JP2012523230A - Yeast having increased sulfur-containing compound content, screening method thereof, and culture method - Google Patents

Abstract

  Yeast having an increased intracellular content of sulfur-containing compounds such as γ-glutamylcysteine and glutathione is obtained by combining the properties of selenate sensitivity and red coloration. The red coloration method includes conferring adenine requirement and culturing in a minimal medium supplemented with methionine.

Description

  The present invention relates to a sulfur-containing compound-containing yeast, a screening method thereof, and a method of culturing the yeast. The sulfur-containing compound-rich yeast obtained by the present invention is useful in the fields of foods, pharmaceuticals, chemical products, feeds and the like.

  At present, sulfur-containing compounds are used in a wide range of fields such as foods, pharmaceuticals, and chemical products. For example, glutathione (GSH), which is a tripeptide composed of glutamic acid, cysteine and glycine, is known to have a medicinal effect as a pharmaceutical product. Currently, GSH preparations as pharmaceuticals are positioned as antidotes and ophthalmic agents, and are used to prevent various intoxications, chronic liver diseases, side effects of anticancer drugs and damage caused by radiation therapy, skin diseases, cataracts and corneal damage. It is used (Non-patent Document 1).

  On the other hand, it is known that glutathione is a substance that imparts a rich taste to food as a food application (Non-Patent Document 2), and a yeast extract containing a high content of glutathione is used as a seasoning. In addition, γ-glutamylcysteine, which is a dipeptide consisting of glutamic acid and cysteine, is being reported to be useful for food applications.

  As described above, since sulfur-containing compounds have a wide range of industrial utility, various studies have been conducted to obtain microorganisms that efficiently produce them. For example, a method for increasing the content of sulfur-containing compounds in cells by predicting a target enzyme in the biosynthesis pathway of sulfur-containing compounds and modifying its function is disclosed. For example, it has been reported that the intracellular glutathione content is increased by introducing γ-glutamylcysteine synthetase (non-patent document 3) or glutathione synthetase (non-patent document 4) of Escherichia coli into yeast.

  In addition to these, methods for increasing the content of glutathione, which is a sulfur-containing compound, by introducing an enzyme involved in glutathione synthesis into yeast have been reported (Patent Document 1, Patent Document 2, Patent Document 3, and Patent Document 4). ).

  On the other hand, microorganisms that have undergone random genetic modification by mutating the parent strain are spread on a medium containing various drugs and a viable strain (drug resistant strain) is selected, or various drugs are added by the replica method There has been reported a method for selecting a microorganism having an increased intracellular content of a sulfur-containing compound by selecting a strain (drug-sensitive strain) that cannot grow on the medium in which it is contained. For example, a method in which Candida yeast is mutated and a strain capable of growing on a medium containing ethionine and sulfite is selected (Patent Document 5, Patent Document 6, and Patent Document 7), Saccharomyces yeast is mutated, and zinc There is a method for selecting a strain having improved resistance (Patent Document 8). In addition to these methods, various drugs for increasing the intracellular content of sulfur-containing compounds have been studied (Patent Documents 9 and 10).

  However, in recent years, it has been reported that a yeast strain belonging to Saccharomyces cerevisiae containing 5% by weight or more of glutathione in the bacterial body has been successfully obtained by random mutation (Patent Document 11). In this document, a high-producing strain was obtained by measuring the glutathione content of the mutant strain one by one. Although it was reported that a large number of strains could be evaluated by the method of the same literature, it was evaluated how fast the strain could be measured by the method described in the literature, and one person evaluated it a day. The number of strains that can be produced is about 100 strains. Therefore, it is clear that the method described in this document is very complicated, expensive and economically burdensome.

  By the way, it has long been known that yeast having adenine requirement, in particular, yeast having a mutation in the ADE1 gene or ADE2 gene, develops red color. Recently, this mechanism has been analyzed at the genetic level. Namely, the ADE2 gene encoding the enzyme and AIR intermediate catalyzing the sixth step of the purine synthesis system or the ADE1 gene encoding the ADE1 gene encoding the enzyme and CAIR intermediate catalyzing the seventh step of the purine synthesis system It has become clear that AIR (phosphoribosylaminoimidazole) and CIAR (phosphoribosylaminoimidazole carboxylate), which are intermediates in the synthesis, bind with glutathione and are transported to the vacuole, resulting in a red color (Non-Patent Document 5). However, the same report reports that the GSH1 gene encoding the rate-limiting enzyme for biosynthesis of GSH was overexpressed, but the red level did not change. Therefore, even a person skilled in the art could not have the idea of utilizing adenine requirement for screening of yeast with high GSH content.

JP-A 61-52299 Japanese Patent Laid-Open No. Sho 62-275585 JP 63-129985 A JP-A-4-179484 JP 59-151894 A Japanese Patent Laid-Open No. 03-18872 JP-A-10-191963 Japanese Patent Laid-Open No. 02-295480 Japanese Patent Laid-Open No. 06-70752 Japanese Patent Laid-Open No. 08-70884 JP 2004-180509 A

Protein Nucleic Acid Enzyme 1988-7 VOL.33 NO.9 ISSN 003909450 Special Issue “Epoc of Glutathione Research” p1626 Y. Ueda et al, Biosci. Biotech. Biochem., 61, 1977-1980 (1997) Yasuyuki OHTAKE et al, Agric. Biol. Chem., 52 (11), 2753-2762, 1988 Yasuyuki OHTAKE et al, Journal of FERMENTATION AND BIOENGINEERING, Vol.68, No.6, 390-394, 1989 K.G.Sharma et al, Arch Microbiol (2003) 180: 108-117

  It is an object of the present invention to provide a yeast having an increased content of sulfur-containing compounds in cells, a method for efficiently screening yeasts, and a culture method for causing the yeast to contain a high amount of sulfur-containing compounds in cells.

The present inventors examined the report of KG Sharma et al. (Non-Patent Document 5) in detail, and since adenine biosynthesis is involved in ATP biosynthesis essential for organisms, ADE1 gene disruption strain or ADE2 gene disruption It was hypothesized that intermediates such as AIR and CAIR accumulated well in cells in adenine-requiring strains such as strains. If the hypothesis is correct, the present inventors consider that the intracellular glutathione content controls the red coloration of the yeast, and that the yeast that develops a red color has a higher glutathione content. It was. As a result of intensive studies, KG
Unlike the hypothesis of Sharma et al., The present inventors have found that yeast containing a high amount of glutathione can be screened using the red color of yeast as an indicator, and the intracellular content of sulfur-containing compounds containing glutathione. It was found that the content can be increased by a combination of selenate sensitivity and imparting adenine requirement or cultivating in a minimal medium supplemented with methionine, resulting in red coloration, thereby completing the present invention. I let you.

