JP2013099253A - Diagnostic marker for lung cancer or cervical cancer - Google Patents

Abstract

PROBLEM TO BE SOLVED: To elucidate a diagnostic means for cancer having a principle different from that of a conventional one, a new diagnostic marker for cancer or a diagnostic means for cancer excellent in detection accuracy.SOLUTION: A polynucleotide is used for diagnosing cancer, wherein the polynucleotide hybridizes with a nucleic acid, a part of the same or a complementary strand thereof, wherein the nucleic acid contains one or more kinds of base sequences selected from the group consisting of a human-originated specific base sequence, a base sequence having ≥80% homology to the base sequence, a base sequence in which one or more bases are deleted, substituted or added, or a base sequence of a nucleic acid hybridizing with a nucleic acid comprising a base sequence complementary to the base sequence under stringent conditions.

Description

  The present invention relates to a cancer diagnostic marker or a detection product thereof.

  Cancer is one of the leading causes of death worldwide. According to the World Health Organization (WHO), approximately 13% (7.9 million) of deaths worldwide were reported to have died from cancer in 2007. In addition, the number of deaths due to cancer is expected to increase in the future. Under such circumstances, various cancer diagnostic markers have been researched and developed by researchers and experts all over the world for early diagnosis, prognosis or improvement of cancer. For example, α-fetoprotein, CEA, CA19-9, PSA, SCC and the like are conventionally used.

  Classification of cancer diagnostic markers includes low molecular weight compounds, DNA (Deoxyribonucleic acid), mRNA (messenger ribonucleic acid), proteins, sugar chains and the like. For example, Patent Document 1 describes that mRNA having a specific base sequence can be used as a diagnostic marker for lung cancer. Patent Document 2 describes that mRNA encoding a specific CAPN10 can be used as a diagnostic marker for type 2 diabetes. Patent Document 3 describes that GPC3 protein can be used as a diagnostic marker for liver cancer. Patent Document 4 describes that a protein having a specific amino acid sequence can be used as a diagnostic marker for liver cancer.

  Examples of the method for detecting a cancer diagnostic marker include immunoassay, real-time PCR, RT-PCR, Southern blot, Northern blot and the like. For example, Patent Document 1 describes an inspection method using RT-PCR. Patent Document 2 and Patent Document 3 describe inspection methods using real-time PCR. Patent Document 4 describes a test method using an immunoassay.

Japanese Patent No.4392163 Japanese Patent No. 4214235 Japanese Patent No. 4283227 Japanese Patent No. 4280814

However, the prior art described in the above literature has room for improvement in the following points.
Although there are various conventional cancer diagnostic markers, there are cases in which cancer cannot be detected even if they are used. For example, since the onset mechanism of cancer is complex, there are cases where conventional cancer markers do not increase as usual even if cancer develops or progresses. Therefore, a cancer diagnostic means having a different principle from the conventional one is necessary.

  Moreover, the conventional cancer diagnostic marker is only one of the indexes for measuring the possibility of cancer, and even if the diagnostic result is negative, the cancer cannot be completely denied. Therefore, in the medical field, cancer may be evaluated by combining multiple types of cancer diagnostic markers. Therefore, a new cancer diagnostic marker is necessary to further improve the diagnostic accuracy.

  Furthermore, early detection is important for treating cancer and stopping cancer progression. However, in the case of early cancer, the amount of the cancer diagnostic marker present in the test sample is often a very small amount, and it is not easy to detect. Therefore, there is a need for a cancer diagnostic means with excellent detection accuracy that can detect a small amount of cancer diagnostic markers.

  In addition, conventional cancer diagnostic markers sometimes showed false positives in normal cells. Therefore, a cancer diagnostic marker specific to cancer that is difficult to detect in normal cells is required.

  The present invention has been made in view of the above circumstances, and an object thereof is to provide a novel cancer diagnostic marker.

  According to the present invention, there is provided a polynucleotide that hybridizes with a nucleic acid comprising the nucleotide sequence of SEQ ID NO: 1 or a part thereof, or a complementary strand thereof.

  It has been demonstrated that this polynucleotide can bind to mRNA that is strongly suggested to be overexpressed in lung cancer or cervical cancer in Examples described later. Therefore, this polynucleotide can be used for cancer diagnosis of lung cancer or cervical cancer.

  In addition, according to the present invention, there is provided a cancer diagnostic agent comprising a polynucleotide that hybridizes with a nucleic acid comprising the nucleotide sequence of SEQ ID NO: 1 or a part thereof, or a complementary strand thereof.

  This cancer diagnostic agent contains a polynucleotide that has been demonstrated to bind to mRNA that is strongly suggested to be overexpressed in lung cancer or cervical cancer in the examples described below. Therefore, if this diagnostic agent is used and further a diagnostic method known in the art is used, cancer can be diagnosed.

  In addition, according to the present invention, there is provided a cancer diagnostic kit comprising a cancer diagnostic agent having a polynucleotide that hybridizes with a nucleic acid comprising the nucleotide sequence of SEQ ID NO: 1 or a part thereof, or a complementary strand thereof.

  This cancer diagnostic kit contains a cancer diagnostic agent having a polynucleotide that has been demonstrated to be able to bind to mRNA that is strongly suggested to be overexpressed in lung cancer or cervical cancer in the examples described later. Therefore, using this cancer diagnostic kit makes it possible to diagnose cancer.

  Moreover, according to this invention, the cancer diagnostic marker containing the RNA chain | strand which has a base sequence of sequence number 1 is provided.

  It is strongly suggested that this cancer diagnostic marker is overexpressed in lung cancer or cervical cancer in Examples described later. Therefore, if this cancer diagnostic marker and a diagnostic method known in the art are used, a cancer can be diagnosed.

  The present invention also provides a cancer diagnostic marker comprising an RNA chain having the base sequence from 1071st G to 3379th A of SEQ ID NO: 1.

  It is strongly suggested that this cancer diagnostic marker is overexpressed in lung cancer or cervical cancer in Examples described later. Therefore, if this cancer diagnostic marker and a diagnostic method known in the art are used, a cancer can be diagnosed.

  In addition, according to the present invention, in a test sample derived from a subject, a cancer diagnostic marker comprising an RNA chain having the base sequence of SEQ ID NO: 1 or the 1071st G to 3379th A base sequence of SEQ ID NO: 1 There is provided a method for examining a subject's cancer comprising the step of detecting.

  The method for examining this cancer includes a step of detecting a cancer diagnostic marker that is strongly suggested to be overexpressed in lung cancer or cervical cancer in Examples described later. Therefore, cancer can be diagnosed by using this method.

  In addition, according to the present invention, in a test sample derived from a subject, a cancer diagnostic marker comprising an RNA chain having the base sequence of SEQ ID NO: 1 or the 1071st G to 3379th A base sequence of SEQ ID NO: 1 A method for examining the prognosis of cancer in a subject is provided, comprising the step of detecting.

  This method for examining the prognosis of cancer includes a step of detecting a cancer diagnostic marker which is strongly suggested to be overexpressed in lung cancer or cervical cancer in Examples described later. Therefore, if this method is used, the prognosis of cancer can be diagnosed.

  According to the present invention, there is also provided a cancer diagnostic marker comprising an RNA chain having a base sequence of SEQ ID NO: 1 or a 1071st G to 3379th A base sequence of SEQ ID NO: 1 in a test sample derived from a subject. A detecting unit for detecting, a quantifying unit for quantifying the amount of the cancer diagnostic marker based on a detection intensity of the cancer diagnostic marker, and a determining unit for determining whether the amount of the cancer diagnostic marker exceeds a predetermined threshold And an apparatus for diagnosing cancer provided with an output unit that outputs the result of the determination.

  This cancer diagnostic apparatus includes a step of detecting a cancer diagnostic marker that is strongly suggested to be overexpressed in lung cancer or cervical cancer in Examples described later. Therefore, if this apparatus is used, it becomes possible to diagnose cancer.

  Further, according to the present invention, a cancer comprising a computer comprising an RNA chain having a base sequence of SEQ ID NO: 1 or a 1071st G to a 3379th A base sequence of SEQ ID NO: 1 in a test sample derived from a subject Detecting a diagnostic marker; quantifying the amount of the cancer diagnostic marker based on a detection intensity of the cancer diagnostic marker; and determining whether the amount of the cancer diagnostic marker exceeds a predetermined threshold And a program for cancer diagnosis for executing the step of outputting the determination result.

  This cancer diagnostic program includes a step of detecting a cancer diagnostic marker that is strongly suggested to be overexpressed in lung cancer or cervical cancer in Examples described later. Therefore, using this cancer diagnosis program makes it possible to diagnose cancer.

  The present invention also provides an antibody that binds to a nucleic acid comprising the nucleotide sequence of SEQ ID NO: 1 or a part thereof, or a complementary chain thereof.

  It is strongly suggested that the nucleic acid binding to this antibody or a part thereof, or a complementary strand thereof is overexpressed in lung cancer or cervical cancer in the examples described later. Therefore, this antibody can be used for cancer diagnosis of lung cancer or cervical cancer.

  The polynucleotide, the cancer diagnostic agent, the cancer diagnostic kit, the cancer diagnostic marker, the method for examining the cancer, the method for examining the prognosis of the cancer, the device for cancer diagnosis, the program for cancer diagnosis, And the antibody has a nucleotide sequence in which SEQ ID NO: 1 has a homology of 80% or more with respect to the nucleotide sequence of SEQ ID NO: 1, wherein one or several bases are deleted, substituted or substituted in the nucleotide sequence of SEQ ID NO: 1 One or more base sequences selected from the group consisting of an added base sequence, a base sequence of a nucleic acid that hybridizes under stringent conditions to a nucleic acid consisting of a base sequence complementary to the base sequence of SEQ ID NO: 1. Even so, it is easily assumed by those skilled in the art that the same effect can be obtained.

  The present invention also provides a polynucleotide that hybridizes with a nucleic acid encoding mouse NKX1-2 ortholog protein, a complementary strand of the nucleic acid, or a part thereof.

  It has been demonstrated that this polynucleotide can bind to a nucleic acid encoding a mouse NKX1-2 ortholog protein, which is strongly suggested to be overexpressed in lung cancer or cervical cancer in Examples described later. Therefore, this polynucleotide can be used for cancer diagnosis of lung cancer or cervical cancer.

  Moreover, according to this invention, the cancer diagnostic marker containing mouse | mouth NKX1-2 ortholog protein is provided.

