JP2011068660A - Method of inducing regulated pancreatic hormone production in non-pancreatic islet tissue - Google Patents

Abstract

<P>PROBLEM TO BE SOLVED: To provide a method for inducing pancreatic endocrine phenotype and function including the production of pancreatic hormone in non-pancreatic and non-endocrine cells, especially in liver cells/tissues and a composition. <P>SOLUTION: This method for inducing a regulated pancreatic hormone production is provided by making a PDX-1 inducer compound such as a nucleic acid encoding a PDX-1 polypeptide, neuro D polypeptide or β-cellulin peptide in contact with the non-pancreatic and non-endocrine cells, eventually in the presence of nicotinamide, EGF, activin A, HGF, an exedin GLP-1 or β-cellulin. <P>COPYRIGHT: (C)2011,JPO&INPIT

Description

(Field of Invention)
The present invention relates generally to methods of inducing pancreatic endocrine phenotypes and functions, including pancreatic hormone production in non-endocrine tissues, and in particular to methods and pharmaceutical compositions for treating endocrine related diseases.

(Background of the Invention)
The endocrine pancreas consists mainly of islet cells that synthesize and secrete the peptide hormones glucagon, insulin, somatostatin, and pancreatic polypeptide. Insulin gene expression is restricted to islet β cells in the mammalian pancreas through a regulatory mechanism that is mediated in part by specific transcription factors. In other cells, insulin, other pancreatic hormones and certain peptidase genes are transcriptionally silent. Homeodomain protein PDX-1 (pancreatic and duodenal homeobox gene-1, aka IDX-1, IPF-1, STF-1, or IUF-1) plays a central role in the regulation of islet development and function. PDX-1 is directly or indirectly involved in islet cell-specific expression of various genes such as insulin, glucagon somatostatin, proinsulin converting enzyme 1/3 (PC1 / 3), GLUT-2 and glucokinase. Yes. Furthermore, PDX-1 mediates transcription of the insulin gene in response to glucose.

(Summary of the Invention)
The present invention relates in part to the ectopic expression of the pancreatic and duodenal homeobox gene (PDX-1) in the liver, the processing of silent pancreatic hormone gene expression and conversion of the prohormone into a mature biologically active hormone. It is based on the discovery that it induces a mechanism.

  The present invention provides a method for inducing pancreatic gene expression in a cell by introducing a PDX-1 inducer compound into the cell. The present invention further provides a method of converting non-pancreatic cells into pancreatic cells by contacting the non-pancreatic cells with a PDX-1 inducer compound. PDX-1 in an amount that induces expression of endogenous PDX-1, an embryonic marker, insulin, glucogon or somatostatin, such that the non-pancreatic cell suppresses expression of C / EBPβ, albumin or ADH-1 in the non-pancreatic cell Contact with inducer compound. The embryo marker is, for example, alpha-1 fetoprotein or Gata-4.

  A PDX-1 inducer compound is any compound that induces endogenous PDX-1 expression. PDX-1 inducer compounds are nucleic acids, polypeptides or small molecules. Exemplary PDX-1 inducer compounds are nucleic acids encoding pancreatic and duodenal homobox (PDX-1) polypeptides, neuro D polypeptides or betacellulin polypeptides.

  Examples of nucleic acids include cytomegalovirus (CMV) promoter, BOS promoter, transthyretin promoter, glucose 6-phosphatase promoter, albumin intestinal fatty acid binding protein promoter, thyroglobulin promoter, surfactant A promoter, surfactant c promoter, or phosphoglycease. It is operably linked to a promoter such as the rate kinase 1 promoter. Nucleic acid methods exist in plasmids or vectors. The vector is a viral vector, such as an adenoviral vector or a lentiviral vector. The adenovirus vector is, for example, a gutless recombinant adenovirus vector.

  “Induces expression” means that the expression of a gene is increased in the presence of the compound as compared to in the absence of the compound. For the cell, a composition comprising a nucleic acid encoding a pancreatic or duodenal homobox 1 (PDX-1) polypeptide is in an amount sufficient to induce the gene in the cell. “Suppressing expression” means that the expression of a gene is decreased in the presence of the compound as compared to the absence of the compound.

