JP2014504878A - Recombinant E. coli and its application in the production of 5-aminolevulinic acid - Google Patents

Abstract

The present invention relates to recombinant E. coli. The name of the recombinant E. coli is recombinant E. coli DALA, which is produced by the following method. A co-expression vector p-hemA ^M -hemL containing hemA ^M and hemL gene is constructed, and an expression vector p-rhtA containing rhtA gene is constructed. The constructed recombinant plasmids p-hemA ^M -hemL and p-rhtA are both converted into E. coli to obtain recombinant E. coli DALA that simultaneously overexpresses heMA ^M , hemL and rhtA genes. The present invention also relates to the application of said recombinant E. coli in the production of 5-aminolevulinic acid. As can be seen from the results of the fermentation, the production of ALA in the recombinant Escherichia coli of the present invention reached 4.13 g / L, and the conversion rate of ALA / glucose was 0.168 g ALA / g glucose. Showed that there is a future.

Description

Detailed Description of the Invention

[Technical field]
The present invention relates to the fields of genetic engineering and microbial fermentation, specifically to recombinant E. coli and methods for its construction and the application of the recombinant bacterial strain in the production of 5-aminolevulinic acid (ALA).

[Background technology]
5-aminolevulinic acid (ALA) is a molecular formula C ₅ O ₃ NH _9, a molecular weight of 131.13, a melting point of 118 ° C., and plays an important role in agriculture. As research has shown, ALA is a biodegradable, non-polluting natural substance. 5-Aminolevulinic acid is a novel pesticide, is easily decomposed in the environment, is non-residue, and does not show toxicity to mammals. ALA is also widely used in agriculture. Mainly applied to eco-herbicides, plant growth regulators, insecticides, etc. In addition to agriculture, ALA is popular as a photodynamic drug with excellent safety, selectivity and permeability in the medical field. ALA has already been applied to the diagnosis and photodynamic therapy (PDT) of skin cancer, bladder cancer, gastrointestinal cancer, lung cancer, etc.

  At present, the production method of ALA is mainly chemical synthesis. In the 50s of the last century, reports on the chemical synthesis method of δ-ALA already appeared, and in the 90s of the 20th century, research on chemical synthesis was most active, mainly hippuric acid (benzoylglycine) and oxalic acid Concentrating on research on synthetic processes using as raw materials, research on synthetic processes using heterocyclic compounds such as furfural, and research on synthetic processes using levulinic acid, acetylpropionic acid or its derivatives as raw materials. ing. Chemical synthesis has a high production cost because the reaction process is complicated, there are many by-products, separation and purification are difficult, and ALA yield rate is low. In addition, chemical synthesis uses a toxic reagent, which is bad for the environment. Therefore, according to the development of society and science and technology, it seems that the future trend is to produce ALA using fermentation of microorganisms with low price and renewable resources as substrate. At present, the market price of glucose is 4500 yuan / ton and the price of ALA is 80 million yuan / ton. Even with ALA-HCl, the price is extremely high, reaching 4,000,000 yuan / ton. Therefore, producing ALA by a fermentation method using an inexpensive substrate such as glucose as a raw material has an advantage in terms of cost.

  Researchers abroad will induce mutations in the photosynthetic bacterium Rhodobacter sphaeroides using a method of mutagenesis breeding to select high-producing ALA strains. Throughout the fermentation process, the production of ALA reached 7.2 g / L. However, since light irradiation is employed when fermenting photosynthetic bacteria, the cost increases and it is unsuitable for large-scale industrial fermentation production. E. coli is a host of production industrial products, has a clear genetic background, is easy to operate, grows fast, is easy to cultivate, and can be cultivated in an inorganic salt medium. Since it can be used, it is increasingly emphasized. As genetic engineering technology matured, people adopted genetic engineering technology to express the ALA synthase gene (hemA) in R. sphaeroides in wild-type E. coli. Mariet and Zeikus obtained a recombinant strain of Escherichia coli, and the fermentation production of ALA reached 3.79 g / L. L. Xie et al. Et al. Fermented and optimized recombinant E. coli containing the ALA synthase gene of R. sphaeroides to achieve ALA production of 5.2 g / L. The ALA production method described above is to use the C4-route, that is, to produce ALA by biotransforming succinic acid and glycocoll by expressing ALA synthase.

