CN104017767B - A kind of method utilizing combinatorial regulation strategy to improve 5-ALA yield - Google Patents
A kind of method utilizing combinatorial regulation strategy to improve 5-ALA yield Download PDFInfo
- Publication number
- CN104017767B CN104017767B CN201410274656.2A CN201410274656A CN104017767B CN 104017767 B CN104017767 B CN 104017767B CN 201410274656 A CN201410274656 A CN 201410274656A CN 104017767 B CN104017767 B CN 104017767B
- Authority
- CN
- China
- Prior art keywords
- hemd
- hemf
- plasmid
- heml
- hema
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Landscapes
- Preparation Of Compounds By Using Micro-Organisms (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
The invention discloses a kind of method utilizing combinatorial regulation strategy to improve 5-ALA yield, belong to metabolic engineering and field of microbial fermentation.The present invention is using EscherichiacoliBL21 (DE3) as starting strain, use expression vector pETDuet-1 and pRSFDuet-1 key gene hemL, hemA, hemD to playing positive regulating and controlling effect in ALA route of synthesis, and hemF is combined optimizing, build recombinant bacterial strain.Verifying by fermenting, adopting the plasmid pRSFDuet-1 of height copy to express hemA, hemL and hemF, middle copy plasmid pETDuet-1 expression hemD, ALA PRODUCTIVITY Productivity is the highest, about 3250mg/L.
Description
Technical field
The present invention relates to a kind of method utilizing combinatorial regulation strategy to improve 5-ALA yield, belong to metabolic engineering and field of microbial fermentation.
Background technology
5-ALA (5-aminolevulinicacid, ALA), molecular formula is C5O3NH9, molecular weight is 131.13, and fusing point is 149-151 DEG C, and it is organism synthesis chlorophyll, haemachrome, vitamin B12Deng critical precursors.ALA as a kind of safe, select, the photodynamic agents of good penetrability comes into one's own gradually at medical domain, be successfully applied in diagnosis and the optical dynamic therapy of skin carcinoma, bladder cancer, digestive tract cancer, pulmonary carcinoma etc..It addition, ALA is as the significantly high novel photo-activation pesticide of a kind of Environmental compatibility and selectivity, apply widely at pesticide field, as a kind of non-harmful environment friendly agricultural, herbicide and plant growth regulator etc..
At present, ALA synthesis is main adopts chemical method synthesis, occurs in the fifties in last century the earliest, until the nineties in 20th century, correlational study is just carried out in a large number, and achieves certain achievement.But due to chemosynthesis reaction complex steps, by-product is many, separating-purifying difficulty, the yield of ALA is relatively low, and the problem such as environmental pollution is serious, and in recent years, fermentable produces ALA has become the focus of research.In nature, there are two approach in the biosynthesis of ALA, article one, it is C4 approach, by 5-aminolevulinate synthetase (ALAS, hemA encodes) catalysis succinyl-CoA and glycine generate a step enzymatic reaction composition of ALA, it be primarily present in some photosynthetic bacterias, fungus and animal body.Other one is C5 approach, first glutamic acid is at Glutamyl-tRNA synthetase (GluRS, gltX encodes) under catalysis, generating glutamy-tRNA, then, glutamy-tRNA is at glutamyl-tRNA reductase (GluTR, hemA encode) effect under generate glutamic acid-1-semialdehyde (GSA), last GSA is by glutamic acid-1-semialdehyde-2, and 1-aminotransferase (GSA-AM, hemL encode) catalysis generates ALA.This approach is widely present in plant, algae and antibacterial (such as escherichia coli).
In early days, people screen the photosynthetic bacteria hydrogenlike silicon ion (Rhodobactersphaeroides) producing ALA, by induced mutation breeding method, it are carried out mutation, the superior strain of screening ALA, and make the yield of ALA reach 7.2g/L by fermentation optimization etc..But due to the particularity of photosynthetic bacteria, it is relatively costly, is not suitable for large-scale industrial production.Bioconversion based on C4 approach is of a relatively high owing to adding precursor succinic acid and glycine production ALA cost at present.
