KR102015527B1 - Genetic mutation of desmoglein 3 and use thereof - Google Patents

Abstract

Epidermal cells with reduced expression levels of desmogloin triprotein, compositions for predicting the risk of developing swelling-like diseases, and methods for providing information for predicting the risk of developing stool-like diseases in individuals using the same It is about.

Description

Genetic mutation of desmoglein 3 and use thereof

A cell expressing a variant of the desmogloin 3 protein, a composition for predicting the risk of developing a skylarginous like disease, and a method for providing information for predicting the risk of developing a skylarginous like disease in an individual using the same

The pemphigus is a chronic blister disease that forms blisters on the skin and mucous membranes and is considered an autoimmune disease with autoantibodies to epidermal cells. Depending on the clinical and histological findings, it can be divided into vulgaris, proliferative spear, deciduous spear, and erythematous spear.

Diagnosis of pemphigus can be performed by 1) microscopic examination of samples from unbroken blisters on the skin or mucous membranes, 2) direct immunofluorescence testing for the presence of antibodies in the skin tissue that may induce blisters, or 3) patients. Indirect immunofluorescence to test for the presence of autoantibodies in the serum of the patient, or 4) the presence of autoantibodies and the activity of the disease in the serum of the patient using the enzyme-linked immunosorbent absorption method.

At present, the main treatment of pemphigus is the use of immunosuppressants. For example, the administration of corticosteroids can effectively suppress the development of new blisters and use them at high doses when the disease activity is severe. In patients with very severe symptoms, immunoglobulin intravenous therapy can be used to improve clinical outcomes. Recently, targeted treatment (Rituximab: Rituximab) has been shown to be effective in the treatment of autoantibodies that cause symptomatic swelling by selectively removing B cells. Suppresses production Rituximab is known to reduce the possible side effects of long-term use of steroids.

However, the development of an efficient method for diagnosing swelling disease is still insufficient. For the customized diagnosis and treatment of P. aeruginosa, it is required to establish accurate genetic diagnosis. Therefore, the present inventors have identified a novel mutant gene that has not been reported previously, and completed the present invention by confirming that the mutant gene can be usefully used for the diagnosis of P. pelvis-like disease.

One aspect provides epidermal cells with reduced expression levels of desmoglein 3 (DSG3) protein as compared to wild type cells.

Another aspect provides a composition for predicting the risk of developing a skyrocket-like disease.

Another aspect provides a kit for predicting the risk of developing a skyrocket-like disease.

Another aspect provides a method of providing information for predicting the risk of developing a stool-like disease in an individual.

One aspect provides epidermal cells with reduced expression levels of desmoglein 3 (DSG3) protein as compared to wild type cells.

Wild-type cell means a cell having no genetic modification, and may be a normal cell or a cell having a reference genome sequence.

The expression level of the desmoglein 3 (DSG3) protein is lower than that of the wild-type cells, which does not exist because the DSG3 protein is not expressed in the epidermal cells, or is expressed at a lower level than that of the wild-type cells. May be less. That is, the expression level of the desmogloin 3 protein is lower than that of wild-type cells, may be a loss or deficiency of the desmogloin 3 protein.

DSG3 protein is NCBI Accession No. It may be a protein consisting of the amino acid sequence shown in CCDS 11898.1, NP_001935.2 or SEQ ID NO: 1. DSG3 gene is a polynucleotide encoding the DSB3 protein, NCBI Accession No. It may be a polynucleotide consisting of the nucleotide sequence shown in CCDS 11898.1, NM_001944.2 or SEQ ID NO: 2.

Keratinocytes in the epidermis bind to adjacent keratinocytes by cell-cell adhesion junctions called desmosomes. Desmosomes are composed of cytoplasmic plaques and transmembrane cadherins. Desmosome's Cadhirin includes four types of desmogleins (DSGs, DSG1-4) and three types of desmocollinss (DSCSs-3), which are heterodimers in the intracellular space. It exists as a heterodimeric interaction. In other words, DSG is a structure of desmosomes. Among the CADHIRs, DSG1 and DSG3 are at different positions in the epidermis. DSG1 and DSG3 are mainly expressed in the upper and lower layers of the epidermis, respectively. These two DSG isoforms function compensatory for the other if one is deficient. However, because the expression level (density) of the two isoforms varies from tissue to tissue, blisters may occur in certain tissues upon either deficiency. The expression level of DSG1 is high in the skin, but the expression level of DSG1 is relatively high in the mucous membrane. Thus, inactivation of DSG3 in the skin has less effect on the skin, while inactivation of DSG3 in the mucosa does not completely compensate for the deficiency of DSG3 in the mucosa. This is because the expression level of DSG1 is not high in the mucosa. Inactivation of DSG3 is theoretically due to two factors: dysfunction of DSG3 and loss of DSG. There have been reports of patients with swelling caused by dysfunction of DSG3, but none of patients with swelling caused by loss of DSG3 have been reported.

The epidermal cells may express desmoglein 3 (DSG3) protein variants.

The term “DSG3 protein variant” means that a nonsense variation occurred in the amino acid sequence of the DSG3 protein represented by SEQ ID NO: 1. Specifically, the DSG3 protein variant may be a DSG3 protein variant consisting of an amino acid sequence of which arginine (R) at position 287 in the amino acid sequence of SEQ ID NO: 1 is terminated by a stop codon. The DSG3 protein variant may be a DSG3 protein variant consisting of an amino acid sequence of arginine (R) terminated by a stop codon in extracellular (EC) domains 1-5, and arginine (R) in extracellular domain 3 It may be a DSG3 protein variant consisting of an amino acid sequence terminated by a stop codon. That is, expressing a DSG3 protein variant means that the arginine (R) at position 287 in the amino acid sequence of SEQ ID NO: 1 is transcribed and translated so that a polypeptide consisting of an amino acid sequence terminated by a stop codon is produced.

The epidermal cell may be one that expresses desmoglein 3 (DSG3) gene variant. The epidermal cell may comprise a polynucleotide encoding the DSG3 protein variant.

The term “DSG3 gene variant” means that a mutation has occurred in a portion of the nucleotide sequence of the DSG3 gene represented by SEQ ID NO: 2. Specifically, the DSG3 gene variant may be composed of a nucleotide sequence in which cytosine (C) at position 859 in the nucleotide sequence of SEQ ID NO: 2 is substituted with thymine (T). Alternatively, the DSG3 gene variant may be a substitution of T for the 29041235 base C of human chromosome 18.

DSG3 Genetic variant is DSG3 By single nucleotide polymorphism (SNP) or point mutation of a gene, it may be to cause a missense mutation.

The term "gene" refers to a structural unit that determines genetic information and controls the expression of a structural gene, and / or structural gene having information that determines the amino acid sequence of a protein or the nucleotide sequence of a functional RNA (tRNA, rRNA, etc.). Regulatory genes, for example, may include a promoter, a suppressor (repressor), an operator (operator) and the like. The term "gene" is understood herein to mean a single stranded side comprising a nucleotide sequence that is transcribed to produce a product of a gene.