  At present, since oxalic acid is mainly prepared by chemical synthesis, the cost of producing ALA by bioconversion using oxalic acid and glycocor as substrates is high. And since a high concentration of glycocor (> 1.7 g / L) suppresses the growth of bacterial cells, the process of bioconversion is relatively complicated. At the same time, the fact that the culture medium in bioconversion is an expensive LB culture medium is also a bottleneck for ALA industrialization. Reduction of fermentation cost and simplification of fermentation process are the key points for large-scale industrialization of ALA. Only when the production cost of ALA by the biological method is reduced and the fermentation process is simplified, the current chemical synthesis method can be replaced by the industrial production of ALA using microorganisms.

[Content of the Invention]
The problem to be solved by the present invention against the current defects in ALA production is the recombinant E. coli and its construction method and the application of the recombinant strain in the production of 5-aminolevulinic acid (ALA).

  The technical solution of the present invention is based on the CLA route of ALA. Fermentative production of 5-aminolevulinic acid (ALA) using glucose as the sole carbon source and an improved inorganic salt culture medium.

The recombinant Escherichia coli of the present invention is a recombinant Escherichia coli DALA, which is produced by the following method. A co-expression vector p-hemAM-hemL containing hemA ^M and hemL genes is constructed, and an expression vector p-rhtA containing rhtA is constructed. Then, the constructed recombinant plasmids (plasmid) p-hemA ^M -hemL and p-rhtA are both converted into E. coli to obtain recombinant E. coli DALA that simultaneously overexpresses heMA ^M , hemL and rhtA genes.

Among them, heMA ^M is a mutant of the hemA gene from Escherichia coli or Salmonella, the hemL gene is from Escherichia coli or Salmonella, and the rhtA gene is from Escherichia coli.

More preferably, the hemA ^M is a mutant of the hemA gene from Arizona salmonella, and the hemL gene is from Salmonella.

The vector expressing the above-mentioned heM ^M , hemL or rhtA gene is pBluescript SK ⁻ , pUC19, pUC18, pCL1920 or pTrc99A. PBluescript SK plasmid in it ^- and pCL1920 than from the DSMZ (German Culture Center of Microorganisms, Deutsche Sammlung von Mikroorganismen und Zellkulturen) , pUC19 plasmid, pUC18 and pTrc99A is from famentas company.

Among them, it is preferable to select pUC19 as the vector expressing the heM ^M and hemL genes, and it is preferable to select pCL1920 as the vector expressing the rhtA gene. As the above-mentioned original Escherichia coli, Escherichia coli MG1655, Escherichia coli DH5α, Escherichia coli JM109 Escherichia coli W3110 or Escherichia coli XL1-Blue are selected. Among them, MG1655, JM109 and W3110 are from ATCC (American Typical Species Conservation Center), and E. coli DH5α and E. coli Xl1-blue are from DSMZ (German Microorganism Conservation Center). Among them, it is preferable to select E. coli DH5α as the E. coli.

As the above-described recombinant Escherichia coli DALA, DH5α / pUC-hemA ^M -hemL + pCL1920-rhtA is preferably selected.

Process for constructing recombinant E. coli described in the present invention:
1． Construction of hemA ^M and hemL gene co-expression vector:
The basic method, the mutant hemA ^M of hemA gene from E. coli or Salmonella, a plasmid vector pBluescript SK containing hemL gene from E. coli ^- and inserted into pUC19, pUC18, pCL1920 or pTrc99A, or, from E. coli hemL gene plasmid vector pBluescript SK of hemA ^M including hemA gene mutants from E. coli or Salmonella ^-, pUC19, pUC18, pCL1920 or by inserting into pTrc99A, co-expression vector of hemA ^M and hemL gene p-hemA ^M -Acquire hemL.

2． Construction of rhtA gene expression vector The basic method is to clone the rhtA gene using the E. coli gene group as a form. The rhtA obtained by cloning the plasmid pBluescript SK ^-, was inserted into pUC19, pUC18, pCL1920 or pTrc99A, obtaining an expression vector p-rhtA the rhtA.