  It is strongly suggested that this cancer diagnostic marker is overexpressed in lung cancer or cervical cancer in Examples described later. Therefore, if this cancer diagnostic marker and a diagnostic method known in the art are used, a cancer can be diagnosed.

  Moreover, according to this invention, the mouse | mouth NKX1-2 ortholog protein binding antibody couple | bonded with a cancer diagnostic marker containing mouse | mouth NKX1-2 ortholog protein is provided.

  It is strongly suggested that the cancer diagnostic marker to which this mouse NKX1-2 ortholog protein-binding antibody can bind is overexpressed in lung cancer or cervical cancer in Examples described later. Therefore, this mouse NKX1-2 ortholog protein-binding antibody can be used for cancer diagnosis of lung cancer or cervical cancer.

  Moreover, according to this invention, the polynucleotide couple | bonded with a cancer diagnostic marker containing mouse | mouth NKX1-2 ortholog protein is provided.

  It is strongly suggested that a cancer diagnostic marker to which this polynucleotide can be bound is overexpressed in lung cancer or cervical cancer in Examples described later. Therefore, this polynucleotide can be used for cancer diagnosis of lung cancer or cervical cancer.

  According to the present invention, since a novel cancer diagnostic marker is provided, cancer diagnosis can be performed by a method different from the conventional method. Or since the novel substance couple | bonded with the cancer diagnostic marker is provided, a novel cancer diagnostic agent is obtained.

FIG. 1 is a functional block diagram showing the overall configuration of the cancer diagnosis apparatus 1000. FIG. 2 is a flowchart for explaining the operation of the cancer diagnosis apparatus 1000. FIG. 3 is a view showing the positional relationship between the mouse NKX1-2 ortholog gene in the genomic DNA and the SCpair67633_L primer and the like. FIG. 4 is a diagram showing the positional relationship between the position corresponding to the mouse NKX1-2 ortholog gene in mRNA, the position corresponding to the poly A signal, the intron, and various primers.

Hereinafter, embodiments of the present invention will be described in detail. For similar contents,
In order to avoid repeated complications, description will be omitted as appropriate.

<Embodiment 1: Cancer diagnostic marker>
The cancer diagnostic marker according to the present embodiment is a cancer diagnostic marker including an RNA chain, which includes the nucleotide sequence of SEQ ID NO: 1 or the nucleotide sequence from the 1070th G to the 3379th A of SEQ ID NO: 1. Here, it is strongly suggested that the RNA strand is overexpressed in lung cancer or cervical cancer in Examples described later. In the examples described later, the expression of the RNA chain is not detected in adjacent normal cells, and it is strongly suggested that the expression specificity is high in lung cancer or cervical cancer. Therefore, the cancer diagnostic marker can be suitably used as a cancer diagnostic marker for lung cancer or cervical cancer. Similarly, the above-mentioned cancer diagnostic marker is used as a cancer diagnostic marker for cancer that overexpresses the nucleotide sequence of SEQ ID NO: 1 or the RNA chain comprising the 1070th G to 3379th A base sequence of SEQ ID NO: 1. Can also be used. The 1070th G of SEQ ID NO: 1 refers to the 5 ′ terminal base on the 116_L primer side of the base sequence in which DNA amplification was observed by RT-PCR using 116_L primer and 20_R primer in the examples described later It corresponds to. The 3379th A in SEQ ID NO: 1 is a base located at the 3 ′ end of SEQ ID NO: 1.

  The cancer diagnostic marker comprises an RNA chain comprising a base sequence having 80% or more homology with the base sequence of SEQ ID NO: 1 or the base sequence of 1070th G to 3379th A of SEQ ID NO: 1. Includes cancer diagnostic markers. Here, the above 80% or more preferably has 85% or more homology with SEQ ID NO: 1, more preferably 90% or more, more preferably 95% or more. And more preferably 98% or more. This is because the above-mentioned RNA strand containing a base sequence having a homology of 80% or more is compared with the RNA strand containing the base sequence of SEQ ID NO: 1 or the 1070th G to 3379th A base sequence of SEQ ID NO: 1. This is because the higher the homology is, the closer to the RNA chain containing the nucleotide sequence of SEQ ID NO: 1 or the nucleotide sequence of 1079th G to 3379th A of SEQ ID NO: 1.

  In addition, the above-mentioned cancer diagnostic marker is a nucleotide sequence in which one or several bases are deleted, substituted or added in the nucleotide sequence of SEQ ID NO: 1 or the nucleotide sequence of 1070th G to 3379th A of SEQ ID NO: 1. A cancer diagnostic marker having an RNA strand comprising Here, the above one or several is preferably 30, more preferably 20, more preferably 15, more preferably 10, and more preferably 5. The number is preferably 4, more preferably 3, more preferably 2, and even more preferably 1. This is because an RNA strand containing a base sequence in which one or several bases are deleted, substituted or added is the base sequence of SEQ ID NO: 1 or the base sequence of A from the 3rd to the 3379th A of SEQ ID NO: 1. The fewer nucleotide deletions, substitutions or additions to the RNA strand containing, the closer to the RNA strand containing the nucleotide sequence of SEQ ID NO: 1 or the nucleotide sequence of 1070th G to 3379th A of SEQ ID NO: 1 It is because it will have.

  In addition, the above-mentioned cancer diagnostic marker is used under stringent conditions with respect to a nucleic acid consisting of a base sequence complementary to the base sequence of SEQ ID NO: 1 or the base sequence of 1070th G to 3379th A of SEQ ID NO: 1. A cancer diagnostic marker having an RNA chain containing the base sequence of the nucleic acid to be hybridized is included.

  As used herein, “overexpression” means significantly more expression than the expression level of a control sample (for example, a cell that does not develop lung cancer and cervical cancer, a normal cell, or a sample derived therefrom). Indicates the state of being. Here, being significant means, for example, that a statistically significant difference between a control sample and a test sample is evaluated using a Student's t-test, and statistical analysis is performed when p <0.05. Can be considered significant.

  As used herein, “homology” is a ratio of the number of identical amino acids in an amino acid sequence between two or more amino acids calculated according to a method known in the art. Before calculating the ratio, the amino acid sequences of the amino acid sequences to be compared are aligned, and a gap is introduced into a part of the amino acid sequence if necessary to maximize the same ratio. Nor do any conservative substitutions be considered identical. Further, it means the ratio of the same number of amino acids to all amino acid residues including overlapping amino acids in an optimally aligned state. Alignment methods, percentage calculation methods, and related computer programs are well known in the art and use common sequence analysis programs (eg GENETYX, GeneChip Sequence Analysis, etc.) Can be measured. In addition, “homology” is obtained by calculating the ratio of the same base in two or more DNA strands or two or more RNA strands according to a method known in the art as described above. is there.

  In this specification, “stringent conditions” means, for example, (1) low ionic strength and high temperature for washing, for example, 0.015 M sodium chloride / 0.0015 M sodium citrate / 0.005 at 50 ° C. Using 1% sodium dodecyl sulfate, (2) denaturing agents such as formamide during hybridization, eg 50% (vol / vol) formamide and 0.1% bovine serum albumin / 0.1% ficoll / 42 ° C. With 0.1% polyvinylpyrrolidone / 50 mM sodium phosphate buffer (pH 6.5) and 750 mM sodium chloride, 75 mM sodium citrate, or (3) 50% formamide, 5 × SSC (0.75 M NaCl, 0.075 M sodium citrate), 50 mM sodium phosphate (PH 6.8), 0.1% sodium pyrophosphate, 5 × Denhardt's solution, sonicated salmon sperm DNA (50 μg / ml), 0.1% SDS, and 10% dextran sulfate at 0 ° C. at 42 ° C. Conditions may include washing in 2 × SSC (sodium chloride / sodium citrate) and formamide at 55 ° C. followed by stringent washing in 0.1 × SSC containing EDTA at 55 ° C. The stringency of the hybridization reaction can be easily determined by those skilled in the art and generally depends on the probe length, the washing temperature, and the salt concentration. In general, longer probes require higher temperatures for proper annealing, and shorter probes require lower temperatures. In general, stringency is inversely proportional to salt concentration.

  As used herein, “hybridization” as applied to a polynucleotide refers to the property of allowing pairing between nucleotides by hydrogen bonding between nucleotide bases. Base pairs can occur in Watson-Crick base pairs, Hoogsteen base pairs, or any other sequence specific form. Base pairs include double strands forming a double stranded structure, three or more strands forming a multi-stranded complex, a single self-hybridizing strand, or any combination thereof. Hybridization reactions can also occur in cases such as initiating PCR reactions or enzymatic cleavage of polynucleotides by ribozymes. When hybridization occurs in an antiparallel arrangement between two single stranded polynucleotides, the polynucleotides are said to be “complementary” or “complementary strands”.

  As used herein, “cancer” is a disease caused by normal cells mutating and continuing to grow. Malignant cancer cells arise from all organs and tissues throughout the body, and when cancer cells grow, they become a mass of cancer tissues and invade and destroy surrounding normal tissues. Cancer is lung cancer, esophageal cancer, stomach cancer, liver cancer, pancreatic cancer, kidney cancer, adrenal cancer, biliary tract cancer, breast cancer, colon cancer, small intestine cancer, cervical cancer, endometrial cancer, ovarian cancer, bladder cancer, prostate cancer, Ureteral cancer, renal pelvic cancer, ureteral cancer, penile cancer, testicular cancer, brain tumor, cancer of central nervous system, cancer of peripheral nervous system, head and neck cancer (oral cancer, pharyngeal cancer, laryngeal cancer, nasal cavity / sinus cancer, Salivary gland cancer, thyroid cancer, etc.), skin cancer, melanoma, thyroid cancer, salivary gland cancer, blood cancer, malignant lymphoma, carcinoma or sarcoma.

  Lung cancer includes malignant tumors that occur in the epithelial cells of the trachea, bronchi, alveoli, and the like, and can be classified pathologically into adenocarcinoma, squamous cell carcinoma, large cell carcinoma, and small cell carcinoma. Adenocarcinoma, squamous cell carcinoma, and large cell carcinoma are also collectively referred to as non-small cell carcinoma because the mode of progression and therapeutic response differ between small cell carcinoma and other cancers. There are also a few tumors that are not included in small and non-small cell carcinomas, such as carcinoids and columnar species. Conventional diagnostic markers for lung cancer include CEA for adenocarcinoma, ProGRP for small cell carcinoma, and SCC or Shifra 21-1 for squamous cell carcinoma (latest medical course for nursing (2nd edition), Nakayama Bookstore, 84-92 (2008/8/29)). However, they are only one index for measuring the possibility of cancer, and even if the diagnostic result is negative, it cannot be completely denied cancer. There are also diagnostic markers that tend to show false positives, such as CEA. Therefore, evaluation is often performed in combination with other various cancer diagnostic markers.