Those skilled in the art will be able to easily identify monobasic polymorphic markers and sequences using the registration numbers. The specific sequence corresponding to the number registered in the UCSC genome browser or GenBank may change slightly over time. It will be apparent to those skilled in the art that the scope of the present invention extends to such altered sequences.

The term "single nucleotide polymorphism (SNP)" is used in the meaning commonly known in the art. Monobasic polymorphism refers to a single base or nucleotide (A, T, C or G, nucleotide A stands for adenine, nucleotide T stands for thymine, nucleotide C stands for cytosine, nucleotide G stands for guanine) between members of a species. By diversity or polymorphism of the base or nucleotide sequence present in the genome. Monobasic polymorphism is the most common genetic polymorphism on the human genome, and genetically, a single basic polymorphism can cause a large difference in each individual. The single nucleotide polymorphism may be mixed with a single nucleotide variant (SNV). The single nucleotide variation refers to a change in sequence showing a difference of one base or nucleotide on the genome.

The single nucleotide polymorphism may be that the base at position 859 in the nucleotide sequence of SEQ ID NO: 2 is cytosine (C) or thymine (T). Alternatively, the single nucleotide polymorphism may be one in which the 29041235th base of human chromosome 18 is C or T.

The epidermal cells may be derived from mucosal tissue or skin tissue. The epidermal cells may be keratinocytes.

The epidermal cells may be derived from oral tissue or laryngeal tissue.

The epidermal cells may be derived from vertebrates, specifically mammals, amphibians, reptiles, or birds, more specifically from mammals, for example from humans ( Homo sapiens ).

The epidermal cells may be deposited with accession number KCTC 13702BP.

A DSG3 protein variant consisting of an amino acid sequence in which arginine (R) at position 287 in the amino acid sequence of SEQ ID NO: 1 is terminated by a stop codon, or cytosine (C) at position 859 in a nucleotide sequence of SEQ ID NO: 2 is thymine ( The DSG3 gene variant, consisting of the nucleotide sequence substituted with T), may be a diagnostic marker for schizophrenia-like disease. Thus, the p.R287X variant region of the DSG3 protein variant or the c.859C> T variant region of the DSG3 gene variant may be a mutant marker for the diagnosis of swelling-like disease.

The term "diagnosis" refers to identifying the presence or characteristic of a pathological condition. Therefore, the "diagnosis of a skylarginous like disease" may refer to confirming the likelihood or possibility of developing a skylarginous like disease or predicting the risk of the onset.

Another aspect is a protein consisting of an amino acid sequence of which arginine (R) at position 287 in the amino acid sequence of SEQ ID NO: 1 is terminated by a stop codon, or cytosine (C) at position 859 of the nucleotide sequence of SEQ ID NO: 2 is thymine ( Provided is a composition for predicting the risk of developing a skyrocket-like disease, comprising an agent capable of specifically detecting a polynucleotide consisting of a nucleotide sequence substituted with T).

The term "agent capable of specifically detecting a protein" means a substance that can be used to specifically identify or detect the protein in a subject's sample. Agents capable of specifically detecting the protein are p. It may be an agent capable of specifically detecting an R287X mutation site.

The term “agent capable of specifically detecting a p. R287X variant site of a protein” refers to the p. A substance that can be used to specifically identify or detect a R287X mutation site.

Agents capable of specifically detecting the protein may be selected from DSG3 protein variants, such as p. It may be a specific compound or synthetic substance targeting the R287X mutation site, more specifically, an antibody specific for the DSG3 protein variant, and more specifically, the arginine (R) at position 287 may be selected by a stop codon. It may be an antibody specific for a desmoglein 3 (DSG3) protein variant consisting of a terminated amino acid sequence, but the type is not necessarily limited thereto.

The term “antibody” refers to a specific protein molecule directed to an antigenic site as it is known in the art. The antibody specific for the DSG3 protein variant is obtained by cloning a gene encoding the DSG3 protein variant into an expression vector according to a conventional method to obtain a DSG3 protein variant encoded by the gene, and from the obtained DSG3 protein variant. It can be produced by the method. This may include partial peptides that may be made from the DSG3 protein variant, and the partial peptide may include 7 amino acids, 9 amino acids, or 12 or more amino acids. The form of the antibody is not particularly limited and may be a polyclonal antibody, a monoclonal antibody, or a part thereof as long as it has antigen binding, and all immunoglobulin antibodies may be included. Furthermore, the antibody may also include special antibodies such as humanized antibodies.

Polyclonal antibodies can be produced by methods well known in the art for injecting the DSG3 protein variant antigens described above into an animal and collecting blood from the animal to obtain serum comprising the antibody. Such polyclonal antibodies can be prepared from any animal species host such as goat, rabbit, sheep, monkey, horse, pig, bovine dog.

Monoclonal antibodies are known in the art by the hybridoma method (Kohler and Milstein, European Jounral of Immunology 6: 511-519, 1976), or phage antibody libraries (Clackson et al, Nature 352: 624-). 628, 1991; Marks et al, J Mol Biol 222 (58): 1-597, 1991) technology. Antibodies prepared by the above method can be isolated and purified using methods such as gel electrophoresis, dialysis, salt precipitation, ion exchange chromatography, affinity chromatography, and the like.

Antibodies capable of detecting the DSG3 protein variant may include functional fragments of antibody molecules as well as complete forms having two full length light chains and two full length heavy chains. A functional fragment of an antibody molecule refers to a fragment having at least antigen binding function and includes Fab, F (ab '), F (ab') 2 and Fv.

The term "agent capable of specifically detecting a polynucleotide" refers to a substance that can be used to specifically identify or detect the polynucleotide in a sample of an individual. Agents capable of specifically detecting the polynucleotide include c. 859 C> T may be an agent capable of specifically detecting a mutation site.

The term "agent capable of specifically detecting a c. 859 C> T mutation site of a polynucleotide" means c. 859 C> T means a substance that can be used to specifically identify or detect a mutation site.

The agent capable of specifically detecting the polynucleotide may be a substance that specifically binds to a DSG3 gene variant, and specifically, c. 859 C> T variant site, and more specifically c. Of the DSG3 gene variant. 859 C> T may be a primer, probe or antisense nucleic acid that specifically binds to a mutation site, but the kind thereof is not necessarily limited thereto.

The primer, probe or antisense nucleic acid specifically binds to a polynucleotide consisting of a nucleotide sequence in which cytosine (C), which is at position 859 of the nucleotide sequence of SEQ ID NO: 2, is substituted with thymine (T). There may be no specific binding.

The primers, probes or antisense nucleic acids can be prepared by those skilled in the art Design can be based on the nucleotide sequence of the gene variant.