  Pancreatic genes include, for example, pancreatic transcription factors such as PDX-1, beta 2, ISL-2, Nkx6.1, Ngn3.1 or NKx2.2, endocrine genes such as SCG2, SGNE1, CHGN, PTPRN, AMPH, NBEA, neuronal Includes D or follistatin, or exocrine genes such as serine protease inhibitors, Kazal type I, elastase, p48 factor or regenerated islet-derived 1 alpha.

  The cell is provided from a mammalian subject in vivo, in vitro or ex vivo. The cell is a non-pancreatic cell. The cell is a differentiated cell. The cell is an endoderm cell, ectoderm cell or mesoderm cell. For example, the cell is a hepatocyte, skin cell or bone marrow cell. Alternatively, the cells are further contacted with a transfection agent or a composition comprising nicotinamide, epidermal growth factor, activin A, liver growth factor, exendin, GLP-1 or betacellulin.

  The present invention provides methods for inducing concentrations in a subject of pancreatic hormones such as insulin, glucagon and somatostatin. In one aspect, the method comprises administering to a subject in need thereof a compound that increases PDX expression or activity in an amount sufficient to induce pancreatic hormone production in the subject. In another aspect, the method provides for a cell capable of expressing pancreatic hormones, contacting the cell with a compound that increases PDX expression or activity, and introducing the cell into the subject. Including inducing hormone production.

  Further provided in the present invention is a method for the treatment of pancreatic-related disorders, such as diabetes, eg type I or type II, symptom relief or delayed onset in a subject. The method includes administering to the subject a therapeutically effective amount of a compound that increases PDX expression. For example, the compound is a nucleic acid encoding pancreatic and duodenal homobox 1 (PDX-1) polypeptide. Symptoms of diabetes include hyperglycemia, increased blood glucose (blood glucose level), frequent urination, increased drinking craving, increased hunger, abnormal weight loss, increased fatigue, irritation, or blurred vision. Diabetes is diagnosed, for example, by a fasting plasma glucose test or a random blood glucose test.

  In another aspect, the present invention provides a method of inducing characteristics of islet gene expression in a subject. The method includes administering to a subject in need thereof a compound that increases PDX expression or activity in an amount sufficient to induce islet gene expression.

  Yet another feature of the invention is a method of inducing or enhancing an islet cell phenotype in a cell. The method comprises contacting the cell with an amount of a compound that increases PDX expression or activity sufficient to induce or enhance an islet cell phenotype in the cell.