The present invention analyzes in escherichia coli on the basis of C5 approach (Fig. 1) regulatory mechanism systematically discussing, 5-ALA C5 route of synthesis key gene hemA and hemL and haemachrome biosynthesis pathway genes hemD and hemF utilize the plasmid of different copy number be combined optimizing, it is achieved that the further raising of ALA yield.
Summary of the invention
The technical problem to be solved in the present invention is to provide the colibacillus engineering strain of a kind of high yield 5-ALA, it is with high copy number plasmid expressing in series ALAC5 pathway key gene hemA (coding glutamyl-tRNA reductase), hemL (coding paddy ammonium aldehyde aminotransferase), and with middle copy plasmid expressing in series hemD (coding uroporphyrinogen III synthase), hemF (coding coproporphyrinogen III oxidase)；Or with high copy number plasmid expressing in series hemA, hemL, hemD, and with middle copy plasmid expression hemF；Or with high copy number plasmid expressing in series hemA, hemL, hemF, and with middle copy plasmid expression hemD.
Described escherichia coli are JM109, DH5 α, W3110 or BL21 (DE3).
The nucleotide sequence of described hemL is such as shown in SEQIDNO.1.
The nucleotide sequence of described hemA is such as shown in SEQIDNO.2.
The nucleotide sequence of described hemD is such as shown in SEQIDNO.3.
The nucleotide sequence of described hemF is such as shown in SEQIDNO.4.
Described high copy number plasmid refers to the plasmid that copy number is 100.Described middle copy plasmid refers to the plasmid that copy number is 40.
The preferred pRSFDuet-1 of described high copy number plasmid.
The described middle preferred pETDuet-1 of copy number plasmid.
Described colibacillus engineering strain is preferably with pRSFDuet-1 expressing in series hemA, hemL, hemF, and expresses hemD with pETDuet-1.
Described colibacillus engineering strain is it is also preferred that with pRSFDuet-1 expressing in series hemA, hemL, hemD, and expresses hemF with pETDuet-1.
Described colibacillus engineering strain is it is also preferred that with pRSFDuet-1 expressing in series hemA, hemL, and with pETDuet-1 expressing in series hemD, hemF.
The present invention also provides for a kind of method building described colibacillus engineering, is with high copy number plasmid expressing in series ALAC5 pathway key gene hemA, hemL, and with middle copy plasmid expressing in series with high hemD, hemF；Or with high copy number plasmid expressing in series hemA, hemL, hemD, and with middle copy plasmid expression hemF；Or with high copy number plasmid expressing in series hemA, hemL, hemF, and with middle copy plasmid expression hemD.
The hemA gene deriving from salmonella typhi is preferably connected expression vector pRSFDuet-1 with colibacillary hemL gene by described method, it is thus achieved that the coexpression vector pRSFDuet-1-hemLA of hemA and hemL gene；Colibacillary hemD and hemF gene will be derived from and connect expression vector pETDuet-1, it is thus achieved that plasmid pETDuet-1-hemD-hemF.By above-mentioned plasmid transformation escherichia coli, screening obtains positive transformant.
Described method it is also preferred that by deriving from the hemA of salmonella typhi, colibacillary hemL, hemD connection carrier pRSFDuet-1 acquisition pRSFDuet-1-hemLA-hemD, connect carrier pETDuet-1 by hemF.By above-mentioned plasmid transformation escherichia coli, screening obtains positive transformant.
Described method it is also preferred that by deriving from the hemA of salmonella typhi, colibacillary hemL, hemF connection carrier pRSFDuet-1 acquisition pRSFDuet-1-hemLA-hemF, connect carrier pETDuet-1 by hemD.By above-mentioned plasmid transformation escherichia coli, screening obtains positive transformant.
The 3rd the invention solves the problems that technical problem is that the described colibacillus engineering fermenting and producing ALA of application.
