JP2015227806A - High sensitivity detection method of target molecule using magnetic material gel bead, and detection kit - Google Patents

Abstract

PROBLEM TO BE SOLVED: To provide a detection method capable of detecting a target molecule in a short time with high detection sensitivity, and a detection kit used for detecting the target molecule.SOLUTION: A high sensitivity detection method for a target molecule includes: a binding step of binding a magnetic material gel bead in which a peptide aptamer is fixed in a buffer, with a target molecule specifically bound with the peptide aptamer; an aggregation step of aggregating in the buffer the magnetic material gel bead bound with the target molecule; and a detection step of detecting the target molecule bound with the aggregated gel bead. A detection kit used in the detection method is also provided.

Description

  The present invention relates to a highly sensitive detection method and a detection kit for a target molecule using magnetic gel beads. In particular, the present invention relates to the detection method and detection kit using temperature-sensitive magnetic gel beads.

  In order to appropriately diagnose various diseases and perform effective treatment, detection of proteins and other biomolecules serving as disease markers is very important. Regarding detection of such biomolecules, conventionally, a molecule that can specifically bind to a biomolecule to be detected (hereinafter referred to as “target molecule”) is used and based on the interaction between these two molecules. Detection methods have been widely used.

  Conventional protein detection methods using an antigen as a target molecule and an antibody that specifically binds to such an antigen are simple detection methods and high-sensitivity detection methods used in research and clinical tests. As a simple detection method, an immunoturbidimetric method (hereinafter referred to as “Prior Art 1”), an immunochromatography method (hereinafter referred to as “Prior Art 2”), and the like are roughly classified. Can be mentioned. As a highly sensitive detection method, ELISA method (hereinafter referred to as “Prior Art 3”), indirect fluorescent antibody method (hereinafter referred to as “Prior Art 4”), latex agglutination method (hereinafter referred to as “Prior Art 5”). And the like.

  Among conventional protein detection methods, the immunoturbidimetric method, which is classified as a simple detection method, forms an immune complex (precipitate) by reacting an antibody with an antigen, and irradiates this aggregate with light. In this method, the amount of antigen contained in the specimen is measured by measuring the absorbance with an automatic analyzer. The immunochromatography method is one of rapid test methods using an antigen-antibody reaction, and is mainly used for detecting pathogens such as bacteria and viruses. Recently, utilizing the capillary phenomenon of the cellulose membrane, the labeled antibody supported on this membrane reacts with the antigen in the sample, and the immune complex formed here is trapped in the capture antibody and colored, A product that is visually judged is also commercially available.

  The ELISA method classified as a highly sensitive detection method is a method using an antigen-antibody reaction, in which a primary antibody or a secondary antibody is labeled with an enzyme such as alkaline phosphatase, and the amount of the enzyme reaction product is colored. Examining provides the amount of antigen. That is, a sample specimen and an enzyme-labeled antigen are added to a container in which an antibody is immobilized, and an antigen / antibody reaction is caused. In this method, after removing a sample specimen by washing, an enzyme substrate is added to develop color, and the absorbance is measured to measure the amount of antigen in the specimen.

Similarly, the indirect fluorescent antibody method is a technique in which an unlabeled primary antibody is first bound to a target molecule, and then a fluorescently labeled secondary antibody that reacts with the primary antibody is allowed to act to detect fluorescence. The latex agglutination method is a method of detecting an antigen (antibody) by immobilizing an antibody (antigen) on latex particles, aggregating latex particles in the presence of the antigen (antibody), and observing the aggregation.
The latex agglutination method is a technique in which antibodies are immobilized on latex particles and latex particles are aggregated in the presence of an antigen. Aggregation does not occur in the absence of the antigen, so the presence of the antigen can be confirmed by observing the presence or absence of aggregation.

  In such a detection method, detection is usually performed by immobilizing an antibody on a magnetic bead and reacting with a sample containing an antigen. Since magnetic beads can be easily and quickly separated from a solution by a magnet and are easy to handle, they are widely used in the field of life science, and magnetic beads coated with various polymers are commercially available.

  By the way, biological samples contain various proteins in addition to the target molecule, and the concentration of the target molecule is often low. I have been. If more antibodies can be immobilized, the detection sensitivity can be increased, and therefore a carrier having a larger surface area is used. On the other hand, when the particle size of the magnetic beads becomes several hundred nm or less, the magnetic force of the magnetic beads decreases, and it is strongly influenced by Brownian motion due to water molecules in water. Separation becomes difficult. For this reason, in magnetic diagnosis, magnetic beads having a particle size of several μm are frequently used as magnetic beads that can be separated by a magnet.

  Improvements have been made in this regard, and magnetic particles with poly-N-isopropylacrylamide immobilized on the surface of magnetic nanoparticles have been developed. Poly-N-isopropylacrylamide is a kind of thermoresponsive polymer and exhibits a lower critical solution temperature (LCST) in an aqueous solution. These magnetic nanoparticles have a property of aggregating when the water temperature is raised and redispersing when the water temperature is lowered (see FIG. 2). A sandwich ELISA method using the magnetic nanoparticles has been proposed (see Non-Patent Document 1, hereinafter referred to as “Prior Art 6”, see FIG. 4).

Analytical Chem. 2011, 83, 9197-9200

In the case of the simple detection method described above, the target substance can be detected with a detection sensitivity of several hundred μg / mL to several hundred mg / mL within a relatively short time of several hours. There is also a problem that there is a negative and the reliability is not so high.
In the case of the high-sensitivity detection method described above, the detection sensitivity is high from several hundred ng / mL to several hundred μg / mL compared to the simple detection method, but the absolute detection sensitivity is not high. . There is also a problem that the time required for detection is as long as several hours or longer and in some cases as long as 12 hours or longer (see FIG. 1).

Furthermore, in the conventional method as described above, an antibody is used. However, the antibody used here must be purified, and the purification of the antibody requires a lot of time and complexity. Operation is required. The following is a brief description. For example, when an antigen is administered to a mouse, the antigen is first administered to the mouse, blood is collected after a predetermined period of time, and B cells are removed from the mouse blood. Next, the myeloma cells cultured in advance and this B cell are fused in a predetermined manner in a test tube to prepare a hybridoma. The hybridoma is cultured, and a monoclonal antibody is produced in the culture supernatant. Then, the monoclonal antibody in the culture supernatant is purified.
In the case of the sandwich assay, an antibody that recognizes a plurality of epitopes is required, and there is a problem that it takes much time to obtain the antibody (see FIG. 3).

  Since the molecular weight of the antibody thus obtained is as large as about 150 KDa, purification takes time and it is difficult to chemically modify a part of the antibody so as not to affect other parts. . Therefore, in recent years, aptamers capable of specifically binding to target molecules have been used as detection molecules instead of antibodies. Aptamers have a molecular weight of about 10 KDa or less compared to antibodies and are single-stranded nucleic acids. Therefore, aptamers can be synthesized using a nucleic acid synthesizer or the like as necessary. However, when an automatically synthesized aptamer is used, there is a problem of lack of diversity.

  On the other hand, various infectious diseases such as the emergence of resistant bacteria and the increase of emerging infectious diseases are not decreasing, and there is a strong social demand for a rapid, simple and highly sensitive detection method (see FIG. 1). ).

Under such circumstances, the inventors of the present invention have completed the present invention through extensive research.
That is, the first aspect of the present invention includes a binding step of binding a magnetic gel bead having a peptide aptamer immobilized in a buffer and a target molecule that specifically binds to the peptide aptamer; A target molecule high-sensitivity detection method comprising: an aggregation step of aggregating magnetic substance gel beads in a buffer; and a detection step of detecting a target molecule bound to the aggregated gel beads.

  Here, the concentration of the target molecule is preferably 60 nM to 1.25 μM, and the magnetic gel beads are preferably temperature sensitive. Moreover, it is preferable that an immobilization molecule for immobilizing a peptide aptamer is immobilized on the magnetic gel beads, and the immobilization molecule is selected from the group consisting of streptavidin, an amino group, and a carboxyl group It is preferable that

  The peptide aptamer is preferably composed of 8 or more and 150 or less amino acids, more preferably 10 or more and 30 or less amino acids. The agglomeration is preferably performed at a temperature in the range of 18 to 28 ° C, more preferably in the range of 20 to 27 ° C. Furthermore, the aggregation is preferably performed in a salt concentration range of 100 to 500 mM, and more preferably in a range of 300 to 500 mM.

A second aspect of the present invention is a linker preparation agent for preparing a peptide aptamer that binds to a target molecule; a magnetic bead for purification for purifying the peptide aptamer; a biotinylation reagent; and an enzyme; A binding reagent for binding a peptide aptamer to a magnetic gel bead having an immobilizing molecule immobilized thereon; and a magnetic gel bead having an immobilizing molecule immobilized to immobilize the bound peptide aptamer. This is a highly sensitive detection kit for target molecules.
Here, the linker preparation agent comprises: one end to which a peptide-presenting molecule is bound; the other end to which mRNA having a sequence corresponding to the base sequence of the peptide aptamer is bound as a main chain; and the other end And a peptide chain having a solid phase binding molecule located in the vicinity of the part.