3． Construction of ALA-fermented recombinant strain As a basic method, the constructed recombinant plasmids p-hemA ^M -hemL and p-rhtA are both converted into MG1655, JM109, DH5α, W3110, BL21 or XL1-blue, and heA Recombinant E. coli DALA overexpressing ^M , hemL and rhtA is obtained.

It is desirable to construct recombinant Escherichia coli DALA in which heA ^M , hemL and rhtA are overexpressed as described above, constructing recombinant Escherichia coli DALA DH5α / pUC-hemA ^M -hemL + pCL1920-rhtA.

The recombinant Escherichia coli of the present invention is applied in the production of 5-aminolevulinic acid. The recombinant Escherichia coli produces 5-aminolevulinic acid by fermenting glucose with an improved inorganic salt culture medium, and the preparation of the improved inorganic salt culture medium is as follows. It is characterized by the following. Glucose 5-50 g / L, (NH4) ₂ SO ₄ 10-30 g / L, KH ₂ PO ₄ 1-8 g / L, Na ₂ HPO ₄・ 12H ₂ O 10-30 g / L, MgSO ₄・_{7H2O 0.1-1.5g / L, MnSO 4 ·} 7H 2 O 0.001-0.1 g / L, yeast powder 0.5-3 g / L, isopropyl-beta-D-thiogalactoside (IPTG, isopropyl-β-D -thiogalactoside) 0.05 -1 mM; Add 50-100 μg / mL Ampicillin and 30-50 μg / mL spectinomycin to the fermentation broth.

More preferably, the improved inorganic salt culture medium formulation described above is as follows. (NH ₄ ) ₂ SO ₄ 16 g / L, KH ₂ PO ₄ 3 g / L, Na ₂ HPO ₄・ 12H ₂ O 16 g / L, MgSO ₄・ 7H2O 1 g / L, MnSO ₄・ 7H ₂ O 0.01 g / L, yeast powder 2 g / L, isopropyl-β-D-thiogalactoside (IPTG) 0.1 mM, glucose 35 g / L.

For the application of the recombinant E. coli of the present invention in the production of 5-aminolevulinic acid, a specific method is as follows:
1． Shaking culture and ALA measurement Shaking culture: Select a single colony of the constructed recombinant strain and place it in a 25 mL Erlenmeyer bottle containing 3-5 mL fermentation medium. The final concentration of ampicillin is 100 μg / mL and the final concentration of spectinomycin is 50 μg / mL. Incubate for 12 hours at a temperature of 37 ° C and a speed of 225 revolutions / minute.

  Place the fungus cultivated over the screen in a 300 mL Erlenmeyer bottle containing 50 mL of fermentation broth at an inoculum of 0.5-3% (v / v). The concentration of ampicillin is 100 μg / mL and the concentration of spectinomycin is 50 μg / mL. Ferment for 8-56 hours, setting the temperature to 37 ° C and the speed to 200-280 revolutions / minute. Sampling every 2-6 h during fermentation and measuring the concentration of ALA by chromaticity analysis.

  Method for measuring ALA: Dilute the sample to 2 mL and add 1 mL of acetate and 0.5 mL of acetylacetone. Then simmer for 15 minutes. And let it cool to room temperature. Place 2 mL of reaction in a new tube and add 2 mL of modified Ehrlich's reagent. After a 20 minute reaction, the spectrophotometer is measured at 554 nm.

2． Fermentation can culture and ALA measurement Seed preparation: Select a single colony of the constructed recombinant strain and place it in a 25 mL Erlenmeyer bottle containing 3-5 mL of fermentation broth. The concentration of ampicillin is 100 μg / mL and the concentration of spectinomycin is 50 μg / mL. Incubate for 8-16 hours with temperature set at 37-39 ° C and speed set at 200-250 revolutions / minute.

  Place the fungus cultivated over the pot in a 300 mL Erlenmeyer bottle containing 50 mL of fermentation broth at an inoculum of 0.5-3% (v / v). The concentration of ampicillin is 100 μg / mL and the concentration of spectinomycin is 50 μg / mL. Set the temperature to 37 ° C, the speed to 200-250 revolutions / minute, ferment in 6-10 hours and obtain the seed solution.