  In addition, cervical cancer is cancer of the cervix (the part below the uterus and connected to the vagina), and can be classified pathologically into adenocarcinoma, squamous cell carcinoma, and others. Conventional diagnostic markers for cervical cancer are not useful for adenocarcinoma, but CA125 and CEA are used. SCC urine hCGβ-CF can be used in squamous cell carcinoma (latest medical course for nursing (2nd edition), Nakayama Shoten, 106-120 (2008/8/29)). However, even if the diagnostic result by these cancer diagnostic markers alone is negative, it cannot be completely denied cancer.

  In addition, cancer can be diagnosed by performing a method for examining a subject's cancer in a test sample derived from the subject, including a step of detecting the cancer diagnostic marker. In particular, lung cancer or cervical cancer can be diagnosed. In addition, it is possible to diagnose cancer in which an RNA chain containing the nucleotide sequence of SEQ ID NO: 1 or the RNA sequence comprising the 1070th G to 3379th A nucleotide sequence of SEQ ID NO: 1 is overexpressed.

  In the present specification, “diagnosis of cancer” includes diagnosis of non-specific cancer or diagnosis of specific cancer such as lung cancer and cervical cancer. Further, in the present specification, “detection” includes quantitative or non-quantitative detection. As non-quantitative detection, whether or not a cancer diagnostic marker specifically overexpressed in cancer exists is present. Measurement of whether or not there is more than a certain amount of cancer diagnostic marker specifically overexpressed in cancer, the amount of cancer diagnostic marker specifically overexpressed in cancer in other samples ( For example, the measurement compared with a control sample etc. can be mentioned. Quantitative detection can include measuring the concentration or amount of a cancer diagnostic marker that is specifically overexpressed in cancer. For detection, a substance capable of binding to the cancer diagnostic marker or a derived substance derived from the cancer diagnostic marker can be used.

  The above-mentioned “detection” step is not particularly limited, but real-time PCR, RT-PCR, real-time RT-PCR, northern blotting, microarray, immunoassay, SAGE method, CAGE method, mass spectrometry, intermolecular interaction analysis And an analysis step using one or more methods selected from the group consisting of next-generation sequencers. In this case, the cancer diagnostic marker can be detected by a procedure widely used in the diagnostic field. Since detection accuracy is higher than other methods, detection by real-time PCR is preferable. For example, since microarrays have poor accuracy, in general, they are not completely verified to be expressed only by being detected by the microarray, and verification experiments such as real-time PCR are required. Furthermore, there is no clear standard for how many values of expression intensity are considered in microarrays. Even if a high value is obtained with a microarray, the possibility of cross-hybridization cannot be ruled out, and eventually a demonstration experiment such as real-time PCR is required. Real-time PCR can also detect trace amounts of cancer diagnostic markers.

  Real-time PCR is a method for monitoring nucleic acids amplified by PCR in real time. For example, it can be carried out by a commercially available kit such as LightCycler480 SYBR Green I Master (Roche) or the procedure described in [Real-time PCR experiment guide well understood from principle, Yodosha, December 12, 2007]. Total RNA can be extracted from any cell using the guanidine thiocyanate method, commercially available reagents or kits. Total RNA can also be purchased from Applied Biosystems and BioChain. Cells can be purchased from Sanko Junyaku Co., Ltd. or Takara Bio Inc. Examples of the monitoring method include an intercalation method, a hybridization method, and a LUX (Light Upon eXtensyon) method. A typical method of the intercalation method is a method of measuring the amount of nucleic acid by utilizing the property that a fluorescent substance such as SYBRR Green I enters a double-stranded nucleic acid and emits light when irradiated with excitation light. Since the intensity of fluorescence increases in proportion to the amount of nucleic acid, the amount of nucleic acid amplified can be determined by measuring the fluorescence intensity. In addition, the quantification method using real-time PCR is roughly divided into two quantification methods, an absolute quantification method and a relative quantification method, which can be used as appropriate.

  RT-PCR (Reverse Transcription Polymerase Chain Reaction) is a method in which reverse transcription is performed using an RNA chain as a template, and PCR is performed on the generated cDNA. Examples of the intermolecular interaction analysis include a method using a Biacore system. A sequencer is a device that can measure the sequence structure of a DNA sequence, RNA sequence, or amino acid sequence, and includes a next-generation sequencer.

  In the present specification, the “subject” means a human or other mammal (eg, rat, mouse, rabbit, cow, monkey, pig, horse, sheep, goat, dog, cat, guinea pig, hamster, etc.) or Including birds. The test sample includes a sample derived from the body or excrement, for example, cells, blood, interstitial fluid, plasma, extravascular fluid, cerebrospinal fluid, synovial fluid, pleural fluid, ascites, serum, lymph fluid, body fluid. , Saliva, urine, feces, sputum, pus, pathological sections or samples obtained from them (eg, cell culture medium or extracted total RNA). As the test sample, it is preferable to use a tissue or cell directly extracted from a diseased site or a sample obtained from the same because the diagnostic accuracy is further improved.

  As one aspect of the detection, a substance capable of binding to the cancer diagnostic marker or a derived substance derived from the cancer diagnostic marker can be labeled with a labeling substance and used for real-time PCR, Northern blotting, or the like. This labeling can be performed by a generally known method. As the labeling substance, it is possible to use labeling substances known to those skilled in the art, such as fluorescent dyes, enzymes, coenzymes, chemiluminescent substances, radioactive substances, etc., and specific examples include radioisotopes (32P, 14C, 125I, 3H, 131I, etc.), fluorescein, rhodamine, dansyl chloride, umbelliferone, luciferase, peroxidase, alkaline phosphatase, β-galactosidase, β-glucosidase, horseradish peroxidase, glucoamylase, lysozyme, saccharide oxidase, microperoxidase, Biotin and the like can be mentioned. When biotin is used as the labeling substance, it is preferable to further add avidin to which an enzyme such as alkaline phosphatase is bound after adding the biotin-labeled antibody.

  Further, in the present specification, as a diagnosis method, diagnosis may be performed by combining two or more kinds of diagnosis markers. When used in such a combination, for example, it is possible to further diagnose the type of cancer with a known diagnostic marker for a test sample diagnosed as cancer with the cancer diagnostic marker. On the contrary, it is possible to further diagnose whether the cancer is lung cancer or cervical cancer with the above cancer diagnostic marker for a test sample diagnosed as cancer with a known diagnostic marker. In addition, cancer can be diagnosed by comprehensively evaluating the results obtained when a known diagnostic marker is examined and the results obtained when the cancer diagnostic marker is examined.

  The diagnosis may be a diagnosis for examining the onset or progress of cancer, or a diagnosis for examining the prognosis of cancer. Usually, if no cancer diagnosis is made before the onset of cancer, it will not be noticed until various symptoms of cancer (for example, bleeding, inflammation, swelling, lump, discomfort in the affected area, etc.) appear, and it is already too late when it is noticed There is a case. Therefore, the diagnosis for examining the onset or progress of cancer is an important diagnosis for early detection of cancer and effective cancer treatment. In addition, even after it has been found that cancer has developed, in order to verify the effects of various anticancer agents and to verify the therapeutic effects of cancer, diagnosis that examines the progress of cancer becomes important. . In addition, the prognosis of cancer is generally a prediction or prospect of how the medical condition will progress after some kind of treatment. The result of the diagnosis for examining the prognosis of cancer is an effective index for developing a cancer treatment plan.

  Moreover, if a screening method for a cancer suppressor drug comprising the step of detecting the cancer diagnostic marker is performed, the cancer suppressor drug can be screened. In particular, cancer suppressive drugs for lung cancer or cervical cancer can be screened. In addition, a cancer suppressor drug that overexpresses an RNA chain comprising the nucleotide sequence of SEQ ID NO: 1 or the nucleotide sequence of 1070th G to 3379th A of SEQ ID NO: 1 can be screened. Although the specific operation procedure of this screening is not particularly limited, for example, screening can be performed by measuring the increase / decrease in the amount of the cancer diagnostic marker before and after administration of a candidate substance for a cancer suppressant to a subject. In this case, if the amount of the cancer diagnostic marker is reduced after administering a candidate substance for a cancer suppressing drug to a subject, it can be said that the candidate substance has a function as a cancer suppressing drug.

  FIG. 1 is a functional block diagram showing the overall configuration of the cancer diagnosis apparatus 1000. The cancer diagnosis apparatus 1000 includes a cancer diagnosis marker analysis apparatus 100 that analyzes detection data of the cancer diagnosis marker in a test sample. The cancer diagnosis apparatus 1000 includes an operation unit 102 for operating the cancer diagnosis marker analysis apparatus 100. The cancer diagnostic apparatus 1000 includes a detection unit 104 that detects the cancer diagnostic marker in a test sample derived from a subject.

  The cancer diagnosis apparatus 1000 also includes an image display apparatus 106 that displays data output from the cancer diagnosis marker analysis apparatus 100. The cancer diagnosis apparatus 1000 includes a printer 108 that prints data output from the cancer diagnosis marker analysis apparatus 100. The cancer diagnosis apparatus 1000 includes a PC (personal computer) 110 that receives data output from the cancer diagnosis marker analysis apparatus 100.

  On the other hand, the cancer diagnostic marker analysis apparatus 100 includes an acquisition unit 202 that acquires detection data of a cancer diagnostic marker of a test sample input from the detection unit 104. The cancer diagnostic marker analyzer 100 includes a quantification unit 204 that quantifies the amount of the cancer diagnostic marker based on the detection intensity of the cancer diagnostic marker.

  Moreover, the cancer diagnostic marker analysis apparatus 100 includes a detection intensity database 206 that stores quantitative data of the comparative sample. The cancer diagnostic marker analyzing apparatus 100 includes a comparison control unit 208 that compares the quantitative data of the cancer diagnostic marker of the test sample with the quantitative data of the comparative sample.

  Furthermore, the cancer diagnostic marker analysis apparatus 100 includes a determination unit 210 that determines whether the amount of the cancer diagnostic marker exceeds a predetermined threshold. The cancer diagnostic marker analysis apparatus 100 includes an output unit 212 that outputs a determination result.