The term "primer" refers to a nucleic acid sequence having a short free 3 'hydroxyl group, which can form complementary templates and base pairs and serve as a starting point for template strand copying. It means 7 to 50 nucleic acid sequences. Primers are usually synthesized but can also be used in naturally occurring nucleic acids. The sequence of the primer does not necessarily have to be exactly the same as the sequence of the template, but only if it is sufficiently complementary to hybridize with the template. Primers will initiate DNA synthesis in the presence of four different nucleoside triphosphates and reagents for polymerization (ie, DNA polymerase or reverse transcriptase) at appropriate buffers and temperatures. PCR conditions, sense and antisense primer lengths can be modified based on what is known in the art, therefore, PCR using the sense and antisense primers of the nucleotide sequence region of the DSG3 gene variant Amplification can be performed to diagnose P. pelvis-like disease.

The term “probe” refers to a nucleic acid fragment such as RNA or DNA, which is short to several bases to hundreds of bases capable of specific binding with mRNA, and labeled to identify the presence of a specific mRNA. Can be. The probe may be manufactured in the form of an oligonucleotide probe, a single stranded DNA probe, a double stranded DNA probe, an RNA probe, or the like. Selection of suitable probes and hybridization conditions can be modified based on what is known in the art. Therefore, hybridization may be performed using a probe complementary to the nucleotide sequence of the DSG3 gene variant, thereby diagnosing a stool-like disease through hybridization.

The primer or probe may be chemically synthesized using a phosphoramidite solid support method, or other well known methods. Such nucleic acid sequences may incorporate additional features that do not change the underlying properties. Examples of additional features that may be incorporated include, but are not limited to, methylation, encapsulation, substitution of one or more nucleic acids with homologues, and modifications between nucleic acids.

The term “antisense nucleic acid” refers to a nucleic acid based molecule that has a complementary sequence to a target DSG3 gene variant and can form a dimer with a DSG3 gene variant and can be used to detect a DSG3 gene variant.

The antisense nucleic acid may be complementary to the polynucleotide or fragment thereof, or these. The fragments are 5 or more, specifically 10 or more, more specifically 10 to 1000, more specifically 10 to 500, even more specifically 15 to 500, even more specifically 15 to 300 Dogs, more specifically 15-200, even more specifically 15-150 nucleotides, but appropriate lengths may be selected to increase detection specificity.

The polynucleotide may be determined that if one single-stranded polynucleotide is associated with the risk of developing a skylar like disease, the polynucleotide complementary to the single-stranded polynucleotide may naturally be associated with the risk of developing a skylarginous disease. Thus, a composition according to one aspect comprises a single stranded polynucleotide and a polynucleotide having a sequence complementary thereto that is associated with the risk of developing a skyrocket-like disease with one particular sequence.

For example, the 29041235 base (monopolymorphism marker) of human chromosome 18 is "C" or "T". In this case, the composition not only comprises the "C" or "T" nucleotide of the 29041235th base (monopolymorphic marker) of human chromosome 18, but also has a position corresponding to the 29041235 base of chromosome 18 of human It may include complementary single stranded polynucleotides having "G" or "A" nucleotides. Thus, the composition can detect base C or T at position 859 in the nucleotide sequence of SEQ ID NO: 2, or the 29041235 base of human chromosome 18.

Another aspect provides a kit for diagnosing or at risk of developing a spear-like disease comprising the composition.

The kit is a protein consisting of an amino acid sequence of which arginine (R) at position 287 in the amino acid sequence of SEQ ID NO: 1 is terminated by a stop codon, or cytosine (C) at position 859 in the nucleotide sequence of SEQ ID NO: 2 By specifically detecting a polynucleotide consisting of a nucleotide sequence substituted with thymine (T), it is possible to diagnose whether or not a risk of developing a swelling-like disease occurs.

Specifically, the kit is a p. Of the protein consisting of the amino acid sequence terminated by the stop codon arginine (R) at position 287 in the amino acid sequence of SEQ ID NO: 1 in the test subject. C. Of a polynucleotide consisting of a R287X mutation site or a nucleotide sequence wherein cytosine (C) at position 859 in the nucleotide sequence of SEQ ID NO: 2 is substituted with thymine (T); By specifically detecting the 859 C> T mutation site, it is possible to diagnose the onset of or risk of developing a flares-like disease.

The kit includes an antibody that specifically recognizes a protein consisting of an amino acid sequence terminated by a stop codon with arginine (R) at position 287 in the amino acid sequence of SEQ ID NO: 1, or position 859 in a nucleotide sequence of SEQ ID NO: 2 One or more other constituent compositions suitable for analysis, including primers, probes or antisense nucleic acids capable of specifically detecting a polynucleotide consisting of a nucleotide sequence in which cytosine (C) is substituted with thymine (T). , Solutions or devices may be included. Specifically, the kit may be an RT-PCR kit, a microarray chip kit or a protein chip kit.

The RT-PCR kit is a c. Of a polynucleotide consisting of a nucleotide sequence of cytosine (C) at position 859 in the nucleotide sequence of SEQ ID NO: 2 substituted with thymine (T). 859 C> T may include the necessary elements required to perform RT-PCR to specifically detect the site of mutation. The RT-PCR kit comprises a c. Of a polynucleotide consisting of a nucleotide sequence wherein cytosine (C) at position 859 in the nucleotide sequence of SEQ ID NO: 2 is substituted with thymine (T). In addition to each primer pair specific for the 859 C> T mutation site, test tubes or other suitable containers, reaction buffers, enzymes such as deoxynucleotides (dNTPs), Taq-polymerase and reverse transcriptase, DNase, RNase inhibitors, DEPC-water (DEPC-water), sterile water, and the like.

The microarray chip may include a DNA or RNA polynucleotide probe. The microarray is a c. Of a polynucleotide consisting of a nucleotide sequence in which the cytosine (C) at position 859 in the nucleotide sequence of SEQ ID NO: 2 is substituted with thymine (T). It can include the construction of conventional microarrays, except for including probes specific for the 859 C> T mutation site. The microarray is a c. Of a polynucleotide consisting of a nucleotide sequence in which the cytosine (C) at position 859 in the nucleotide sequence of SEQ ID NO: 2 is substituted with thymine (T). The presence of a 859 C> T mutation site can be provided to provide useful information in diagnosing the likelihood of developing a skylarginous disease.

C. Of a polynucleotide consisting of a nucleotide sequence wherein cytosine (C) at position 859 in the nucleotide sequence of SEQ ID NO: 2 is substituted with thymine (T); Methods of preparing microarrays by immobilizing probes on 859 C> T mutation sites on a substrate are well known in the art. For example, the DNA microarray may include, but is not limited to, c. By a method using a micropipetting or pin type spotter using a piezoelectric method. C. Probes for 859 C> T mutation sites can be immobilized on a substrate. The substrate of the microarray may be coated with an active group selected from the group consisting of amino-silane, poly-L-lysine, and aldehyde, but is not limited thereto. . In addition, the substrate may be selected from the group consisting of slide glass, plastic, metal, silicon, nylon membrane and nitrocellulose membrane, but is not limited thereto.