  Cultivation in fermentor: The seed solution prepared is placed in a 5L fermentor with 3L fermentation medium at 2% inoculum. Fermentation temperature is 35 ℃ -38 ℃, pH is 6.0-7.0, and dissolved oxygen is controlled to 50% or more. Fermentation time is 36-60 hours. Sample every 2-6 hours and measure the concentration of ALA by chromaticity analysis.

  Same as above for measuring ALA.

  In the above-described application of recombinant E. coli in the production of 5-aminolevulinic acid, it is desirable to select a fermentation temperature of 37 ° C. and a pH of 6.2. Control dissolved oxygen to 50% or more. The fermentation time is 60 hours.

  The method for producing recombinant E. coli and 5-aminolevulinic acid (ALA) provided by the present invention has very important industrial application value.

  Through comparison of experiments, it was found that the production of ALA in the recombinant strain DALA of the present invention was the highest.

  Among them, the ALA production of recombinant strains DEX, DEL, DA, DAL and DXAL used in the experiments in shaking culture were 0.016 g / L, 0.024 g / L, 0.176 g / L and 2.05 g / L, respectively. And 1.32 g / L. In contrast, the ALA production of the recombinant strain DALA of the present invention is 2.86 g / L, the highest in all experimental strains, and 179 times the production of ALA of the strain DEX. In the fermentation can culture, the production of ALA in the experimental recombinant Escherichia coli DALA reaches 4.13 g / L, and the conversion rate of glucose is 0.168 g ALA / g glucose. It shows very good industrial development and application potential.

[Brief description of drawings]
Figure 1. A route to ferment glucose by recombinant E. coli to produce ALA.

  Figure 2. Construction of plasmid expression vector catalog.

  Figure 3. Comparison of production of each recombinant strain ALA.

  Figure 4. ALA is produced from recombinant strains in fermentation can culture.

[Mode for Carrying Out the Invention]
General description: All enzymes involved in the examples are purchased from the TaKaRa company. Reagent boxes for extracting plasmids are purchased from the Tenne Company. Reagent boxes for recovered agarose gel DNA fragments are purchased from Henno Shinsai Company. Operation is in full accordance with the corresponding instructions. Measurement of the gene sequence in the construction of the plasmid is completed by the Hua University Gene Company. All ALA standard samples and other reagents are purchased from Sigma. DH5α competent cells are purchased from Zenki Gold Biotechnology Co., Ltd.

  LB liquid culture medium (1 L): yeast powder 5, peptone 10, NaCl 10, pH 7.0.

  LB-ampicillin resistant fixed culture medium (1 L): yeast powder 5, peptone 10, NaCl 10, ampicillin 100 μg / mL.

  ALA measurement method: Dilute the sample to 2 mL, add 1 mL acetate buffer and 0.5 mL acetylacetone, and boil for 15 minutes. Allow to cool to room temperature, then place 2 mL of reaction in a new tube and add 2 mL of modified Ehrlich's reagent. React for 20 minutes and measure with spectrophotometer 554nm.

  Distribution of the acetate buffer (1 L): 57 mL glacial acetic acid, 82 g anhydrous sodium acetate.

  The modified Ehrlich's reagent: Place 30 mL of glacial acetic acid, 1 g of p-dimethylaminobenzaldehyde and 8 mL of 70% perchloric acid in a 50 mL graduated cylinder, then make up to a volume of 50 mL.

Example 1, construction of gltX gene expression vector
Based on the sequence of the E. coli gene published by NCBI, using the primers gltX-F: 5'-TCCCTGCAGAAAGGAGGATATACATATGAAAATCAAAACTCGCTTCGCGC-3 'and gltX-R: 5'-GGCGTCGACTTACTGCTGATTTTCGCGTTCAGCAATAAAATCC-3' Use PCR to clone the gltX gene. The cloned gltX fragment is digested using the endonucleases PstI and SalI, respectively. At the same time, the plasmid vector pUC19 is also digested using the endonucleases PstI and SalI, respectively. The digested gltX fragment and the pUC19 plasmid vector are recovered using an agarose gel reagent box and ligated with T4 ligase. The binding system is 10 μL:
gltX fragment: 6μL
pUC19 vector: 2 μL
10 x Buffer: 1 μL
T4 ligase: 1μL
After binding for 12 hours at a temperature of 16 ° C., 10 μL of the binding solution is converted into E. coli DH5α competent cells. Conversion process: Add 10 μL of the binding solution to 100 μL of DH5α competent cells and stir uniformly. Ice bath for 30 minutes, heat shock for 90 seconds at a temperature of 42 ° C., then ice bath for 2 minutes and add 900 μL of LB medium. Incubate for 1 hour at a temperature of 37 ° C and a speed of 100 turns / minute. Paint an ampicillin resistant plate, incubate for 16 hours, select the transducer, extract the plasmid and verify. Then, the accuracy of the gltX gene is further verified by measuring the sequence to obtain the recombinant plasmid pUC-gltX.