  The peptide-presenting molecule is preferably puromycin, the solid-phase binding molecule is preferably biotin, and the enzyme is preferably selected from the group consisting of RNase T1, Endonuclease V, and PvuII. The concentration of the target molecule is preferably 0.1 nM to 1 mM.

  According to the present invention, high-sensitivity detection is possible in which the detection sensitivity of a target molecule is as high as several tens of ng / mL to several tens of μg / mL, and the time required for detection is as short as about 10 minutes to 3 hours. In addition, a detection kit that enables such highly sensitive and rapid detection can be provided.

FIG. 1 is a conceptual diagram showing the difference between a conventional detection method and the detection method of the present invention. FIG. 2 is a schematic diagram showing a dispersion state and an aggregation state of magnetic nanoparticles (magnetic gel beads) coated with a thermoresponsive polymer. In the figure, LCST is an abbreviation that indicates the lower critical solution temperature. FIG. 3 shows an antigen-antibody complex formed by sandwiching an antigen (target molecule) between a β antibody bound to biotin and an α antibody bound to PAAc (polyacrylic acid). It is a figure which shows typically the sandwich assay which incubates with the said magnetic body gel bead which fixed the streptavidin. FIG. 4A is a diagram schematically showing a state in which the antigen-antibody complex is bound to the surface of the magnetic gel beads. FIG. 4B is a diagram schematically showing a state in which the target molecules are not present and the particles are aggregated. FIG. 5 is a diagram showing magnetic gel beads in a dispersed state in a tube when the LCST is lower than 22 ° C., and magnetic gel beads in an aggregated state at 22 ° C. or higher. Fig. 6 shows the state of the beads when the peptide aptamer is immobilized on the surface of the magnetic gel beads and IL-6R (target molecule) is not added (left photo), and the state of the beads when IL-6R is added (right) And a schematic diagram showing the state of the gel beads in each case. FIG. 7A is a diagram schematically showing a case where a peptide aptamer is bound to the surface of a magnetic gel bead and a case where an antibody is determined. FIG. 7B is an enlarged view schematically showing a case where a peptide aptamer is bound to the surface of a magnetic gel bead.

Hereinafter, the present invention will be described in more detail with reference to FIGS.
As shown in FIG. 7, the present invention comprises (a) a binding step of binding a magnetic gel bead having a peptide aptamer immobilized in a buffer and a target molecule that specifically binds to the peptide aptamer; (b) An aggregation step of aggregating the magnetic substance gel beads bound to the target molecule in a buffer; and (c) a detection step of detecting the target molecule bound to the aggregated gel beads. This is a sensitivity detection method.

(1) Peptide aptamer In the present specification, a “peptide aptamer” refers to a nucleic acid molecule that specifically binds to a specific substance and changes the function of a protein or cell. “Specific substances” to which peptide aptamers bind include growth factors, enzymes, receptors, viral proteins and other various proteins, various metal ions, and the like. Peptide aptamers can be synthesized with a nucleic acid synthesizer or the like, or can be prepared by a cDNA display method or the like. When the cDNA display method is used, a linker for preparing mRNA / cDNA-protein conjugate described later is used.

(2) Preparation of Linker for Peptide Aptamer Generation In this specification, “linker” refers to mRNA-linker conjugate, mRNA-linker-protein conjugate, mRNA / cDNA-linker-protein linkage used in the cDNA display method. (Hereinafter, this conjugate may be referred to as “IVV”) and a linker used for producing any one of conjugates selected from the group consisting of cDNA-linker-protein conjugates.

  The linker is (L1) a solid phase binding site (BB) having a molecule that forms a bond with a solid phase; (L2) is located so as to sandwich the solid phase binding site, and is cleaved with a DNA repair enzyme Two or more cleavage sites (C1 and C2) for cleaving from the solid phase containing the damaged DNA, and (L3) an mRNA ligation site that is located on the 5 ′ end side of the linker and can be recognized by RNA ligase ( (MB); (L4) a side chain binding site (SB) located near the 3 ′ end of the linker; (L5) located at the 3 ′ end of the linker, and reverse transcription is performed on the linker A primer region (PR) that functions as a primer for reverse transcription in some cases; and (L6) a side chain linked to the side chain linking site (SB).

The linker is mainly composed of DNA, but may contain DNA analogs such as deoxyinosine, biotin-modified deoxythymine, and fluorescein-modified deoxythymine, and is designed to have flexibility and hydrophilicity as a whole. It is preferable to do. “Solid phase synthesis” refers to a synthesis reaction performed by directly or indirectly immobilizing the linker of the present invention on the solid phase surface such as beads, the side wall of the reaction vessel, the bottom surface, or the like.
Further, in the present specification, “predetermined mRNA” includes mRNA having a sequence encoding a gene, a sequence necessary for ligation formation, translation reaction promotion, or other sequences.

  Examples of molecules that form a bond with the solid phase include biotin when avidin and streptavidin are bound to the solid phase, and maltose and G protein when maltose-bound protein is bound. Guanine nucleotides when bound, metal such as Ni or Co when bound with polyhistidine peptide, glutathione when bound with glutathione-S-transferase, sequence-specific DNA or RNA binding DNA or RNA having a specific sequence when proteins are bound, antigen or epitope peptide when antibodies or aptamers are bound, calmodulin-binding peptide when calmodulin is bound, ATP or estradiol if ATP binding protein is bound When a receptor protein is bound, estradiol and the like can be mentioned. Among these, it is preferable to use metals such as biotin, maltose, Ni or Co, glutathione, antigen molecules or epitope peptides, and biotin is often used from the viewpoint of ease of linker synthesis.

  The solid phase binding site (BB) is a site for binding a conjugate such as the mRNA-linker-protein conjugate described above to a solid phase via a linker, and the solid phase binding site (BB) is It is composed of at least 1 to 10 bases. For example, biotin-modified deoxythymidine (dT) may be used.

  In addition, the above-mentioned specific polypeptide or the like is introduced into a solid phase binding site by a method using tannic acid, formalin, glutaraldehyde, pyruvic aldehyde, bis-diazotized benzidone, toluene-2,4-diisocyanate, etc. In order to avoid denaturation of IVV, only the affinity between molecules is used. The cleavage sites (C1 and C2) in (L2) are located so as to sandwich the solid phase binding part (BB). Examples of DNA repair enzymes having an endonuclease action include Endo III, Endo IV, Endo V, Endo VIII, Fpg, hAAG, hNEIL 1, hOGG1, T4 PDG, APE1, Tma Endo III, Tth Endo IV, and the like. . The above cleavage sites include aprinic acid, apyrimidine acid, oxidized pyrimidine, oxidized purine, alkylated purine, deoxyinosine, deoxyuridine, 5-hydroxyuracil, 5-hydroxymethyluracil, 5-formyluracil, pyrimidine dimer, dihydro Damaged DNA cleaved by an endonuclease such as thymine, 6-methyladenine, 8-oxoguanine, deoxyuracil and the like may be contained.

  The mRNA linking site of (L3) is composed of at least 1 to 10 bases. The mRNA ligation region (MB) does not need to be phosphorylated in advance, but in order to be ligated to a predetermined mRNA, prior to or during the ligation reaction with the 3 ′ end of the mRNA, It needs to be phosphorylated by a kinase or the like.

  The side chain binding site (SB) located in the vicinity of the 3 'end of the linker of (L4) is a site to which side chains described later are linked. For example, when the side chain linking site (SB) of the linker is composed of Amino-Modifier C6 dT, the 5 ′ end of the side chain is defined as 5′-Thiol-Modifier C6 using EMCS. The main chain and the side chain can be linked by crosslinking.

The primer region (PR) of (L5) is located on the 3 ′ end side of the linker and functions as a primer for reverse transcription when reverse transcription is performed on the linker. Adjacent to the 3 'side of the site. Here, the primer region (PR) is a region that functions as a primer for reverse transcription when reverse transcription is performed on the linker. This region preferably consists of about 1 to 15 bases, particularly 3 to 5 bases. When the number of bases exceeds 15, the binding efficiency as a linker is deteriorated. Therefore, from the viewpoint of the binding efficiency with a linker and the reaction efficiency as a primer, the above base number is preferable.
Further, the side chain linked to the side chain linking site (SB) of (L6) is a protein linking site (P) for linking a protein synthesized from mRNA complementary to the main chain, and the side chain linking site. Between the spacer and the fluorescent group (F).