  FIG. 2 is a flowchart for explaining the operation of the cancer diagnosis apparatus 1000. The detection unit 102 detects a cancer diagnostic marker using a thermal cycler and a spectrofluorometric method, and generates detection data. This detection data is obtained by performing real-time PCR using a DNA primer set that can bind to a nucleic acid having the nucleotide sequence of SEQ ID NO: 1 with respect to the total RNA derived from the subject. The detection data is the number of cycles when a predetermined fluorescence intensity is shown by real-time PCR.

  In addition, the quantitative unit 204 converts the detection data into quantitative data that can quantitatively represent the amount of the cancer diagnostic marker. The quantitative data is, for example, the concentration of a cancer diagnostic marker. This concentration can be calculated from the number of cycles and initial conditions in detecting a cancer diagnostic marker.

  Further, the comparison control unit 208 compares the quantitative data of the cancer diagnosis marker of the test sample with the quantitative data of the comparative sample. Here, the quantitative data of the cancer diagnostic marker derived from the non-cancer specimen obtained from the detection intensity database 206 can be used as the quantitative data of the comparative sample. This comparison result is expressed as a percentage of the quantitative data of the comparative sample, with the quantitative data of the cancer diagnostic marker set to 100%.

  Further, the determination unit 210 acquires the comparison result from the comparison control unit 208, and determines that the cancer is positive when the quantitative data of the cancer diagnostic marker of the test sample exceeds a predetermined threshold. The predetermined threshold value can be the maximum value of quantitative data of cancer diagnostic markers derived from a plurality of non-cancer specimens.

  Further, the output unit 212 outputs the determination result of cancer positive or cancer negative from the determination unit 210 to the image display device 106 or the like outside the device, and the series of flow ends.

  The cancer diagnostic apparatus 1000 can be suitably used for diagnosis of lung cancer, cervical cancer, or cancer in which the cancer diagnostic marker is overexpressed.

  Further, as a modification, the detection unit 102 can detect cancer by RT-PCR, Northern blotting, microarray, immunoassay, SAGE method, CAGE method, mass spectrometry, intermolecular interaction analysis, or a method using a next-generation sequencer. Detection data may be generated by detecting a diagnostic marker. In this case, the detection data is not represented by the number of cycles but is represented by various numerical values proportional to the concentration of the cancer diagnostic marker. In addition, the quantitative data converted from the detection data in the quantitative unit is also represented by various numerical values proportional to the concentration of the cancer diagnostic marker.

  As another modified example, the quantitative data converted from the detection data by the quantitative unit 204 may not have a unit like a concentration, and may be a relative value.

  As another modification, the detection intensity database 206 may store quantitative data of cancer diagnosis markers of other test samples measured in the past. In this case, the quantitative data of the cancer diagnostic marker of another test sample measured in the past can be used as the quantitative data of the comparative sample used by the comparison control unit 208 for comparison. If quantitative data is stored for those that have been determined to be cancer positive in the past and that have been determined to be cancer positive by a close examination by a clinician, they can be used as a positive control.

  As another modification, the comparison result obtained by the comparison control unit 208 can be expressed as a relative value as long as it represents the relationship between the quantitative data of the cancer diagnostic marker and the quantitative data of the comparative sample.

  As another modified example, the output unit 212 includes the detection data, the quantitative data of the cancer diagnosis marker of the test sample, the quantitative data of the comparison sample, or a table representing the comparison result thereof, or the relationship between the cycle number and the fluorescence intensity. May be output to the image display device 106 or the like.

  As another modified example, in order to increase detection accuracy, negative control experiments may be performed in parallel using a sample that is known in advance to have no cancer diagnostic marker. In this case, even if the cancer diagnostic marker of the test sample shows a predetermined concentration, if the negative control shows a similar concentration or a predetermined concentration to the cancer diagnostic marker of the test sample, they are regarded as noise. .

  In addition, a computer installed with a program capable of performing the above operations excluding the operation of the detection unit is connected to a device capable of performing real-time PCR capable of detecting a test sample, so that lung cancer, cervical cancer, or It can be used for diagnosis of cancer in which the above cancer diagnostic marker is overexpressed. If the device connected to the computer can detect the test sample, RT-PCR, Northern blotting, microarray, immunoassay, SAGE method, CAGE method, mass spectrometry, intermolecular interaction analysis, or An apparatus equipped with a next-generation sequencer may be used.

<Embodiment 2: Detection substance of cancer diagnostic marker>
Another embodiment of the present invention is a nucleic acid detection substance that binds to a nucleic acid comprising the nucleotide sequence of SEQ ID NO: 1, a part of the nucleic acid, or a complementary strand thereof. The nucleic acid detection substance is not particularly limited as long as it has a property capable of binding to a nucleic acid, and includes a polynucleotide, a protein, an antibody, a low molecular compound, or the like, and is particularly preferably a polynucleotide. This is because a polynucleotide has excellent binding specificity with a nucleic acid, can be produced inexpensively or easily, and can be suitably used for a diagnostic technique with high detection accuracy such as real-time PCR. Of the polynucleotides, a DNA strand is preferable. This is because it is excellent in stability and can be manufactured at a lower cost.

  In the present specification, the “nucleic acid” includes a DNA base, an RNA base or an equivalent thereof. This equivalent includes, for example, a DNA base or RNA base that has undergone chemical modification such as methylation, or a nucleic acid analog. The “DNA strand” or “RNA strand” represents a form in which two or more DNA bases or RNA bases are linked. A “base sequence” is a sequence of bases constituting a nucleic acid. Moreover, generally a base sequence can be represented by A (adenine), G (guanine), C (cytosine), and T (thymine). For example, in the NCBI Reference Sequence that is a typical database, A, G, C, and T are used to represent the base sequences of DNA strands and RNA strands. In the present specification, when the base sequence of an RNA chain is expressed, the above T is replaced with U (uracil). The nucleotide generally includes A, G, C, T, or U.

  Here, it is strongly suggested that the mRNA containing the nucleotide sequence of SEQ ID NO: 1 is overexpressed in lung cancer or cervical cancer in Examples described later. Further, in the examples described later, mRNA containing the nucleotide sequence of SEQ ID NO: 1 was not detected in adjacent normal cells, which strongly suggests that the expression specificity is high in lung cancer or cervical cancer. And since the said nucleic acid detection substance can couple | bond with this mRNA, it can be conveniently used as a diagnostic agent of lung cancer or cervical cancer. In the examples described later, it is strongly suggested that the mRNA can be detected or quantified using a primer that binds to cDNA (complementary DNA) prepared from the mRNA. Therefore, the nucleic acid detection substance can be suitably used as a diagnostic agent for lung cancer or cervical cancer also by binding to this cDNA. Similarly, the nucleic acid detection substance can also be suitably used as a diagnostic agent for cancer that overexpresses the mRNA.

  The nucleic acid detection substance is a nucleic acid detection substance that binds to a nucleic acid comprising a base sequence having a homology of 80% or more with respect to the base sequence of SEQ ID NO: 1, a part of the nucleic acid, or a complementary strand thereof. Including. Here, the above 80% or more preferably has 85% or more homology with SEQ ID NO: 1, more preferably 90% or more, more preferably 95% or more. And more preferably 98% or more. This is because a nucleic acid containing a base sequence having a homology of 80% or more is more similar to a nucleic acid containing a base sequence of SEQ ID NO: 1 as the homology with a nucleic acid containing the base sequence of SEQ ID NO: 1 is higher. It is because it will have.

  The nucleic acid detection substance binds to a nucleic acid containing a base sequence in which one or several bases have been deleted, substituted or added in the base sequence of SEQ ID NO: 1, a part of the nucleic acid, or a complementary strand thereof. Contains a nucleic acid detection substance. Here, the above one or several is preferably 30, more preferably 20, more preferably 15, more preferably 10, and more preferably 5. More preferably, it is 4, more preferably 3, more preferably 2, and even more preferably 1. This is because a nucleic acid containing a base sequence in which one or several bases are deleted, substituted or added has a smaller base deletion, substitution or addition to the nucleic acid containing the base sequence of SEQ ID NO: 1, This is because it has properties close to those of a nucleic acid containing the base sequence of SEQ ID NO: 1.

  In addition, the nucleic acid detection substance is a nucleic acid containing a nucleic acid base sequence that hybridizes under stringent conditions to a nucleic acid consisting of a base sequence complementary to the base sequence of SEQ ID NO: 1, or a part of the nucleic acid, or Nucleic acid detection substances that bind to their complementary strands are included.

  In addition, the nucleic acid detection substance includes SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24, It may be a nucleic acid comprising the base sequence of SEQ ID NO: 25, SEQ ID NO: 26, or SEQ ID NO: 27. It has been demonstrated that these nucleic acids can be used for PCR reaction by hybridizing to the mRNA of SEQ ID NO: 1 or its cDNA in the examples described later. Therefore, these nucleic acids can be used as the nucleic acid detection substance. The polynucleotide is preferably SEQ ID NO: 2 or SEQ ID NO: 3. This is because it has been demonstrated that it can be used for real-time PCR in Examples described later, and further, it can be used for cancer diagnosis of lung cancer or cervical cancer.

  In addition, the nucleic acid detection substance includes SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24, It may be a nucleic acid containing a base sequence in which one or several bases are deleted, substituted or added in the base sequence of SEQ ID NO: 25, SEQ ID NO: 26, or SEQ ID NO: 27. Here, the number of one or several is preferably 5, more preferably 4, more preferably 3, more preferably 2, and still more preferably 1. This is because the nucleotide sequence of this nucleic acid detection substance is SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 22, SEQ ID NO: 23, Any nucleotide sequence having higher homology to the nucleotide sequence of SEQ ID NO: 24, SEQ ID NO: 25, SEQ ID NO: 26, or SEQ ID NO: 27 should be capable of hybridizing to the mRNA of SEQ ID NO: 1 or its cDNA in the examples described later. This is because they have properties closer to those of DNA primers that have been demonstrated.