Also included are pharmaceutical compositions comprising a compound that increases PDX expression and a pharmaceutically acceptable carrier.
The present invention also provides the following items, for example.
(Item 1)
A method of inducing endogenous PDX-1 expression in a cell, said method comprising a composition comprising an amount of a PDX-1 inducer compound sufficient to induce said endogenous PDX-1 expression in said cell A method comprising introducing into a cell.
(Item 2)
2. The method of item 1, wherein the PDX-1 inducer compound comprises a nucleic acid encoding a pancreatic and duodenal homeobox gene-1 (PDX-1) polypeptide, a neuro D polypeptide, or a betacellulin polypeptide.
(Item 3)
Item 3. The method according to Item 2, wherein the nucleic acid is operably linked to a promoter.
(Item 4)
The promoter is cytomegalovirus (CMV) promoter, BOS promoter, transthyretin promoter, glucose 6-phosphatase promoter, albumin gut fatty acid binding protein promoter, thyroglobulin promoter, surfactant A promoter, surfactant c promoter or phosphoglyce Item 3. The method according to Item 2, which is a rate kinase 1 promoter.
(Item 5)
Item 3. The method according to Item 2, wherein the nucleic acid is present in a plasmid.
(Item 6)
Item 3. The method according to Item 2, wherein the nucleic acid is present in a viral vector.
(Item 7)
7. The method according to item 6, wherein the viral vector is an adenoviral vector or a lentiviral vector.
(Item 8)
Item 8. The method according to Item 7, wherein the adenovirus vector is a gutless recombinant adenovirus vector.
(Item 9)
Item 2. The method according to Item 1, wherein the cell is a non-pancreatic cell.
(Item 10)
Item 2. The method according to Item 1, wherein the cell is an endoderm cell, ectoderm cell or mesoderm cell.
(Item 11)
Item 11. The method according to Item 10, wherein the endoderm cells are hepatocytes.
(Item 12)
Item 11. The method according to Item 10, wherein the ectoderm cells are skin cells.
(Item 13)
Item 11. The method according to Item 10, wherein the mesoderm cell is a bone marrow cell.
(Item 14)
The method of item 1, wherein the cell is provided from a mammalian subject in vivo, in vitro or ex vivo.
(Item 15)
The method of item 1, further comprising contacting the cell with a transfection agent.
(Item 16)
The method of item 1, further comprising contacting the cell with a composition comprising nicotinamide, epidermal growth factor, activin A, liver growth factor, exendin, GLP-1 or betacellulin.
(Item 17)
A method of inducing pancreatic gene expression in non-pancreatic cells, said method comprising an amount of pancreatic and duodenal homeobox gene-1 (PDX-1) polypeptide sufficient to induce said gene expression in said cells A method comprising introducing into the cell a composition comprising a nucleic acid that encodes.
(Item 18)
Item 18. The method according to Item 17, wherein the pancreatic gene is a pancreatic transcription factor.
(Item 19)
19. The method according to item 18, wherein the pancreatic transcription factor is beta 2, ISL-2, Nkx6.1, Ngn3.1 or NKx2.2.
(Item 20)
18. The method according to item 17, wherein the pancreatic gene is an endocrine gene or an exocrine gene.
(Item 21)
21. The method according to item 20, wherein the endocrine gene is SCG2, SGNE1, CHGN, PTPRN, AMPH, NBEA, neuro D or follistatin.
(Item 22)
21. The method according to item 20, wherein the exocrine gene is a serine protease inhibitor, Kazal type I, elastase, p48 factor or regenerated island-inducing 1 alpha.
(Item 23)
18. The method according to item 17, wherein the cell is an endoderm cell, ectoderm cell or mesoderm cell.
(Item 24)
24. The method according to item 23, wherein the endoderm cells are hepatocytes.
(Item 25)
The method according to item 23, wherein the ectoderm cells are skin cells.
(Item 26)
The method according to item 23, wherein the mesoderm cell is a bone marrow cell.
(Item 27)
18. A method according to item 17, wherein the cell is provided from a mammalian subject in vivo, in vitro or ex vivo.
(Item 28)
A method of converting non-pancreatic cells into pancreatic cells,
a. An amount to induce expression of endogenous PDX-1, an embryonic marker, insulin, glucagon, or somatostatin in the non-pancreatic cells, or
b. An amount for suppressing the expression of C / EBPβ, albumin or ADH-1 in the non-pancreatic cell
Contacting said non-pancreatic cell with a PDX-1 inducer compound.
(Item 29)
29. The method of item 28, wherein the PDX-1 inducer compound comprises a nucleic acid encoding a pancreatic and duodenal homeobox gene-1 (PDX-1) polypeptide, a neuro D polypeptide, or a betacellulin polypeptide.
(Item 30)
29. The method according to item 28, wherein the embryo marker is alpha-1 fetoprotein or Gata-4.
(Item 31)
29. The method according to item 28, wherein the non-pancreatic cell is a differentiated cell.
(Item 32)
32. The method according to item 31, wherein the differentiated cells are hepatocytes, skin cells or bone marrow cells.
(Item 33)
A method for remission of diabetes in a subject comprising administering to the subject a composition comprising a nucleic acid encoding pancreatic and duodenal homeobox gene-1 (PDX-1) polypeptide.
(Item 34)
34. The method of item 33, wherein the diabetes is type I diabetes or type II diabetes.

  Unless defined otherwise, all technical terms used herein have the same meaning as commonly understood in the technical field to which this invention belongs. Although methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present invention, suitable methods and materials are as described below. All publications, patent applications, patents and other references mentioned herein are hereby incorporated by reference in their entirety. In case of conflict, the present specification, including definitions, will control. In addition, the materials, methods, and examples are illustrative only and not intended to be limiting.

  Other features and advantages of the invention will be apparent from the following detailed description and claims.