  Here, the protein linking site of the side chain includes puromycin, ribocytidylpuromycin (rCpPur), deoxydylpuromycin (dCpPur), deoxy, in which the 3 ′ end of the nucleotide sequence and an amino acid form an amide bond In addition to puromycin analogues such as uridylpuromycin (dUpPur), 3'-N-aminoacylpuromycin aminonucleoside (PANS-amino acid), 3'-N-aminoacyl adenosine aminonucleoside (AANS-amino acid), etc. Can do.

  Examples of PANS-amino acids include PANS-Gly, PANS-Val, and PANS-Ala. Examples of AANS-amino acids include AANS-Gly, AANS-Val, and AANS-Ala. In addition, those in which a nucleoside and an amino acid are ester-bonded can be used, but it is particularly preferable to use puromycin because of the high stability of protein ligation at the protein ligation site.

  As the spacer, Spacer 18 Phosphoramidite is preferably used because it has flexibility and low steric hindrance. In order to prevent the occurrence of steric hindrance when a puromycin analog is incorporated into a ribosome, the side chain preferably has a structure in which about 1 to 8 Phosphoramidite molecules are linked. From the viewpoint of balance with body formation efficiency, it is more preferable to have a structure in which about 4 such Phosphoramidite molecules are connected.

  Since the side chain has a fluorescent group between the protein linking site and the side chain linking site, the presence or absence of a linker can be easily detected in each step of the cDNA display method described later. . Examples of the fluorescent group include a free functional group such as a carboxyl group that can be converted into an active ester, a hydroxyl group that can be converted into a phosphoramidide, or an amino group, and can be linked to a linker as a labeled base. It is preferable to use fluorescent compounds that can be used. Examples of such fluorescent compounds include fluorescein isothiocyanate (FITC), phycobiliprotein, rare earth metal chelate, dansyl chloride, tetramethylrhodamine isothiocyanate, and fluorescein-dT. Among these, it is preferable to use Fluorescein-dT used as a compound for molecular labeling because synthesis is easy.

Below, the manufacturing method of the linker for peptide aptamer preparation is demonstrated.
First, DNA is synthesized according to a conventional method so as to obtain a desired sequence, and a single-stranded oligomer for use as a main chain is prepared. As described above, the single-stranded oligomer synthesized in this manner includes a solid phase binding site, two or more cleavage sites, an mRNA linking site, a side chain linking site, and a primer region. The length of the single-stranded oligomer serving as the main chain is appropriately determined depending on the size of the two or more cleavage sites and the position in the main chain.
Next, a side chain having a desired length is synthesized and linked to a side chain linking site on the main chain. For example, puromycin can be introduced into the free end of the side chain, and the above-described Fluorescein-dT can be introduced into the fluorescent labeling site to obtain the mRNA / cDNA-protein conjugate preparation linker of the present invention.

  In designing the backbone, various mRNA coding sequences can be referred to. For example, mRNA encoding various receptor proteins with known sequences, mRNA encoding various antibodies or fragments thereof, and other mRNAs can be mentioned. The 3 ′ terminal analog of aminoacyl-tRNA such as puromycin and its analogs is incorporated into the C-terminal of the polypeptide chain generated by translation from the mRNA coding sequence, and the polypeptide chain and the mRNA-linker conjugate are linked. To do so, select a sequence that does not contain a stop codon. These mRNAs can be obtained using in vitro transcription reactions, chemical synthesis, extraction from living organisms, cells, and microorganisms, and other various methods. High cell translation reaction efficiency.

  Moreover, it is preferable from the point of the synthetic | combination efficiency of a protein to have at least one structure of 7-methylated guanosine cap structure of 5 'terminal, or poly A tail structure of 3' terminal. It is more preferable to have a Kozak sequence or Shine-Dalgarno sequence because it promotes the initiation of translation. The length of mRNA used here depends in principle on the length of the coding region defined by the length of the protein or polypeptide to be molecularly evolved using the present invention. A length of 50 to 1,000 bases is preferable from the viewpoint of reaction efficiency, and a length of 200 to 500 bases is more preferable because the highest reaction efficiency can be obtained.

  In the generation of the mRNA / cDNA-linker-protein conjugate, the mRNA / cDNA-protein conjugate preparation linker described above and mRNA having a sequence complementary to the main chain of the linker are linked by T4 RNA ligase at the mRNA linkage site. Thus, an mRNA-linker conjugate is generated. Next, a protein is synthesized from the mRNA by a cell-free translation system, and the synthesized protein is ligated to the protein ligation site in the mRNA-linker ligation to generate an mRNA-linker-protein ligation.

  Subsequently, the mRNA-linker-protein conjugate is bound to the solid phase via the solid-phase binding site, and the solid phase to which the mRNA-linker-protein conjugate is bound is washed with a first buffer. Thereafter, a 3 ′ end of the main chain is used as a reaction start point, and a reverse transcription reaction is performed using the mRNA as a template to synthesize a cDNA chain to obtain an mRNA / cDNA-linker-protein conjugate. Next, the solid phase to which the mRNA / cDNA-linker-protein conjugate is bound is washed with a second buffer, and the cleavage site of the main chain is cleaved with the predetermined endonuclease.

  The ligation reaction is performed at 20 to 40 μL from the viewpoint of reaction efficiency, and RNA: linker is performed in a molar ratio of 3: 1 to 1: 6. In order to increase the reaction efficiency and minimize the residue, 1: (1-2) (10-20 pmol linker for 10 pmol mRNA) may be used.

  Next, after heating the sample solution at about 60-100 ° C. for about 2 to about 60 minutes using a heating block, aluminum block, water bath, or other heating device, it is about 2 to about 60 minutes at room temperature. Let stand and gently reduce the liquid temperature. Thereafter, it is further cooled to about −5 ° C. to about 10 ° C. Specifically, for example, the sample solution is warmed on an aluminum block at 90 ° C. for 5 minutes, then transferred to an aluminum block at 70 ° C. for 5 minutes, and then a ligation reaction between the mRNA and the linker is performed. . For example, about 0.1 to about 2.5 U / μL T4 polynucleotide kinase, about 0.4 to about 5 U / μL T4 RNA ligase, about 2 to about 50 mM magnesium chloride, about 2 to about 50 mM DTT, about 0.2 to about 5 mM The reaction is performed in 10 to 250 mM Tris-HCl buffer (pH 7.0 to 8.0) containing ATP of about 10 to about 40 minutes at about 10 to about 40 minutes. From the viewpoint of work efficiency and reaction efficiency, it is preferably performed at 20 ° C. to 30 ° C. for 5 minutes to 30 minutes, more preferably at 25 ° C. for 15 minutes.

  It is preferable to use a lysate of mammalian reticulocyte cells as the cell-free translation system, and it is more preferable to use a lysate of reticulocyte cells obtained from rabbit blood. In addition, when acetylphenylhydrazine is preliminarily administered to the mammal to induce hemolytic anemia and blood is collected after several days, the ratio of reticulocytes in the blood can be increased. For example, as the lysate, a cell-derived mRNA is degraded with micro-coccal nuclease, and calcium ether is added with glycol ether diamine tetraacetic acid (EGTA) to inactivate the nuclease (hereinafter referred to as “micro-coccal”). Nuclease-treated ”).

For example, a reaction solution containing about 16 to about 400 mM potassium acetate, about 0.1 to about 2.5 mM magnesium acetate, about 0.2 to about 50 mM creatine phosphate, 0 to about 0.25 mM amino acid (the concentrations are all final). (Concentration) In 100 to 100 μL, a translational reaction can be performed by adding a rabbit reticulocyte lysate treated with micrococcal nuclease and the above-mentioned ligated body.
From the viewpoint of reaction efficiency, the amount of rabbit reticulocyte lysate is about 8.5 to about 17 μL, the amount of the above conjugate is about 1.2 to about 2 pmol, the size of the reaction system is about 12.5 to about 25 μL, and about 20 to about 40 ° C. For about 10 to about 30 minutes. The reaction solution used in this case contains 80 mM potassium acetate, 0.5 mM magnesium acetate, 10 mM creatine phosphate, 0.025 mM methionine and leucine, respectively, and amino acids other than 0.05 mM methionine and leucine. When translation is performed at about 30 ° C for about 20 minutes, production efficiency and work efficiency are high.

  After the translation reaction, the translation product protein and the mRNA-linker conjugate are about 27 to about about, for example, in the presence of 0.3 to 1.6 M potassium chloride and 40 to 170 mM magnesium chloride (the concentrations are both final concentrations). When the reaction is carried out at 47 ° C. for about 30 minutes to about 1.5 hours, the protein can be efficiently bound to the above conjugate.

  Examples of the solid phase on which the mRNA-linker-protein conjugate is immobilized include beads such as styrene beads, glass beads, agarose beads, sepharose beads, magnetic beads; glass substrates, silicon (quartz) substrates, plastic substrates, metals Examples include substrates such as substrates (for example, gold foil substrates); containers such as glass containers and plastic containers; membranes made of materials such as nitrocellulose and polyvinylidene fluoride (PVDF). When the solid phase is composed of a plastic material such as styrene beads or a styrene substrate, a part of the linker may be directly covalently bonded to the solid phase using a known method, if necessary ( (See Qiagen, LiquidChip Applications Handbook, etc.) When biotin or its analog is bound to the conjugate, the conjugate can be easily bound to the solid phase by binding avidin to the solid phase.