Example 2, construction of hemL gene expression vector
Based on the sequence of the E. coli gene published by NCBI, using the primers hemL-F: 5'-ACAGGATCCAAAGGAGGATATACATATGAGTAAGTCTGAAAATCTTTACAGCG-3 'and hemL-R: 5'-AATGAGCTCTCACAACTTCGCAAACACCCGACGTGCAGCA-3' Use PCR to clone the hemL gene. The cloned hemL fragment is digested using the endonucleases BamI and SacI, respectively. At the same time, the plasmid vector pUC19 is also digested using the endonucleases PstI and SalI, respectively. The digested hemL fragment and the pUC19 plasmid vector are collected using an agarose gel reagent box and then combined with T4 ligase. The binding system is 10 μL:
hemL fragment: 6μL
pUC19 vector: 2 μL
10 x Buffer: 1 μL
T4 ligase: 1μL
After binding for 12 hours at a temperature of 16 ° C., 10 μL of the binding solution is converted into E. coli DH5α competent cells. Conversion process: Add 10 μL of the binding solution to 100 μL of DH5α competent cells and stir uniformly. Ice bath for 30 minutes, heat shock for 90 seconds at a temperature of 42 ° C., then bath in ice for 2 minutes and add 900 μL of LB medium. Incubate for 1 hour at a temperature of 37 ° C and a speed of 100 turns / minute. Paint an ampicillin resistant plate, incubate for 16 hours, select the transducer, extract the plasmid and verify. Then, the accuracy of the hemL gene is further verified by measuring the sequence to obtain the recombinant plasmid pUC-hemL.

Example 3, mutation of hemA gene and construction of expression vector
Based on the sequence of Salmonella published by NCBI, using the primers heMA ^M -F: 5′-CCCGTCGACAAAGGAGGATATACATATGACCAAGAAGCTTTTAGCACTCGGTATCAAC -3 ′ and hemA ^M -R: 5′-AAATCTAGACTACTCCAGCCCGAGGCTGTCGCGCAGA-3 ′ directly Clone heA ^M using bacterial PCR. The cloned hemL fragment is digested using the endonucleases SalI and XbaI, respectively. At the same time, the plasmid vector pUC19 is also digested using the endonucleases PstI and SalI, respectively. The digested heA ^M fragment and the pUC19 plasmid vector are recovered using an agarose gel reagent box and then combined with T4 ligase. The binding system is 10 μL:
hemA ^M fragment: 6μL
pUC19 vector: 2 μL
10 x Buffer: 1 μL
T4 ligase: 1μL
After binding for 12 hours at a temperature of 16 ° C., 10 μL of the binding solution is converted into E. coli DH5α competent cells. Conversion process: Add 10 μL of the binding solution to 100 μL of DH5α competent cells and stir uniformly. Bath in ice for 30 minutes, heat shock for 90 seconds at a temperature of 42 ° C., bath in ice for 2 minutes, and add 900 μL of LB medium. Incubate for 1 hour at a temperature of 37 ° C and a speed of 100 turns / minute. Paint an ampicillin resistant plate, incubate for 16 hours, select the transducer, extract the plasmid and verify. Then, to further validate the accuracy of the hemA ^M gene measuring sequence to obtain the recombinant plasmid pUC-hemA ^M.