MRNA in Balb / c mouse liver tissue for mouse insulin I (mI-1), mouse insulin II (mI-2), human insulin, PDX-1 and β-actin after adenovirus administration as measured by RT-PCR Indicates detection. Lane 1: no DNA (PCR negative control); lanes 2-6: livers of mice treated with AdCMV-PDX-1; lanes 7, 8: livers of mice administered with AdCMV-PDX-1 + AdRIP-1-hIns; lanes 9-9 11: livers of mice administered with control AdCMV-β-gal + AdRIP-1-hIns; lanes 12, 13: livers of mice administered with AdCMV-hIns; lane 14: normal mouse pancreas. Figure 2 shows the HPLC elution characteristics of insulin-related peptides extracted from murine tissue. Panel A is a pancreatic feature of PDX-1 treated mice. Panel B is a liver feature of PDX-1 treated mice. Detection of PDX-1, somatostatin Somato), proinsulin converting enzyme PC1 / 3 (PC1 / 3), glucagon (Glucg) and β-actin measured by RT-PCR is shown. Total RNA extracted from PDX-1 and control treated mice was reverse transcribed using PC1 / 3 specific primers. Lanes 1-3: AdCMV-PDX-1 treated mice; Lanes 4-5: AdCMV-β-gal treated mice; Lane 6: Pancreas; Lane 7: No cDNA (control for PCR). Ectopic PDX-1 expression in mouse liver is shown to ameliorate STZ-induced hyperglycemia. Male C57BL / 6 12-13 weeks old were administered 220 mg / kg STZ in citrate buffer. 36 to 48 hours after STZ administration, mice were treated with AdCMVPDX-1 (n = 15 mice) or AdCMVβ-gal (n = 22 as a control, but 12 mice died 3-5 days after STZ administration, 6-7 after STZ administration. Three more died a day). No deaths were observed with AdCMVPDX-1 administration. In each administration, recombinant adenovirus 2 × 10 ⁹ PFU (plaque forming unit) in 200 μl saline was administered systemically. The glucose concentration was measured with a blood sample collected from the ocular vein. FIG. 5 shows that ectopic PDX expression in mature hepatocytes in culture activates the insulin promoter (rat insulin-1 promoter) co-delivered to the same cells by AdRIPhIns. Human insulin is detected as in FIG. Lane 1: cells administered AdCMVPDX-1 + AdRIPhIns, lane 2: AdCMVβ-galactosidase + AdRIPhIns, lane 3: control. Shown is the induction of insulin 1 and somatostatin genes in primary monolayer cultures of fetal Fisher rat (E14) hepatocytes. Fetal liver cells were isolated from Fisher 344 rat embryos on day 14 of gestation and plated on collagen-coated tissue culture dishes. Cells were infected with AdCMVPDX-1 at a stage of 2-5 MOI (multiplicity of infection = number of virus particles per cell). Total RNA was extracted from the culture 4 days after virus administration and analyzed for somatostatin gene expression by RT-PCR. RNA was reverse transcribed using oligo (dT) ₁₅ primer as shown in FIG. 1, and PCR amplification was performed using the primers and conditions shown in Table 1. Lanes 1-3: Samples obtained from PDX-1 treated cells, Lanes 4-6: Untreated sample (control), Lane 7: No DNA. PCR products were resolved on 1.7% agarose gel electrophoresis. Figure 6 shows the effect of glucose on PDX-1 activation manifested by its increased ability to bind to the insulin promoter. The expression of GLUT-2 and GK promotes this activation by allowing glucose entry and metabolism. Intermediate RIN-38 cells were infected with AdCMV-GLUT2 or AdCMV-GK (lanes 4-6) or left untreated (lanes 1-3). Twenty-four hours after virus administration, whole cells were incubated on 0.2, 5 and 15 mM glucose. FIG. 4 is a photograph of RT-PCR analysis showing that ectopic PDX-1 induces an endocrine repertoire of pancreatic gene expression in mature liver in vivo. FIG. 3 is a photograph of RT-PCR analysis showing that ectopic PDX-1 induces an exocrine repertoire of pancreatic gene expression in mature liver in vivo. FIG. 3 is a photograph of RT-PCR analysis of pancreatic gene expression in PDX-1 treated liver as a function of time after a single dose of Ad-CMV-PDX-1 in vivo. It is a series of photographs showing that insulin and glucagon positive cells are located in the vicinity of the central vein (cv) 4 to 6 months after administration. Panel A: Insulin; Panel B: Glucagon 120 days; Panel C: 180 days after administration of insulin-positive cells Ad-CMV-PDX-1; Panel D: Control group. Scatter plot showing liver insulin content in individual mice as a function of time after systemic administration of Ad-CMV-PDX-1: 56 days (PDX-1 administration, n = 3, control, n = 6) 120 days (PDX-1 administration, n = 7, control, n = 3) and 180 days (PDX-1 administration, n = 4, control, n = 5). Liver IRI content in PDX-1 treated (□) or control (♦) mice is shown individually for each individual mouse. It is a bar graph which shows the liver glucagon content (PDX-1 administration, n = 10, control, n = 10) in the Ad-CMV-PDX-1 administration mouse | mouth. It is a bar graph which shows the liver somatostatin (PDX-1 administration, n = 9, control, n = 7) in the Ad-CMV-PDX-1 administration mouse | mouth. Photo showing PCR of ectopic rat PDX-1 cDNA bound to CMV promoter reflecting the presence of viral Ad-CMV-PDX-1 DNA in the treated liver as a function of time (days) after adenovirus administration to mice in vivo It is. RT-PCR analysis of gene expression of rat PDX-1 (rPDX-1), mouse PDX-1 (mPDX-1) and β-actin in the liver as a function of time after administration of Ad-CMV-PDX-1 in vivo It is a photograph which shows. 