In addition, hybridization of nucleic acids on microarrays and detection of hybridization results are well known in the art. The detection involves labeling a nucleic acid sample with a labeling substance capable of generating a detectable signal comprising a fluorescent substance, for example, a substance such as Cy3 and Cy5, and then hybridizing onto a microarray and generating a signal from the labeling substance. The hybridization result can be detected by detecting.

The protein chip kit can measure the expression level of the protein consisting of the amino acid sequence of the arginine (R) at position 287 in the amino acid sequence of SEQ ID NO: 1 terminated by the stop codon. The protein chip kit may include a substrate, a suitable buffer, a secondary antibody labeled with a chromophore or a fluorescent substance, a chromogenic substrate, and the like for immunological detection of the antibody. As the substrate, a nitrocellulose membrane, a 96-well plate synthesized with a polyvinyl resin, a 96-well plate synthesized with a polystyrene resin, a slide glass made of glass, etc. may be used, and a peroxidase (peroxidase) may be used. ), Alkaline phosphatase and the like can be used. In addition, FITC, RITC, etc. may be used as the fluorescent substance, and ABTS (2,2'-azino-bis- (3-ethylbenzothiazoline-6-sulfonic acid)) and OPD (o-phenyl) may be used as a chromogenic substrate. Rendiamine), TMB (tetramethyl benzidine) and the like can be used.

Another aspect is that a stop codon terminates the arginine (R) at position 287 in the amino acid sequence of SEQ ID NO. 1 in a biological sample isolated from an individual to provide information for diagnosing or predicting the risk of developing a skylargin-like disease. It provides a protein consisting of an amino acid sequence, or a polynucleotide consisting of a nucleotide sequence of cytosine (C) at position 859 in the nucleotide sequence of SEQ ID NO: 2 substituted with thymine (T).

The term "individual" refers to an individual who wants to confirm or predict the possibility of developing a flare-up disease-like disease or to predict the risk of developing it. The subject may be a vertebrate, specifically mammals, amphibians, reptiles, birds, and the like, more specifically may be mammals, for example humans ( Homo sapiens ). The subject may be Asian or Korean. "Subject" and "patient" are used interchangeably herein.

The term "biological sample" may include, but is not limited to, tissues, cells, whole blood, serum, plasma, saliva, sputum, cerebrospinal fluid or urine, isolated from an individual, and the like. The biological sample may be tissue or cells of mucous membranes or skin.

The protein may be detected by using an agent that can specifically detect the protein. Specifically, the agent capable of specifically detecting the protein is p. It may be an agent capable of specifically detecting an R287X mutation site. The agent capable of specifically detecting the protein may be an antibody, but is not limited thereto.

Assays for detecting the protein include Western blotting, enzyme linked immunosorbent assay (ELISA), radioimmunoassay (RIA), radioimmunodiffusion, and Ouchterlony. Immunodiffusion, rocket immunoelectrophoresis, immunohistochemical staining, immunoprecipitation assay, complement fixation assay, fluorescence activated cell sorter (FACS), protein chips, etc. It is not limited to this.

The polynucleotide is selected from c. 859 C> T may be detected using an agent that can specifically detect a mutation site. C. Of said polynucleotide. Agents capable of specifically detecting the 859 C> T mutation site may be, but are not limited to, primers, probes or antisense nucleic acids.

Assays for detecting the polynucleotide include reverse transcriptase (RT-PCR), competitive reverse transcriptase (RT) PCR, real-time reverse transcriptase (Real-time RT-PCR), and RNase protection assay (RNase protection). assay: RPA), Northern blotting, DNA chips, etc., but is not limited thereto.

In the method, p. Of the protein consisting of the amino acid sequence of the arginine (R) at position 287 in the amino acid sequence of SEQ ID NO: 1 in the biological sample isolated from the individual consisting of the termination codon. C. Of a polynucleotide consisting of a R287X mutation site or a nucleotide sequence wherein cytosine (C) at position 859 in the nucleotide sequence of SEQ ID NO: 2 is substituted with thymine (T); If a 859 C> T mutation site is present, it may be diagnosed as having or at risk of developing a skylargin-like disease.

Providing information for predicting the risk of developing a swelling-like disease of the individual may be for predicting or diagnosing the relative risk of the swelling-like disease. For example, the risk may be for predicting or diagnosing whether the likelihood of developing a skylarginous disease is increased compared to a normal group or a group having a reference genome sequence.

The term “reference genome sequence” may be that of a human genome sequence, to which reference is made for polymorphism or mutation identification. The reference genome sequence may be a nucleotide sequence of a reference genome, for example, a nucleotide sequence of a human gene, specifically NCBI37.1 or UCSC hg19 (GRCh37), published in a database of the National Institute of Biotechnology Information Institute of the National Institutes of Health. . The comparison between the nucleotide sequence of the individual and the reference genome sequence can be performed using various known sequence comparison assay programs such as Maq, Bowtie, SOAP, GSNAP and the like.

The swelling-like disease may be caused by homozygous monobasic polymorphism. The swelling-like disease may be blisters formed on the mucosa, and specifically, blisters may be formed on the laryngeal mucosa, oral mucosa, or a combination thereof, or suprabasal blisters may be formed on the base of the mucosa. have. The swelling-like disease may be one having no skin lesion, and specifically, the scalp, hair, or a combination thereof may have a normal phenotype.

4 shows the phenotype in DSG3 ^{− / −} mice. As shown in FIG. 4, DSG3 ^{− / −} mice showed blisters in the basal upper part of the mucous membrane, including the oral cavity, vagina, nostrils and conjunctiva, and showed sores and hypochondria of the skin that appeared as trauma. . However, unlike DSG3 ^{− / −} mice, when the function of DSG3 is lost in humans, the mucosa of the conjunctiva and genitals is relatively preserved and the hair condition is normal. Variation of DSG3 in humans is considered to have a relatively low effect on skin that appears as a trauma. In addition, a milder phenotype compared to mice in human patients deficient in DSG3 showed that the compensation capability of human DSG1 was superior to that of mouse DSG1 when DSG3 deficient. Imply.

Variants of the desmogloin 3 protein and cells expressing the same according to one aspect may be used as markers for predicting the risk of developing a skyrocket-like disease. Precise diagnosis is possible through genetic testing for P. aureus-like diseases. Therefore, the treatment effects that are being developed recently can be applied early to maximize the therapeutic effect.

1A shows the results of clinical analysis of the oral mucosa of a patient. 1B and 1C show the results of histological analysis of the oral mucosa and scalp of the patient.
2A shows the result of confirming the nonsense variation of DSG3. 2B shows the structure of extracellular domains 1-5 of DSG3.
3A shows immunofluorescence staining analysis of oral mucosa sections from patients and normal subjects. Green stained the target protein, blue stained DAPI. Scale bars are shown on a 100 μm basis. 3B shows Western blot analysis of skin keratinocytes and mucosal keratinocytes of patients and normal subjects. 3C shows the desmosome structure of the patient. Scale bars are shown relative to 100 nm.
4 is DSG3 deficiency (DSG3 ^{− / −} ) Phenotype in mice.
5 shows immunofluorescence staining analysis of the dermis and epidermis of patients.