One aspect of the present invention is to provide a yeast having an increased content of sulfur-containing compounds in cells, having sensitivity to selenate, and exhibiting a red color on the medium when cultured on the medium. It is.
Another aspect of the present invention is to provide the above yeast, wherein the medium is a medium supplemented with methionine.
Another aspect of the present invention is to provide the yeast as described above, which is colored red by imparting adenine requirement.
Another aspect of the present invention is to provide a yeast as described above, wherein the adenine requirement is imposed by modification of the ADE1 gene or ADE2 gene.
Another aspect of the present invention is to further provide the yeast as described above, wherein a mutation is introduced into the ADE4 gene or ADE8 gene, and the white color appears on the medium.
Another aspect of the present invention is to provide a yeast as described above, wherein selenate sensitivity has been applied by a modification that enhances expression of the MET25 gene.
Another aspect of the present invention is to provide the yeast as described above, wherein the sulfur-containing compound is at least one compound selected from the group consisting of cysteine, γ-glutamylcysteine, glutathione, and cystenylglycine.
Another aspect of the present invention includes a step of culturing yeast in a state in which intracellular adenine is satisfied in order to increase the amount of bacterial cells, and a lack of intracellular adenine in order to increase the content of sulfur-containing compounds in the cell. It is providing the said yeast culture | cultivation method including the process of culture | cultivating yeast in the state to do.
Another aspect of the present invention is a step of subjecting a yeast having adenine requirement and selenate sensitivity to a genetic modification treatment, a step of spreading the modified yeast on a medium in which the yeast develops a red color when deficiency of adenine, and forming a yeast colony And a method for screening a yeast having an increased content of sulfur-containing compounds in cells, comprising a step of selecting a yeast that develops red color than before modification.
Another embodiment of the present invention includes a step of performing genetic modification treatment on yeast having selenate sensitivity, a step of spreading the modified yeast in a medium supplemented with methionine in a minimal medium to form a colony, and a color development that is more red than before the modification. It is intended to provide a method for screening yeast having an increased content of sulfur-containing compounds in cells, comprising a step of selecting the yeast to be used.
Another aspect of the present invention is to provide the above method, wherein the sulfur-containing compound is at least one compound selected from the group consisting of cysteine, γ-glutamylcysteine, glutathione, and cystenylglycine.

The figure which shows a time-dependent change of the GSH content of Y-3256 strain. The figure which shows the construction procedure of a GSH2 gene disruption cassette.

The yeast of the present invention is not particularly limited as long as it is selenate-sensitive and has a sulfur content in the cells increased by exhibiting a red color on the medium when cultured on the medium. Examples include yeast belonging to the genus Saccharomyces such as Saccharomyces cerevisiae, the genus Candida such as Candida utilis, the genus Pichia such as Pichia pastoris, and the genus Schizosaccharomyces such as Schizosaccharomyces pombe. Of these, Saccharomyces cerevisiae and Candida utilis, which are often used in the production of sulfur-containing compounds, are preferable. The yeast of the present invention may be haploid or may have diploidity or higher ploidy.
Here, the medium for evaluating the redness is not particularly limited as long as the medium can develop red color when the adenine in the yeast cell is insufficient. A solid medium having an adenine content of 25 mg / L or less can be mentioned. Specifically, a YPD medium (composition: Bacto-yeast extract 1%, Bacto-peptone 2%, Glucose 2%: see METHODS IN YEAST GENETICS 2000 Edition p171) ISBN 0-87969-588-9) PGC medium (composition: Casamine acid (vitamin free) 0.5%, Bacto-peptone 1%, Glucose 2%) and the like. A PGC medium that is more likely to develop a red color due to the influence of trace components is preferred. If cadmium is added to the medium, the color is more vividly reddish, so it is more preferable to add cadmium. The medium is preferably supplemented with methionine. In addition, since a strain | stump | stock forms a colony and redness can be evaluated by the color of a colony, it is preferable to use an agar medium rather than a liquid medium. The method for producing a red color on the medium is not particularly limited, and examples thereof include imparting adenine requirement and culturing in a minimum medium to which methionine is added.

  In the present invention, having adenine requirement means that the strain cannot form a colony on a solid medium not containing adenine, or forms a small colony similar to the Y-3219 strain described later. The gene causing adenine requirement may or may not be specified, but it is preferable that it is specified. The gene responsible for adenine requirement may identify the obtained adenine requirement strain by complementation analysis or sequence analysis. The yeast of the present invention preferably has adenine-requiring property by modifying any of the genes of the adenine biosynthetic pathway so as to be inactivated. Examples of genes in the adenine biosynthetic pathway include the intermediate AIR that binds to GSH and the ADE1 and ADE2 genes that directly affect the accumulation of CAIR. In the present invention, “modifying so as to inactivate” includes introducing a mutation into the gene so that the activity of the gene product is lost, and preventing the gene from being expressed.

  In the present invention, gene modification treatment means that the base sequence of the parent strain is mutated. A conventional mutation technique may be used, or a genetic recombination technique may be used. Examples of conventional mutation techniques include mutations caused by irradiation with ultraviolet rays, lasers, EMS (ethyl methanesulfonate), MNNG (N-methyl-N'-nitro-N-nitrosoguanidine), DAPA (4 There is a method using a mutagen such as sodium dimethylaminobenzenediazosulfonate). Moreover, you may utilize the natural variation which arises when cultivating yeast. An adenine-requiring strain can be obtained by subjecting yeast to a mutation treatment and selecting a strain that grows in a medium containing adenine and does not grow or hardly grows in a medium not containing adenine. Yeast having a mutation in the ADE1 gene or ADE2 gene is adenine-requiring and develops a red color.

  Examples of the method using gene recombination technology include a method of replacing a wild-type gene on a chromosome with a mutant gene (inactive gene or disrupted gene) using homologous recombination.