  In addition, the above “part of the nucleic acid” means the base sequence from the 26th C to the 3379th A of the base sequence of SEQ ID NO: 1, the base from the 130th A to the 3379th A of the base sequence of SEQ ID NO: 1. Sequence, base sequence from 134th T to 3379th A of base sequence of SEQ ID NO: 1, base sequence of 136th A to 3379th A of base sequence of SEQ ID NO: 1, or base sequence of SEQ ID NO: 1 From the 157th T to the 3379th A base sequence (hereinafter also referred to as “the 26th to 3379th base sequence of the base sequence of SEQ ID NO: 1”), from the 26th base sequence of the SEQ ID NO: 1 A base sequence having 80% or more homology with the base sequence of the 3379th, etc., and one or several bases in the base sequence of the base sequence of SEQ ID NO: 1 from the 26th to the 3379th are deleted, substituted or Added base sequence, salt from the 26th to 3379th of the base sequence of SEQ ID NO: 1 To a nucleic acid consisting of a nucleotide sequence complementary to the sequence comprises a nucleic acid having one or more nucleotide sequence selected from the group consisting of the nucleotide sequence of a nucleic acid that hybridizes under stringent conditions,. It is strongly suggested that mRNA having the nucleotide sequence from the 26th to the 3379th of the nucleotide sequence of SEQ ID NO: 1 is specifically overexpressed in lung cancer or cervical cancer in Examples described later. Therefore, the nucleic acid detection substance can also be used as a diagnostic agent for lung cancer or cervical cancer by binding to a nucleic acid consisting of the nucleotide sequence from the 26th to 3379th nucleotide sequence of SEQ ID NO: 1 or its complementary strand. . Similarly, it can also be used as a diagnostic agent for cancer overexpressing mRNA having the nucleotide sequence from the 26th to 3379th of the nucleotide sequence of SEQ ID NO: 1.

  The “part of the nucleic acid” is the base sequence from the 1070th G to the 3379th A of SEQ ID NO: 1 (hereinafter also referred to as “the 1070th to 3379th base sequence”), the 1070th to 3379 A base sequence having 80% or more homology to the first base sequence, a base sequence in which one or several bases are deleted, substituted or added in the base sequence from the 1070th to the 3379th base, from the 1070th base It includes a nucleic acid having one or more base sequences selected from the group consisting of nucleic acid base sequences that hybridize under stringent conditions to a nucleic acid base sequence complementary to the 3379th base sequence. It is strongly suggested that the mRNA having the 1070th to 3379th nucleotide sequences is specifically overexpressed in lung cancer or cervical cancer in the examples described later. Therefore, the nucleic acid detection substance can also be used as a diagnostic agent for lung cancer or cervical cancer by binding to a nucleic acid comprising the 1070th to 3379th nucleotide sequence or its complementary strand. Similarly, it can also be used as a diagnostic agent for cancer overexpressing mRNA having the 1070th to 3379th nucleotide sequences.

  The “part of the nucleic acid” is the nucleotide sequence from the 1070th G to the 3325th T of SEQ ID NO: 1 (hereinafter also referred to as “the 1070th to 3325th nucleotide sequence”), the 1070th to 3325 thereof. A base sequence having 80% or more homology to the first base sequence, a base sequence in which one or several bases are deleted, substituted or added in the base sequence from the 1070th to the 3325th base, from the 1070th base It includes a nucleic acid having one or more base sequences selected from the group consisting of nucleic acid base sequences that hybridize under stringent conditions to a nucleic acid base sequence complementary to the 3325th base sequence. It is strongly suggested that the mRNA having the 1070th to 3325th base sequences is specifically overexpressed in lung cancer or cervical cancer in the examples described later. Therefore, the nucleic acid detection substance can also be used as a diagnostic agent for lung cancer or cervical cancer by binding to a nucleic acid comprising the 1070th to 3325th base sequences or its complementary strand. Similarly, it can also be used as a diagnostic agent for cancer that overexpresses the mRNA having the 1070th to 3325th base sequences.

  The “part of the nucleic acid” is the base sequence from the 1070th G to the 2997th C of SEQ ID NO: 1 (hereinafter also referred to as “the 1070th to 2997th base sequence”), from the 1070th to 2997th. A base sequence having 80% or more homology to the first base sequence, a base sequence in which one or several bases are deleted, substituted or added in the base sequence from the 1070th to the 2997th base, from the 1070th base It includes a nucleic acid having one or more base sequences selected from the group consisting of nucleic acid base sequences that hybridize under stringent conditions to a nucleic acid base sequence complementary to the 2997th base sequence. It is strongly suggested that the mRNA having the 1070th to 2997th base sequences is specifically overexpressed in lung cancer or cervical cancer in Examples described later. Therefore, the nucleic acid detection substance can also be used as a diagnostic agent for lung cancer or cervical cancer by binding to a nucleic acid comprising the 1070th to 2997th nucleotide sequence or its complementary strand. Similarly, it can also be used as a diagnostic agent for cancer overexpressing mRNA having the 1070th to 2997th base sequences.

  The “part of the nucleic acid” is the nucleotide sequence of the 1070th C to 2685th T of SEQ ID NO: 1 (hereinafter also referred to as the “1070th to 2685th nucleotide sequence”), the 1070th to 2685 A base sequence having 80% or more homology to the first base sequence, a base sequence in which one or several bases are deleted, substituted or added in the 1070 to 2685 base sequences, from the 1070th base It includes a nucleic acid having one or more base sequences selected from the group consisting of a nucleic acid base sequence that hybridizes under stringent conditions to a nucleic acid base sequence complementary to the 2685th base sequence. It is strongly suggested that the mRNA having the nucleotide sequence from the 1070th to 2685th is specifically overexpressed in lung cancer or cervical cancer in the examples described later. Therefore, the nucleic acid detection substance can also be used as a diagnostic agent for lung cancer or cervical cancer by binding to a nucleic acid comprising the 1070th to 2685th base sequence or its complementary strand. Similarly, it can also be used as a diagnostic agent for cancer that overexpresses mRNA having the 1070th to 2685th base sequences.

  Further, “a part of the nucleic acid” means the nucleotide sequence of the 2451st C to 2541st T of SEQ ID NO: 1 (hereinafter also referred to as “2451st to 2541st nucleotide sequence”), 2451th to 2541 A base sequence having 80% or more homology to the 2nd base sequence, a base sequence in which one or several bases are deleted, substituted or added in the 2451st to 2541st base sequences, from the 2451st It includes a nucleic acid having one or more base sequences selected from the group consisting of nucleic acid base sequences that hybridize under stringent conditions to a nucleic acid base sequence complementary to the 2541st base sequence. It is strongly suggested that the mRNA having the nucleotide sequence from the 2451st to 2541st nucleotides is specifically overexpressed in lung cancer or cervical cancer in the examples described later. Therefore, the nucleic acid detection substance can also be used as a diagnostic agent for lung cancer or cervical cancer by binding to a nucleic acid consisting of the nucleotide sequence from 2451st to 2541st nucleotide or its complementary strand. Similarly, it can also be used as a diagnostic agent for cancer that overexpresses mRNA having the nucleotide sequence from the 2451st position to the 2541st position.

  In addition, the length of “part of the nucleic acid” is not particularly limited, but preferably has a length that allows PCR primers and probes to hybridize. This is because if the PCR primer or probe can be hybridized, the “part of the nucleic acid” can be detected by a method such as real-time PCR or Northern blot. PCR primers and probes are generally known to lose their specificity if they are too short (PCR front line, Takeo Sekiya et al., Kyoritsu Publishing Co., Ltd., 31-39 (1997)), genetic engineering In research in the field, PCR primers and probes containing 15 or more bases are often used. Therefore, the length of the “part of the nucleic acid” preferably includes 15 or more consecutive RNA bases, more preferably includes 20 or more consecutive RNA bases, and more preferably 25 or more consecutive. Of RNA bases, more preferably 30 or more consecutive RNA bases.

  As used herein, “polynucleotide” includes a DNA strand comprising a plurality of DNA bases or an RNA strand comprising a plurality of RNA bases. Moreover, it is preferable that it is the length which can be used when using as a PCR primer or a probe. PCR primers and probes generally have a tendency to lose their specificity if they are too short, and are known to be unsuitable as PCR primers or probes (PCR method front line, Takeo Sekiya et al., Kyoritsu Shuppan Co., Ltd., 31-39 (1997)). Therefore, PCR primers and probes containing 15 or more bases are often used in genetic engineering research. Therefore, the “polynucleotide” preferably includes at least 15 consecutive nucleotides. In order to further improve the specificity, the number is preferably 18 or more, more preferably 20 or more, and still more preferably 25 or more. The polynucleotide can be synthesized using a DNA / RNA synthesizer. In addition, after designing an arbitrary base sequence, it can also be purchased from a DNA or RNA synthesis contractor (for example, Invitrogen Corporation, Takara Bio Inc., etc.).

  As used herein, “bond” means a connection between substances. The linkage may be either covalent or non-covalent, and includes, for example, ionic bonds, hydrogen bonds, hydrophobic interactions, or hydrophilic interactions. It also includes hybridization between DNA strands or RNA strands.

As used herein, “antibody” refers to a molecule capable of specifically binding to a specific epitope on an antigen, and includes polyclonal antibodies and monoclonal antibodies. The antibody can exist in various forms, for example, Fv, Fab, F (ab ′) ₂ , Fab ′, diabody, single chain antibody (eg, scFv, dsFv), peptide containing CDR, Examples include a valent specific antibody (for example, a bivalent specific antibody), a chimeric antibody, a humanized antibody, or a human antibody. Moreover, the form of the low molecular antibody couple | bonded with the existing chemical synthetic drug substance or pharmaceutical formulation, or a sugar chain modification antibody may be sufficient.

  Polyclonal antibodies can be used in mammals (eg, rats, mice, rabbits, cows, monkeys, pigs, horses, sheep, goats, dogs, cats, for example, to induce the production of serum containing polyclonal antibodies specific for the antigen. , Guinea pigs, hamsters, etc.), birds, etc., can be used to produce antibodies by administering an immunogen containing the antigen of interest. Immunization protocols are known in the art and may be performed by any method that elicits an immune response, depending on the animal host selected [Protein Experiment Handbook, Yodosha (2003): 86-91. ].

  A monoclonal antibody also refers to an antibody obtained from a substantially homogeneous population of antibodies. That is, the individual antibodies that make up the population include those that are identical except for naturally occurring mutations that may be present in small amounts. In general, monoclonal antibodies are highly specific, and unlike conventional polyclonal antibodies that typically include different antibodies that correspond to different epitopes, each monoclonal antibody corresponds to a single epitope of the antigen. A monoclonal antibody can be prepared by a method similar to the hybridoma method described in [Kohler G, Milstein C., Nature. 1975 Aug 7; 256 (5517): 495-497.]. Alternatively, it can be produced by a method similar to the recombinant method as described in US Pat. No. 4,816,567. Or [Clackson et al., Nature. 1991 Aug 15; 352 (6336): 624-628.] Or [Marks et al., J Mol Biol. 1991 Dec 5; 222 (3): 581-597.] Isolation from phage antibody libraries may be performed using methods similar to those described.