The invention is explained in more detail by the following examples. However, the following examples are only intended to help the understanding of the present invention, and the scope of the present invention in any sense is not limited by these examples.

Example  One : Des Moglane  3 ( desmoglein  3: DSG3 ) lack of In the patient pemphigus  Similar symptom analysis and genetic variation SNP 859C> T

Clinical and histological analysis of bleb formation in mucosal tissues

1.1. Study Selection and Clinical Analysis of Blister Formation in Mucosal Tissues

The study was conducted under the approval of the Institutional Review Board of Yonsei University College of Medicine.

The patient was a 1-year-old girl who had bleeding in the oral from a week after birth and had repeated erosion in the mucosa of the oral cavity and laryngeal. The mucosa and skin of the conjunctival and genitals were sparred and the hair grew normally. The patient's parents showed no blisters on the skin and mucous membranes.

1A shows the results of clinical analysis of the oral mucosa of a patient. As shown in Figure 1a, a large number of sores and lip cracks in the tongue of the patient, and laryngeal sores were shown. 1C shows the results of clinical analysis of the scalp of the patient. As shown in Figure 1c, the patient's scalp and hair showed normal findings.

1.2 Histological Analysis of Blister Formation in Mucosal Tissues-Hematoxylin and Eosin Staining, Immunofluorescence Staining and Electron Microscopy

Scalp and oral mucosa tissue were obtained from the patient and the patient's parent, fixed in formalin, embedded in paraffin and sectioned at 6 μm. Sectioned tissue samples were stained with hematoxylin and eosin and images were taken from skin and oral mucosal tissue sections using a microscope.

1B shows the histological analysis of the oral mucosa of the patient. 1C shows the histological analysis of the scalp of the patient. 1b and 1c, suprabasal acantholytic blisters were observed in the oral mucosa, but the epidermis and hair structure in the scalp appeared normal.

Fragmented tissue samples were subjected to mouse anti-human DSG3 antibody (clone 5H10; Novus Biologicals and clone 5G11; Invitrogen), mouse-anti-human DSC3 antibody (clone DSC3-U114; Progen), mouse anti-human plakoglobin Primary antibodies, including antibody (clone PG-11E4; Invitrogen) and mouse anti-human desmoplakin antibody (Progen) and IgG obtained from serum of patients with deciduous flares (PF IgG, desmogloin 1) IgG). Alexa Fluor 488 was then bound with a secondary antibody comprising rabbit anti-mouse IgG and goth anti-human IgG (Invitrogen). The sections were then stained with 4,6-diamidino-2-phenylindole (DAPI) (Invitrogen) for 5 minutes. Images are obtained from tissue samples stained using an LSM 780 confocal microscope (Carl Zeiss, Oberkochen, Germany) and Karnovsky using a transmission electron microscopy (H-7600, Hitachi, Japan). Images were obtained from skin tissue sections fixed in Karnovsky's fixative.

3 shows expression levels and structures of desmosome protein components in patients and normal subjects. 3A shows immunofluorescence staining analysis of oral mucosa sections from patients and normal subjects. Green stained the target protein, blue stained DAPI. Scale bars are shown on a 100 μm basis. As shown in FIG. 3A, DSG3 was not expressed in the mucosa of the patient. On the other hand, desmoglein 1 (DSG1) and desmocollin, plakoglobin, and desmoplakin, cadherins of other desmosomes, are normal people and expression. The levels were similar.

3C shows the desmosome structure of the patient. Scale bars are shown relative to 100 nm. As shown in FIG. 3C, desmosomes were observed in the lower layer (base layer, stratum basalis: SB) and the upper layer (granular layer, stratum granulosum: SG) of the epidermis. Desmosomes observed were normal in the basal and granular layers.

1.3 Des Moglane  In serum of 3 deficient patients Des Moglane  Levels 1 and 3-Enzyme-linked immunosorbent assay (ELISA)

ELISA was used to detect antibodies against desmogloin 1 and 3 in the serum of patients (MBL diagnostics). As a result, the concentration of desmogloin 1 was about 25.0 U / ml, and the concentration of desmogloin 3 was about 30.4 U / ml.

2. Genetic variation analysis and homozygosity of blister formation in mucosal tissue SNP 859C> T OK

2.1 Genetic variation analysis of blister formation in mucosal tissues, homozygous SNP c.859C> T and p. R287X  Confirmation-whole-genome sequencing: WGS )

Blood samples were taken from patients and their parents, and whole genome sequencing was performed on the blood samples as follows.

Sequencing libraries were prepared for blood samples using Illumina library preparation protocol (TruSeq DNA PCR-free library, Illumina). The prepared library was sequenced using HiSeq X Ten instrument (Illumina). Isaac Aligner (Illumina) was then used to align the WGS raw data in the BCL file format to the human reference genome to generate a BAM file. Issac Variant Caller (https://www.illumina.com/documents/products/whitepapers/whitepaper_isaac_workflow.pdf), SnpEff (http://snpeff.sourceforge.net/SnpEff.html), Manta (https: //www.synapse.org/#!Synapse:syn312572) and Control-FREEC to improve the accuracy of mutation extraction.

As a result of mutation extraction, 3,474,087 SNPs were identified in the patients. In this data, stop-gained and truncated SNPs were selected, except for SNPs of non-coding genes. After the filtering was performed, stop-gained and lattice shift SNPs were selected and shown in Table 1. Among them, c. Of chr18: 29041235 which is a homozygous variant. 859C> T was finally selected.

gene Genotype
(Homo / Hetero) Reference genome
Allele
(Reference allele) patient
Allele
(Patient
allele) chromosome
number
(Chr) location
(Position) STOP CODON GAINED DSG3 T / T (Homo) C T 18 29041235 HELZ2 G / A (Hetero) G A 20 62203525 FRAMESHIFT HSPB11 AG / A (Hetero) AG A One 54387416 ZNF717 A / AATGACTT (Hetero) A AATGACTT 3 75787044 MAML3 TTGCTGCTGC / T (Hetero) TTGCTGCTGCTGC TTGCTGCTGC, T 4 140811063 TRIM4 A / AT (Hetero) A AT 7 99516871 ARHGEF5 A / ATGGAGGCTGAGGAGGCCCAGCG (Hetero) A ATGGAGGCTGAGGAGGCCCAGCG 7 144059763 CYSLTR2 AT / A (Hetero) AT A 13 49281070 CCDC175 CACTAGAG / C (Hetero) CACTAGAG C 14 60005557 RNFT1 GAT / G (Hetero) GAT G 17 58040263 GAMT C / CTCCA (Hetero) C CTCCA 19 1399155 ZNF799 TA / T (Hetero) TA T 19 12501866

2.2. Genetic variation analysis of blister formation in mucosal tissues, homozygous SNP c.859C> T and p. R287X  Confirm - Of DSG3  Site-specific Amplicon  Site-specific amplicon sequencing and restriction fragment length polymorphism (RFLP)

Blood samples were taken from patients and their parents and genomic DNA was obtained from blood samples using DNA extraction kits. Target primers were used to amplify the DSG3 gene by polymerase chain reaction (PCR).