The above gene replacement can be performed as follows. First, yeast is transformed with a recombinant DNA containing a mutant ADE1 gene, and recombination is caused between the mutant ADE1 gene and the ADE1 gene on the chromosome. At this time, the recombinant DNA can be easily manipulated by including a marker gene in accordance with a trait such as auxotrophy of the host. In addition, if the recombinant DNA is linearized by cutting with a restriction enzyme, etc., and the replication control region that functions in yeast is removed, a strain in which the recombinant DNA is incorporated into the chromosome can be efficiently obtained. Can do.
For transformation of yeast, methods usually used for transformation of yeast, such as protoplast method, KU method, KUR method, electroporation method, etc. can be employed. A strain in which recombinant DNA is integrated into the chromosome as described above causes recombination between the mutant ADE1 gene and the ADE1 gene originally present on the chromosome, and a fusion gene of the wild-type ADE1 gene and the mutant ADE1 gene. Two of them are inserted into the chromosome with the other part of the recombinant DNA (vector part and marker gene) in between.
In order to leave only the mutant ADE1 gene out of the two fusion genes, one copy of the ADE1 gene is dropped from the chromosomal DNA together with the vector portion (including the marker gene) by recombination of the two ADE1 genes. In that case, two cases occur. In one case, the wild type ADE1 gene is left on the chromosomal DNA and the mutant ADE1 gene is excised. In the other case, conversely, the mutant ADE1 gene is left on the chromosomal DNA, and the wild-type ADE1 gene is excised. In any case, since the marker gene is lost, the occurrence of the second recombination can be confirmed by the phenotype corresponding to the marker gene. The target gene replacement strain can be selected by amplifying the ADE1 gene by PCR and examining its structure.
Although the ADE1 gene has been described above as an example, the ADE2 gene and other genes can be modified in the same manner.

In addition to the ADE1 gene and / or ADE2 gene, when a mutation is introduced into the ADE4 gene or ADE8 gene, the yeast is more preferable because it becomes a normal white color instead of a red color. Screening for introducing mutations into the ADE4 gene or ADE8 gene involves first introducing mutations into the ADE1 gene or ADE2 gene, obtaining yeast with increased sulfur-containing compound content using the degree of red coloration as an indicator, and then ADE4 If the gene or ADE8 gene is mutated, a white sulfur-containing compound-rich yeast can be efficiently obtained.
Mutations of the ADE4 gene or ADE8 gene can be introduced in the same manner as the ADE1 gene and ADE2 gene.

  As the ADE1 gene, ADE2 gene, ADE4 gene, and ADE8 gene, the yeast genes to be modified can be used. For example, Saccharomyces cerevisiae ADE1 gene, ADE2 gene, ADE4 gene, and ADE8 gene are SEQ ID NO: 1, Examples thereof include DNAs having 3, 5, and 15 base sequences. The ADE1 gene, ADE2 gene, ADE4 gene, and ADE8 gene are not particularly limited as long as they have the same degree of identity as homologous recombination with each yeast gene used to create a genetically modified strain. Therefore, the ADE1 gene, the ADE2 gene, the ADE4 gene, and the ADE8 gene are 80% or more, preferably 90% or more, more preferably 95% or more, respectively, with the amino acid sequences shown in SEQ ID NOs: 2, 4, 6, and 16, respectively. Preferably, it may be a DNA encoding an amino acid sequence having 98% or more identity. The ADE1 gene, ADE2 gene, ADE4 gene, and ADE8 gene may be DNAs that hybridize under stringent conditions with DNAs having the nucleotide sequences shown in SEQ ID NOs: 1, 3, 5, and 15. Examples of stringent conditions include conditions in which washing is performed once at a salt concentration corresponding to 65 ° C., 0.1 × SSC, and 0.1% SDS, preferably two or three times.

  In the present invention, having selenate sensitivity means that colonies cannot be formed on a medium containing selenate and methionine (eg, a medium containing 5 mM selenate and 1 mM methionine). Selenate is an analog of sulfuric acid and is cytotoxic. In normal yeast, since the sulfuric acid uptake system is suppressed by an organic sulfur compound such as methionine, selenate is not taken up into cells and grows in a selenate-containing medium. On the other hand, in the selenate-sensitive strain, the sulfuric acid uptake system is not suppressed by organic sulfur compounds such as methionine, and selenate is taken up. Since the sulfate uptake system is not suppressed, biosynthesis of sulfur-containing compounds is improved in selenate-sensitive strains compared to wild-type strains (MOLLECULAR AND CELLUAR BIOLOGY Dec, 1995, p6526-6534).

Selenate sensitivity may be imparted by mutation treatment or may be imparted by gene recombination. For example, a selenate-sensitive strain can be obtained by subjecting yeast to mutation treatment and selecting a strain that cannot grow on a medium containing selenate and methionine.

On the other hand, as a genetic recombination for conferring selenate sensitivity, O-acetylhomoserine
Modification may be made to enhance the expression of the MET25 gene encoding sulfhydrylase compared to the wild type. Methods for enhancing the expression of the MET25 gene include increasing the copy number of the MET25 gene by introducing a plasmid into the cell or introducing it onto the chromosome, or replacing the MET25 gene promoter with a strong promoter. Is exemplified.

It is also possible to enhance the expression of the MET25 gene by modifying a transcriptional regulatory factor of the MET25 gene. The expression of MET25 gene is considered as follows. The MET4 product acts as a positive factor in the expression of the MET25 gene. Normally, the MET4 product forms an SCFMET30 complex with the MET30 product and several other proteins, undergoes ubiquitination, and is degraded along with the MET30 product by the 26S proteasome proteolytic system, thus suppressing the expression of the MET25 gene Has been. On the other hand, when the function of the SCFMET30 complex decreases, the MET4 and MET30 products are not degraded and the MET25 gene is expressed. (Patton et al., Genes Dev. 12: 692-705, 1998, Rouillon et al., EMBO Journal 19: 282-294, 2000) Therefore, mutations were introduced into the MET4 and MET30 genes, and the expression of the MET25 gene was It can also be enhanced.
As a mutant MET4 gene capable of enhancing the expression level of the MET25 gene, a MET4 gene in which the 215th serine is mutated to proline or the 156th isoleucine is mutated to serine has been reported (Omura et al. FEBS Letters 387 (1996) 179-183, JP-A-10-33161).
Moreover, as a mutant MET30 gene that increases the expression level of the MET25 gene, a mutant MET30 gene obtained by introducing a mutation into a WD40 repeat has been reported. JP-A-2004-201677 reports a mutant MET30 gene having a mutation that substitutes serine at position 569 with another amino acid such as phenylalanine.
By replacing the wild-type gene on the chromosome with such a mutant gene, the expression of the MET25 gene can be enhanced and selenate sensitivity can be imparted.