  Conjugates that did not bind to the solid phase consisted of 1-100 mM Tris-HCl buffer (about 0.1 to about 10 M sodium chloride, about 0.1 to about 10 mM EDTA, about 0.01 to about 1% surfactant) ( Wash and remove using pH 7.0-9.0) or phosphate buffer (pH 7.0-9.0). When 20 mM Tris-HCl buffer (pH 8.0) containing 2 M sodium chloride, 2 mM EDTA, and 0.1% Triton X-100 is used, the washing efficiency is good.

  Using the 3 ′ end of the main chain as a reaction start point and the mRNA as a template, a reverse transcription reaction is performed under predetermined conditions to synthesize a cDNA chain. As a result, an mRNA / cDNA-linker-protein conjugate is obtained. The reverse transcription reaction system can be arbitrarily selected, but the mRNA-linker protein conjugate, dNTP Mix, DTT, reverse transcriptase, standard solution, and water from which RNase has been removed (hereinafter referred to as “RNase-free water”). It is preferable to carry out reverse transcription under the conditions of 30 to 50 ° C. for 5 to 20 minutes in this system.

Subsequently, it is washed with the same buffer as above to remove the free mRNA / cDNA-linker-protein conjugate. Thereafter, the cleavage site of the main chain is cleaved with the above-described endonuclease. For example, when Endo V (NEB, M0305S) is used, the reaction has a composition of about 5 to 20 mM Tris-HCl, about 2.5 to about 10 mM EDTA, and about 0.1 to about 0.4 M sodium acetate. The reaction is carried out in the liquid at a temperature range of about 30 to about 45 ° C. for about 5 to about 20 minutes.
As described above, various proteins can be obtained using the linker of the present invention, and cDNAs corresponding to the proteins can also be obtained.

  In the above method, the obtained mRNA and the puromycin-containing linker DNA are immobilized on a magnetic bead modified with streptavidin using an avidin-biotin bond, and from a mRNA using a cell-free translation system. It synthesizes protein and synthesizes cDNA from mRNA using reverse transcription. For this reason, a protein that is a phenotype and DNA sequence information that is a genotype are stably associated with each other on a magnetic bead.

  Subsequent to the cleavage / separation step, the mRNA / cDNA-linker-protein conjugate can be selected using the affinity of the obtained protein or the like. Thereafter, mutation is introduced into the selected base sequence in the ligated body using PCR or the like to carry out an amplification reaction. The amplified product is ligated to a double-stranded DNA having a desired promoter sequence by a predetermined method to obtain a first generation mutant mRNA (hereinafter abbreviated as “mRNA G1”). Then, mRNA G1, mRNA G3, etc. can be obtained by repeating each step of the above-described cDNA display method using mRNA G1, and by introducing desired mutations etc. while repeating the above reaction Peptide aptamers having various sequences can be obtained.

(3) Production of Peptide Aptamer Hereinafter, a case where a peptide aptamer is produced using a modified oligonucleotide (for example, Puro-FS and biotin loop) will be described as an example.

The magnetic gel beads used in the present invention are not particularly limited as long as they contain a magnetic material that responds to magnetism. Examples thereof include particles having a magnetic material such as magnetite, γ-iron oxide, and manganese zinc ferrite.
The magnetic gel beads used in the present invention are preferably in a dispersed state even after binding to the target molecule. For this reason, it is preferable that an average particle diameter is 50-200 nm, and it is more preferable that it is about 100 nm.

The magnetic gel beads preferably have a fixing molecule for fixing a peptide aptamer on the surface thereof. Examples of such fixing molecules include biotin, avidin, NHS-Ester, Amin and the like. Can be mentioned.
Examples of such commercially available magnetic gel beads include Tharma-Max (registered trademark) (manufactured by JNC Corporation, Japan). In this magnetic gel bead, a heat-sensitive polymer that reversibly aggregates and disperses with changes in temperature is immobilized on the surface of the magnetic particle (see FIG. 2). A gel bead in which either avidin or biotin is bound to the surface of the magnetic gel bead can be used (see FIG. 3).

As the above Puro-FS, use a 5 '-(S) -TC (F)-(Spec18)-(Spec18)-(Spec18)-(Spec18) -CC- (Puro) -3' structure Can do. In this Puro-FS chain, (S) represents 5'-Thiol-ModifierC6, (F) represents fluorescein-dT, (Puro) represents puromycin CPG, and (Spacer18) represents spacer phosphoramidite 18. You may use things.
As the biotin loop, a desired oligonucleotide can be used, but it is preferable from the viewpoint of cleavage efficiency to use an oligonucleotide having the following sequence.

  5'-CCCGGTGCAGCTGTTTCATC (T-B) CG GAAACAGCTGCACCCCCCGCCGCCCCCCG (T) CC T-3 '... SEQ ID NO: 1

  In the biotin loop chain, (T) represents Amino-Modifier C6 dT, and (T-B) represents Biotin-dT. In Sequence Listing 1, (T) is b, and (T-B) is y.

(4) Library construction Library construction can be performed as follows. For example, the B domain of protein A can be obtained from a pEZZ 18 protein A gene fusion vector (GE Healthcare) and used with the following primers.
(FP) Forward primer: T7 promoter, tobacco mosaic virus (TMV) 5 'untranslated region "omega", Kozak sequence and ATG start codon (RP) Reverse primer: hexahistidine tag, spacer sequence (GGGGGA GGCAGC: sequence No. 2) and a sequence complementary to puromycin linker DNA that can be ligated at the 3 ′ end (AGGACGG GGGGCGGGGAAA: SEQ ID NO: 3) is included between mRNA and puromycin linker DNA.

  When the Oct-1 POU-specific DNA binding domain is used, a template may be prepared by substituting the B domain with PDO. Two single-stranded synthetic DNAs (27mers) encoding a FLAG epitope and a random decamer peptide can be used for affinity selection of anti-FLAG M2 antibodies. These are commercially available from, for example, FASMAC (Japan). The DNA encoding the random decamer peptide may include codon triplets, X, Y, and Z, where the percentage of bases contained in X, Y, and Z representing a mixture of nucleotides is shown in Table 1 below. The following can be used.

(Table 1)

  In the same manner as described above, a 35-residue library can be prepared using DNA encoding 32 random residues using the above-described codon triplet.

(5) Synthesis of puromycin linker DNA The 5 ′ thiol group of Puro-FS is reduced and desalted in a desired amount of phosphate buffer under predetermined conditions. The desired amount of biotin loop and EMCS are then added to the buffer and the mixture is incubated at the desired conditions to remove excess EMCS. This precipitate is washed twice, dissolved in a predetermined buffer, and reduced Puro-FS is immediately added, followed by stirring under predetermined conditions. After stopping the reaction, excess Puro-FS is removed and the column is used to remove biotin loops and uncrosslinked biotin loop-EMCS complexes.

  For example, the 5 ′ thiol group of Puro-FS (5 to 20 nmol) is 0.5 to 2 mM in 50 to 200 μl of 25 to 100 mM phosphate buffer (pH 6.8 to 7.2) at room temperature for 3 to 9 hours. Then, it may be reduced with TCEP, and then desalted as necessary with a NAP-5 column (manufactured by GE Healthcare). A total amount of 5-20 nmol of biotin loop and 1-10 μmol of EMCS is added to 50-200 μl of 0.1-0.5 M sodium phosphate buffer (pH 6.5-7.5). The mixture is subsequently incubated at 34-39 ° C. for 15-45 minutes and ethanol precipitation is performed at 2-6 ° C. to remove excess EMCS.

This precipitate is washed with 250-750 μL of pre-cooled 70% ethanol, for example, twice and 5-20 μL of pre-cooled 0.1-0.5 M sodium phosphate buffer (pH 6.8-7.2). Dissolve in The reduced Puro-FS was immediately added and stirred at 2-6 ° C. overnight. For example, 2-6 mM TCEP was added to stop the reaction at 34-39 ° C. for 10-20 minutes. Also good. Thereafter, excess Puro-FS is removed at room temperature by ethanol precipitation or the like. Further, this precipitate is dissolved in 0.05 to 0.2 M TEAA (Glen Research) or phosphate buffer, and the following is performed using a C ₁₈ HPLC column. Under these conditions, the biotin loop and the uncrosslinked biotin loop-EMCS complex can be removed.
Fractions from the fraction from the last peak at an absorbance of 254 nm (corresponding to a single peak at an absorbance of 490 nm) are collected, dried, resuspended in this diethylpyrocarbonate (DEPC) treated water and stored. As described above, puromycin-linker DNA can be prepared.