Example 4, Construction of heM ^M and hemL Gene Co-expression Vector The plasmid pUC-hemL is digested with the endonucleases BamI and SacI to obtain the fragment BamI-hemL-SacI. Then, by BamI and SacI endonuclease, to digest handle pUC-hemA ^M plasmids. The BamI-hemL-SacI fragment with T4 ligase to bind to the pUC-hemA ^M. The binding system is 10 μL:
hemA ^M fragment: 6μL
pUC-hemA ^M vector: 2μL
10 x Buffer: 1 μL
T4 ligase: 1μL
After binding for 12 h at a temperature of 16 ° C., 10 μL of the binding solution is converted into E. coli DH5α competent cells. Conversion process: Add 10 μL of the binding solution to 100 μL of DH5α competent cells and stir uniformly. Bath in ice for 30 minutes, heat shock for 90 seconds at a temperature of 42 ° C., bath in ice for 2 minutes, and add 900 μL of LB medium. Incubate for 1 hour at a temperature of 37 ° C and a speed of 100 turns / minute. Paint ampicillin resistant plates, incubate for 16 hours, select transformants, extract plasmids and verify. Then, the accuracy of heMA ^M and hemL genes is further verified by measuring the sequence to obtain a recombinant plasmid pUC-hemA ^M -hemL.

Example 6, Construction of gltX, heM ^M and hemL gene co-expression vector The plasmid pUC-gltX is digested with the endonucleases PstI and SalI to obtain the fragment PstI-gltX-SalI. The plasmid pUC-hemA ^M -hemL is then digested with the endonucleases PstI and SalI. The fragment PstI-gltX-SalI is ligated to pUC-hemA ^M -hemL with T4 ligase. The binding system is 10 μL:
gltX fragment: 6μL
pUC-hemA ^M -hemL vector: 2μL
10 x Buffer: 1 μL
T4 ligase: 1μL
After binding for 12 hours at a temperature of 16 ° C., 10 μL of the binding solution is converted into E. coli DH5α competent cells. Conversion process: Add 10 μL of the binding solution to 100 μL of DH5α competent cells and stir uniformly. Ice bath for 30 minutes, heat shock for 90 seconds at a temperature of 42 ° C., ice bath for 2 minutes, and add 900 μL of LB medium. Incubate for 1 hour at a temperature of 37 ° C and a speed of 100 turns / minute. Paint an ampicillin resistant plate, incubate for 16 hours, select the transducer, extract the plasmid and verify. In this way, the recombinant plasmid pUC-gltX-hemA ^M -hemL is obtained.

Example 7, construction of rhtA expression vector
Based on the E. coli sequence published by NCBI, using the primers rhtA-F: 5'-CCGAAGCTTTTAATAAGGAGGATATACATATGCCTGGTTCATTACGTAAAATGCCGG-3 'and rhtA-R: 5'-GCCCTGCAGTTAATTAATGTCTAATTCTTTTATTTTGCTCTC-3' To clone rhtA. The cloned rhtA fragment is digested using the endonucleases HindIII and PstI, respectively. At the same time, the plasmid vector pCL1920 is also digested using the endonucleases HindIII and PstI, respectively. The rhtA fragment digested using the agarose gel reagent box and the pCL1920 plasmid vector are recovered and then combined with T4 ligase. The binding system is 10 μL:
rhtA fragment: 6 μL
pCL1920 vector: 2 μL
10 x Buffer: 1 μL
T4 ligase: 1μL
After binding for 12 hours at a temperature of 16 ° C., 10 μL of the binding solution is converted into E. coli DH5α competent cells. Conversion process: Add 10 μL of the binding solution to 100 μL of DH5α competent cells and stir uniformly. Ice bath for 30 minutes, heat shock for 90 seconds at a temperature of 42 ° C., ice bath for 2 minutes, and add 900 μL of LB medium. Incubate for 1 hour at a temperature of 37 ° C and a speed of 100 turns / minute. Apply ampicillin resistant plate (30 μg / mL), incubate for 16 hours, select transducer, extract plasmid and verify. Then, the accuracy of the rhta gene is further verified by measuring the sequence to obtain the overexpressed rhtA recombinant plasmid pCL1920-rhtA.