  The MET25 gene, MET30 gene, and MET4 gene may be any yeast gene, such as a modified yeast. For example, as Saccharomyces cerevisiae MET25 gene, MET30 gene, and MET4 gene, DNAs having the nucleotide sequences of SEQ ID NOs: 9, 11, and 7 can be mentioned, respectively. In addition, the MET25 gene is not particularly limited as long as it encodes a protein having O-acetylhomoserine sulfhydrylase activity, and the MET30 gene and MET4 gene encode a protein that suppresses the expression of the Met25 gene. Therefore, the MET25 gene, the MET30 gene, and the MET4 gene are 80% or more, preferably 90% or more, more preferably 95% or more, particularly preferably 98%, respectively, with the amino acid sequences shown in SEQ ID NOs: 10, 12, and 8. It may be DNA encoding the amino acid sequence having the above identity. The MET25 gene, MET30 gene, and MET4 gene may be DNAs that hybridize under stringent conditions with DNAs having the nucleotide sequences shown in SEQ ID NOs: 9, 11, and 7. Examples of the stringent conditions include those described above.

In the yeast of the present invention, the content of sulfur-containing compounds in the cells is increased by combining selenate sensitivity with adenine requirement, compared to the corresponding yeast selenate sensitive and non-adenine requirement strain.
In the present invention, the sulfur-containing compound means a compound having an —SH group in the chemical formula, and may be a protein, peptide, amino acid, or other substance. Examples of proteins include metallothionein, in which 30% of the constituent amino acids are cysteine residues, glutathione, γ-glutamylcysteine, cystenylglycine, etc. as peptides, cysteine as amino acids, and homocysteine as other substances. However, it is not particularly limited thereto. Glutathione, γ-glutamylcysteine, cysteine are
Since it is currently widely used in industry, it is particularly preferable as a target sulfur-containing compound.

  When glutathione is accumulated in yeast as a sulfur-containing compound, the activity of one or both of glutathione synthetase and γ-glutamylcysteine synthetase may be further enhanced in the yeast cell. Enhancing enzyme activity can be performed by increasing the copy number of genes encoding these enzymes, or by replacing the promoter with a strong promoter. The sequence of the Saccharomyces cerevisiae γ-glutamylcysteine synthetase gene and the sequences of the Candida utilis glutathione synthetase gene and the γ-glutamylcysteine synthetase gene are disclosed in JP-A-2005-073638. The amino acid sequence encoded by the nucleotide sequence of the glutathione synthetase gene of Saccharomyces cerevisiae is shown in SEQ ID NOs: 13 and 14, respectively.

When γ-glutamylcysteine is accumulated as a sulfur-containing compound in yeast cells, it is preferable to modify the yeast so that the glutathione synthetase activity decreases, the glutathione synthetase activity decreases, and γ -It is more preferable to modify so that glutamylcysteine synthetase activity may increase. Modifications that reduce glutathione synthetase activity include disrupting the glutathione synthetase gene or introducing mutations that reduce glutathione synthetase activity.
Examples of the mutation that decreases glutathione synthetase activity include a mutation that changes the arginine residue at position 370 of the amino acid sequence of SEQ ID NO: 14 to a stop codon.
Other examples of mutations that reduce glutathione synthase activity include the following mutations (International Publication No. 03/046155 pamphlet).
(1) A mutation that replaces threonine at position 47 in the amino acid sequence of SEQ ID NO: 14 with isoleucine.
(2) A mutation that replaces glycine at position 387 in the amino acid sequence of SEQ ID NO: 14 with aspartic acid.
(3) A mutation that replaces the proline at position 54 in the amino acid sequence of SEQ ID NO: 14 with leucine.
The mutation may be a single mutation of (1) or (2) or any combination of (1) to (3), but a combination of (1) and (3) and (2) and (3) A combination is preferred.
In addition, since cysteine is produced by heat-treating γ-glutamylcysteine, if yeast that has accumulated γ-glutamylcysteine is heat-treated, yeast having accumulated cysteine can be obtained.
Moreover, when accumulating cystenylglycine as a sulfur-containing compound, it is preferable to modify yeast so that ECM38 activity is enhanced (Yeast. 2003 Jul 30; 20 (10): 857-63).
Yeast having an increased intracellular content of sulfur-containing compounds such as glutathione and γ-glutamylcysteine can also be obtained from yeast exhibiting rapamycin resistance (WO2006 / 013736).

For yeast having the above-mentioned adenine requirement and selenate sensitivity, further genetic modification treatment, preferably mutation treatment, is applied to a medium that develops red color when adenine is deficient, and develops red color before modification. By selecting the yeast to be used, the content of sulfur-containing compounds can be further increased.
In the present invention, the medium used for screening is not particularly limited as long as it is a medium that allows the yeast to develop a red color when adenine in the yeast cells is insufficient. Examples include a medium having an adenine content of 25 mg / L or less. Specifically, a YPD medium (composition: Bacto-yeast extract 1%, Bacto-peptone 2%, Glucose 2%. Refer to METHODS IN YEAST GENETICS 2000 Edition p171. ISBN 0-87969-588-9) PGC medium (composition: Casamine acid (vitamin free) 0.5%, Bacto-peptone 1%, Glucose 2%) and the like. A PGC medium that is more likely to develop a red color due to the influence of trace components is preferred. If cadmium is added to the medium, the color is more vividly reddish, so it is more preferable to add cadmium. In view of isolation of the strain, it is preferable to use an agar medium rather than a liquid medium. In order to identify the degree of color development, it is preferable to culture at 20 to 30 ° C. for about 1 week on a solid medium.

  In addition, for yeast with selenate sensitivity, genetic modification treatment, preferably treatment with a mutation agent, spread the treated yeast in a medium supplemented with methionine in a minimal medium, and the degree of coloration of the modified yeast that appeared in the medium Can be screened for yeast having an increased content of sulfur-containing compounds in the cells. The medium used here may be a methionine-containing medium that can artificially create the same state as that required for adenine, but is preferably a minimal medium with methionine added in the absence of biotin. Examples thereof include a min-met (+)-biotin (−) plate described later.