Column: AR-300 (C ₁₈ ), 4.6 x 250 mm (Nacalai Tesque, Japan)
Solvent: 0.1M TEAA; Solvent B: Acetonitrile / Water (80:20, v / v)
Gradient: B / A (15-35%, 33 minutes)
Flow rate: 0.5 ml / min Detection wavelength: Absorbance 254 nm and 490 nm

(6) Immobilization of mRNA-puromycin conjugate to magnetic beads
Immobilization of the mRNA-puromycin conjugate to the magnetic substance can be performed as follows. That is, magnetic particles on which aptamer-binding molecules of a desired particle size are immobilized are washed with a desired buffer, incubated with the above-mentioned mRNA-puromycin conjugate under desired conditions, and before cell-free translation, Wash with buffer.
For example, magnetic particles (hereinafter referred to as “SA particles”) such as streptavidin-coated magnetic particles (MAGNOTEX-SA, manufactured by Takara, Japan) having a particle size of 2 to 3 μm are bonded according to the manufacturer's instructions. Wash twice with buffer (5-20 mM Tris-HCl (pH 7.8-8.2), 0.5-2 mM EDTA, 0.5-2 M NaCl, 0.05-0.2% Triton X-100). Thereafter, for example, 45-55 pmol of the above mRNA-puromycin conjugate is incubated with 1-2 mg of SA particles in 100-150 μL of binding buffer at room temperature for 5-15 minutes. Subsequently, before cell-free translation, the particles can be washed with the binding buffer and translation mix buffer (Ambion) to immobilize the mRNA-puromycin conjugate on the magnetic particles.

(7) Synthesis of peptide aptamers (7-1) Cell-free translation and reverse transcription on magnetic particles (RT)
Separate the magnetic particles with a magnetic stand, add the desired amount of cell-free translation extract, and incubate the mixture at the desired conditions. When it is desired to increase the yield of the mRNA-protein fusion, a post-translation product may be subjected to a translation fusion reaction in which the product is further translated under high salt conditions. The expressed mRNA-protein complex bound particles are then washed with a binding buffer containing an RNase inhibitor, rinsed with RT buffer, RT buffer and reverse transcriptase are added to the particles, and the desired conditions are reached. Incubate at RT for RT.

For example, after separating the magnetic particles, 200-400 μL of cell-free translation extract (Ambion, USA) is added and the mixture is incubated at 25-35 ° C. for 15-30 minutes. When increasing the yield of mRNA- protein fusions, the translation product, in the presence of high salt concentration (MgCl ₂ of KCl and 55~70mM each 70~80mM final concentration), 90 at 35 to 42 ° C. Perform a post-translation fusion reaction with further translation for 1 minute. The particles bound with the expressed mRNA-protein complex were then washed with 150-250 μL of binding buffer containing RNase inhibitor and 50-150 μL of RT buffer (25-100 mM Tris-HCl (pH 8.1-8.5). ), 65-85 mM KCl, 2-4 mM MgCl ₂ ). 60 to 100 μL of RT buffer and 60 to 100 units of reverse transcriptase M-MLV (Takara, Japan) are added to the particles, and RT is performed at 40 to 45 ° C. for 5 to 15 minutes.

(7-2) Refolding of disulfide-rich protein The cDNA-protein on the streptavidin-coated magnetic particles is reduced under desired conditions and washed with a binding buffer. Refolding is performed using reduced glutathione and protein disulfide isomerase in the presence of oxidized glutathione. The particles can be washed, digested with restriction enzymes and purified for selection.

  For example, cDNA-protein on streptavidin-coated magnetic particles is reduced with 0.5 mM for 1.5 to 1.5 hours at 20 to 30 ° C. by adding 100 mM DTT (Takara, Japan) and washed with a binding buffer. Refolding is performed in the presence of 0.5-2 mM oxidized glutathione using 5-20 mM reduced glutathione and protein disulfide isomerase at approximately equimolar amounts with the cDNA fusion for 0.5-2 hours at 20-30 ° C. The particles were washed, digested with a restriction enzyme such as PvuII (see below) and selected by Ni-NTA purification.

(7-3) Recovery of cDNA-protein fusion from magnetic beads Magnetic particles bound with reverse-transcribed mRNA-protein fusion are washed with a binding buffer and separated using an M buffer. Release of the mRNA / cDNA-protein fusion molecule from the particles is carried out under desired conditions by adding M buffer, restriction enzyme and BSA. The cDNA-protein fusion product is then purified from the remaining supernatant using agarose beads. After separating the agarose beads, the supernatant is transferred to a new tube and incubated with RNase to remove the mRNA and subjected to SDS-PAGE. Thereafter, fluorescence observation is performed, and the band on the gel is quantified by detecting the FITC label attached to the puromycin linker.

For example, magnetic particles to which a reverse transcription mRNA-protein fusion is bound are washed once with a binding buffer, and M buffer (5-15 mM Tris-HCl (pH 7.3-7.7), 5-15 mM MgCl ₂ , 0.5 Further washing with ~ 1.5mM DTT, 25 ~ 100mM NaCl) (Takara, Japan), the magnetic particles are separated using a magnetic stand. Add 20-80 μL of M buffer, 20-30 units of restriction enzyme such as PvuII and BSA (final concentration = 0.05-0.2 mg / mL) and incubate at 35-42 ° C. for 0.5-2 hours. Release the mRNA / cDNA-protein fusion molecule. The cDNA-protein fusion product can then be purified from the remaining supernatant using, for example, Ni-NTA agarose beads (QIAGEN).

  The beads are separated from the reaction and the supernatant is transferred to a new tube for detection. Incubate with 1-5 units of RNase H (Promega, USA) for 10-30 minutes at 34-42 ° C to remove mRNA and subject to SDS-PAGE containing the desired concentration of urea. . Thereafter, the band on the gel is quantified by observation using a fluoroimager (Typhoon 8600) or the like and detection of the FITC label attached to the puromycin linker described above.

(7-4) Protein immobilization and labeling Immunoglobulin G, target molecule and bovine serum albumin are combined in NHS-activated Sepharose 4 Fast Flow (GE Healthcare) to prepare a slurry of desired concentration. To do. Uncoated particles are similarly prepared under protein-free conditions. Double-stranded DNA having a Pou binding site, for example, the following oligonucleotide

5'-CCAGGGT [ATGCAAAT] TATTAAGGGCAAAAA (SEQ ID NO: 4) -Biotin-3 '
5'-TTTTTGCCCTTAATA [ATTTGCAT] ACCCTGG-3 '(SEQ ID NO: 5)

Can be prepared by hybridization. The sequence surrounded by [] indicates the Pou binding site. The obtained biotinylated dsDNA (hereinafter abbreviated as “Oct-DNA”) can be immobilized on streptavidin-coated sepharose beads. The biotin labeling of the target molecule can be performed using, for example, NHS-ss-biotin (Pierce). The resulting mixture is dialyzed against buffer to remove free biotin molecules, and the protein concentration is estimated by SDS-PAGE using a standard with a known concentration.

  For example, IgG (manufactured by Sigma), IL-6R (manufactured by Peprotech) and BSA (manufactured by Ambion, USA) (25-100 μg) (150-100 μL) NHS-activated Sepharose 4 Fast Flow (GE Healthcare) Can be combined according to the manufacturer's instructions to prepare the final solution as a 40-60% slurry. Moreover, biotin labeling of IL-6R can be performed using NHS-ss-biotin (Pierce) according to the manufacturer's instructions (Pierce).

(7-5) In vitro affinity selection
Double-stranded containing three different templates for cDNA, eg, protein A B domain (BDA), Oct-1 Pou-specific DNA binding domain (PDO), human immunoglobulin G (IgG) and Pou binding site Each DNA (Oct-DNA) can be used to prepare for test screening.
Subsequently, a cDNA library containing a predetermined ratio of BDA / PDO is prepared by translation of linker-bound mRNAs, incubated under high salt concentration, reverse transcribed, PvuII digested, and Ni-NTA purified via a 6 × His tag. The purified fraction of the BDA / PDO library is added to either IgG coated particles or Oct-DNA-coated particles and stirred in selection buffer, followed by incubation of the mixture for 30 minutes at room temperature with stirring.

  Thereafter, the particles were collected and washed with a selection buffer. Bound cDNA display molecules were removed with elution buffer and quickly neutralized. The supernatant is precipitated with ethanol and a coprecipitation reagent, dissolved in water, and a desired amount of aliquot is amplified by PCR using, for example, the following two primers, followed by denaturing gel electrophoresis, It can be analyzed quantitatively by major.