6 is a bar graph showing quantification results of ectopic (rat) vs. endogenous (mouse) PDX-1 expression as a function of time after initial Ad-CMV-PDX-1 administration using real-time PCR. Mouse PDX-1 (hatched) and rat PDX-1 (black). Bar graph showing hepatic insulin production protects mice from STZ-induced hyperglycemia 8 months after initial Ad-CMV-PDX-1 administration and that metastatic differentiated insulin-producing cells in the liver are resistant to STZ It is. It is a bar graph showing insulin gene expression in human keratinocytes, where PDX-1 administration was acting in a dose-dependent manner, and activation of insulin gene expression was possible at 100 moi (multiplicity of infection), but not at 10 moi. It was possible. It is a bar graph which shows the glucagon gene expression in a human keratinocyte. It is a bar graph which shows a somatostatin gene expression in a human keratinocyte. FIG. 3 shows the Ad-RIP-GFP-CMV-PDX-1 construct, which allows for the discovery of cells in which ectopic PDX-1 expression induces activation of the ectopic insulin promoter. Phase contrast microscopic morphology (A, C) and green fluorescence of mature hepatocytes at passage 2 (A, B) and passage 8 (C, D) infected with Ad-RIP-GFP-CMV-PDX-1 It is a series of photographs showing (B, D) (magnification x200). FIG. 5 is a bar graph showing the number of mature (black) and fetal (green) hepatocytes showing activation of the insulin promoter as manifested by green fluorescence as a function of in vitro passage number. (Random fields of n ≧ 20 are counted at each passage) Insulin promoter activation (Ad-RIP-GFP-CMV-PDX-1) divided by the ability to infect whole cells expressed by fluorescent cells after Ad-CMV-GFP infection (grey, n ≧ 10) as a function of passage number , Black) is a bar graph in which the metastatic differentiation ability (solid line) of mature hepatocytes was calculated as a percentage of cells showing. 2 is a bar graph showing pancreatic hormone gene expression in mature and fetal hepatocytes administered Ad-CMV-PDX-1 in the presence or absence of growth factor (GF). Ad-CMV-hIns is used as a positive control for insulin gene expression. C _t (threshold cycle) values were all normalized for β-actin expression within the same RNA sample. Human islets in mature (B) and fetal (C) human hepatocytes treated with Ad-CMV-PDX-1 and GF, untreated mature (D) and fetal (B) hepatocytes (RNA dilution 1:50, A ) Quantitative RT-PCR (real time) amplification curves (all with the same Ct value for β-actin gene expression). The curve is shown as ΔRn (fluorescence unit) vs. cycle number of amplification reaction. Mature hepatocytes have been shown to be as efficient as fetal human hepatocytes in activating insulin gene expression in response to PDX-1. Ad-CMV-PDX-1 supplemented with growth factors was administered, and insulin content (black, n ≧ 10), insulin (line, n ≧ 25) and C-peptide (dot, n ≧ 25) by static incubation for 48 hours. 25) is a bar graph showing insulin content, secretion and processing in mature primary hepatocytes analyzed for secretion of 25). Ad-CMV-hIns infected cells are used as a positive control for unregulated and unprocessed insulin secretion. Results show fold increase values (FOI) when compared to untreated control hepatocytes. It is a series of photographs showing insulin secretory granules in mature human hepatocytes treated with PDX-1. Insulin immunogold histochemical electron microscopy in adult human hepatocytes administered (A, B) or not (C) with Ad-CMV-PDX-1 and growth factors. Arrows are immunogold particles, and are concentrated in secretory granules produced in hepatocytes administered with PDX-1. A specific endocrine secretory granule molecular marker secretogranin 2 (SCG2) normalized to the same intracellular β-actin gene expression in Ad-CMV-PDX-1 and GF-treated or untreated mature hepatocytes and It is a bar graph which shows the result of the quantitative RT-PCR (real-time) gene expression analysis implemented using the specific Taqman probe about secretory granule neuroendocrine 1 (SGNE1). Human islets are used as a positive control. Results show fold increase (FOI) values compared to untreated control hepatocytes (n ≧ 12 for each experiment). Regulatory proteins glucokinase, Glut-2 and prohormone converting enzyme 2 (PC2) normalized to the same intracellular β-actin gene expression in mature hepatocytes administered or not administered with Ad-CMV-PDX-1 and GF FIG. 5 is a bar graph showing the results of quantitative RT-PCR (real-time) gene expression analysis performed using a specific Taqman probe. Human islets are used as a positive control. Results show fold increase values (FOI) compared to (untreated) control hepatocytes (n ≧ 10 for each experiment). FIG. 2 is a graph showing insulin secretion over time (15 to 180 minutes) at a glucose concentration of 2 mM (◯) or 25 mM (.) In mature human hepatocytes treated with PDX-1 and GF. FIG. 2 is a graph showing C-peptide secretion over time (15 to 180 minutes) at a glucose concentration of 2 mM (◯) or 25 mM (.) In PDX-1 and GF-treated mature human hepatocytes. 