PCR-RFLP (polymerase chain reaction-restriction fragment length polymorphism) was performed using restriction enzyme TaqI.

2A shows the result of confirming the nonsense variation of DSG3. The lower figure shows the ancestry of the patient, where the squares are male, the circles are female, and the filled figures represent individuals affected by the disease. The middle figure shows the results of PCR-RFLP analysis of the patient's household and healthy normal persons, with N representing normal. As shown in FIG. 2A, in the wild type allele, the fragment of 596 bp was divided into two fragments of 247 bp and 249 bp. In contrast, 596 bp fragments were detected in patients with a c.859C> T mutation of DSG3. The top figure shows the results of sequencing the DSG3 gene directly. Sanger sequencing was performed to identify heterozygous c.859C> T mutations in each patient's parent. This suggests that the homozygous c.859C> T mutation of DSG3 in patients was genetic.

DSG3 is a membrane protein of about 130 kDa consisting of five extracellular 1-5 (EC 1-5) domains 1-5, and a small transmembrane and intracellular domain. 2B shows the structure of extracellular domains 1-5 of DSG3. The c.859C> T mutation of DSG3 is expected to result in premature termination of protein translation (p.R287X) in the EC3 domain of DSG3.

4. Confirmation of Desmoglen 3 Expression in Dermal Explants and Keratinocytes for Induction into Primary Human Keratinocytes

Normal and patient skin and oral mucosa were biopsied with a 3 mm punch and dissected into 10 pieces with sharp edges. The pieces were placed in a culture dish of 100 pi wells, Dulbecco's modified Eagle's medium (Dulbecco's) containing 10% fetal bovine serum (FBS) and 1% penicillin / streptomycin. Modified Eagle Medium (DMEM) was maintained at 37 ° C., 5% CO ₂ conditions. After one week, the medium was replaced with Keratinocyte-SFM (Invitrogen). The cells were then fully grown, trypsin was added to separate the cells from the culture dish, and then centrifuged to obtain the cells and stored in a nitrogen tank. The obtained cells were deposited with the Korea Research Institute of Bioscience and Biotechnology, and received the KCTC13402BP accession number.

Using the obtained cells, the expression levels of the proteins were analyzed by Western blot as follows. Proteins were obtained from primary human keratinocytes using RIPA lysis buffer (Cell Signaling Technology, Danvers, MA) containing 1 mM PMSF. After obtaining the protein, the same amount of protein in each sample was loaded onto a Nupage Novex Bis-Tris gel (Invitrogen) and subjected to electrophoresis on X-cell SureLock Mini-Cell (Invitrogen). After electrophoresis, the protein was transferred to PVDF membrane and the PVDF membrane was reacted with the primary antibody. Subsequently, it was reacted with a secondary antibody and protein bands were detected using ECL PLUS reagent (Pierce, Rockford, IL). At this time, a rabbit anti-human E-cadherin antibody (24E10; Cell Signaling Technology), a mouse anti-human GAPDH antibody (6C5; Calbiochem) and an antibody for immunofluorescence were used as the primary antibody. Secondary antibodies were HRP bound anti-mouse and anti-rabbit secondary antibodies (Invitrogen).

3B shows Western blot analysis of skin keratinocytes and mucosal keratinocytes of patients and normal subjects. As shown in FIG. 3B, DSG3 in the mucosa of the patient was not expressed differently from normal people. This is the same result as the immunofluorescence staining analysis performed in Figure 3a.

5. Des Moglane  3 deficient patients pemphigus  Check for illness

5.1 Des Moglane  3 deficient patients pemphigus  Check for outbreaks- Immunofluorescence  Staining observation

Immunofluorescence staining analysis of the dermis and epidermis of the patient is shown. Green is for IgG and blue is for DAPI. As shown in FIG. 5, no IgG was deposited on the skin of the patient, and it can be seen from this that the desmogloin 3 deficient patient does not exhibit the same symptoms as the pemphigus.