Described colibacillus engineering preferred E.coliBL21 (DE3) pRSFDuet-1-hemLApETDuet-1-hemD-hemF or E.coliBL21 (DE3) pRSFDuet-1-hemLA-hemDpETDuet-1-hemF or E.coliBL21 (DE3) pRSFDuet-1-hemLA-hemFpETDuet-1-hemD.
The culture medium that described fermenting and producing ALA relates to is preferred:
Slant medium (g/L): peptone 10, sodium chloride 10, yeast powder 5.0, agar 20, pH7.0；
Seed culture medium (g/L): peptone 10, sodium chloride 10, yeast powder 5.0, pH7.0, liquid amount 20mL/250mL；
Fermentation medium (g/L): (NH4)2SO415, KH2PO45.0, Na2HPO4·12H2O15, MgSO4·7H2O1.0, yeast extract (Yeastextract) 1.0, glucose 20, pH7.0.
The condition of culture that described fermenting and producing ALA relates to is preferred:
Spawn culture: glycerol pipe is rule, and then picking list bacterium colony streak plate 37 DEG C cultivation, as seed source；
Seed culture: flat board picking thalline, 37 DEG C, 200r/min, add ampicillin 100 μ g/mL, kanamycin 50 μ g/mL as requested, cultivate about 12h, fermentation medium of transferring；
Fermentation culture: transfer with 2% inoculum concentration, add 0.1-0.5mMIPTG inducible gene expression during 0h, be added as needed on benzylpcnicillin (100 μ g/mL) and kanamycin (50 μ g/mL), 30-37 DEG C, 200r/min cultivates, cycle 28-36h.
The present invention is expressing on the basis of C5 pathway key gene hemL and hemA, and downstream gene hemD and the hemF of coexpression ALA metabolic pathway achieves unexpected technique effect.In addition, the present invention is also by genes of interest and have the expression vector of different copy number and be combined, ALA metabolic pathway trickleer regulation and control have been carried out, gained colibacillus engineering strain 3L fermentation tank can accumulate 5-ALA 3250mg/L, effectively utilize C5 approach and promote the synthesis of 5-ALA, thus realizing microbe fermentation method direct fermentation glucose synthesis 5-ALA.
Accompanying drawing explanation
Fig. 1: ALAC5 route of synthesis in escherichia coli.
Fig. 2: construction of recombinant plasmid restriction enzyme digestion and electrophoresis figure
M1:DL5000Marker
M2:DL10000Marker
A:pETDuet-1-hemLA
B:pETDuet-1-hemD
C:pETDuet-1-hemF
D:pRSFDuet-1-hemD
E:pETDuet-1-hemLA-hemD
F:pETDuet-1-hemLA-hemF
G:pETDuet-1-hemD-hemF
H:pRSFDuet-1-hemLA-hemD
I:pRSFDuet-1-hemF
J:pRSFDuet-1-hemD-hemF
K:pRSFDuet-1-hemLA
L:pRSFDuet-1-hemLA-hemF
Fig. 3: recombinant bacterium shake flask fermentation ALA yield
LADF-1:E.coliBL21(DE3)pETDuet-1-hemLApRSFDuet-1-hemD-hemF
LADF-2:E.coliBL21(DE3)pETDuet-1-hemLA-hemDpRSFDuet-1-hemF
LADF-3:E.coliBL21(DE3)pETDuet-1-hemLA-hemFpRSFDuet-1-hemD
LADF-4:E.coliBL21(DE3)pRSFDuet-1-hemLApETDuet-1-hemD-hemF
LADF-5:E.coliBL21(DE3)pRSFDuet-1-hemLA-hemDpETDuet-1-hemF
LADF-6:E.coliBL21(DE3)pRSFDuet-1-hemLA-hemFpETDuet-1-hemD
Fig. 4: recombinant bacterium LADF-6 sweat curve chart
LADF-6:E.coliBL21(DE3)pRSFDuet-1-hemLA-hemFpETDuet-1-hemD
Detailed description of the invention
ALA analyzes method:
Adopt the spectrophotography of Mauzerall and Granick: by diluted sample to 2mL, add the acetate buffer of 1mL, the acetylacetone,2,4-pentanedione of 0.5mL, then boil 15min.It is cooled to room temperature, takes the reactant liquor of 2mL to new pipe, be subsequently adding improvement Ehrlich ' the s reagent of 2mL, react 20min, utilize and detect under spectrophotometer 554nm.