By culturing the yeast of the present invention, a yeast in which a sulfur-containing compound is accumulated can be produced. Preferably, as a culture method, the yeast of the present invention is cultured in a medium containing a sufficient amount of adenine (adenine-satisfied state), and after the yeast is grown, the yeast is cultured in a medium with a limited amount of adenine. And a method for increasing the sulfur-containing compound content. Thereby, the yeast which the sulfur-containing compound accumulate | stored can be manufactured efficiently.
Preferably, the “sufficient amount” of the adenine is the amount of adenine necessary for experimentally measuring a required amount of adenine necessary for obtaining a certain amount of yeast cells in advance and obtaining the target amount of cells. Can be determined by calculating. For example, 100 mg / L or more is mentioned.
As the medium and culture conditions other than the amount of adenine, the medium and conditions used for normal yeast culture can be employed. If necessary, necessary nutrients are added to the medium according to the characteristics of the yeast to be used.

When a sufficient amount of yeast is obtained, the cells are cultured in a medium with a limited amount of adenine. Examples of the medium in which the amount of adenine is limited include a medium having an adenine content of 25 mg / L or less. During cultivation in a medium with a limited amount of adenine, the amount of sulfur-containing compound accumulated in the yeast cells increases with time.
Preferably, the culture is terminated when the accumulation amount of the target sulfur-containing compound is reached. Usually, the culture time is 10 to 30 hours, preferably 15 to 27 hours.

  The culture obtained as described above or a fraction thereof contains a sulfur-containing compound. The culture may be a culture medium containing yeast cells or yeast cells collected therefrom. The fraction containing the sulfur-containing compound may be a cell lysate or a yeast extract. Preparation of yeast extract and the like may be performed in the same manner as normal yeast extract preparation. The yeast extract may be one obtained by treating a yeast cell extracted with hot water, or one obtained by treating a yeast cell obtained by enzymatic digestion.

  The sulfur-containing compound can be isolated from the yeast cell. The said sulfur-containing compound, yeast culture, or its fraction can be used for manufacture of a foodstuff, a pharmaceutical, a chemical product, feed, etc. Examples of the food include alcoholic beverages, bread foods, and fermented food seasonings. Foods are produced by mixing sulfur-containing compounds, cultured cells or fractions thereof with food ingredients and processing them into foods.

  Hereinafter, the present invention will be described based on examples. The present invention is not limited to the following examples.

<Example 1>
(Acquisition of adenine-requiring yeast)
Saccharomyces cerevisiae diploid strain AJ14819 (MATα type) carrying the mutant MET30 gene and Saccharomyces cerevisiae haploid AJ14810 strain (MATa type) were joined to obtain a Saccharomyces cerevisiae diploid strain. The AJ14819 strain is a selenate-sensitive strain. Based on the Budapest Treaty on October 1, 2003, the National Institute of Advanced Industrial Science and Technology, Patent Biological Deposit Center (Japan, 305-8566 Tsukuba City, Ibaraki Prefecture 1-1 Tsukuba, 1-1 Tsukuba Deposited at the center center No. 6) with a deposit number of FERM BP-8502. AJ14180 was deposited on November 1, 2002, under the Budapest Treaty, at the Patent Organism Depositary, National Institute of Advanced Industrial Science and Technology under the accession number FERM BP-8229.
The diploid strain was sporulated, and four molecules were analyzed to obtain a strain having the following properties.
A: MATa type haploid, mutant MET30 gene
B: MATα type haploid, mutant MET30 gene
C: MATa type haploid, wild type MET30 gene
D: MATα type haploid, wild type MET30 gene

  Next, the expression levels of MET25 gene of the four strains obtained were compared. Based on the method described in Example 1 of Japanese Unexamined Patent Application Publication No. 2004-201677, the MET25 gene expression levels of these four strains were measured as follows. Each strain was inoculated into a YPD medium (500 ml Sakaguchi flask, 50 ml instilled), and cultured with shaking at 30 ° C. Cells were collected during the logarithmic growth phase, RNA contained in the cells was collected, and quantified using the ACT1 gene with MET25 gene expression as an internal standard. Quantification was performed using PCR5700 (Applied Biosystems) and TaqMan One-Step RT-PCR kit (Applied Biosystems). TaqMan Probe (Applied Biosystems) has ACT1-986T and MET25-1077T described in Example 1 of JP2004-201677, and ACT1-963F and ACT1-963 of Example 1 of JP2004-201677 for amplification of the ACT1 gene. 1039R and MET25-1056F and MET25-1134R were used as primers for amplification of the MET25 gene. As a result, it was confirmed that the expression levels of the mutant MET30 gene and the MET25 gene of the A strain and the B strain having selenate sensitivity were higher than those of the C strain and the D strain not having the mutant MET30 gene. Private number AJ14889 was assigned to B shares and private number AJ14890 was assigned to A shares.

Next, the AJ14889 strain was treated with a mutant MNNG (1-methyl-3-nitro-1-nitrosoguanidine) according to a conventional method under the condition that the survival rate was 5 to 10%, then spread on a YPD plate, and about 1 at 30 ° C. Cultured for a week. A strain that developed a red color was selected from the colonies that appeared. Next, a complementary test for adenine requirement was performed on the obtained strains in accordance with a conventional method. As a result, an adenine-requiring yeast strain N1 due to ADE1 gene mutation and an adenine leaky mutant yeast N2 strain due to ADE2 gene mutation were obtained. (N1 and N2 shares will be issued on 23 December 2008 in accordance with the Budapest Treaty.
International deposits are made in the National Collection of Industrial Microorganisms (VKPM) (1 Dorozhny proezd., 1 Moscow 117545, Russia) as VKPM Y-3218 and VKPM Y-3219, respectively. )

<Example 2>
(Screening of high GSH accumulation mutants using strong red coloration as an index)
Next, after treating the Y-3218 strain having a mutation in the ADE1 gene based on a conventional method under the condition that the survival rate is 5 to 10% with the mutant MNNG, it is spread on a PGC or YPD plate and cultured at 30 ° C. for about 1 week. did. From the emerged colonies, a strain that developed a red color than the Y-3218 strain was selected, and the GSH content was compared with the AJ14889 strain (parent strain) and the Y-3218 strain. The selected strains, AJ14889 strain and Y-3218 strain were each inoculated into 5 ml of YPD liquid medium and cultured for 24 hours at 30 ° C. and 250 rpm shaking. The obtained cultures of each strain were inoculated into 50 ml of YPD liquid medium, and cultured for 24 hours at 30 ° C. with a shaking speed of 250 rpm. As a result of measuring the GSH content of each strain according to the agreement, the GSH content of the Y-3218 strain was higher than that of the AJ14889 strain (Table 1). Of the selected strains (180 in total), 7 strains were found to have a higher GSH content than the Y-3218 strain (Table 1).