5 '-(FITC) -CAACAACATTACATTTTACATTCTACAACTACAAGCCACC-3 (SEQ ID NO: 6)
5'-TTTCCCCGCCGCCCCCCGTCCTGCTTCCGCCGTGATGATGATGATGATGGCTGCCTCCCCC-3 '(SEQ ID NO: 7)

  For example, cDNA libraries can be prepared by translation of linker-bound mRNAs with BDA / PDO ratios of 1: 1, 1: 3, and 1:20. The purified fraction of the BDA / PDO library is added to either IgG-coated particles or Oct-DNA-coated particles on 10-30 μL of 40-60% slurry rinsed with selection buffer, and 50-200 μL of selection buffer ( Stir in 25-100 mM Tris-HCl (pH 7.4-7.8), 0.5-2 mM EDTA, 250-750 mM NaCl, 0.05-0.2% Tween 20) for 15-45 minutes at room temperature The mixture can be incubated at room temperature for 15-45 minutes with agitation.

  The particles are then collected and washed with a selection buffer, and bound cDNA display molecules are removed with 50-150 μL of elution buffer (0.0.5-0.2 M glycine HCl (pH 2-3)) and 0.5-2 M Neutralize quickly with Tris-HCl (pH 7.8-8.2). The supernatant is precipitated with ethanol and a coprecipitation reagent (Quick-precip Plus, Edge BioSystems), dissolved in 5-20 μL of water, and 1-5 μL aliquots are added using 0.1-0.5 μM of the above primers. For example, amplification is performed by PCR in which 20 to 30 cycles are performed with denaturation 15 to 25 seconds, annealing 10 to 20 seconds, and extension 25 to 35 seconds as one cycle. Subsequently, it can be subjected to denaturing gel electrophoresis (3-6% Tween and 8M urea) and quantitatively analyzed with a fluoroimager.

(8) Selection of random library for IL-6R (8-1) Prediction of cDNA display peptide Random library is selected as a desired fragment, for example, a random sequence encoding 35 residues, and 6x-His and Y at 3'-end. -Prepare by overlap PCR using tag, T7 promoter and 5'-UTR, Kozak, and fragment containing essential elements such as start codon at 5 'end. The initial library mRNA is added to the puromycin linker, translated into the desired amount of lysate, and the desired salt is added to form a protein fusion. RT, PvuII digestion and Ni-NTA purification were scaled up using previously described pilot conditions (Yamaguchi J, et al., Nucleic Acids Res. 2009, 37, e108. Doi: 10.1093 / nar / gkp514.) This is done to remove DTT and the purified cDNA display peptide is estimated by known FITC-labeled oligonucleotides.
For example, the initial library mRNA can be 200 pmol and translated into 0.5-2 mL of lysate at 20-35 ° C. for 10-30 minutes.

(8-2) Selection of the obtained cDNA peptide In the first round, a predetermined amount of library molecule and target molecule can be supplemented by incubating with a desired magnetic particle in a buffer. For example, in S-buffer (25-100 mM Tris-HCl, 250-750 mM NaCl, 0.5-2 mM EDTA, 0.05-0.2% Tween (pH 7.4-7.8), 0.05-0.2 mg / ml BSA) 2-4 × 10 ¹¹ library molecules and 10-35 nM biotinylated IL-6R are captured with streptavidin (SA) beads for 0.5-1.5 hours incubation at room temperature. The particles are washed several times with S-buffer and the bound (captured) molecules are recovered by incubating for 5-15 minutes using, for example, 50-200 mM DTT, purified and processed for the next round To do. From the desired round, random mutations can be introduced during the PCR amplification step of the selected molecule using, for example, the Diversify PCR Random Mutagenesis Kit (Clontech, CA, USA).

Mutations are introduced at the desired rate and selection is performed. After random mutation, for example, 0.5 to 1.5 mM oxidized glutathione and 5 to 15 mM reduced glutathione (both manufactured by Sigma), and protein disulfide isomerase (PDI; manufactured by Takara, Japan), protein and a desired ratio In the presence of these, solid phase refolding can be performed at room temperature for 0.5 to 1.5 hours. The particles are washed and the peptides are released from the particles by PvuII digestion and purified by Ni-NTA resin chromatography. These conditions can be used to make a desired number of selections.
As described above, various peptide aptamers can be prepared.

(Example 1) Synthesis of chemically modified peptide aptamer (1) Preparation of a linker for cDNA display (1-1) Reagents Puro-FS and biotin loop, which are modified oligonucleotides, were produced by Gene World (Tokyo, Japan). ) As Puro-FS, a structure of 5 ′-(S) -TC (F)-(Spec18)-(Spec18)-(Spec18)-(Spec18) -CC- (Puro) -3 ′ was obtained. In this Puro-FS chain, (S) represents 5'-Thiol-ModifierC6, (F) represents fluorescein-dT, (Puro) represents puromycin CPG, and (Spacer18) represents spacer phosphoramidite 18. .
Oligonucleotides having the following sequences were used as biotin loops.

  5'-CCCGGTGCAGCTGTTTCATC (T-B) CG GAAACAGCTGCACCCCCCGCCGCCCCCCG (T) CC T-3 '... SEQ ID NO: 1

  In the biotin loop chain, (T) is Amino-Modifier C6 dT, and (T-B) is Biotin-dT (underlined represents the recognition site for PvuII restriction enzyme). EMCS [N- (6-maleimidocaproyloxy) succinimide] was purchased from Dojindo Laboratories (Kumamoto, Japan). TCEP [Tris (2-carboxyethyl) phosphine was purchased from Pierce.

(1-2) Library construction The protein A B domain was obtained from the pEZZ 18 protein A gene fusion vector (GE Healthcare) and the following primers were used.
Forward primer: contains T7 promoter, tobacco mosaic virus (TMV) 5 'untranslated region "omega", Kozak sequence and ATG start codon.
Reverse primer: hexahistidine tag, spacer sequence (GGGGGA GGCAGC: SEQ ID NO: 2), and sequence complementary to puromycin linker DNA (AGGACGG GGGGCGGGGAAA: ligated at the 3 ′ end between mRNA and puromycin linker DNA) SEQ ID NO: 3).

  In addition, a template was prepared by replacing the B domain with PDO, and the POU-specific DNA binding domain of Oct-1 was used. For affinity selection of anti-FLAG M2 antibody, two single-stranded synthetic DNAs (27mers) encoding a FLAG epitope and a random decamer peptide were purchased from FASMAC (Japan). The DNA encoding the random decamer peptide contains codon triplets X, Y, and Z, where X, Y, and Z indicate a mixture of nucleotides. The ratio in the mixture was as shown in Table 1X below.

(Table 1X)

  In the same manner as described above, a 35-residue library was prepared using DNA encoding 32 random residues using the above-mentioned codon triplet.

(1-3) Synthesis of puromycin linker DNA The 5 ′ thiol group of Puro-FS (10 nmol) was reduced with 1 mM TCEP in 100 μl of 50 mM phosphate buffer (pH 7.0) at room temperature for 6 hours. Thereafter, desalting was performed as necessary using a NAP-5 column (manufactured by GE Healthcare). A total of 10 nmol of biotin loop and 2 μmol of EMCS were added to 100 μl of 0.2 M sodium phosphate buffer (pH 7.0). Subsequently, the mixture was incubated at 37 ° C. for 30 minutes and ethanol precipitated at 4 ° C. to remove excess EMCS.

This precipitate was washed twice with 500 μL of pre-cooled 70% ethanol and dissolved in 10 μL of pre-cooled 0.2 M sodium phosphate buffer (pH 7.0). Reduced Puro-FS was added immediately and stirred at 4 ° C. overnight. The reaction was stopped at 37 ° C. for 15 minutes with the addition of 4 mM TCEP. Thereafter, ethanol precipitation was performed, and excess Puro-FS was removed at room temperature. To remove the biotin loop and uncrosslinked biotin loop-EMCS complex, the precipitate was dissolved in 0.1 M TEAA (Glen Research) or phosphate buffer and purified using a C ₁₈ HPLC column under the following conditions: did.

Column: AR-300, 4.6x250mm (Nacalai Tesque, Japan)
Solvent: Solvent A: 0.1M TEAA; Solvent B: Acetonitrile / Water (80:20, v / v)
Gradient: B / A (15-35%, 33 minutes)
Flow rate: 0.5 ml / min Detection wavelength: Absorbance 254 nm and 490 nm

  Fractions from the fraction from the last peak at an absorbance of 254 nm (corresponding to a single peak at an absorbance of 490 nm) were collected. After drying, it was resuspended in diethylpyrocarbonate (DEPC) -treated water and stored. As described above, puromycin-linker DNA could be obtained.

(2) Immobilization of mRNA-puromycin conjugate to magnetic beads Manufacturer of streptavidin-coated magnetic particles with a particle size of 2.3 μm (MAGNOTEX-SA, Takara, Japan) (hereinafter referred to as “SA beads”). According to the instructions in the above, the cells were washed twice with a binding buffer (10 mM Tris-HCl (pH 8.0), 1 mM EDTA, 1 M NaCl, 0.1% Triton X-100). Thereafter, the mRNA-puromycin conjugate (48 pmol) and SA beads (1.2 mg) were incubated in 120 μL of binding buffer at room temperature for 10 minutes. Subsequently, before the cell-free translation, the beads were washed with the above binding buffer and translation mix buffer (Ambion, USA), respectively. As described above, the mRNA-puromycin conjugate was immobilized on the magnetic particles.