Culture medium:
Slant medium (g/L): peptone 10, sodium chloride 10, yeast powder 5.0, agar 20, pH7.0；
Seed culture medium (g/L): peptone 10, sodium chloride 10, yeast powder 5.0, pH7.0, liquid amount 20mL/250mL；
Fermentation medium (g/L): (NH4)2SO415, KH2PO45.0, Na2HPO4·12H2O15, MgSO4·7H2O1.0, yeastextract1.0, Glucose20, pH7.0.
Condition of culture:
Spawn culture: glycerol pipe is rule, and then picking list bacterium colony streak plate 37 DEG C cultivation, as seed source；
Seed culture: flat board picking thalline, 37 DEG C, 200r/min, add ampicillin 100 μ g/mL, kanamycin 50 μ g/mL as requested, cultivate about 12h, fermentation medium of transferring；
Fermentation culture: transfer with 2% inoculum concentration, add 0.1-0.5mMIPTG inducible gene expression during 0h, be added as needed on benzylpcnicillin (100 μ g/mL) and kanamycin (50 μ g/mL), 30-37 DEG C, 200r/min cultivates, cycle 28-36h.
The structure of embodiment 1 recombiant plasmid and qualification
(1) structure of recombiant plasmid
Obtaining hemL, hemD, and hemF with genome of E.coli for template, hemA derives from salmonella typhi,
Primer following (underscore part is restriction enzyme site)
hemL-hemAF:CGCGGATCCATAAAAGGAGGAAAATATATGAGTAAGTCTGAA
hemL-hemAR:TGCACTGCAGCTACTCCAGCCCGAGGCTG
hemD-F:CGCCATATGAGTATCCTTGTCACCCGCC
hemD-R:CCGCTCGAGTTATTGTAATGCCCGTAAAAGCG
hemF-F:CGCCATATGAAACCCGACGCACACC
hemF-R:CCGCTCGAGTTACACCCAATCCCTGACCTTAAT
hemD(2)-F:CGCGGATCCATAAAAGGAGGAAAATATATGAGTATCCTTGTCACCCG
hemD(2)-R:TGCACTGCAGTTATTGTAATGCCCGTAAAAGCG
Reaction condition is: 94 DEG C of 5min；94 DEG C of 30s, 58 DEG C of 30s, 72 DEG C of 150s (hemL-hemA)/60s (hemD and hemF) (30 circulations)；72 DEG C of 10min carry out PCR reaction, and verify with 0.8% agarose gel electrophoresis and reclaim pcr amplification product, after restriction enzymes double zyme cutting purification, overnight connect in 16 DEG C with corresponding expression vector with T4DNA ligase, connect product Transformed E .coliJM109, select positive colony extract plasmid and serve the raw work sequence verification in sea, plasmid construction restriction enzyme digestion and electrophoresis figure such as Fig. 2.
The hemA gene that gained derives from salmonella typhi utilizes restriction enzyme site BamHI and PstI to be connected in expression vector pETDuet-1 and pRSFDuet-1 respectively with colibacillary hemL by amplification, it is thus achieved that coexpression vector pETDuet-1-hemLA and the pRSFDuet-1-hemLA of hemA and hemL gene.
Gained derives from colibacillary hemD and hemF gene respectively through amplification and utilizes restriction enzyme site NdeI and XhoI to connect in expression vector pETDuet-1 and pRSFDuet-1 respectively, it is thus achieved that plasmid pETDuet-1-hemD and pRSFDuet-1-hemD and pETDuet-1-hemF and pRSFDuet-1-hemF.