2 is a graph showing dose-response secretion of C-peptide at concentrations of 0-25 mM glucose (.) Or 2-DOG (.). Arrows and dotted lines indicate an exchange from 25 mM glucose administration to 2 mM glucose administration. (B-d): n = 6 in 3 different experiments. It is a graph which shows that PDX-1 administration hepatocytes correct hyperglycemia in a SCID-NOD mouse. Diabetic SCID-NOD mice were transplanted with subcapsular Ad-CMV-PDX-1 and mature human hepatocytes treated with growth factor (.; N = 9) and untreated (□; n = 5). The glucose concentration after the designated number of days after transplantation is shown in mg%. The asterisk indicates that there is a significant difference in glucose concentration between mice transplanted with Ad-CMV-PDX-1 and mice transplanted with control cells (p <0.01). It is a series of photographs showing immunohistochemical staining for Pdx-1 (A) and insulin (B) in a kidney capsule section 10 days after transplantation of mature hepatocytes administered with Ad-CMV-PDX-1. Insulin staining of pancreas from the same SCID-NOD mouse (C). FIG. 2 is a bar graph showing the human C-peptide concentration in the sera of transplanted and control mice measured by ELISA before the transplantation experiment (day 0, before administration; gray) and at the end of the experiment (day 10, administration; black). An asterisk (*) indicates that there is a significant difference between the serum concentrations of human C-peptide in mice transplanted with Ad-CMV-PDX-1 and the same diabetic mice before human cell transplantation (p <0.01). ). FIG. 5 is a bar graph showing that ectopic expression of rat PDX-1 induces expression of endogenous human PDX-1 in hepatocytes. Mature primary hepatocytes were administered growth factor-added Ad-CMV-PDX-1 and analyzed for endogenous human PDX-1 gene expression. Results show fold increase (FOI) values compared to untreated control hepatocytes. The blood glucose level in the diabetic CAD-NOD mouse | mouth which administered Ad-CMV-PDX-1 is shown. Control unadministered or b-gal-administered mice ▲, PDX-1-administered mice (.). It is a bar graph which shows the body weight of the diabetic CAD-NOD mouse | mouth administered Ad-CMV-PDX-1. Control unadministered or b-gal-administered mice ▲, PDX-1-administered mice (.). A series of photographs showing glycogen storage in a diabetic mouse treated with Ad-CMV-PDX-1. C1, administered mouse; C2, non-administered mouse; C3, pre-diabetic NOD mouse. A series of photographs showing immunohistochemical staining of pancreas and liver in CAD-NOD mice. A, CAD-NOD mice stain negative for insulin; B, control non-diabetic mice; C, insulin in liver of PDX-1 treated mice; D, liver of non-treated diabetic mice. The bar graph which shows the insulin density | concentration in serum of the CAD-NOD mouse | mouth which Ad-CMV-PDX-1 administration. The bar graph which shows the liver insulin density | concentration of the CAD-NOD mouse | mouth which Ad-CMV-PDX-1 administration. The graph which shows the glucose tolerance of the Ad-CMV-PDX-1 administration CAD-NOD mouse | mouth. It is a photograph of RT-PCR and what divided the amplified product on the agarose gel has shown that ectopic PDX-1 induced the gene expression in the CAD-NOD mouse liver. FIG. 6 is a scatter graph showing PDX-1 induction of expression changes in about 500 genes analyzed by DNA microarray chip analysis of human hepatocytes administered PDX-1 or control. It is a table | surface which shows PDX-1 suppression of C / EBP (beta) expression in a liver, a pancreas, a human hepatocyte control, Ad-CMV-h insulin administration human hepatocytes, and PDX-1 administration human hepatocytes by DNA microarray analysis. It is a bar graph which shows PDX-1 suppression of C / EBP (beta) expression by quantitative RT-PCR analysis. It is a photograph of the Western blot which shows PDX-1 suppression of the intracellular protein concentration of C / EBPβ. FIG. 6 is a photograph of a Western blot showing PDX-1 inhibition of liver proteins and induction of dedifferentiation of mature human hepatocytes in mature (left) and fetal (right) human hepatocytes. 2 is a bar graph showing PDX-1 inhibition of liver gene expression and protein production. 2 is a bar graph showing PDX-1 inhibition of liver gene expression and protein production. FIG. 6 is a bar graph showing that PDX-1 induces dedifferentiation of mature hepatocytes that is manifested by induction of embryonic markers. FIG. 6 is a bar graph showing that PDX-1 induces dedifferentiation of mature hepatocytes that is manifested by induction of embryonic markers. RT-PCR photographs showing amplification products split on an agarose gel indicate that ectopic PDX-1 induces expression of pancreatic genes and pancreatic transcription factors in in vitro human hepatocytes. FIG. 5 is a bar graph showing that ectopic PDX-1 induces endogenous human PDX-1 expression in human hepatocytes in vitro. FIG. 5 is a bar graph showing that ectopic PDX-1 induces beta 2 expression in human hepatocytes in vitro. FIG. 5 is a bar graph showing that ectopic PDX-1 induces Isl-1 expression in human hepatocytes in vitro. FIG. 5 is a bar graph showing that ectopic PDX-1 induces Nkx6.1 expression in human hepatocytes in vitro. FIG. 5 is a bar graph showing that ectopic PDX-1 induces Ngn3.1 expression in human hepatocytes in vitro. FIG. 5 is a bar graph showing that ectopic PDX-1 induces Nkx2.2 expression in human hepatocytes in vitro. FIG. 5 is a bar graph showing that ectopic PDX-1 induces insulin gene expression when enhanced by liver growth factor-1. FIG. 5 is a bar graph showing that ectopic PDX-1 induces elastase gene expression. Western blot analysis showing that ectopic neuro D1 induces endogenous Pdx-1 in hepatocytes.