Example 8, Construction of recombinant strain and comparison of ALA production amount Construction of recombinant strain: Plasmids pUC-gltX, pUC-hemL, pUC-hemA ^M , pUC-hemA ^M -hemL and pUC-gltX-hemA ^M constructed above -hemL is transformed into E. coli DH5α competent cells, and recombinant strains DH5α / pUC-gltX (named DEX), DH5α / pUC-hemL (named DEL), DH5α / pUC-hemA ^M (named DA) DH5α / pUC-hemA ^M -hemL (named DAL) and DH5α / pUC-gltX-hemA ^M -hemL (named DXAL). The recombinant plasmid pUC-hemA ^M -hemL and the recombinant plasmid pCL1920-rhtA are both converted into E. coli DH5α competent cells to obtain a recombinant strain DH5α / pUC-hemA ^M -hemL + pCL1920-rhtA (named DALA).

Comparison of fermentation of each recombinant strain: Select a single colony of DEX, DEL, DA, DAL, DXAL and DALA of the constructed recombinant strain and place it in a 250 mL Erlenmeyer bottle containing 20 mL of fermentation medium. Incubate for 12 hours at a temperature of 37 ° C and a speed of 225 revolutions / minute. Place the culture in a 300 mL Erlenmeyer bottle containing 50 mL of fermentation broth at an inoculum of 1% by volume. Sample for 4 hours at a temperature of 37 ° C and a speed of 225 revolutions / minute. The fermentation time is 36 hours. Among them, DEX, DEL, DA, DAL, DXAL fermentation culture group allocation: (NH4) ₂ SO ₄ 16 g / L, KH ₂ PO ₄ 3 g / L, Na ₂ HPO ₄ · 12H ₂ O 16 g / L _{, MgSO 4 · 7H2O 1 g /} L, MnSO 4 · 7H 2 O 0.01 g / L, yeast powder 2 g / L, 100μg / mL ampicillin, IPTG 0.1 mM, glucose 35 g / L. Among them, the addition of ampicillin is for keeping the plasmid stable. In contrast, the allocation of fermentation culture group of recombinant strain DALA: (NH4) ₂ SO ₄ 16 g / L, KH ₂ PO ₄ 3 g / L, Na ₂ HPO ₄ · 12H ₂ O 16 g / L, MgSO ₄ · _{7H2O 1 g / L, MnSO 4} · 7H 2 O 0.01 g / L, yeast powder 2 g / L, 100μg / mL ampicillin, 50 [mu] g / mL spectinomycin, IPTG 0.1 mM, glucose 35 g / L. Among them, the addition of ampicillin and spectinomycin is for keeping the plasmid stable.

  Specific method for measuring ALA: Dilute the sample to 2 mL and add 1 mL of acetate and 0.5 mL of acetylacetone. Then simmer for 15 minutes. After cooling to room temperature, place 2 mL of reaction in a new tube and add 2 mL of modified Ehrlich's reagent. React for 20 minutes and measure with spectrophotometer 554nm.

  The statistics of the production amount of each recombinant strain ALA are as shown in FIG. Among them, ALA production amounts of recombinant strains DEX, DEL, DA, DAL and DXAL are 0.016 g / L, 0.024 g / L, 0.176 g / L, 2.05 g / L and 1.32 g / L, respectively. In contrast, the ALA production of recombinant strain DALA reached 2.86 g / L, the highest, 179 times the ALA production of strain DEX.

Example 9, Fermentative Production of Recombinant ALA by Recombinant Strain E. coli DALA Preparation of Seed Solution: A single colony of the constructed recombinant E. coli is selected and placed in a 25 mL Erlenmeyer bottle containing 4 mL of fermentation broth. Incubate for 12 hours at a temperature of 37 ° C and a speed of 225 revolutions / minute. Place the culture broth in a 300 mL Erlenmeyer bottle containing 50 mL of fermentation broth at an inoculum of 1% (v / v). Incubate for 8 hours at a temperature of 37 ° C and a speed of 225 revolutions / minute. So seed solution is completed.

  Fermentation can culture: The prepared seed solution is inoculated at a 2% (v / v) inoculation amount into a 5L fermentation can containing 3L fermentation culture medium and cultured. Fermentation temperature is 37 ° C, pH is 6.2, and dissolved oxygen is controlled to 50% or more. The fermentation time is 56h. Sample every 4 hours. Then, the concentration of ALA is measured by chromaticity analysis.