Gained derives from colibacillary hemD gene utilizes restriction enzyme site BamHI and PstI to connect in carrier pETDuet-1-hemF and pRSFDuet-1-hemF by amplification, it is thus achieved that expression vector pETDuet-1-hemD-hemF and pRSFDuet-1-hemD-hemF.
The hemA gene that gained derives from salmonella typhi utilizes restriction enzyme site BamHI and PstI to be connected carrier pETDuet-1-hemD and pRSFDuet-1-hemD and pETDuet-1-hemF and pRSFDuet-1-hemF respectively with hemL by amplification, it is thus achieved that expression vector pETDuet-1-hemLA-hemD and pRSFDuet-1-hemLA-hemD and pETDuet-1-hemLA-hemF and pRSFDuet-1-hemLA-hemF.
(2) structure of ALA fermentation recombinant bacterial strain
Basic skills is by the recombiant plasmid pETDuet-1-hemLA built and pRSFDuet-1-hemD-hemF cotransformation E.coliBL21 (DE3), it is thus achieved that recombinant bacterium E.coliLADF-1.
By the recombiant plasmid pETDuet-1-hemLA-hemD built and pRSFDuet-1-hemF cotransformation E.coliBL21 (DE3), it is thus achieved that recombinant bacterium E.coliLADF-2.
By the recombiant plasmid pETDuet-1-hemLA-hemF built and pRSFDuet-1-hemD cotransformation E.coliBL21 (DE3), it is thus achieved that recombinant bacterium E.coliLADF-3.
By the recombiant plasmid pRSFDuet-1-hemLA built and pETDuet-1-hemD-hemF cotransformation E.coliBL21 (DE3), it is thus achieved that recombinant bacterium E.coliLADF-4.
By the recombiant plasmid pRSFDuet-1-hemLA-hemD built and pETDuet-1-hemF cotransformation E.coliBL21 (DE3), it is thus achieved that recombinant bacterium E.coliLADF-5.
By the recombiant plasmid pRSFDuet-1-hemLA-hemF built and pETDuet-1-hemD cotransformation E.coliBL21 (DE3), it is thus achieved that recombinant bacterium E.coliLADF-6.
The fermentation checking of embodiment 2 recombinant bacterium
Bacterial strain:
LADF-1:E.coliBL21(DE3)pETDuet-1-hemLApRSFDuet-1-hemD-hemF
LADF-2:E.coliBL21(DE3)pETDuet-1-hemLA-hemDpRSFDuet-1-hemF
LADF-3:E.coliBL21(DE3)pETDuet-1-hemLA-hemFpRSFDuet-1-hemD
LADF-4:E.coliBL21(DE3)pRSFDuet-1-hemLApETDuet-1-hemD-hemF
LADF-5:E.coliBL21(DE3)pRSFDuet-1-hemLA-hemDpETDuet-1-hemF
LADF-6:E.coliBL21(DE3)pRSFDuet-1-hemLA-hemFpETDuet-1-hemD
Different recombination bacillus colis carry out fermenting experiment contrast.Recombinant bacterium LADF-1, LADF-2, LADF-3, LADF-4, LADF-5 and LADF-6 carry out fermenting experiment, measure ALA yield as shown in Figure 3: by adopting vector expression hemL and the hemA and hemD and hemF of different copy number, can be seen that plasmid expression hemL, hemA and the hemF by adopting high copy, the plasmid expression hemD of middle copy, the yield of ALA is the highest, for 2100mg/L (Fig. 3).
Embodiment 3 recombinant bacterium LADF-63L ferment tank is verified
Bacterial strain: LADF-6:E.coliBL21 (DE3) pRSFDuet-1-hemLA-hemFpETDuet-1-hemD.
Recombination bacillus coli LADF-6 produces in 3L fermentation cylinder for fermentation, inoculum concentration 2%, initial glucose concentration is 33g/L, 0h adds 0.1-0.5mMIPTG induction and corresponding antibiotic, change over time, after 10h, ALA starts a large amount of accumulation, the highest in 30hALA yield, for 3250mg/L (Fig. 4).
