAS2) was determined as a ratio to the expression level of β-actin mRNA, which is an internal standard, in accordance with a predetermined method. The expression rate of HAS2 was calculated as the ratio of the expression level of HAS2 mRNA in the cytoglobin added group to the expression level of HAS2 mRNA in the control. In addition, the primer for HAS2 is as follows.

Primer set TGGATGACCCTACGAAGCGATTA for HAS2 (SEQ ID NO: 11)
GCTGGATTACTGTGGCAATGAG (SEQ ID NO: 12)

  The experimental results are shown in Table 2. As a result, the cytoglobin of the present invention showed an excellent hyaluronic acid synthesis promoting effect.

Experimental example 3 Inhibitory effect on proliferation of melanoma cells Human malignant melanoma-derived G-361 cells were seeded on a 96-well plate at 5 × 10 ³ cells per well, and cytoglobin (final concentrations 0.1, 1 and 10 μg / mL) was added. The cells were cultured in a McCoy 5A culture solution containing 1% FBS for 6 days under conditions of 37 ° C. and 5% CO ₂ . The number of cells was measured by the MTT method. That is, after culturing, the culture solution was removed, and the medium was dissolved in McCoy5A in which MTT (3- [4,5-dimethylthiazol-2-yl] -2,5-diphenyltetrazolium bromide) was dissolved at a concentration of 500 μg / mL. After culturing for 2 hours, the cells were dissolved in 150 μL of isopropanol, and the absorbance at 570 and 630 nm was measured using a microplate reader. The number of cells is calculated by subtracting the absorbance value at 630 nm from the absorbance value at 570 nm. The number of cells not added with the sample is used as a control, and the cell proliferation promoting effect of the sample is evaluated from the number of cells when the sample is added to the control. did.

  The results of these experiments are shown in Table 3. As a result, cytoglobin showed an excellent cytostatic effect on human malignant melanoma-derived G-361 cells.

Formulation Example 1 Lotion Toner Formulation Content (%)
1. Cytoglobin 0.0001
2. 1,3-butylene glycol 8.0
3. Glycerin 2.0
4). Xanthan gum 0.02
5. Citric acid 0.01
6). Sodium citrate 0.1
7). Ethanol 5.0
8). Methyl paraoxybenzoate 0.1
9. Polyoxyethylene hydrogenated castor oil (40E.O.) 0.1
10. Perfume proper amount11. [Manufacturing method] Components 1 to 6 and 11 and components 7 to 10 are uniformly dissolved in purified water, and both are mixed and filtered to obtain a product.

Formulation Example 2 Emulsion Formulation Content (%)
1. Cytoglobin 0.001
2. Squalane 5.0
3. Olive oil 5.0
4). Jojoba oil 5.0
5. Cetanol 1.5
6). Glycerol monostearate 2.0
7). Polyoxyethylene cetyl ether (20E.O.) 3.0
8). Polyoxyethylene sorbitan monooleate (20E.O.) 2.0
9. Fragrance 0.1
10. Propylene glycol 1.0
11 Glycerin 2.0
12 Methyl paraoxybenzoate 0.2
13. [Manufacturing method] Components 2 to 8 are heated and dissolved and mixed with purified water to a total amount of 100, and kept at 70 ° C to obtain an oil phase. Ingredients 10 to 13 are dissolved by heating and mixed, and kept at 75 ° C. to form an aqueous phase. The aqueous phase is added to the oil phase to emulsify, and the mixture is cooled while stirring. Then, component 9 is added at 45 ° C., and further cooled to 30 ° C., then component 1 is added to obtain a product.

Formulation Example 3 Cream Formulation Content (%)
1. Cytoglobin 0.1
2. Squalane 5.5
3. Olive oil 3.0
4). Stearic acid 2.0
5. Beeswax 2.0
6). Octyldodecyl myristate 3.5
7). Polyoxyethylene cetyl ether (20E.O.) 3.0
8). Behenyl alcohol 1.5
9. Glycerol monostearate2.5
10. Fragrance 0.1
11 Methyl paraoxybenzoate 0.25
12.1,3-Butylene glycol 8.5
13. [Manufacturing method] Components 2 to 9 are heated and dissolved and mixed with purified water to a total amount of 100, and kept at 70 ° C to obtain an oil phase. Ingredients 11-13 are dissolved by heating and mixed, and kept at 75 ° C. to form an aqueous phase. The aqueous phase is added to the oil phase to emulsify, and the mixture is cooled while stirring. Component 10 is added at 45 ° C., and further cooled to 30 ° C., then component 1 is added to obtain a product.

Comparative Example 1 Conventional Cream A formulation containing no cytoglobin in Formulation Example 3 was used as a conventional cream.

Formulation Example 4 Pack Formulation Content (%)
1. Cytoglobin 0.001
2. Polyvinyl alcohol 12.0
3. Ethanol 5.0
4.1,3-Butylene glycol 8.0
5. Methyl paraoxybenzoate 0.2
6). Polyoxyethylene hydrogenated castor oil (20 EO) 0.5
7). Citric acid 0.1
8). Sodium citrate 0.3
9. Perfume appropriate amount10. [Production method] Components 1 to 10 are uniformly dissolved in purified water to give a product of 100.