  A similar study was performed using the ADE2 gene mutant Y-3219. Based on the conventional method, the Y-3219 strain was treated with the mutant MNNG under conditions that resulted in a survival rate of 5 to 10%, spread on a PGC or YPD plate, and cultured at 30 ° C. for about 1 week. From the colonies that appeared, a strain that developed a red color more than the separately spotted Y-3219 strain was selected, and the GSH content was compared with that of the AJ14889 strain (parent strain) and the Y-3219 strain. Colonies were streaked from the YPD agar medium, and the selected strains, AJ14889 strain and Y-3218 strain, were inoculated into 5 ml of YPD liquid medium, respectively, and cultured at 30 ° C. and 250 rpm shaking for 24 hours. The obtained cultures of each strain were inoculated into 50 ml of YPD liquid medium, and cultured for 24 hours at 30 ° C. with a shaking speed of 250 rpm. As a result of measuring the GSH content of each strain according to approval, it was found that the GSH content of the Y-3219 strain was higher than that of the AJ14889 strain. It was found that 10 of the selected strains (118 in total) had a higher GSH content than the Y-3218 strain (Table 2).

As shown in Tables 1 and 2, it was possible to isolate yeast having an improved GSH content using the red color development of yeast due to adenine requirement as an index.

<Example 3>
(Isolation of white colonies with high GSH content)
Wild-type yeast is not red but white to cream. Therefore, the inventors examined the acquisition of strains that form colonies of normal color from yeast screened using the degree of red color development as an index. First, as in Example 2, the Y-3219 strain was mutated with MNNG and seeded in PGC medium or YPD medium to obtain a strain with a stronger red color. As a result, the Y-3219-20 strain shown in Table 3 was obtained in the same manner as in Example 2. Next, the Y-3219-20 strain was mutated with MNNG so that the survival rate was 5 to 10%, spread on a PGC plate, and cultured at 30 ° C. for about 1 week. From the appearing colonies, three white colonies (Y-3219-20-52, Y-3219-20-53, Y-3219-20-56) and one red colony (Y-3219-20-1) Were selected and their GSH content was measured and compared with the Y-3219 and Y-3219-20 strains. That is, the obtained strain, the Y-3219 strain and the Y-3219-20 strain were inoculated into 5 mL of YPD liquid medium, and cultured for 24 hours at 30 ° C. and 250 rpm shaking. Next, the obtained cultures of the respective strains were inoculated into 50 ml of YPD liquid medium, and cultured for 24 hours at 30 ° C. with a shaking speed of 250 rpm. The amount of GSH in each cell was measured according to a conventional method. The results are shown in Table 3.

The white strain was genetically analyzed using the test strain. As a result, the adenine requirement was lost in the Y-3219-20-52 strain with a reduced GSH content. On the other hand, in the Y-3219-20-56 strain that maintained a high GSH content, the ADE4 gene was also mutated in addition to the ADE2 gene mutation. In the Y-3219-20-53 strain, the ADE8 gene was also mutated in addition to the ADE2 gene mutation. From this result, it was found that adenine-requiring strains that form red colonies can become normal white colonies by mutating the ADE4 gene or ADE8 gene.
Y-3219-20-56 shares were deposited with VKPM Y-3256 on December 23, 2008 in the Russian National Collection of Industrial Microorganisms (VKPM) (1 Dorozhny proezd., 1 Moscow 117545, Russia) based on the Budapest Treaty Has been.

<Example 4>
(High GSH accumulation due to adenine insufficiency)
The relationship between the degree of adenine satisfaction and the GSH content was examined. Y-3256 strain was obtained by shaking culture in 50ml YPD medium (D-glucose 20g / L, Bact Peptone 20g / L, Yeast Extract 10g / L) in a 500ml Sakaguchi flask for 24 hours at 30 ° C and 120rpm. The initial absorbance is 660 nm = 0.1 in 50 ml YPD medium with different concentrations of adenine (final adenine concentration 0 mg / L, 10 mg / L or 20 mg / L) in a 500 ml Sakaguchi flask. Inoculated and cultured with shaking at 30 ° C. and 120 rpm. As a result, GSH amount change with time was as shown in Table 4.

  From these results, it became clear that the GSH content of the adenine-requiring Y-3256 strain is inversely proportional to the amount of adenine in the medium. Since YPD medium contains a small amount of adenine, the Y-3256 strain can grow even when no adenine is added (Ade 0 mg / L) (the adenine content of YPD medium is about 10 mg / L). there were).

(Jar Fermentor evaluation)
Y-3256 strain was cultured in Jar Fermentor, and the change with time of GSH content was evaluated. The strain cells were picked up from the YPD agar medium, inoculated into three 750 ml Erlenmeyer flasks containing 50 ml of YPD medium, and cultured with shaking at 30 ° C. and 250 rpm for 20 hours. The obtained seed culture solution (120 ml) was inoculated into 1.2 L of main medium (YPD medium) in 3 L of Jar-Fermentor and cultured at 30 ° C. with a stirring speed of 1,100 rpm. At this time, the air flow rate was set to 1/1 vvm, and the pH was controlled to 6.0 with aqueous ammonia. The fed-batch medium was continuously fed at a rate of 1.5 ml / hr during culture from 0 hr to 24 hr, and at a rate of 1.8 ml / hr after 24 hr. In addition, the composition of the fed-batch medium used at this time was Glucose 600 g per liter, Bacto-yeast extract 10 g, corn
extract 10g, Bacto-peptone 10g, (NH 4) 2 SO 4 0.274g, KH2PO4 0.11g, KCl 0.732g, MgSO 4 0.466g, CuSO 4 0.0012g, ZnSO 4 0.014g, MnSO 4 0.00334g, NaMoO 4 0.00012g KCl 0.002 g, H ₃ BO ₃ 0.00004 g, CoSO ₄ 0.0001 g, CaCl ₂ 0.28 g, FeSO ₄ 0.2 g, Biotine 0.05 mg, riboflavin 0.2 mg, and thiamine 0.5 mg.
The change in the GSH content of the Y-3256 strain at this time was as shown in FIG.

<Example 6>
(Acquisition of diploid strain and examination of medium composition)
Based on the conventional method, an attempt was made to self-diploidize Y-3219-20-53 strain. The experimental conditions are as follows. The Y-3219-20-53 strain was treated with the mutation agent MNNG under conditions such that the survival rate was 5 to 10% by a conventional method, and spread so that 100 to 200 colonies appeared on the YPD agar medium. After culturing at 30 ° C. for 5 days, it was replicated on SD agar medium and YPD agar medium supplemented with adenine. Strains that could grow on the YPD agar medium but could not grow on the SD agar medium with adenine added were selected. The auxotrophy other than adenine was examined, and Y-3219-20-53-aux1 and Y-3219-20-53-aux2 strains with different auxotrophy were obtained. Streak Y-3219-20-53-aux1 strain into SD agar medium supplemented with adenine in a vertical line, and strain Y-3219-20-53-aux2 strain into SD agar medium supplemented with the same adenine. Streaks were made to form a horizontal straight line. However, the vertical line and the horizontal line intersected at one point at this time. The SD agar medium supplemented with adenine was cultured at 30 ° C. for 20 days, and colonies appearing at the intersection were selected. In this way, the D1-3 strain, which is an adenine-requiring diploid strain, was obtained. This strain was internationally deposited at Russian National Collection of Industrial Microorganisms (VKPM) (1 Dorozhny proezd., 1 Moscow 117545, Russia) on December 23, 2008 under the Budapest Treaty. The strain D1-3 was streaked on an SD agar medium supplemented with adenine and cultured at 30 ° C for 2 days. Colonies appeared, so the strain D1-3 was not given auxotrophy other than adenine. I was able to confirm.
In addition, a diploid Dip strain was obtained by joining AJ14889 strain and AJ14890 strain as a target area for non-adenine requirement.
D1-3 strain and Dip strain were inoculated into a test tube containing 5 ml of YPD liquid medium, and cultured for 24 hours at 30 ° C. with a shaking speed of 250 rpm. The obtained culture was inoculated into 50 ml of each medium having the composition shown in Table 5, and cultured for 24 hours at 30 ° C. and 250 rpm shaking. The GSH content in each cell was measured. The results are as shown in Table 6.

Thus, in any medium, the GSH content increased due to adenine requirement.

<Example 7>
(Adenine-requiring γ-glutamylcysteine-rich yeast breeding and evaluation of γ-glutamylcysteine content improving effect)
A haploid strain accumulating γ-glutamylcysteine was obtained by disrupting the GSH2 gene encoding the glutathione synthetase of the Y-3256 strain obtained in Example 3. In order to construct the GSH2 gene disruption cassette, primers 17-22 were used, and S. cerevisiae (wild type) genomic DNA and plasmid pFA6a-KanMX6 (Chiara et al., Yeast 2000, 16: 1089-1097) were used as templates. PCR was performed (FIG. 2). Detailed conditions are as follows.

First, a region about 400 bp upstream from the ORF of GSH2 was used as a template with the genomic DNA of X2180-1B (S. cerevisiae wild-type strain: available at ATCC under accession number ATCC204505) as a template, GSH2-up-F primer (SEQ ID NO: 17 ) And a GSH2-up-R primer (SEQ ID NO: 18) to obtain a GSH2 upstream fragment. The GSH2 upstream fragment is based on the sequences of the GSH2-up-F primer and GSH2-up-R primer, has a BpiI restriction site on one end, and a con1 site for fusion PCR described later on the other end. Have
In addition, the region about 300 bp downstream from the ORF of GSH2 was amplified using the genomic DNA of X2180-1B as a template and using the GSH2-down-F primer (SEQ ID NO: 19) and GSH2-down-R primer (SEQ ID NO: 20). A GSH2 downstream fragment was obtained. The GSH2 downstream fragment has a BpiI restriction site at one end and a con2 site for fusion PCR at the other end, based on the sequences of the GSH2-down-F and GSH2-down-R primers. .
KanMX gene as a template using pFA6a-KanMX6 plasmid as a template, marker F primer (SEQ ID NO: 21
) And a marker R primer (SEQ ID NO: 22). The KanMX gene amplified by this PCR has a con1 site on one end side and a con2 site on the other end side based on the sequences of the marker F primer and the marker R primer.
These PCR conditions are as follows. A mixture of DNA polymerases (Pfu: Taq = 1: 10; available from Fermentas, Lithuania) was used for each reaction. In PCR, a cycle of 94 ° C. for 30 seconds, 50 ° C. for 30 seconds, and 68 ° C. for 3 minutes was repeated 30 times.

The resulting 3 fragments were combined by fusion PCR to construct a GSH disruption cassette. Fusion PCR was performed using GSH2-up-F primer and marker R primer using GSH2 upstream fragment and KanMX gene fragment as templates. Since both the GSH2 upstream fragment and the KanMX gene fragment have a con1 site at the end, a GSH2 upstream-KanMX fragment in which they are linked is obtained by performing fusion PCR. This fusion PCR used the same DNA polymerase mixture as described above. For PCR, a cycle of 94 ° C. for 30 seconds, 61 ° C. for 30 seconds and 68 ° C. for 4.5 minutes was repeated 5 times, and then a cycle of 94 ° C. for 30 seconds, 50 ° C. for 30 seconds and 68 ° C. for 4.5 minutes was repeated 25 times.
Next, fusion PCR was performed using the GSH2-up-F primer and the GSH2-down-R primer using the GSH2 upstream-KanMX fragment and the GSH2 downstream fragment as templates. Since both the GSH2 upstream-KanMX fragment and the GSH2 downstream fragment have a con2 site at the end, the GSH2 upstream-KanMX fragment and the GSH2 downstream fragment are ligated to obtain a GSH2 destruction cassette. This fusion PCR used the same DNA polymerase mixture as described above. For PCR, a cycle of 94 ° C. for 30 seconds, 61 ° C. for 30 seconds, and 68 ° C. for 5.3 minutes was repeated five times, and then a cycle of 94 ° C. for 30 seconds, 50 ° C. for 30 seconds, and 68 ° C. for 5.3 minutes was repeated 25 times.

Primer sequences are as follows.
(1) GSH2-up-F, CCGAAGACCTTCGTTTGGTGTTATGGT (SEQ ID NO: 17)
(2) GSH2-up-R, GAGAGGGGGGGGGTGGGGGGAAGGTGGATAGTGTGCC (SEQ ID NO: 18)
(3) GSH2-down-F, CCTCCTCCCCCCGCCCACGGCAGGATTCGGATGTTTG (SEQ ID NO: 19)
(4) GSH2-down-R, CGAAGACTCAGTACGAGCATTACGCAA (SEQ ID NO: 20)
(5) Marker-F, 5'-CCCCACCCCCCCCCTCTCTACCGTTCGTATAATGTATGCTATACGAAGTTATACTGGATGGCGGCGTTAG-3 '(SEQ ID NO: 21)
(6) Marker-R, 5'-GTGGGCGGGGGGAGGAGGTACCGTTCGTATAGCATACATTATACGAAGTTATGTTTAGCTTGCCTCGTCC-3 '(SEQ ID NO: 22)

The transformant obtained by transforming the Y-3256 strain with the GSH2 disruption cassette to cause homologous recombination was spread on a YPD agar medium containing G418 (50 μg / ml). From the appearing colonies, N8ΔGSH2 strain, which is a strain in which the GSH2 gene was disrupted, was obtained.
This strain was inoculated into 50 ml of YPD medium (D-glucose 20 g / L, Bact Peptone 20 g / L, Yeast Extract 10 g / L) in a 500 ml Sakaguchi flask, and after shaking culture at 30 ° C. and 120 rpm for 24 hours, The obtained culture was planted in 50 ml of YPD medium in a 500 ml Sakaguchi flask to which different concentrations of adenine (final adenine concentrations 0 mg / L, 10 mg / L, 20 mg / L) were added so that the initial absorbance was 660 nm = 0.1. The cells were cultivated and cultured with shaking at 30 ° C. and 120 rpm. The γ-glutamylcysteine concentration was measured according to a conventional method. Table 7 shows the time course of γ-glutamylcysteine. It has been found that the concentration of γ-glutamylcysteine can be increased by imparting adenine requirement.

<Example 8>
(Evaluation with medium that creates pseudo-adenine requirement)
According to a conventional method, the AJ14889 strain was treated with a mutant MNNG under conditions that resulted in a survival rate of about 10%, and then min-met (+)-biotin (-) containing the components shown in Table 8 and 150 mg / L methionine. The plate was spread so that the number of colonies per plate was 350 or less. After culturing at 30 ° C. for 8 to 10 days, 106 colonies that were colored from light pink to red were picked up from the colonies that appeared on 30 plates.
Next, the AJ14889 strain (parent strain) and the selected strains were each inoculated into a YPD medium, and the GSH content in the cells was measured. Specifically, the selected strain cultured in YPD medium and the AJ14889 strain were inoculated into test tubes containing 5 ml of YPD liquid medium, respectively, and cultured for 24 hours at 30 ° C. and 250 rpm shaking. Then, the preculture was inoculated into the main medium containing 50 ml of YPD medium in a 750 ml Erlenmeyer flask so that the absorbance at 600 nm was 0.1, and the shaking was performed at 30 ° C. and 250 rpm for 24 hours and 48 hours. Incubate for hours. As a result, 8 out of 106 selected strains had a GSH content higher than that of the AJ14889 strain at 24 hr or 48 hr (Table 9). Since 8 out of 108 selected strains were strains with improved GSH content, this method was shown to be a very efficient screening method.

  Next, the growth and GSH content of the 89-6, 89-28 and 89-31 strains selected from the above 8 strains were compared with those of the AJ14889 strain. These strains were cultured as described above, except that they were inoculated so that the absorbance at 600 nm was 0.3. Growth was measured based on changes in dry cell weight (DCW). As shown in Table 10, the selected 3 strains grew substantially the same as the parent strain at 24 hr and 48 hr, and the GSH content exceeded that of the parent strain.

  In addition, in order to verify whether or not an unexpected auxotrophy was imparted to these three strains, AJ14889 strain and these three strains were inoculated in an SD medium, and the presence or absence of their growth was examined. Specifically, the strain that had been cultured on the YPD agar medium was inoculated into a test tube containing 5 ml of SD medium, and cultured at 30 ° C. and a shaking speed of 250 rpm for 24 hours and 48 hours, respectively. As a result, the selected 3 strains showed almost the same growth as the AJ14889 strain on the SD medium (Table 11), indicating that these three strains were not given unexpected auxotrophy.

  The present invention provides an adenine-requiring yeast having an increased intracellular sulfur-containing compound content, a method for screening the yeast, and a method for culturing the yeast. The present invention can be used in a wide range of industries such as foods, pharmaceuticals, chemical products, and feeds.

Claims (11)

A yeast having an increased content of sulfur-containing compounds in cells, having sensitivity to selenate, and exhibiting a red color on the medium when cultured on the medium. The yeast according to claim 1, wherein the medium is a medium to which methionine is added. The yeast of Claim 1 or 2 which exhibits red on a culture medium by provision of adenine requirement. The yeast according to claim 3, wherein adenine requirement is imparted by modification of the ADE1 gene or the ADE2 gene. Furthermore, the yeast of Claim 3 or 4 which came to exhibit white on the said culture medium by introduce | transducing mutation into ADE4 gene or ADE8 gene. The yeast according to any one of claims 1 to 5, wherein the sensitivity to selenate is applied by a modification that enhances the expression of the MET25 gene. The yeast according to any one of claims 1 to 6, wherein the sulfur-containing compound is at least one compound selected from the group consisting of cysteine, γ-glutamylcysteine, glutathione, and cystenylglycine. A step of culturing yeast in a state where intracellular adenine is sufficient to increase the amount of bacterial cells, and a step of culturing yeast in a state where there is a shortage of intracellular adenine to increase the content of sulfur-containing compounds in the cell. The yeast cultivation method according to any one of claims 1 to 7, comprising: A genetic modification process for adenine-requiring and selenate-sensitive yeast, a process of spreading the modified yeast on a medium that develops a red color when adenine is deficient, and forming a yeast colony A method for screening yeast having an increased intracellular sulfur-containing compound content, comprising a step of selecting a yeast colony. A process of genetic modification to yeast having sensitivity to selenate, a process of forming a yeast colony by spreading the modified yeast on a medium supplemented with methionine in a minimal medium, and a process of selecting a yeast colony that develops red color than before the modification. A method for screening yeast having an increased content of sulfur-containing compounds in cells. The screening method according to claim 9 or 10, wherein the sulfur-containing compound is at least one compound selected from the group consisting of cysteine, γ-glutamylcysteine, glutathione, and cystenylglycine.

Images