<Embodiment 3: Cancer diagnostic marker protein and its detection substance>
Another embodiment of the present invention is a cancer diagnostic marker comprising mouse NKX1-2 ortholog protein. In the examples described later, it is strongly suggested that the RNA strand encoding the mouse NKX1-2 ortholog protein is overexpressed in lung cancer or cervical cancer. Therefore, in lung cancer or cervical cancer cells, the presence of excess RNA strands encoding mouse NKX1-2 ortholog protein promotes translation of mouse NKX1-2 ortholog protein, resulting in more mice than normal cells. NKX1-2 ortholog protein is thought to exist. In the examples described later, the expression of the RNA chain encoding mouse NKX1-2 ortholog protein is not detected in adjacent normal cells, and it is strongly suggested that the expression specificity is high in lung cancer or cervical cancer. Therefore, a cancer diagnostic marker containing mouse NKX1-2 ortholog protein can be suitably used as a marker for cancer diagnosis of lung cancer or cervical cancer. The cancer diagnostic marker can also be used as a diagnostic agent for cancer that overexpresses the RNA chain.

  The mouse NKX1-2 ortholog protein has one or several amino acid sequences in the amino acid sequence of SEQ ID NO: 28, an amino acid sequence having 80% or more homology to the amino acid sequence of SEQ ID NO: 28, and the amino acid sequence of SEQ ID NO: 28. To the nucleotide sequence of a nucleic acid that hybridizes under stringent conditions to a nucleic acid comprising an amino acid sequence deleted, substituted or added, or a nucleotide sequence complementary to the nucleotide sequence encoding the amino acid sequence of SEQ ID NO: 28 One or more amino acid sequences selected from the group consisting of encoded amino acid sequences may be included. In this case, the mouse NKX1-2 ortholog protein contains an amino acid sequence encoded by mRNA that is strongly suggested to be specifically overexpressed in lung cancer or cervical cancer in the examples described later. Therefore, this cancer diagnostic marker can be suitably used as a marker for diagnosing lung cancer, cervical cancer, or cancer that overexpresses the mRNA. The mouse NKX1-2 ortholog protein is preferably an amino acid sequence having higher homology to the amino acid sequence of SEQ ID NO: 28. This is because the mouse NKX1-2 ortholog protein has a property closer to a protein containing the amino acid sequence of SEQ ID NO: 28 as the homology to the protein containing the amino acid sequence of SEQ ID NO: 28 is higher. Because.

  When the amino acid sequence of the mouse NKX1-2 ortholog protein has one or several substitutions with respect to the amino acid sequence of SEQ ID NO: 28, the amino acid sequence is replaced with another amino acid that preserves the properties of the amino acid side chain. It is preferable. For example, amino acid side chain properties include hydrophobic amino acids (A, I, L, M, F, P, W, Y, V), hydrophilic amino acids (R, D, N, C, E, Q, G, H, K, S, T), amino acids having aliphatic side chains (G, A, V, L, I, P), amino acids having hydroxyl group-containing side chains (S, T, Y), sulfur atom-containing side chains Amino acids (C, M) having carboxylic acid and amide-containing side chains (D, N, E, Q), amino acids having base-containing side chains (R, K, H), and aromatic-containing Amino acids having side chains (H, F, Y, W) can be mentioned (the parentheses indicate single letter amino acids). Substitutions between amino acids within each of these groups are collectively referred to as conservative substitutions. It is already known that a polypeptide having an amino acid sequence modified by deletion, addition or substitution by one or more amino acid residues with respect to a certain amino acid sequence maintains its biological activity. (Mark et al., Proc Natl Acad Sci US A. 1984 Sep; 81 (18): 5662-5666., Zoller et al., Nucleic Acids Res. 1982 Oct 25; 10 (20): 6487-6500., Wang et al., Science. 1984 Jun 29; 224 (4656): 1431-1433.).

  Another embodiment of the present invention is a protein detection substance that binds to a cancer diagnostic marker including the mouse NKX1-2 ortholog protein. Since this protein detection substance can detect the above mouse NKX1-2 ortholog protein, it can be used as a diagnostic agent for lung cancer, cervical cancer or cancer that overexpresses the RNA chain encoding the mouse NKX1-2 ortholog protein. . The protein detection substance is not particularly limited as long as it has a property capable of binding to a protein, and includes a polynucleotide, a protein, an antibody, a low molecular weight compound, etc., and an antibody is particularly preferable. This is because an antibody is excellent in binding specificity with a protein and can be suitably used for a general protein detection technique such as an immunoassay.

  Another embodiment of the present invention is a nucleic acid detection substance that binds to a nucleic acid encoding mouse NKX1-2 ortholog protein, a part of the nucleic acid, or a complementary strand thereof. The type of the nucleic acid detection substance is not particularly limited as long as it can bind to the nucleic acid, and includes a polynucleotide, a protein, an antibody, a low molecular compound, or the like. Here, it is strongly suggested that the RNA strand encoding the mouse NKX1-2 ortholog protein is specifically overexpressed in lung cancer or cervical cancer in Examples described later. Therefore, the nucleic acid detection substance can be used as a diagnostic agent for lung cancer or cervical cancer. The nucleic acid detection substance can also be used as a diagnostic agent for cancer that overexpresses the RNA strand.

  In the present specification, the mouse NKX1-2 ortholog protein represents a protein having a homeodomain and having 50% or more homology in amino acid sequence with the mouse NKX1-2 protein. The amino acid sequence of the mouse NKX1-2 protein can be referred to in GenBank, which is a database of National Center for Biotechnology Information (NCBI). The mouse NKX1-2 gene is, for example, [Hong et al., Gene. 1997 Oct 1; 198 (1-2): 373-8.] And [Rovescalli et al., Proc Natl Acad Sci US A. 2000 Feb 29 ; 97 (5): 1982-7.] Describes this. The homeodomain is a region that encodes a protein site capable of binding to DNA, and is known to exist in virtually all eukaryotes from yeast to humans (cellular molecular organisms). (3rd edition), Educational company, 409-410 (1995/06)).

<Embodiment 4: Cancer diagnostic agent>
Another embodiment of the present invention is a cancer diagnostic agent containing the nucleic acid detection substance or protein detection substance. Since this cancer diagnostic agent has the above nucleic acid detection substance or protein detection substance, it can be suitably used for diagnosing lung cancer or cervical cancer. In addition, one or several bases are deleted, substituted or added in the base sequence of SEQ ID NO: 1, a base sequence having 80% or more homology to the base sequence of SEQ ID NO: 1, or the base sequence of SEQ ID NO: 1. And one or more base sequences selected from the group consisting of nucleic acid sequences that hybridize under stringent conditions to a nucleic acid consisting of a base sequence complementary to the base sequence of SEQ ID NO: 1. It can also be suitably used as a diagnostic agent for cancer in which mRNA or a part thereof is overexpressed.

  As used herein, the term “diagnostic agent” refers to a substance that can be used for diagnosing a subject's disease or disease potential, or for examining a disease-related substance in a test sample derived from a subject. In this specification, the method of using a cancer diagnostic agent is not particularly limited. For example, in a test sample derived from a subject, the nucleic acid detection material or the protein detection material is used to specifically overexpress in cancer. Cancer can be diagnosed by detecting the mRNA present.

  The cancer diagnostic agent can be used as a cancer diagnostic kit containing the cancer diagnostic agent. This cancer diagnostic kit can be suitably used for diagnosing a cancer that can be diagnosed by the above-described cancer diagnostic agent. The cancer diagnostic kit may contain instructions describing how to use or use examples when using the above-mentioned cancer diagnostic agent for cancer diagnosis, a sentence describing the location of the instructions, or various buffers. .

  As mentioned above, although embodiment of this invention was described, these are illustrations of this invention and various structures other than the above are also employable.

  EXAMPLES Hereinafter, although an Example demonstrates this invention further, this invention is not limited to these.

<Example 1: Detection of mRNA by real-time PCR>
Total RNA derived from lung, cervix, liver, uterus, large intestine, prostate, liver, or lymph tumor tissue purchased from Applied Biosystems (hereinafter sometimes referred to as “test sample”) and from adjacent normal tissue Total RNA (hereinafter sometimes referred to as “normal sample”) was purchased and used for detection of tissue-specific overexpression of mRNA by real-time PCR.

(1-1) RNA reverse transcription
Using the QuantiTect Rev. Transcription Kit (QUIAGEN), reverse transcription reaction was performed on the test sample and the normal sample, and the cDNA derived from the test sample and the cDNA derived from the normal sample were synthesized. This reverse transcription reaction was performed using random primers. The reaction time and the like were performed according to the protocol of the kit.

(1-2) Real-time PCR
Using LightCycler480 SYBR Green I Master (Roche), real-time PCR was performed on the cDNA derived from the test sample and the cDNA derived from the normal sample. SCpair67633_L primer: CCTTGCCACTTTTGCTTGGA (SEQ ID NO: 2) and SCpair67633_R primer: ACTGGGGACCTCTGGGTTTCT (SEQ ID NO: 3) were used as primers. We also performed real-time PCR for the endogenous gene GAPDH for use in cDNA confirmation and quantification. The reaction time and the like were performed according to the protocol of the kit.

  The results of real-time PCR are shown in Table 1. Amplified cDNA was confirmed in the 29th cycle of real-time PCR in lung tumor tissue. When the amount of the cDNA was 100%, the cervical tumor tissue was 112%, the liver tumor tissue was 0.50%, and the uterine tumor tissue was 0.80%. It was not detected in other tumor tissues or adjacent normal tissues (indicated as non in Table 1).

(1-3) Discussion of results From the above results, the presence of overexpressed mRNA in lung and cervical tumor tissues was revealed. Therefore, this overexpressed mRNA is considered to be a diagnostic marker for detecting lung cancer and cervical cancer.

  This mRNA has not been detected in adjacent normal tissues. This means that the expression level of mRNA is extremely small in the adjacent normal tissue, or mRNA is not present. Therefore, this mRNA can be said to be a highly specific and highly accurate diagnostic marker. Being a highly accurate diagnostic marker has an effect of making it less likely to generate false positives derived from adjacent normal cells when diagnosing cancer negative or positive, for example. In addition, the SCpair67633_L primer and the SCpair67633_R primer can be excellent detection reagents for detecting the diagnostic marker.