  ALA is measured by chromaticity analysis. For details, refer to the general description of the examples.

Allocation of fermentation culture group of recombinant strain DALA mentioned above: (NH4) ₂ SO ₄ 16 g / L, KH ₂ PO ₄ 3 g / L, Na ₂ HPO ₄ · 12H ₂ O 16 g / L, MgSO ₄ · 7H2O 1 g / L, MnSO ₄ · 7H ₂ O 0.01 g / L, yeast powder 2 g / L, 100 μg / mL ampicillin, 50 μg / mL spectinomycin, IPTG 0.1 mM, glucose 35 g / L.

  The result of fermentation is as shown in FIG. ALA production of recombinant E. coli DALA reaches 4.13 g / L, and glucose conversion reaches 0.168 g ALA / g glucose.

It is a figure which shows the route which ferments glucose by recombinant Escherichia coli and produces ALA. It is a figure which shows the structure of a plasmid expression vector catalog. It is a figure which shows the result of having compared the production amount of each recombinant strain ALA. It is a figure which shows producing ALA with the recombinant strain of fermentation can culture | cultivation.

Claims (10)

The name is recombinant E. coli DALA, which is produced by the following method.
A co-expression vector p-hemA ^M -hemL containing hemA ^M and hemL genes is constructed, and an expression vector p-rhtA containing rhtA is constructed. Then, the constructed recombinant plasmids (plasmid) p-hemA ^M -hemL and p-rhtA are both converted into E. coli to obtain recombinant E. coli DALA that simultaneously overexpresses heMA ^M , hemL and rhtA genes. The recombinant Escherichia coli according to claim 1, wherein the hemA ^M is a mutant of the heMA gene from Escherichia coli or Salmonella, the hemL gene is from Escherichia coli or Salmonella, and the rthA gene is from Escherichia coli. The recombinant Escherichia coli according to claim 2, wherein the hemA ^M is a mutant of the hemA gene from Arizona salmonella and the hemL gene is from Salmonella. The hemA ^M, vectors expressing hemL or rhtA gene ^{pBluescript SK -, pUC19, pUC18,} pCL1920 or recombinant E. coli according to claim 1, characterized in that the pTrc99A. Said vector expressing hemA ^M and hemL gene select pUC19, recombinant E. coli of Claim 4 vector expressing said rhtA gene, characterized in that pick pCL1920.   The recombinant E. coli according to claim 1, wherein E. coli is selected from E. coli MG1655, E. coli DH5α, E. coli JM109, E. coli W3110 or E. coli XL1-Blue.   The recombinant Escherichia coli according to claim 6, wherein Escherichia coli is selected from Escherichia coli DH5α. The recombinant Escherichia coli according to claim 1, wherein the Escherichia coli DALA is DH5α / pUC-hemA ^M -hemL + pCL1920-rhtA. The recombinant Escherichia coli produces 5-aminolevulinic acid by fermenting glucose in an improved inorganic salt culture medium, and the preparation of the improved inorganic salt culture medium is as follows: Application of said recombinant E. coli in the production of
Glucose 5-50 g / L, (NH4) ₂ SO ₄ 10-30 g / L, KH ₂ PO ₄ 1-8 g / L, Na ₂ HPO ₄・ 12H ₂ O 10-30 g / L, MgSO ₄・_{7H2O 0.1-1.5g / L, MnSO 4 ·} 7H 2 O 0.001-0.1 g / L, yeast powder 0.5-3 g / L, isopropyl-beta-D-thiogalactoside (IPTG, isopropyl-β-D -thiogalactoside) 0.05 -1 mM: Ampicillin having a concentration of 50-100 μg / mL and spectinomycin having a concentration of 30-50 μg / mL are added to the fermentation culture medium. The application of the recombinant E. coli in the production of 5-aminolevulinic acid, characterized in that the conditions under which the recombinant E. coli ferments glucose in an improved inorganic salt culture medium are as follows.
The inoculum of the bacterial species is 2% to 5% by volume, fermentation temperature is 35 ℃ -38 ℃, pH is 6.0-7.0, dissolved oxygen is controlled to 50% or more, fermentation time is 36-60 hours It is.

Images