Formulation Example 5 Foundation Formulation Content (%)
1. Cytoglobin 0.0001
2. Stearic acid 2.4
3. Polyoxyethylene sorbitan monostearate (20EO) 1.0
4). Polyoxyethylene cetyl ether (20E.O.) 2.0
5. Cetanol 1.0
6). Liquid lanolin 2.0
7). Liquid paraffin 3.0
8). Isopropyl myristate 6.5
9. Sodium carboxymethylcellulose 0.1
10. Bentonite 0.5
11 Propylene glycol 4.0
12 Triethanolamine 1.1
13. Methyl paraoxybenzoate 0.2
14 Titanium dioxide 8.0
15. Talc 4.0
16. Bengala 1.0
17. Yellow iron oxide 2.0
18. Perfume proper amount19. [Manufacturing method] Components 2 to 8 are heated and dissolved in purified water to a total amount of 100, and kept at 80 ° C to obtain an oil phase. Ingredient 19 is thoroughly swollen with ingredient 9, and then ingredients 10 to 13 are added and mixed uniformly. To this, components 14 to 17 pulverized and mixed with a pulverizer are added, and the mixture is stirred with a homomixer and kept at 75 ° C. to obtain an aqueous phase. The aqueous phase is added to this oil phase while stirring and emulsified. Thereafter, the mixture is cooled while stirring, and component 18 is added at 45 ° C. After cooling to 30 ° C, component 1 is added to obtain a product.

Formulation Example 6 Bath Agent Formulation Content (%)
1. Cytoglobin 0.0001
2. Sodium bicarbonate 50.0
3. Yellow No. 202 (1) Appropriate amount 4. Perfume appropriate amount 5. [Manufacturing method] Ingredients 1 to 5 are mixed uniformly with sodium sulfate to make a product.

Formulation Example 7 Gel formulation Formulation Content (%)
1. Cytoglobin 0.001
2. Ethanol 5.0
3. Methyl paraoxybenzoate 0.1
4). Polyoxyethylene hydrogenated castor oil (60 EO) 0.1
5. Perfume appropriate amount 6.1,3-butylene glycol 5.0
7). Glycerin 5.0
8). Xanthan gum 0.1
9. Carboxyvinyl polymer 0.2
10. Potassium hydroxide 0.2
11 [Production method] Ingredients 2 to 5 and ingredients 1 and 6 to 11 are uniformly dissolved in purified water, and the two are mixed to obtain a product.

Formulation Example 8 Ointment Formulation Content (%)
1. Cytoglobin 1.0
2. Polyoxyethylene cetyl ether (30E.O.) 2.0
3. Glycerol monostearate 10.0
4). Liquid paraffin 5.0
5. Cetanol 6.0
6). Methyl paraoxybenzoate 0.1
7). Propylene glycol 10.0
8). [Manufacturing method] Components 2-5 are heated and dissolved and mixed with purified water to 100, and kept at 70 ° C. to obtain an oil phase. Ingredients 6 to 8 are dissolved by heating and mixed, and kept at 75 ° C. to form an aqueous phase. The aqueous phase is added to the oil phase to emulsify, and the mixture is cooled to 30 ° C. while stirring, and then component 1 is added to obtain a product.

Experimental Example 4 Use Test Using the cream of Formulation Example 3 and the conventional cream of Comparative Example 1, a use test for 3 months was conducted for 30 women (20 to 45 years old). After use, a questionnaire survey on the improvement of spots, buckwheat and wrinkles was conducted to determine the effect of improving skin properties. The evaluation criteria of the questionnaire were evaluated as “excellent” for valid, “good” for slightly effective, “good” for slightly effective, and “impossible” for invalid.

  These results are shown in Table 4. The cream containing cytoglobin of Formulation Example 3 showed excellent whitening effect and wrinkle improving effect. During the test period, there was no skin problem and there was no problem with safety.

  Tests were conducted on the lotion of Formulation Example 1, the emulsion of Formulation Example 2, the pack of Formulation Example 4, the foundation of Formulation Example 5, the bath preparation of Formulation Example 6, the gel preparation of Formulation Example 7, and the ointment of Formulation Example 8. However, all showed a safe and excellent whitening effect and wrinkle improving effect.

  From the above, the cytoglobin of the present invention has excellent melanin production inhibitory effect, hyaluronic acid synthesis promoting effect and melanoma growth inhibitory effect, and is also excellent in safety. Therefore, the skin external preparation containing the cytoglobin of the present invention is particularly effective for whitening, anti-wrinkle and melanoma treatment.

Claims (4)

An external preparation for skin characterized by containing cytoglobin. An external preparation for skin whitening characterized by containing cytoglobin. An anti-aging skin external preparation characterized by containing cytoglobin. A skin external preparation for treating melanoma, characterized by containing cytoglobin.