(Detailed description of the invention)
In part, the ectopic expression of pancreatic and duodenal homobox gene 1 (PDX-1) in the liver and skin induces an islet cell phenotype in liver and skin cells and expression of pancreatic hormones Based on the discovery that it brings production and processing. PDX-1 is also known as IDX-1, IPF-1, STF-1, and IUF-1, all of which are collectively referred to herein as “PDX”. Furthermore, the present invention provides methods and pharmaceutical compositions for treating pancreatic disorders.

  Recent advances in the results of clinical islet transplantation for diabetes suggest that continued control of blood glucose levels can be achieved by islet cell transplantation. However, this good method of treatment is severely limited by the limited supply of tissue from cadaveric donors and the need for lifelong immunosuppression. Islet cell transplantation as a treatment for diabetics is only widely available when new sources of islet cells or beta cells are discovered. The optimal source of tissue designed to replace β-cell function in type I autoimmune diabetes must be easily isolated, extensively proliferated, and able to resist preferential autoimmune attacks Such cells are thought to be potentially present in extrapancreatic tissue.

  In vivo ectopic expression of PDX-1 delivered by the first generation of E1-deleted recombinant adenovirus (Ad-CMV-PDX-1) is the endocrine and exocrine pancreatic repertoire of gene expression and processed biological Induced both active insulin production and secretion. These results indicate that PDX-1 and PDX-1 expressed ectopically in mature and fully differentiated organs function as pancreatic differentiation factors. Furthermore, although PDX-1 was delivered in vivo using a first generation recombinant adenovirus, pancreatic hormone expression and production has been sustained for over 8 months after administration.