<Example 2: Sequence analysis of mRNA>
The RNA sequence of the overexpressed mRNA of Example 1 was examined. In human genomic DNA, a gene encoding mouse NKX1-2 ortholog protein (hereinafter sometimes referred to as mouse NKX1-2 ortholog gene) is upstream of the DNA sequence corresponding to the SCpair67633_L primer and SCpair67633_R primer. Exists (FIG. 3). In addition, a poly A signal (AATAAA) is present downstream of the DNA sequences corresponding to the SCpair67633_L primer and the SCpair67633_R primer. Human genomic DNA sequences can be referred to in GenBank, which is a database of National Center for Biotechnology Information (NCBI).

(2-1) Analysis of mRNA transcription start point The transcription start point of the overexpressed mRNA of Example 1 was examined using the 5'RACE method. First, total RNA was extracted from HEK293, a human fetal kidney-derived cell line, using TRIzol reagent (invitrogen). The extraction operation was performed according to the protocol of TRIzol reagent. Specifically, only RNA was separated by guanidine isothiocyanate / phenol / chloroform, and the precipitate was collected by isopropanol.

  Next, GeneRacer Kit (Invitrogen Corporation) was used and 5'RACE method was performed according to the kit protocol. Specifically, it was performed as follows. Under the conditions described in the GeneRacer Kit manual, the above total RNA was CIP-treated, then TAP-treated, and GeneRacer RNA Oligo was added. Then, reverse transcription reaction was performed with SuperScript III RT. At this time, the GeneRacer Random primer attached to the kit was used instead of the GeneRacer Oligo dT primer described in the protocol.

  Furthermore, PCR using GeneRacer 3 ′ primer and Forward GSP and Nested PCR using GeneRacer 3 ′ Nested primer and Forward Nested GSP were performed. At this time, a DNA primer of AAGGCCACCAGCTGCTCGTAGGTGAA (SEQ ID NO: 4) was used as the Reverse GSP primer, and a DNA primer of AGGGTCCCTGGAGCTGGCATCTTTCC (SEQ ID NO: 5) was used as the Reverse GSP nested primer. In addition, a highly accurate thermostable enzyme was used to avoid mutagenesis. The PCR product was subjected to agarose gel electrophoresis to confirm size, yield and single band. When RACE products of different sizes were confirmed, up to three fragments were cloned because there is a possibility of Alternative splicing.

Next, it was cloned into PCR4Blunt-TOPO. Then, the insert size of the obtained clone was confirmed, and the total DNA sequence of the insert was analyzed for the Recombinant clone that seems to have the target insert. As a result, CCCGAGCCCAGGCAAGCGGCCGCGG C ACAGCGCCTGATAGTCCCGAGGCTGGCCCGGGCTGCGCCGGTGCCAATCGGCGCGCAGCCCCCCGCGGCGCTCTCCCCGCCCCGCCTCCCCGCCCCCCTCCCC A GCT T C A CTTGGCAGCGCGGACCCGGC T CCTGGCTGGAAAGCTACCGCCAAGCCACAGCCGAAGGCAAGCCCGAGCGGCGCCATCCCCAACCCCGCGCCGCCGACCGCCGGCCCGTGGGCGACGGGC ATG CTGGCATGGCAGGACGGCGGGGCCAAGGCGGCTCCCTCCCACCACAAGATTTCTTTCTCTGTCCTGGACATCCTGGACCCACAGAAATTCACCCGCGCAGCGCTCCCTGCCGTGCGCCCGGCTCCCCGGGAAGCCAGGAAAAGTTTGGCGGAGGTCGAAGCGGGGAAAGATGCCAGCTCCAGGGACCCTGTCCGACAGCTGGAGACCCCTGATGCTGCGGGCCCAGGCGCCGGCCAGGCGTCCCCCCTGGAGGGTTCCGAGGCGGAAGAGGAGGAGGATGCGGAGGATCCGAGGAGGCCGCGGCTGCGGGAGCGGGCTGCGCGCTTGCTGCCGGGCCTAGCGCGCTCACCTGACGCCCCGGCCGGGGCATTGGCGTCTGGGGAGCCCTGCGAGGACGGCGGGGGCGGCCCTGTGAGGTCCCCCCCGGGATCCCCCGGCTCCCCGCGTCCCAGGCGCCGGCGCCTGGAGCCCAACTGCGCCAAGCCGCGGCGCGCGCGCACCGCC sequence of the cDNA of 763bp consisting (SEQ ID NO: 29) revealed. Of this 763 bp cDNA, the 257th, 258th and 259th A, T, and G from the 5 'end are the start codons of the mouse NKX1-2 ortholog gene (in the above 789 bp cDNA sequence, the base of the start codon). Is underlined).

  As a result of this DNA sequence analysis, 5 clones in which 25 bp, 129 bp, 133 bp, 135 bp, or 156 bp of the base at the 5 ′ end were deleted compared to the 789 bp cDNA as compared to the above 789 bp cDNA. There were various types (the 5′-end base of the clone that was deleted in the 789 bp cDNA sequence is underlined). This is probably because mRNA encoding mouse NKX1-2 ortholog protein has at least six variations at the transcription start site.

  On the other hand, this 789 bp cDNA was compared with the region encoding human NKX1-2 ortholog protein of human genomic DNA. Then, it was found that an intron consisting of 1582 bp exists in the region encoding the mouse NKX1-2 ortholog protein of human genomic DNA. The corresponding part of the intron was between the 470th G and the 471st A from the 5 'end of the above-mentioned 789 bp cDNA.

  Further, real-time PCR was performed using 151_L primer: TCAAACCCCCTTTCCCTGTCT (SEQ ID NO: 30) and 151_R primer: AGAGTTTCAGATTTGTGCGGGG (SEQ ID NO: 31) corresponding to the DNA sequence corresponding to this intron. In addition, a primer corresponding to the DNA sequence corresponding to the intron, 147_L primer: TGTTCACCGACCCCTTCTCC (SEQ ID NO: 32), and a primer corresponding to a DNA sequence downstream from the intron, 147_R primer: CTCCGCATCCTCCTCCTCTTC (sequence No. 33) was used for real-time PCR. As a result, DNA amplification was not observed in any real-time PCR. That is, the result of this real-time PCR also supports the presence of an intron between the 470th G and the 471st A from the 5 'end of the 789 bp cDNA.

  FIG. 4 shows the positional relationship between the position corresponding to the mouse NKX1-2 ortholog gene, the position corresponding to the poly A signal, the intron, and the main primers used in this example on the mRNA.

(2-2) Analysis of transcription termination point of mRNA (2-2-1) Upstream from poly A signal 116_L primer: GCCAATGTCCTCTTCCCGTC (SEQ ID NO: 6) and 20_R primer: AGGATTTGGTTGGAAAGCCACT (SEQ ID NO: 9) RT-PCR (Reverse Transcription PCR) was performed (FIG. 4). The 116_L primer is a primer complementary to the DNA sequence in the mouse NKX1-2 ortholog gene near the stop codon (TGA). The 20_R primer is a primer complementary to an upstream DNA sequence separated by 28 bases from the poly A signal.

As a result, amplification of about 2310 bp DNA was confirmed. This is equal to the length between the DNA sequence complementary to the 116_L primer and the DNA sequence complementary to the 20_R primer present in human genomic DNA. That is, in human genomic DNA, there is no transcription termination point during this period, and it is considered that all DNA is transcribed. The nucleotide sequence of the mRNA between 16_L primer and 20_R primers deduced from human genomic DNA base sequence is 2256bp of GCCAATGTCCTCTTCCCGTC CGCCGCCTCCTTCCCGCTGACGGCTGCCGCCCCCGGGAGCCCTTTCGCGCCGTTC CTTGGGCCTTCCTACCTGACC GTTCCAAATAACCTCCCCAGGC AATGGCTTCAAAGTAAAGCACCCT GTTTGGTATTATGGATTACATTCCATGACTATGATCTTGAAATATCTAGTTCTGTTATCAGGAATGATAGAAAATATTCCCCATTTCTCCTAAATTAAGTGAAGACTTCATGGTTCATGTGACTCTCATAATATTTGATAGTATGTATTATTTAATTACTTAATATCCACTAATTAGACTCTTTTCCTTCTAAAGAAGAATGTCCCCCAAACAACACATTGTAACTTTCTAAAAGACAGTTGGTGCCAGATGAGATTAAAAATGCAGTTACTCTACTAGATAATAT TCACCTTACACTTCGGTAAACACTCC TTTAATAACTATTTGTTGGTTTCTCAAAAGCAATATCCCATATTAAACAGACAATTCAAATGTGACAATTCCTCTGTAACAAAGAAGCTGAATTCTGTAATAAATGGGAAACATTTCATTCCAGTCTTCTCAGGTACCAGAATCATGGACTTCAGTAGAAGAGAGGGAATAGGGAGAGAGGTGGGAGGCTGATCTGTTCGTGGCCCAGCACGGTGCTGTAATTCCTGACCCTTCTGGTTTCCACAGATCATTGCAGAGTAATGCTTGAAGCGTGTGACTTTGGACTTCTGCTGCTTTAAAAGGCCC AGTGGCTTTCCAACCAAATCCT ( SEQ ID NO: 29).

  Further, instead of the 20_R primer described above, 37_R primer: GGAGTGTTTACCGAAGTGTAAGGTGA (SEQ ID NO: 11), 51_R primer: AGGGTGCTTTACTTTGAAGCCATT (SEQ ID NO: 13), 96_R primer: GCCTGGGGAGGTTATTTGGAAC (SEQ ID NO: 19), or 116_R primer: GGTCAGGTAGGAAGGCCCA (SEQ ID NO: 19) Even in the case of using DNA, amplification of DNA equal to the corresponding length in human genomic DNA could be confirmed (the primer sequence is underlined in the 2256 bp cDNA sequence).

  Further, when the primers shown in Table 2 were used as a set for each ID, DNA amplification could be confirmed. The primers listed in Table 2 are primers designed to be downstream from the transcription start point, not including the region corresponding to the intron, and upstream from the poly A signal. In Table 2, the one with L at the end of ID is a forward primer, and the one with R at the end of ID is a reverse primer.

(2-2-2) Downstream from the poly A signal In human genomic DNA, a poly A signal (AATAAA) exists further downstream of the DNA sequences corresponding to the SCpair67633_L primer and the SCpair67633_R primer. In general, it is known that when this poly A signal is present, transcription is terminated about 20 bases downstream.