Depositary: Korea Research Institute of Bioscience and Biotechnology

Accession number: KCTC13402BP

Deposit Date: 20171122

<110> Industry Academic Cooperation Foundation Yonsei University <120> Genetic mutation of desmoglein 3 and use <130> PN120091 <160> 2 <170> KopatentIn 2.0 <210> 1 <211> 999 <212> PRT <213> Homo sapiens <400> 1 Met Met Gly Leu Phe Pro Arg Thr Thr Gly Ala Leu Ala Ile Phe Val   1 5 10 15 Val Val Ile Leu Val His Gly Glu Leu Arg Ile Glu Thr Lys Gly Gln              20 25 30 Tyr Asp Glu Glu Glu Met Thr Met Gln Gln Ala Lys Arg Arg Gln Lys          35 40 45 Arg Glu Trp Val Lys Phe Ala Lys Pro Cys Arg Glu Gly Glu Asp Asn      50 55 60 Ser Lys Arg Asn Pro Ile Ala Lys Ile Thr Ser Asp Tyr Gln Ala Thr  65 70 75 80 Gln Lys Ile Thr Tyr Arg Ile Ser Gly Val Gly Ile Asp Gln Pro Pro                  85 90 95 Phe Gly Ile Phe Val Val Asp Lys Asn Thr Gly Asp Ile Asn Ile Thr             100 105 110 Ala Ile Val Asp Arg Glu Glu Thr Pro Ser Phe Leu Ile Thr Cys Arg         115 120 125 Ala Leu Asn Ala Gln Gly Leu Asp Val Glu Lys Pro Leu Ile Leu Thr     130 135 140 Val Lys Ile Leu Asp Ile Asn Asp Asn Pro Pro Val Phe Ser Gln Gln 145 150 155 160 Ile Phe Met Gly Glu Ile Glu Glu Asn Ser Ala Ser Asn Ser Leu Val                 165 170 175 Met Ile Leu Asn Ala Thr Asp Ala Asp Glu Pro Asn His Leu Asn Ser             180 185 190 Lys Ile Ala Phe Lys Ile Val Ser Gln Glu Pro Ala Gly Thr Pro Met         195 200 205 Phe Leu Leu Ser Arg Asn Thr Gly Glu Val Arg Thr Leu Thr Asn Ser     210 215 220 Leu Asp Arg Glu Gln Ala Ser Ser Tyr Arg Leu Val Val Ser Gly Ala 225 230 235 240 Asp Lys Asp Gly Glu Gly Leu Ser Thr Gln Cys Glu Cys Asn Ile Lys                 245 250 255 Val Lys Asp Val Asn Asp Asn Phe Pro Met Phe Arg Asp Ser Gln Tyr             260 265 270 Ser Ala Arg Ile Glu Glu Asn Ile Leu Ser Ser Glu Leu Leu Arg Phe         275 280 285 Gln Val Thr Asp Leu Asp Glu Glu Tyr Thr Asp Asn Trp Leu Ala Val     290 295 300 Tyr Phe Phe Thr Ser Gly Asn Glu Gly Asn Trp Phe Glu Ile Gln Thr 305 310 315 320 Asp Pro Arg Thr Asn Glu Gly Ile Leu Lys Val Val Lys Ala Leu Asp                 325 330 335 Tyr Glu Gln Leu Gln Ser Val Lys Leu Ser Ile Ala Val Lys Asn Lys             340 345 350 Ala Glu Phe His Gln Ser Val Ile Ser Arg Tyr Arg Val Gln Ser Thr         355 360 365 Pro Val Thr Ile Gln Val Ile Asn Val Arg Glu Gly Ile Ala Phe Arg     370 375 380 Pro Ala Ser Lys Thr Phe Thr Val Gln Lys Gly Ile Ser Ser Lys Lys 385 390 395 400 Leu Val Asp Tyr Ile Leu Gly Thr Tyr Gln Ala Ile Asp Glu Asp Thr                 405 410 415 Asn Lys Ala Ala Ser Asn Val Lys Tyr Val Met Gly Arg Asn Asp Gly             420 425 430 Gly Tyr Leu Met Ile Asp Ser Lys Thr Ala Glu Ile Lys Phe Val Lys         435 440 445 Asn Met Asn Arg Asp Ser Thr Phe Ile Val Asn Lys Thr Ile Thr Ala     450 455 460 Glu Val Leu Ala Ile Asp Glu Tyr Thr Gly Lys Thr Ser Thr Gly Thr 465 470 475 480 Val Tyr Val Arg Val Pro Asp Phe Asn Asp Asn Cys Pro Thr Ala Val                 485 490 495 Leu Glu Lys Asp Ala Val Cys Ser Ser Ser Pro Ser Val Val Val Ser             500 505 510 Ala Arg Thr Leu Asn Asn Arg Tyr Thr Gly Pro Tyr Thr Phe Ala Leu         515 520 525 Glu Asp Gln Pro Val Lys Leu Pro Ala Val Trp Ser Ile Thr Thr Leu     530 535 540 Asn Ala Thr Ser Ala Leu Leu Arg Ala Gln Glu Gln Ile Pro Pro Gly 545 550 555 560 Val Tyr His Ile Ser Leu Val Leu Thr Asp Ser Gln Asn Asn Arg Cys                 565 570 575 Glu Met Pro Arg Ser Leu Thr Leu Glu Val Cys Gln Cys Asp Asn Arg             580 585 590 Gly Ile Cys Gly Thr Ser Tyr Pro Thr Thr Ser Pro Gly Thr Arg Tyr         595 600 605 Gly Arg Pro His Ser Gly Arg Leu Gly Pro Ala Ala Ile Gly Leu Leu     610 615 620 Leu Leu Gly Leu Leu Leu Leu Leu Leu Ala Pro Leu Leu Leu Leu Thr 625 630 635 640 Cys Asp Cys Gly Ala Gly Ser Thr Gly Gly Val Thr Gly Gly Phe Ile                 645 650 655 Pro Val Pro Asp Gly Ser Glu Gly Thr Ile His Gln Trp Gly Ile Glu             660 665 670 Gly Ala His Pro Glu Asp Lys Glu Ile Thr Asn Ile Cys Val Pro Pro         675 680 685 Val Thr Ala Asn Gly Ala Asp Phe Met Glu Ser Ser Glu Val Cys Thr     690 695 700 Asn Thr Tyr Ala Arg Gly Thr Ala Val Glu Gly Thr Ser Gly Met Glu 705 710 715 720 Met Thr Thr Lys Leu Gly Ala Ala Thr Glu Ser Gly Gly Ala Ala Gly                 725 730 735 Phe Ala Thr Gly Thr Val Ser Gly Ala Ala Ser Gly Phe Gly Ala Ala             740 745 750 Thr Gly Val Gly Ile Cys Ser Ser Gly Gln Ser Gly Thr Met Arg Thr         755 760 765 Arg His Ser Thr Gly Gly Thr Asn Lys Asp Tyr Ala Asp Gly Ala Ile     770 775 780 Ser Met Asn Phe Leu Asp Ser Tyr Phe Ser Gln Lys Ala Phe Ala Cys 785 790 795 800 Ala Glu Glu Asp Asp Gly Gln Glu Ala Asn Asp Cys Leu Leu Ile Tyr                 805 810 815 Asp Asn Glu Gly Ala Asp Ala Thr Gly Ser Pro Val Gly Ser Val Gly             820 825 830 Cys Cys Ser Phe Ile Ala Asp Asp Leu Asp Asp Ser Phe Leu Asp Ser         835 840 845 Leu Gly Pro Lys Phe Lys Lys Leu Ala Glu Ile Ser Leu Gly Val Asp     850 855 860 Gly Glu Gly Lys Glu Val Gln Pro Pro Ser Lys Asp Ser Gly Tyr Gly 865 870 875 880 Ile Glu Ser Cys Gly His Pro Ile Glu Val Gln Gln Thr Gly Phe Val                 885 890 895 Lys Cys Gln Thr Leu Ser Gly Ser Gln Gly Ala Ser Ala Leu Ser Thr             900 905 910 Ser Gly Ser Val Gln Pro Ala Val Ser Ile Pro Asp Pro Leu Gln His         915 920 925 Gly Asn Tyr Leu Val Thr Glu Thr Tyr Ser Ala Ser Gly Ser Leu Val     930 935 940 Gln Pro Ser Thr Ala Gly Phe Asp Pro Leu Leu Thr Gln Asn Val Ile 945 950 955 960 Val Thr Glu Arg Val Ile Cys Pro Ile Ser Ser Val Pro Gly Asn Leu                 965 970 975 Ala Gly Pro Thr Gln Leu Arg Gly Ser His Thr Met Leu Cys Thr Glu             980 985 990 Asp Pro Cys Ser Arg Leu Ile         995 <210> 2 <211> 3000 <212> DNA <213> Homo sapiens <400> 2 atgatggggc tcttccccag aactacaggg gctctggcca tcttcgtggt ggtcatattg 60 gttcatggag aattgcgaat agagactaaa ggtcaatatg atgaagaaga gatgactatg 120 caacaagcta aaagaaggca aaaacgtgaa tgggtgaaat ttgccaaacc ctgcagagaa 180 ggagaagata actcaaaaag aaacccaatt gccaagatta cttcagatta ccaagcaacc 240 cagaaaatca cctaccgaat ctctggagtg ggaatcgatc agccgccttt tggaatcttt 300 gttgttgaca aaaacactgg agatattaac ataacagcta tagtcgaccg ggaggaaact 360 ccaagcttcc tgatcacatg tcgggctcta aatgcccaag gactagatgt agagaaacca 420 cttatactaa cggttaaaat tttggatatt aatgataatc ctccagtatt ttcacaacaa 480 attttcatgg gtgaaattga agaaaatagt gcctcaaact cactggtgat gatactaaat 540 gccacagatg cagatgaacc aaaccacttg aattctaaaa ttgccttcaa aattgtctct 600 caggaaccag caggcacacc catgttcctc ctaagcagaa acactgggga agtccgtact 660 ttgaccaatt ctcttgaccg agagcaagct agcagctatc gtctggttgt gagtggtgca 720 gacaaagatg gagaaggact atcaactcaa tgtgaatgta atattaaagt gaaagatgtc 780 aacgataact tcccaatgtt tagagactct cagtattcag cacgtattga agaaaatatt 840 ttaagttctg aattacttcg atttcaagta acagatttgg atgaagagta cacagataat 900 tggcttgcag tatatttctt tacctctggg aatgaaggaa attggtttga aatacaaact 960 gatcctagaa ctaatgaagg catcctgaaa gtggtgaagg ctctagatta tgaacaacta 1020 caaagcgtga aacttagtat tgctgtcaaa aacaaagctg aatttcacca atcagttatc 1080 tctcgatacc gagttcagtc aaccccagtc acaattcagg taataaatgt aagagaagga 1140 attgcattcc gtcctgcttc caagacattt actgtgcaaa aaggcataag tagcaaaaaa 1200 ttggtggatt atatcctggg aacatatcaa gccatcgatg aggacactaa caaagctgcc 1260 tcaaatgtca aatatgtcat gggacgtaac gatggtggat acctaatgat tgattcaaaa 1320 actgctgaaa tcaaatttgt caaaaatatg aaccgagatt ctactttcat agttaacaaa 1380 acaatcacag ctgaggttct ggccatagat gaatacacgg gtaaaacttc tacaggcacg 1440 gtatatgtta gagtacccga tttcaatgac aattgtccaa cagctgtcct cgaaaaagat 1500 gcagtttgca gttcttcacc ttccgtggtt gtctccgcta gaacactgaa taatagatac 1560 actggcccct atacatttgc actggaagat caacctgtaa agttgcctgc cgtatggagt 1620 atcacaaccc tcaatgctac ctcggccctc ctcagagccc aggaacagat acctcctgga 1680 gtataccaca tctccctggt acttacagac agtcagaaca atcggtgtga gatgccacgc 1740 agcttgacac tggaagtctg tcagtgtgac aacaggggca tctgtggaac ttcttaccca 1800 accacaagcc ctgggaccag gtatggcagg ccgcactcag ggaggctggg gcctgccgcc 1860 atcggcctgc tgctccttgg tctcctgctg ctgctgttgg ccccccttct gctgttgacc 1920 tgtgactgtg gggcaggttc tactggggga gtgacaggtg gttttatccc agttcctgat 1980 ggctcagaag gaacaattca tcagtgggga attgaaggag cccatcctga agacaaggaa 2040 atcacaaata tttgtgtgcc tcctgtaaca gccaatggag ccgatttcat ggaaagttct 2100 gaagtttgta caaatacgta tgccagaggc acagcggtgg aaggcacttc aggaatggaa 2160 atgaccacta agcttggagc agccactgaa tctggaggtg ctgcaggctt tgcaacaggg 2220 acagtgtcag gagctgcttc aggattcgga gcagccactg gagttggcat ctgttcctca 2280 gggcagtctg gaaccatgag aacaaggcat tccactggag gaaccaataa ggactacgct 2340 gatggggcga taagcatgaa ttttctggac tcctactttt ctcagaaagc atttgcctgt 2400 gcggaggaag acgatggcca ggaagcaaat gactgcttgt tgatctatga taatgaaggc 2460 gcagatgcca ctggttctcc tgtgggctcc gtgggttgtt gcagttttat tgctgatgac 2520 ctggatgaca gcttcttgga ctcacttgga cccaaattta aaaaacttgc agagataagc 2580 cttggtgttg atggtgaagg caaagaagtt cagccaccct ctaaagacag cggttatggg 2640 attgaatcct gtggccatcc catagaagtc cagcagacag gatttgttaa gtgccagact 2700 ttgtcaggaa gtcaaggagc ttctgctttg tccacctctg ggtctgtcca gccagctgtt 2760 tccatccctg accctctgca gcatggtaac tatttagtaa cggagactta ctcggcttct 2820 ggttccctcg tgcaaccttc cactgcaggc tttgatccac ttctcacaca aaatgtgata 2880 gtgacagaaa gggtgatctg tcccatttcc agtgttcctg gcaacctagc tggcccaacg 2940 cagctacgag ggtcacatac tatgctctgt acagaggatc cttgctcccg tctaatatga 3000                                                                         3000