Although the present invention is with preferred embodiment openly as above; but it is not limited to the present invention, any person skilled in the art, without departing from the spirit and scope of the present invention; all can doing various changes and modification, therefore protection scope of the present invention should with being as the criterion that claims define.
Claims (9)
1. the colibacillus engineering strain of a high yield 5-ALA, it is characterised in that be with high copy number plasmid expressing in series ALAC5 pathway key gene hemA, hemL, and with middle copy plasmid expressing in series hemD, hemF；Or with high copy number plasmid expressing in series hemA, hemL, hemD, and with middle copy plasmid expression hemF；Or with high copy number plasmid expressing in series hemA, hemL, hemF, and with middle copy plasmid expression hemD；Described high copy number plasmid refers to the plasmid that copy number is 100, and described middle copy plasmid refers to the plasmid that copy number is 40.
2. colibacillus engineering strain according to claim 1, it is characterised in that the nucleotide sequence of described hemL is such as shown in SEQIDNO.1, and the nucleotide sequence of described hemA is such as shown in SEQIDNO.2.
3. colibacillus engineering strain according to claim 1, it is characterised in that the nucleotide sequence of described hemD is such as shown in SEQIDNO.3, and the nucleotide sequence of described hemF is such as shown in SEQIDNO.4.
4. according to the arbitrary described colibacillus engineering strain of claim 1-3, it is characterised in that described escherichia coli are JM109, DH5 α, W3110 or BL21 (DE3).
5. colibacillus engineering strain according to claim 1, it is characterised in that described high copy number plasmid is pRSFDuet-1, described middle copy plasmid is pETDuet-1.
6. according to the arbitrary described colibacillus engineering strain of claim 1-3, it is characterised in that with pRSFDuet-1 expressing in series hemA, hemL, and with pETDuet-1 expressing in series hemD and hemF.
7. according to the arbitrary described colibacillus engineering strain of claim 1-3, it is characterised in that with pRSFDuet-1 expressing in series hemA, hemL, hemD, and express hemF with pETDuet-1.
8. according to the arbitrary described colibacillus engineering strain of claim 1-3, it is characterised in that with pRSFDuet-1 expressing in series hemA, hemL, hemF, and express hemD with pETDuet-1.
9. applying the method for engineered strain fermentative Production 5-ALA described in claim 1 for one kind, it is characterised in that after engineered strain activation, fermentation medium of transferring, 30-37 DEG C, 200r/min cultivates, fermentation period 28-36h.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410274656.2A CN104017767B (en) | 2014-06-18 | 2014-06-18 | A kind of method utilizing combinatorial regulation strategy to improve 5-ALA yield |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410274656.2A CN104017767B (en) | 2014-06-18 | 2014-06-18 | A kind of method utilizing combinatorial regulation strategy to improve 5-ALA yield |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN104017767A CN104017767A (en) | 2014-09-03 |
| CN104017767B true CN104017767B (en) | 2016-07-06 |
Family
ID=51434775
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201410274656.2A Active CN104017767B (en) | 2014-06-18 | 2014-06-18 | A kind of method utilizing combinatorial regulation strategy to improve 5-ALA yield |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN104017767B (en) |
Families Citing this family (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104561158B (en) * | 2015-01-13 | 2018-01-16 | 江南大学 | One kind addition Fe2+Improve the method that colibacillus engineering synthesizes 5 amino-laevulic acids |
| CN104830748B (en) * | 2015-06-02 | 2018-04-06 | 江南大学 | A kind of reduction hemB gene expressions improve the method that Escherichia coli synthesize 5 amino-laevulic acids |
| CN112301049B (en) * | 2020-11-02 | 2022-10-28 | 中国科学技术大学 | Recombinant plasmid and genetic engineering strain for high yield of heme, construction method thereof and method for high yield of heme |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102206606A (en) * | 2011-03-31 | 2011-10-05 | 山东大学 | Recombinant escherichia coli and application thereof in production of 5-aminolevulinic acid (ALA) |