  In addition, two types of regions considered to be pseudogenes of the mouse NKX1-2 ortholog gene can be confirmed in human genomic DNA. Two types of pseudogenes exist on X chromosome q23 and chromosome 11 p12. A pseudogene generally encodes a gene product, but is now thought to have lost its function. There are several formation methods, but one method is that a cDNA created by retroposon reverse transcriptase was inserted into the genome from the 3 'end of mRNA transcribed from a functioning gene. Has been. Since the pseudogene inserted into this genome is made through mRNA, the transcription termination point of mRNA can be predicted from the sequence of this pseudogene.

  Here, when the poly A signal and its downstream DNA sequence are compared with the sequences of two types of pseudogenes, the DNA sequence 5′AATAAATTCTTTTTGTAGTAAATTTA 3 ′ (hereinafter also referred to as “similar DNA sequence”) is obtained. It was similar. And downstream from the 3 'end of this similar DNA sequence was not similar. Furthermore, the 3 'end of this similar DNA sequence is located 20 bases downstream of the poly A signal. Therefore, the 3 'end of this similar DNA sequence is considered to be the transcription termination point.

  Furthermore, real-time PCR was performed using SCpair67633_dw_L primer: CCCCAAAACAGCCTGGTAGGT (SEQ ID NO: 34) and SCpair67633_dw_R primer: GCTCCTCGGCTATGTGGTTTC (SEQ ID NO: 35) designed further downstream at the 3 'end of the similar DNA sequence. As a result, no DNA amplification was observed. Furthermore, when real-time PCR was performed with 14_L primer: TCCTTAGACTCAATCTATTGGTGTGTTTG (SEQ ID NO: 36) and 14_R primer: TGAAAGCATTGCTAATAGAGAACAAGG (SEQ ID NO: 37) designed to straddle the 3 ′ end of the above similar DNA sequence, Amplification was not observed. Therefore, the results of these real-time PCRs also support that the 3 'end of the similar DNA sequence is a transcription termination point.

(2-3) Summary of mRNA sequence analysis Based on the above results, the positions of the transcription start point, intron, and transcription termination point were set, and when the published base sequence of genomic DNA was referred to, overexpression of Example 1 was observed. The base sequence of mRNA is estimated to be 3379 bp of (SEQ ID NO: 1). Alternatively, the base sequence of the overexpressed mRNA of Example 1 is a base in which 25 bp, 129 bp, 133 bp, 135 bp, or 156 bp of the 5 ′ terminal base is deleted compared to this 3379 bp base sequence. Sequence (base sequence from 26th C to 3379th A of base sequence of SEQ ID NO: 1, base sequence of 130th A to 3379th A of base sequence of SEQ ID NO: 1, 134 of base sequence of SEQ ID NO: 1) The base sequence of the 3379th A from the 1st T, the base sequence of the 136th A to the 3379th A of the base sequence of SEQ ID NO: 1, or the 157th T to the 3379th A of the base sequence of SEQ ID NO: 1 Base sequence).

  The amino acid sequence of overexpressing mice is encoded by mRNA NKX1-2 ortholog protein is assumed to EmuerueidaburyukyudijijieikeieieiPiesueichieichikeiaiesuefuesubuierudiaierudiPikyukeiefutiarueieieruPieibuiaruPiEipiaruieiarukeiesuerueiibuiieijikeidieiesuesuarudiPibuiarukyueruitiPidieieiJipijieijikyuEiesupieruijiesuieiiiiidieiidiPiaruaruPiarueruaruiarueieiaruerueruPijierueiaruesuPidieiPieijieierueiesujiiPishiidijijijiJipibuiaruesuPipijiesupijiesuPiaruPiaruaruaruarueruiPienushieikeiPiaruarueiarutieiefutiwaiikyuerubuieieruienukeiefuarueitiaruwaieruesubuishiiarueruenuerueieruesueruesuerutiitikyubuikeiaidaburyuefukyuenuaruarutikeidaburyukeikeikyuenuPijieidijieieikyubuijijijieiPikyuPijieieijijijijijijijiesujijiesuPiJipiPijitijieierueichiefukyutiefuPiesuwaiesueieienubuieruefuPiesueieiesuefuPierutiAAAPGSPFAPFLGPSYLTPFYAPRL (SEQ ID NO: 28).

(2-4) Discussion of results The above results strongly suggested that the mRNA having the nucleotide sequence of SEQ ID NO: 1 was specifically overexpressed in lung cancer or cervical cancer. Therefore, it is considered that the mRNA having the nucleotide sequence of SEQ ID NO: 1 can be used for cancer diagnosis as a cancer diagnostic marker for lung cancer or cervical cancer. A nucleic acid primer or nucleic acid probe that can detect this mRNA is considered to be a cancer diagnostic agent that can be used for diagnosis of lung cancer or cervical cancer and prognosis. For example, primers that could be used for PCR reactions in the examples can be used.

  In addition, mouse NKX1-2 ortholog protein can be used for cancer diagnosis as a cancer diagnostic marker for lung cancer or cervical cancer. The antibody that binds to the mouse NKX1-2 ortholog protein is considered to be a cancer diagnostic agent that can be used for diagnosis of lung cancer or cervical cancer and prognosis.

  In the above, this invention was demonstrated based on the Example. It is to be understood by those skilled in the art that this embodiment is merely an example, and that various modifications are possible and that such modifications are within the scope of the present invention.

Claims (19)

a) the base sequence of SEQ ID NO: 1,
b) a base sequence having 80% or more homology to the base sequence of SEQ ID NO: 1,
c) a base sequence in which one or several bases are deleted, substituted or added in the base sequence of SEQ ID NO: 1;
d) a nucleic acid base sequence that hybridizes under stringent conditions to a nucleic acid consisting of a base sequence complementary to the base sequence of SEQ ID NO: 1;
A polynucleotide that hybridizes with a nucleic acid comprising one or more base sequences selected from the group consisting of: or a part thereof, or a complementary strand thereof.   A cancer diagnostic agent comprising the polynucleotide according to claim 1. The cancer diagnostic agent according to claim 2,
A cancer diagnostic agent, wherein the part comprises 15 or more consecutive bases. The cancer diagnostic agent according to claim 2 or 3,
A cancer diagnostic agent wherein the cancer comprises lung cancer or cervical cancer.   A cancer diagnostic kit comprising the cancer diagnostic agent according to claim 2. e) the base sequence of SEQ ID NO: 1,
f) a base sequence having 80% or more homology to the base sequence of SEQ ID NO: 1,
g) a base sequence in which one or several bases are deleted, substituted or added in the base sequence of SEQ ID NO: 1;
h) a nucleic acid base sequence that hybridizes under stringent conditions to a nucleic acid consisting of a base sequence complementary to the base sequence of SEQ ID NO: 1;
A cancer diagnostic marker comprising an RNA chain having one or more base sequences selected from the group consisting of: i) the nucleotide sequence from the 1070th G to the 3379th A of SEQ ID NO: 1;
j) a base sequence having 80% or more homology to the base sequence of i);
k) a base sequence in which one or several bases are deleted, substituted or added in the base sequence of i),
l) a nucleic acid base sequence that hybridizes under stringent conditions to a nucleic acid comprising a base sequence complementary to the base sequence of i) above;
A cancer diagnostic marker comprising an RNA chain having one or more base sequences selected from the group consisting of: The cancer diagnostic marker according to claim 6 or 7,
The RNA strand is an RNA strand that is overexpressed in lung cancer or cervical cancer cells;
Cancer diagnostic marker.   A method for examining cancer of a subject, comprising the step of detecting the cancer diagnostic marker according to any one of claims 6 to 8 in a test sample derived from the subject. The method of claim 9, comprising:
Real-time PCR, RT-PCR, Northern blotting, microarray, immunoassay, SAGE method, CAGE method, mass spectrometry, intermolecular interaction analysis, and analysis process using one or more methods selected from the group consisting of sequencers ,
A method for examining a subject for cancer.   A method for examining the prognosis of cancer in a subject, comprising the step of detecting the cancer diagnostic marker according to any one of claims 6 to 8 in a test sample derived from the subject. m) a detection unit for detecting the cancer diagnostic marker according to any one of claims 6 to 8 in a test sample derived from a subject;
n) a quantification unit for quantifying the amount of the cancer diagnostic marker based on the detection intensity of the cancer diagnostic marker;
o) a determination unit that determines whether the amount of the cancer diagnostic marker exceeds a predetermined threshold;
p) an output unit for outputting the result of the determination;
A device for cancer diagnosis, comprising: On the computer,
q) detecting the cancer diagnostic marker according to any one of claims 6 to 8 in a test sample derived from a subject;
r) quantifying the amount of the cancer diagnostic marker based on the detection intensity of the cancer diagnostic marker;
s) determining whether the amount of the cancer diagnostic marker exceeds a predetermined threshold;
t) outputting the result of the determination;
Cancer diagnosis program for running u) the nucleotide sequence of SEQ ID NO: 1,
v) a base sequence having 80% or more homology to the base sequence of SEQ ID NO: 1,
w) a base sequence in which one or several bases are deleted, substituted or added in the base sequence of SEQ ID NO: 1;
x) a nucleic acid base sequence that hybridizes under stringent conditions to a nucleic acid consisting of a base sequence complementary to the base sequence of SEQ ID NO: 1;
An antibody that binds to a nucleic acid containing one or more base sequences selected from the group consisting of: a nucleic acid or a part thereof, or a complementary chain thereof.   A polynucleotide that hybridizes with a nucleic acid encoding mouse NKX1-2 ortholog protein, a complementary strand of the nucleic acid, or a part thereof.   A cancer diagnostic marker comprising mouse NKX1-2 ortholog protein. The cancer diagnostic marker according to claim 16, wherein the mouse NKX1-2 ortholog protein is
y) the amino acid sequence of SEQ ID NO: 28,
z) an amino acid sequence having 80% or more homology to the amino acid sequence of SEQ ID NO: 28;
a ′) an amino acid sequence in which one or several amino acids are deleted, substituted or added in the amino acid sequence of SEQ ID NO: 28;
b ′) an amino acid sequence encoded by the base sequence of a nucleic acid that hybridizes under stringent conditions to a nucleic acid comprising a base sequence complementary to the base sequence encoding the amino acid sequence of SEQ ID NO: 28;
A cancer diagnostic marker comprising one or more amino acid sequences selected from the group consisting of:   The mouse | mouth NKX1-2 ortholog protein binding antibody couple | bonded with the cancer diagnostic marker of Claim 16 or 17.   A polynucleotide that binds to the cancer diagnostic marker according to claim 16 or 17.