(3) Synthesis of peptide aptamers (3-1) Cell-free translation and reverse transcription on magnetic particles (RT)
After separating the magnetic particles on a magnetic stand, 300 μL of cell-free translation extract (Ambion, USA) was added and the mixture was incubated at 30 ° C. for 20 minutes. To increase the yield of the mRNA-protein fusion, the translation product is further translated for 90 minutes at 37 ° C in the presence of high salt concentrations (final concentrations of 75 mM and 63 mM KCl and MgCl _{2 respectively} ). A fusion reaction was performed. The expressed mRNA-protein complex bound particles were then washed twice with 200 μL binding buffer containing RNase inhibitor (SUPERaseIn, Ambion, USA) and 100 μL RT buffer (50 mM Tris-HCl). (pH 8.3), 75 mM KCl, 3 mM MgCl ₂ ). 80 μL of RT buffer and 80 units of reverse transcriptase M-MLV (Takara, Japan) were added to the particles, and RT was performed at 42 ° C. for 10 minutes.

(3-2) Refolding of disulfide-rich protein The cDNA-protein on the streptavidin-coated magnetic particles was added with 100 mM DTT (manufactured by Takara, Japan), reduced at 25 ° C for 1 hour, and bound. Washed with buffer. Refolding was performed at 25 ° C. for 1 hour using 10 mM reduced glutathione and protein disulfide isomerase equimolar with the cDNA fusion in the presence of 1 mM oxidized glutathione. The particles were washed and subjected to PvuII digestion and selected by Ni-NTA purification.

(3-3) Recovery of cDNA-protein fusion from magnetic beads The magnetic particles bound with the reverse transcription mRNA-protein fusion were washed once with a binding buffer, and “M buffer” (10 mM Tris-HCl (pH 7.5), 10 mM MgCl ₂ , 1 mM DTT, 50 mM NaCl) (Takara Corporation, Japan), and magnetic particles were separated using a magnetic stand. 40 μL of M buffer, 24 units of PvuII and BSA (final concentration = 0.1 mg / mL) were added and incubated at 37 ° C. for 1 hour to release the mRNA / cDNA-protein fusion molecules from the particles. BSA was added to weaken the interaction between the mRNA / cDNA-protein fusion product and the particles. The cDNA-protein fusion product was then purified from the remaining supernatant using Ni-NTA agarose beads (QIAGEN).

  After separating the beads from this reaction solution, the supernatant was transferred to a new tube for detection, incubated with 2 units of RNase H (Promega, USA) at 37 ° C. for 20 minutes to remove mRNA, and 6M urea. The sample was subjected to SDS-PAGE. Thereafter, the band on the gel was quantified by observation using a fluoroimager (Typhoon 8600) and detection of the FITC label attached to the puromycin linker described above.

(3-4) Immobilization and labeling of protein Immunoglobulin G (IgG; manufactured by Sigma), IL-6R (manufactured by Peprotech) and bovine serum albumin (BSA; manufactured by Ambion, USA) (50 μg) were mixed with 200 μL. Coupling in NHS-activated Sepharose 4 Fast Flow (GE Healthcare) according to manufacturer's instructions. The final solution was prepared as a 50% slurry. Uncoated particles were similarly prepared under protein-free conditions.

Double-stranded DNA having a Pou binding site,
Double-stranded DNA is converted into the following oligonucleotides

5'-CCAGGGT [ATGCAAAT] TATTAAGGGCAAAAA (SEQ ID NO: 4) -Biotin-3 '
5'-TTTTTGCCCTTAATA [ATTTGCAT] ACCCTGG-3 '(SEQ ID NO: 5)

Prepared by hybridization. The sequence surrounded by [] indicates the Pou binding site. The resulting biotinylated dsDNA (hereinafter abbreviated as “Oct-DNA”) was immobilized on streptavidin-coated sepharose beads (GE Healthcare).
IL-6R was labeled with biotin using NHS-ss-biotin (Pierce) according to the manufacturer's instructions (Pierce). The resulting mixture was dialyzed against buffer to remove free biotin molecules. The protein concentration was estimated by SDS-PAGE using a known concentration of IL-6R.

(3-5) In vitro affinity selection
Double-stranded DNA containing three different templates for cDNA, protein A B domain (BDA), Oct-1 Pou-specific DNA binding domain (PDO), human immunoglobulin G (IgG) and Pou binding site ( Oct-DNA) was used for each and prepared for test screening.

  A cDNA library containing BDA / PDO (1: 1, 1: 3 and 1:20) was prepared by translation of linker-bound mRNAs, incubated under high salt concentration, reverse transcribed, PvuII digested and via 6xHis tag Ni-NTA purification was performed. Purified fractions of the BDA / PDO library are added to either IgG-coated particles or Oct-DNA-coated particles (20 μL 50% slurry rinsed with selection buffer), respectively, and 100 μL selection buffer (50 mM Tris- The mixture was stirred at room temperature for 30 minutes in HCl (pH 7.6), 1 mM EDTA, 500 mM NaCl, 0.1% Tween 20). The mixture was subsequently incubated at room temperature for 30 minutes with agitation.

  Thereafter, the particles were collected and washed with a selection buffer. Bound cDNA display molecules were removed with 100 μL elution buffer (0.1 M glycine HCl (pH 2.5)) and immediately neutralized with 1 M Tris-HCl (pH 8.0). The supernatant was precipitated with ethanol and a coprecipitation reagent (Quick-precip Plus, Edge BioSystems) and dissolved in 10 μL of water. A 2 μL aliquot was amplified by PCR using 0.2 μM of the following primers for 25 cycles of denaturation 20 seconds, annealing 15 seconds, and extension 30 seconds as one cycle. Thereafter, it was subjected to denaturing gel electrophoresis (4.5% Tween and 8M urea) and quantitatively analyzed with a fluoroimager.

5 '-(FITC) -CAACAACATTACATTTTACATTCTACAACTACAAGCCACC-3 (SEQ ID NO: 6)
5'-TTTCCCCGCCGCCCCCCGTCCTGCTTCCGCCGTGATGATGATGATGATGGCTGCCTCCCCC-3 '(SEQ ID NO: 7)

In order to validate the ratio between PDO and / or BDA selected from a mixed pool for a given target, the selected DNA is subjected to 15, 20, 25, 30 and 35 cycles under the conditions described above. Amplified.
Since it was found that the linear range was reached before and after 25 cycles and completed in about 30 cycles, the number of PCR cycles was set to 25. In the case of the FLAG tag, affinity selection was performed three times using anti-FLAG M2 antibody-agarose beads (Sigma). PCR products selected from each round were analyzed by direct sequencing. The PCR product was also cloned into a TA vector (Qiagen) and the clones were picked up randomly.

(4) Selection of random library for IL-6R (4-1) Estimation of cDNA display peptide Random library, random sequence encoding 35 residues, and 6x-His and Y-tag at 3'-end, T7 promoter And 5'-UTR, Kozak, and overlapping PCR of fragments containing essential elements such as the 5 'end initiation codon. 200 pmol of the original library mRNA was added to the puromycin linker and translated into 1 mL lysate for 20 minutes at 30 ° C. In addition 50mM of KCL and 63mM of MgCl _2, respectively, it was formed protein fusions. RT, PvuII digestion and Ni-NTA purification were scaled up using previously described pilot conditions. Removed from buffer using DTT. Purified cDNA display peptide was estimated by known FITC-labeled oligonucleotides.

(4-2) Selection of the obtained cDNA peptide In the first round, S-buffer (50 mM Tris-HCl, 500 mM NaCl, 1 mM EDTA, 0.1% Tween (pH 7.6), 0.1 mg / ml BSA) ), 2.7 × 10 ¹¹ library molecules and 25 nM biotinylated IL-6R were captured by incubation with streptavidin (SA) beads for 1 hour at room temperature and washed several times with S-buffer. Bound molecules were recovered by incubation for 10 minutes with 100 mM DTT (Sigma, USA), purified and processed for the next round. From round 4 (R4), random mutations were introduced during PCR amplification of selected molecules using the Diversify PCR Random Mutagenesis Kit (Clontech, CA, USA).

  Mutations were introduced at 3.2-7.3%. Selections were made 9 rounds using these conditions (ie up to R12). After random mutation, 1 mM oxidized glutathione (Sigma), 10 mM reduced glutathione (Sigma) and protein disulfide isomerase (PDI; Takara, Japan) were added 1: 1 with the protein. Solid phase refolding was performed for 1 hour at room temperature in the presence of. The particles were washed and the peptides were released from the particles by PvuII digestion and purified by Ni-NTA resin chromatography. Using these conditions, selections were made 6 rounds (ie up to R9).