Family Cites Families (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20050089972A1 (en) * | 2003-08-01 | 2005-04-28 | Claudia Schmidt-Dannert | Production of porphyrins |
-
2014
- 2014-06-18 CN CN201410274656.2A patent/CN104017767B/en active Active
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102206606A (en) * | 2011-03-31 | 2011-10-05 | 山东大学 | Recombinant escherichia coli and application thereof in production of 5-aminolevulinic acid (ALA) |
Non-Patent Citations (2)
| Title |
|---|
| A Novel Pathway for the Biosynthesis of Heme in Archaea: Genome-Based Bioinformatic Predictions and Experimental Evidence;Sonja Storbeck et al.;《Archaea》;20101231;第2010卷;1-15 * |
| Optimization of the heme biosynthesis pathway for the production of 5-aminolevulinic acid in Escherichia coli;Junli Zhang et al.;《scientific reports》;20150226;1-7 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN104017767A (en) | 2014-09-03 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN104004701B (en) | Method for building high-yield 5-aminolevulinic acid escherichia coli engineering strains | |
| Kirsch et al. | Salt-regulated accumulation of the compatible solutes sucrose and glucosylglycerol in cyanobacteria and its biotechnological potential | |
| CN103981203B (en) | 5 amino-laevulic acid superior strains and its preparation method and application | |
| JP5895004B2 (en) | Recombinant E. coli and its application in the production of 5-aminolevulinic acid | |
| Kwon et al. | Long-term continuous adaptation of Escherichia coli to high succinate stress and transcriptome analysis of the tolerant strain | |
| Mitsui et al. | Construction of lactic acid-tolerant Saccharomyces cerevisiae by using CRISPR-Cas-mediated genome evolution for efficient d-lactic acid production | |
| CN104830748B (en) | A kind of reduction hemB gene expressions improve the method that Escherichia coli synthesize 5 amino-laevulic acids | |
| CN108531437B (en) | 5-aminolevulinic acid biosynthesis pathway mediated by glyoxylate aminotransferase | |
| WO2012082720A3 (en) | Method of producing succinic acid and other chemicals using sucrose-containing feedstock | |
| CN106047916A (en) | Corynebacterium glutamicum strain for production of 5-aminolevulinic acid and construction and application of corynebacterium glutamicum strain | |
| CN104017767B (en) | A kind of method utilizing combinatorial regulation strategy to improve 5-ALA yield | |
| CN106497858B (en) | A kind of colibacillus engineering producing 5-ALA | |
| CN114381416B (en) | Recombinant escherichia coli strain for high yield of 5-aminolevulinic acid and application thereof | |
| US20140178961A1 (en) | Constructs and strains for fixing carbon dioxide and methods for preparing the same | |
| CN108424868A (en) | A kind of recombinant bacterium using natural double carbon source high yield N-acetyl-neuraminates | |
| WO2022007205A1 (en) | Method for increasing content of intracellular heme in escherichia coli | |
| Tan et al. | Design and optimization of bioreactor to boost carbon dioxide assimilation in RuBisCo-equipped Escherichia coli | |
| MX2015004401A (en) | Process for producing gougerotin employing streptomyces microflavus strains. | |
| Guo et al. | Recruiting a phosphite dehydrogenase/formamidase-driven antimicrobial contamination system in Bacillus subtilis for nonsterilized fermentation of acetoin | |
| Li et al. | High-level production of pullulan from high concentration of glucose by mutagenesis and adaptive laboratory evolution of Aureobasidium pullulans | |
| CN106929499A (en) | A kind of Glucosamine synthase mutant of directional transformation and its application | |
| Lee et al. | Observation of 2, 3-butanediol biosynthesis in Lys regulator mutated Klebsiella pneumoniae at gene transcription level | |
| CN104894043A (en) | Engineering bacteria for producing gamma-aminobutyric acid and construction method and application thereof | |
| CN109312314A (en) | New polyphosphate interdependence glucokinase and the method for preparing G-6-P using it | |
| CN104561158B (en) | One kind addition Fe2+Improve the method that colibacillus engineering synthesizes 5 amino-laevulic acids |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant |