JP2011157328A - Mitochondria function-improving agent - Google Patents

Abstract

<P>PROBLEM TO BE SOLVED: To provide a mitochondria function-improving agent, energy consumption-promoting agent or fat combustion-promoting agent useful as a medicine, a food or the like. <P>SOLUTION: There is provided the mitochondria function-improving agent, energy consumption-promoting agent or fat combustion-promoting agent containing sphingomyelin as an active ingredient. The mitochondria function-improving agent or the like can not only be administered into human and animals, but can also be compounded with various foods, drinks, medicines, pet foods, and the like as an active ingredient. An administration form on the employment of the mitochondria function-improving agent or the like as the active ingredient for medicines or quasi drugs includes the oral administration forms of tablets, capsules, granules, powder, or syrups, and the parenteral administration forms of injections, suppositories, inhalations, percutaneous absorption agents, or external preparations. <P>COPYRIGHT: (C)2011,JPO&INPIT

Description

  The present invention relates to a mitochondrial function improver, an energy consumption promoter, and a lipid combustion promoter.

  Our life activity is supported by ATP produced by a chain of various physical and chemical processes called metabolism, but mitochondria play a central role in energy metabolism, β-oxidation of fatty acids and electron transfer. ATP is supplied by oxidative phosphorylation by the system.

  Oxygen consumption, which reflects energy consumption in the living body, is characterized by a large amount in the skeletal muscle, liver, or heart, which is consistent with the large distribution of mitochondria in the heart muscle, liver, and skeletal muscle. The size of the role of mitochondria in energy metabolism is apparent. It is said that more than 90% of oxygen consumption in the living body is performed in mitochondria.

  In recent years, it has been revealed that mitochondrial dysfunction is closely related to lifestyle-related diseases and aging-related diseases. It is known that a decrease in mitochondrial function such as mutation or damage of mitochondrial DNA is related to a decrease in energy metabolism due to aging (Non-patent Document 1).

  A decrease in mitochondrial function causes an imbalance between energy intake and energy consumption through a decrease in energy metabolism, which can cause lifestyle-related diseases (Non-patent Document 2). Therefore, maintaining and improving mitochondrial function and increasing energy metabolism are thought to lead to prevention and improvement of lifestyle-related diseases and contribute to quality of life (QOL).

  On the other hand, exercise is known as one of the methods for increasing the amount of muscle mitochondria (Non-patent Document 3). Therefore, exercise is thought to lead to an increase in energy consumption in the living body through an increase in mitochondria in the muscle. However, even in the present day when the importance of exercise is widely recognized, it is practically difficult to exercise regularly, and a method to promote energy metabolism and increase energy consumption more effectively is desired. ing.

From this point of view, components that enhance energy metabolism and mitochondrial function have been searched, and caffeine and capsaicin having a sympathetic nerve activation action have been reported as components that promote energy metabolism (Non-Patent Document 4, 5). However, caffeine and capsaicin are not satisfactory because their practicality is limited from the viewpoint of safety and irritation. Examples of other energy metabolism promoting effects include capsinoid-containing compositions (Patent Document 1), flavans or flavanones (Patent Document 2).
In recent years, the effect of capsiate, which is a capsaicin analog with less pungent taste and low irritation, has been reported (Non-patent Document 6).

  Furthermore, tea catechin has been found to have an energy metabolism lowering and mitochondrial function lowering action accompanying aging (Patent Document 3). Examples of mitochondrial function activating activity include benzimidazole derivatives or salts thereof (Patent Document 4) and 1,2-ethanediol or salts thereof (Patent Document 5). However, few other components that enhance energy metabolism and mitochondrial function are known.

On the other hand, sphingomyelin is a compound obtained by adding phosphocholine to a ceramide skeleton composed of a sphingoid base and a fatty acid, and is known to exist in the brain and nerve tissue in the body. In recent years, research on the physiological function thereof has been advanced, and the relationship with the activation of muscle satellite cells (Non-Patent Document 7) and the anti-inflammatory action (Non-Patent Document 8) have been reported. Further, regarding the use of sphingomyelin, a lipid digestion / absorption function improving agent (Patent Document 6), a therapeutic agent for intestinal motility dysfunction (Patent Document 7) and the like are known.
However, the effects of sphingomyelin on energy metabolism and mitochondrial function have not been known so far.

JP 2004-149494 A JP 2007-314446 A JP 2008-63318 A JP 2004-67629 A Japanese Patent Laid-Open No. 2002-322058 JP-A-11-269074 JP 2003-252765 A

Iwanami Lecture Basics of Modern Medicine 1999 12 (2): 55-58. Ritz P.M. Diabetes Metab. 2005 2: 5S67-5S73. Holloszy JO. J. et al. Physiol. Pharmacol. 2008 59: 5-18. Dullo AG. Am J Clin Nutr. 1989 49 (1): 44-50. Kawada T. et al. Proc Soc Exp Biol Med. 1986 183 (2): 250-6. Ohnuki K.K. Biosci Biotechnol Biochem. 2001 65 (12): 2735-40. Nagata Y. et al. J Histochem Cytochem. 2006 54 (4): 375-384. Furuya H. et al. Int J Vitam Nutr Res. 2008 78 (1): 41-49.

  The present invention provides a material that is used in pharmaceuticals, quasi-drugs, foods and feeds that have abundant dietary experience, high safety, excellent mitochondrial function improving action, energy consumption promoting action, lipid burning promoting action About doing.

  As a result of searching for effective components for improving mitochondrial function, promoting energy consumption, promoting lipid burning, sphingomyelin has an effect of enhancing mitochondrial function, promoting energy consumption, promoting lipid burning, It has been found that this is useful as an active ingredient of pharmaceuticals, quasi-drugs, foods and drinks and feeds that can exert the effects.

  That is, the present invention relates to a mitochondrial function improver, an energy consumption promoter, and a lipid combustion promoter containing sphingomyelin as an active ingredient.

  The mitochondrial function improving agent, energy consumption promoting agent, and lipid combustion promoting agent of the present invention have excellent mitochondrial function improving action, energy consumption promoting action, and lipid burning promoting action. Therefore, it is useful as a material for blending as an active ingredient in foods and drinks, pharmaceuticals, quasi drugs or feeds for the prevention and improvement of mitochondrial function and energy metabolism decline.

The sphingomyelin that can be used in the present invention is not particularly limited, and examples thereof include chemically synthesized and naturally derived ones.
For example, as a chemical synthesis method of sphingomyelin, 1) a method via phosphoramidite (Weis, Chem Phys Lip, 3, 1999), 2) a method via cyclic phosphate (Dong, Tetrahedron Lett, 5291, 1991) Or 3) A method of converting to sphingomyelin by introducing phosphocholine into the 1-position hydroxyl group of ceramide by a method via a cyclic phosphite (Byun, J Org Chem, 6495, 1994) is known.
Naturally occurring sphingomyelin includes milk fat globule membrane components in milk, or these milk fat globule membrane components, dialysis, ammonium sulfate fractionation, gel filtration, isoelectric point precipitation, ion exchange chromatography, solvent content. Sphingomyelin (Sanchez-Juanes, Int Dairy J, 273, 2009) obtained by increasing the purity by purifying by a technique such as painting may be used.
Furthermore, a commercial item can also be used as sphingomyelin. Examples of such commercially available products include NOF Corporation “milk-derived sphingomyelin: NM-70” and “egg yolk-derived sphingomyelin: NM-10”.

  As shown in Examples below, sphingomyelin has an effect of improving mitochondrial function, promoting energy consumption, and promoting lipid combustion. Therefore, sphingomyelin can be a mitochondrial function improver, an energy consumption promoter, a lipid combustion promoter (hereinafter referred to as “mitochondrial function improver etc.”), and further used for producing the mitochondrial function improver. be able to. At this time, as the mitochondrial function-enhancing agent, etc., the sphingomyelin alone or in addition to this, a carrier that is appropriately selected as necessary, such as a carrier that is allowed in the later-described object to be blended, is used. May be. In addition, the said formulation can be manufactured by a conventional method according to the target object which should be mix | blended.

  The agent for improving mitochondrial function of the present invention can be administered to humans and animals, and can be used as an active ingredient in various foods, pharmaceuticals, pet foods and the like. As food, food and drinks and functional foods and drinks that indicate the physiological functions such as improvement of mitochondrial function or promotion of energy consumption and prevention / improvement of lifestyle-related diseases and reduction of onset risk as necessary It can be applied to food and drink for the sick, food for specified health use, etc.

  Examples of the dosage form when the mitochondrial function-improving agent of the present invention is used as an active ingredient of pharmaceuticals and quasi-drugs include, for example, oral administration by tablets, capsules, granules, powders, syrups, injections, suppositories, etc. And parenteral administration using inhalants, transdermal absorption agents, external preparations and the like. In order to prepare such various dosage forms, the mitochondrial function improver of the present invention alone or other pharmaceutically acceptable excipients, binders, extenders, disintegrants , Surfactants, lubricants, dispersants, buffers, preservatives, flavoring agents, fragrances, coating agents, carriers, diluents, and the like can be used in appropriate combinations. Of these dosage forms, the preferred form is oral administration, and when an oral liquid preparation is prepared, it can be produced by a conventional method by adding a flavoring agent, a buffering agent, a stabilizer and the like.

  When the mitochondrial function improver of the present invention is used as an active ingredient of food, the form of the food is milk, processed milk, milk drink, yogurt, soft drink, tea-based drink, coffee drink, fruit juice drink, carbonated drink In addition to foods and drinks such as juices, jellies, wafers, biscuits, breads, noodles, sausages and various foods such as nutritive foods, they are also in the same form (tablets, capsules, syrups, etc.) as the above oral preparations Examples include nutritional compositions.

  To prepare various forms of food, the mitochondrial function improver of the present invention alone, or other food materials, solvents, softeners, oils, emulsifiers, preservatives, fragrances, stabilizers, colorants , Antioxidants, humectants, thickeners, and the like can be used in appropriate combinations. The food containing the agent for improving mitochondrial function of the present invention can be used as a food for improving mitochondrial function, a food for promoting energy consumption, and a food for promoting lipid combustion.

  In addition, when the mitochondrial function-improving agent of the present invention is used as an active ingredient in feed, it can be widely used in all livestock feeds, such as cattle, pigs, chickens, sheep, horses, goats, etc. Examples include feed for livestock, feed for small animals used for rabbits, rats, mice, etc., feed for seafood used for tuna, eel, Thailand, yellowtail, shrimp, etc., pet food used for dogs, cats, small birds, squirrels, and the like.

  In addition to the mitochondrial function-improving agent of the present invention for feed, meat, protein, grains, bran, potatoes, sugars, vegetables, vitamins, minerals and other commonly used feed ingredients, or solvents, softeners, Oils, emulsifiers, preservatives, fragrances, stabilizers, colorants, antioxidants, humectants, thickeners, and the like can be appropriately blended to produce the feed by conventional methods.

  In addition to sphingomyelin, other medicinal components appropriately selected as necessary may be used in combination with the energy consumption promoter of the present invention.

  The amount of sphingomyelin blended in beverages containing the energy consumption promoter of the present invention, such as milk beverages, soft drinks, tea-based beverages, etc. is usually 0.0001 to 1.0% by mass, and further 0 in terms of dry matter. 0.001 to 0.5% by mass, particularly 0.01 to 0.2% by mass is preferable.

  In the case of foods and feeds other than beverages containing the energy consumption promoter of the present invention, and pharmaceuticals such as oral solid preparations such as tablets, granules and capsules, oral liquid preparations such as oral liquids and syrups The amount of sphingomyelin is usually 0.002 to 50% by mass, more preferably 0.02 to 25% by mass, and particularly preferably 0.2 to 10% by mass in terms of dry matter. In addition, sphingomyelin may be in a dissolved state or in a dispersed state, and the presence state thereof does not matter.

  The intake of the mitochondrial function improving agent and the like of the present invention varies depending on the dosage form and use, but it is 0.1 to 1000 mg / 60 kg body weight per day for adults as sphingomyelin (in terms of dry matter). Particularly preferred is 1 to 250 mg / 60 kg body weight, more preferably 5 to 100 mg / 60 kg body weight.

  The typical production examples, test examples, and examples of the present invention are shown below, but the present invention is not limited thereto.

Production Example 1: Preparation of sphingomyelin Take 201 g of milk phospholipid PC-500 (obtained from Fontera Japan, containing 8.8% sphingomyelin), add 4000 mL of acetone, and add a homomixer (TK auto homomixer, special under ice cooling) Dispersed by Kika Kogyo Co., Ltd.). Thereafter, the acetone-soluble fraction (neutral lipid) was removed by centrifugation. To the obtained acetone insoluble fraction A, chloroform (800 mL), methanol (400 mL), and water (300 mL) were added, followed by liquid-liquid extraction, and a chloroform layer was collected. The chloroform layer was concentrated under reduced pressure to obtain 154 g of a chloroform fraction A.

To the obtained chloroform fraction A, 28.05 g of potassium hydroxide and 1000 mL of methanol were added, and the mixture was stirred under nitrogen at 37 ° C. for 15 hours for hydrolysis. After completion of the reaction, 2000 mL of chloroform and 750 mL of water were added, and the liquid was partitioned, and the chloroform layer was collected. The chloroform layer was concentrated under reduced pressure and then neutralized with 15 mL of acetic acid, and 400 mL of chloroform, 200 mL of methanol, and 150 mL of water were added, and liquid-liquid extraction was performed again. The chloroform layer was collected and concentrated under reduced pressure to obtain 90 g of chloroform fraction B.
To the obtained chloroform fraction B, 1200 mL of acetone was added, and the mixture was dispersed with a homomixer (TK auto homomixer, manufactured by Tokushu Kika Kogyo Co., Ltd.) under ice cooling. Thereafter, the acetone-soluble fraction (free fatty acid) was removed by centrifugation. The same operation was further repeated twice to obtain 44 g of acetone insoluble fraction B.

  To the obtained acetone insoluble fraction B, 400 mL of hexane, 400 mL of methanol, 150 mL of water, and 50 mL of 28% ammonia water were added, liquid-liquid extraction was performed, and a hexane layer was collected. The hexane layer was further washed with 400 mL of methanol, 150 mL of water, and 50 mL of 28% aqueous ammonia. The obtained hexane layer was concentrated under reduced pressure to obtain 27 g of a hexane fraction.

  Purification was performed by silica gel column chromatography using 22 g of the obtained hexane fraction. That is, after adsorbing the chloroform solution of the hexane fraction to 1 kg of silica gel (silica gel 60, manufactured by Merck), the contaminants were eluted with a chloroform / methanol mixed solvent, then eluted with 21 L of methanol, and purified sphingomyelin fraction 16 g (yield: 8%) was obtained.

Test Example 1 Energy consumption and lipid combustion promoting action of sphingomyelin Evaluation of energy consumption and lipid combustion promoting action of sphingomyelin was performed as follows. Sphingomyelin was extracted from milk phospholipid (PC-500, Fontera Japan) according to the method of Production Example 1 above.
After 1 week of preliminary breeding, 9-week-old BALB / c mice (male: Oriental Bioservice) were divided into two groups so that their body weights were equal (8 mice in each group).
Then, control food (10% lipid, 20% casein, 55.5% potato starch, 8.1% cellulose, 0.2% methionine, 2.2% vitamin (trade name: vitamin mixture AIN-76, Oriental Bioservice) ) 4% mineral (trade name: mineral mixed AIN-76, Oriental Bio Service)), or a test meal containing sphingomyelin (10% lipid, 20% casein, 54.5% potato starch, 8.1% cellulose, 0.2% methionine, 2.2% vitamin, 4% mineral, 0.25% sphingomyelin) was given for 9 weeks and subjected to breath analysis at 10 weeks.

  Mice were transferred to a breath analysis chamber and allowed to acclimate to the environment for 48 hours, and then the oxygen consumption and respiratory quotient of each mouse was measured for 24 hours using an Arco-2000 system (Arco System). The oxygen consumption here refers to the energy consumption (oxygen consumption mL (mL / kg / min) at 1 kg of mouse body weight per min), and the respiratory quotient refers to the ratio of carbon dioxide emission to oxygen consumption. . From these oxygen consumption and respiratory quotient, the amount of lipid burning was calculated using the Peronnet formula (Peronnet F, and Massicotte D (1991) Can J Sport Sci 16: 23-29.). Table 1 shows the average energy consumption (mL / kg / min) and average lipid burning (mg / kg / min) for 24 hours.

After 13 weeks of breeding, the gastrocnemius muscle of each group of mice was collected, and RNA samples were obtained using RNeasy Fibros Tissue Mini Kit (Qiagen). Each RNA sample was quantified, and the amount of RNA per reaction was 125 ng in the reaction solution (1 × PCR buffer II (Applied Biosystems), 5 mM MgCl2, 1 mM dNTP mix, 2.5 μM Oligo d [T] ₁₈ (New England Biolabs). The reverse transcription reaction was performed with 1 U / ml RNase inhibitor (Takara Bio Inc.) to obtain cDNA. The reaction conditions were 42 ° C., 10 minutes, 52 ° C., 30 minutes, 99 ° C. and 5 minutes.

  Using the obtained cDNA as a template, quantitative PCR was performed by ABI PRISM 7700 Sequence Detector (Applied Biosystems). The expression level of 36B4 mRNA was corrected as a reference and expressed as a relative mRNA expression level. As a primer, 36B4 (GenBank: NM_007475, Forward: GACATCACAGAGCAGGCCCCT (SEQ ID NO: 1), Reverse: TCTCCACAGACAATGCCCAGG (SEQ ID NO: 2)), PGC-1α (GenBank: TGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTG 4)) was used. The results are shown in Table 2.

  From Table 1, it can be seen that in mice fed a test diet containing sphingomyelin, PGC-1α gene expression involved in mitochondrial neoplasia and fat burning is significantly higher in the gastrocnemius muscle than in the control diet group. Therefore, sphingomyelin is useful as an agent for improving mitochondrial function.

  From Table 2, it can be seen that the mice that ingested the test meal containing sphingomyelin had significantly higher oxygen consumption and lipid burning than the control diet group. Therefore, sphingomyelin is useful as an energy consumption promoter and a lipid combustion promoter.

Formulation Example Formulation Example 1 Jelly food for improving mitochondrial function, promoting energy consumption Carrageenan and locust bean gum mixed gelling agent 0.65%, grapefruit 50% concentrated fruit juice 5.0%, citric acid 0.05%, vitamin 0.05% C and 0.1% sphingomyelin (NM-70 manufactured by NOF Corporation) were mixed, and water was added thereto to adjust to 100%, followed by dissolution at 65 ° C. Further, a small amount of grapefruit flavor was added and kept at 85 ° C. for 5 minutes, sterilized, and dispensed into a 100 mL container. Allow to stand for 8 hours and cool to 5 ° C while gradually cooling to obtain a jelly food containing sphingomyelin with good mouth meltability, fruit flavor and good texture when put into the mouth. It was.

Formulation Example 2 Tablets for improving mitochondrial function and promoting energy consumption Ascorbic acid 180 mg, citric acid 50 mg, aspartame 12 mg, magnesium stearate 24 mg, crystalline cellulose 120 mg, lactose 594 mg, and sphingomyelin (NM-10, NM-10) 120 mg Tablets were produced in accordance with the Japanese Pharmacopoeia (general formulation “Tablets”) with a prescription (daily dose of 2200 mg) to obtain tablets containing sphingomyelin.

Formulation Example 3 Mitochondrial function improvement, energy consumption promotion vitamin oral solution Taurine 800 mg, sucrose 2000 mg, caramel 50 mg, sodium benzoate 30 mg, vitamin B1 nitrate 5 mg, vitamin B2 20 mg, vitamin B6 20 mg, vitamin C 2000 mg, vitamin E 100 mg, Vitamin D3 2000 IU, nicotinic acid amide 20 mg, purified sphingomyelin (Production Example 1) 50 mg, leucine 200 mg, isoleucine 100 mg, valine 100 mg are dissolved in an appropriate amount of purified water, adjusted to pH 3 with an aqueous phosphoric acid solution, and further purified. Water was added to make a total volume of 50 mL. This was sterilized at 80 ° C. for 30 minutes to obtain a beverage for improving mitochondrial function and promoting energy consumption, which contains sphingomyelin and amino acids.

Formulation Example 4 Mitochondrial function improvement, milk beverage for promoting energy consumption 3.4 g milk casein, 1.67 g separated soy protein, 14.86 g dextrin, 1.3 g sucrose, 1.75 g soybean oil, 0.18 g perilla oil, Purified water is added to 100 mg of soybean phospholipid 0.14 g, glycerin fatty acid ester 0.07 g, minerals 0.60 g, vitamins 0.06 g, and purified sphingomyelin (Production Example 1). A beverage (100 mL) for improving mitochondrial function and promoting energy consumption containing myelin was obtained.

Claims (3)

  Mitochondrial function improver containing sphingomyelin as an active ingredient.   Energy consumption promoter containing sphingomyelin as an active ingredient.   A lipid burning accelerator containing sphingomyelin as an active ingredient.