(5) Peptide synthesis and characterization (5-1) Peptide synthesis Peptides containing two cysteine residues (Cyc-2 type) consisting of one disulfide bond and two disulfide bonds (between C1 and C4, C2 and C3 A peptide containing 4 cysteine residues (Cys-4 type) consisting of In addition, Cys4-2B consisting of different disulfide patterns (ie, between C1 and C3 and between C2 and C4) was also synthesized. In general, the biotin moiety was attached to the N-terminus.
The Cys-2 peptide containing two Cys residues was ordered from Toray (Tokyo, Japan) and synthesized. Cys-4 peptides containing 4 Cys residues were synthesized and characterized by retention time based HPLC profiles for their topology using the Peptide Institute (Osaka, Japan) according to a previously reported method (18) I did it. Of these two peptides, the Cys-4 peptide was used for the following binding assay and characterized.

(5-2) Binding assay
IL-6 receptor (IL-6R) was purchased from ACRObiosystems.
1 mM synthetic biotinylated peptide was incubated with 200 nM immobilized IL-6R in phosphate buffered saline (PBS) for 1 hour at room temperature. The mixture was centrifuged and the supernatant was discarded. The particles were thoroughly washed with PBS-T (Tween 20, 0.1%) and incubated with streptavidin-horseradish peroxidase (SA-HRP; manufactured by GE Healthcare) for 1 / 2,000 dilution for 30 minutes. After several washes with PBS-T, 200 mL of TMB substrate was added. The reaction was stopped with 0.5 M sulfuric acid after proper color development. Absorbance was monitored at 450 nm.

(5-3) Determination of dissociation constant (Kd) The binding affinity of the synthesized biotinylated peptide was assayed with a slight modification of the previously reported method. A fixed amount of peptide (10 nM) was incubated with various concentrations of IL-6R (1 nM to 1 mM) for 1 hour at 25 ° C. in PBS. This mixture was applied to a constant amount (200 nM) of IL-6R coated particles and incubated for an additional 30 minutes. After washing several times with PBS-T, SA-HRP was added to a dilution of 1/2000 and incubated for 30 minutes. The supernatant was removed and the particles were washed 4-5 times with PBS-T. 200 μL of TMB substrate was added for color development and the reaction was stopped with 0.5 M sulfuric acid. Absorbance was monitored at 450 nm. Data was plotted using GraphPad Prism 4 (GraphPad software Inc., San Diego, CA, USA). The required Kd was 55 nM. As described above, a peptide aptamer (IL-6RA) that binds to an IL-6 receptor (IL-6R) having a size of 1 to 8 kDa was obtained.

(Example 2) Aggregation behavior of magnetic gel beads (1) Reagents Therma-Max (registered trademark) LA Avidin (30) (manufactured by JNC Corporation, Japan, hereinafter referred to as "magnetic gel beads") as magnetic gel beads .)It was used. Of the IL-6RA obtained in Example 1, the 5 ′ end of 4 KDa was biotinylated by solid phase synthesis using a peptide synthesizer to obtain biotinylated IL-6RA.

(2) Aggregation of magnetic gel beads themselves An assay buffer (10 mM PBS (pH 7.4) containing 10 mM EDTA) containing magnetic gel beads at a concentration of 2 mg / mL is prepared. When it was placed in an incubator at 0 ° C. and then increased by 1 ° C./10 minutes to change the temperature, the temperature at which the dispersion state changed to the aggregation state was confirmed. Further, the aggregation time at this time was about 10 minutes.
(3) Comparison of aggregation state depending on presence / absence of target molecule Next, in this magnetic substance gel bead solution (gel bead concentration 2 mg / mL, 10 mM PBS (pH 7.4) containing 10 mM EDTA), 40 μM IL-6RP solution (31.2 μM 2), a tube to which IL-6R as a target molecule was added at 50 pmol / 1.25 μL, and a tube to which only a buffer not containing IL-6R was added in an equal amount Incubated at ~ 26.5 ° C for 10 minutes. The aggregation results are shown in FIG. Aggregation was not observed in the tube to which IL-6R was not added, and aggregation was observed in the tube to which IL-6R was not added.
From the above, it was shown that IL-6RP bound to the magnetic gel beads can detect IL-6R at a low concentration of 50 pmol.

(4) Changes in aggregation time depending on the binding mode between IL-6RP and IL-6R bound to magnetic gel beads IL-6R and IL-6RP (4KDa) bound to the above magnetic gel beads via biotin ) And the indirect binding using an antibody were examined.
First, magnetic gel beads and IL-6RP were mixed in a PBS buffer containing 40 mM of 10 mM EDTA under conditions of 4 ° C. in a container, and then allowed to stand at 4 ° C. for 1 hour. IL-6RP was bound to the surface.

  When indirectly binding IL-6R, the mixture was mixed in a PBS buffer containing 40 mM of 10 mM EDTA under conditions of 4 ° C., and then allowed to stand at 4 ° C. for 1 hour. -6R antibody was bound to the bead surface. The antibody size used here was 140 KDa and was purchased from R & D systems.

When the magnetic gel beads and IL-6RP were directly bound, a change was observed in the aggregation time, which was about 10 minutes. On the other hand, in the case of indirectly binding via an antibody, the aggregation time was constant with no change of about 1 minute or less.
From the above, it was speculated that when a large molecule such as an antibody is bound to a peptide aptamer, the change in physical properties on the surface of the magnetic gel beads is small, so that the aggregation time does not change.

  The present invention is useful in the field of medicine, particularly in the field of diagnostic agents.

SEQ ID NO: 1: Biotin loop strand SEQ ID NO: 2: Spacer sequence SEQ ID NO: 3: Sequence complementary to puromycin linker DNA SEQ ID NO: 4: DNA for preparing double-stranded DNA having Pou binding site
SEQ ID NO: 5: DNA for preparing double-stranded DNA having a Pou binding site
Sequence number 6: Primer Sequence number 7: Primer

Claims (16)

A binding step of binding a magnetic gel bead having a peptide aptamer immobilized in a buffer and a target molecule that specifically binds to the peptide aptamer;
An aggregation step of aggregating the magnetic gel beads bound to the target molecule in a buffer;
A detection step of detecting a target molecule bound to the aggregated gel beads;
A method for detecting a target molecule with high sensitivity.   The method of claim 1, wherein the concentration of the target molecule is 10 pM to 1 mM.   The method for detecting a target molecule with high sensitivity according to claim 1 or 2, wherein the magnetic gel beads are temperature sensitive.   The method for highly sensitive detection of a target molecule according to any one of claims 1 to 3, wherein an immobilization molecule for immobilizing a peptide aptamer is immobilized on the magnetic gel beads.   The method for highly sensitive detection of a target molecule according to claim 4, wherein the immobilization molecule is selected from the group consisting of streptavidin, an amino group, and a carboxyl group.   The method for detecting a target molecule according to any one of claims 1 to 5, wherein the peptide aptamer is composed of 8 or more and 150 or less amino acids.   The method for detecting a target molecule according to claim 6, wherein the peptide aptamer is composed of 10 to 40 amino acids.   The method for highly sensitive detection of a target molecule according to any one of claims 1 to 7, wherein the aggregation is performed in a temperature range of 1 to 50 ° C.   The method for highly sensitive detection of a target molecule according to claim 8, wherein the aggregation is performed in a temperature range of 10 to 30 ° C.   The high-sensitivity detection method for a target molecule according to any one of claims 1 to 9, wherein the aggregation is performed in a salt concentration range of 0 to 1M.   The method for highly sensitive detection of a target molecule according to claim 10, wherein the aggregation is performed in a salt concentration range of 0 to 100 mM. A linker preparation for producing a peptide aptamer that binds to a target molecule;
A purification magnetic bead for purifying the peptide aptamer, a biotinylation reagent, an enzyme;
A binding reagent for binding the purified peptide aptamer to the magnetic gel beads on which the fixing molecule is fixed;
A magnetic gel bead having an immobilizing molecule for immobilizing the bound peptide aptamer;
A kit for highly sensitive detection of a target molecule, comprising:   The linker preparation agent comprises: one end to which a peptide-presenting molecule is bound; the other end to which the mRNA corresponding to the base sequence of the peptide aptamer is bound as a main chain; and the vicinity of the other end A kit for detecting a target molecule with high sensitivity according to claim 12, comprising a peptide chain having:   The kit for sensitive detection of a target molecule according to claim 13, wherein the peptide-presenting molecule is puromycin, and the solid-phase binding molecule is biotin.   The kit for highly sensitive detection of a target molecule according to any one of claims 12 to 14, wherein the enzyme is selected from the group consisting of RNase T1, Endonuclease V, and PvuII.   The kit for highly sensitive detection of a target molecule according to any one of claims 12 to 15, wherein the concentration of the target molecule is 0.1 nM to 1 mM.

Images