Claims (17)

delete delete delete delete delete delete A protein consisting of an amino acid sequence of which arginine (R) at position 287 in the amino acid sequence of SEQ ID NO: 1 is terminated by a stop codon, or
Predicting the risk of developing a scab-like disease comprising an agent capable of specifically detecting a polynucleotide consisting of a nucleotide sequence wherein cytosine (C) at position 859 in the nucleotide sequence of SEQ ID NO: 2 is substituted with thymine (T) Composition for The composition of claim 7, wherein the agent that can specifically detect the protein is an antibody. 8. The composition of claim 7, wherein the agent capable of specifically detecting the polynucleotide is a primer, probe or antisense nucleic acid. In biological samples isolated from individuals to provide information for diagnosing or predicting the risk of swelling-like disease,
A protein consisting of an amino acid sequence of which arginine (R) at position 287 in the amino acid sequence of SEQ ID NO: 1 is terminated by a stop codon, or
A method for detecting a polynucleotide consisting of a nucleotide sequence in which the cytosine (C) at position 859 in the nucleotide sequence of SEQ ID NO: 2 is substituted with thymine (T). The method according to claim 10,
Terminated by a stop codon at position 287 in the amino acid sequence of SEQ ID NO: 1, or
When the base at position 859 in the nucleotide sequence of SEQ ID NO: 2 is thymine (T),
And determining that it belongs to a high risk group of the incidence of swelling-like disease. The method of claim 10, wherein the swelling-like disease is due to a single base polymorphism that is homozygous. The method of claim 10, wherein the swelling-like disease is blisters in the mucosa. The method of claim 10, wherein the swelling-like disease is blistering in the laryngeal mucosa, oral mucosa, or a combination thereof. The method of claim 10, wherein the swelling-like disease is normal to the scalp, hair, or a combination thereof. The method of claim 10, wherein the assay for detecting polynucleotide is a reverse transcriptase, competitive reverse transcriptase, real time reverse transcriptase, RNase protection assay (RPA), northern blotting or DNA chip. The method of claim 10, wherein the assay for detecting proteins is performed by Western blotting, ELISA, radioimmunoassay, radioimmunoassay, Ouchterlony immunodiffusion, rocket immunoelectrophoresis, immunohistochemical staining, immunoprecipitation assay, Complement fixation assay, FACS or protein chip.

Images