  This surprising ability of the liver to function as a potential source of tissue to generate functional endocrine pancreas was first revealed by the inventors in vivo in mice using ectopic PDX-1 gene expression. It was done. Short-term expression of the PDX-1 transgene in mice induces a global, irreversible and functional metastatic differentiation process in a subpopulation of hepatocytes (ie one fully differentiated characteristic and function of one mature cell) It was found that it was converted to cells. Furthermore, it has been found that newly isolated mature as well as fetal human hepatocytes under controlled conditions in vitro culture can be induced to metastasize into functional insulin producing tissues. Approximately 50% of the hepatocytes expressing the PDX-1 transgene activated the otherwise negatively active insulin promoter. Metastatic human hepatocytes produced hormones that were stored in secretory granules and released insulin processed in a glucose-regulated manner. Insulin-producing human hepatocytes were functional and restored normoglycemia in cyclophosphamide accelerated diabetes induced in diabetic immunodeficient and non-obese diabetic mice.

  In its various features and embodiments, the invention includes administering to a subject a compound that increases PDX expression or activity (also referred to herein as a PDX inducer compound) or contacting it with a cell. . PDX expression or activity is increased, for example, by compounds that activate endogenous PDX expression. The compound may be, for example, (i) PDX, neuroD or betacellulin polypeptide; (ii) a nucleic acid encoding PDX, neuroD or betacellulin polypeptide; (iii) a nucleic acid that increases expression of a nucleic acid encoding PDX polypeptide; And their derivatives, fragments, analogs and homologues. Nucleic acids that increase the expression of a nucleic acid encoding a PDX polypeptide include, for example, promoters and enhancers. Nucleic acids can be either endogenous or exogenous. Optionally, the cells are further contacted with nicotinamide, epidermal growth factor, activin A, liver growth factor, exendin, GLP-1 or betacellulin.

  As used herein, the term “nucleic acid” refers to DNA molecules (eg, cDNA or genomic DNA), RNA molecules (eg, mRNA), DNA or RNA analogs made using nucleotide analogs, and derivatives thereof, It is intended to include fragments and homologues. The nucleic acid molecule can be single-stranded or double-stranded. Preferably, the nucleic acid is DNA. Nucleic acids that increase the expression of a nucleic acid encoding a PDX polypeptide include, for example, promoters and enhancers. Nucleic acids can be either endogenous or exogenous.

  Suitable sources of nucleic acids encoding PDX include, for example, human PDX nucleic acids (and encoded protein sequences) available as Genbank accession numbers U35632 and AAA88820, respectively. Other sources include rat PDX nucleic acid and protein sequences are shown in Genbank Accession Nos. U35632 and AAA18355, respectively, which are incorporated herein by reference in their entirety. Another source includes scorpion PDX nucleic acid and the protein sequences are shown in Genbank Accession Nos. AF036325 and AAC41260, respectively, which are incorporated herein by reference in their entirety.

  The compound can be administered directly to the subject (ie, directly exposing the subject to the nucleic acid or nucleic acid-containing vector) or indirectly (ie, first transforming the cell with the nucleic acid in vitro and then transplanting it into the subject). For example, in one embodiment, mammalian cells are isolated from the subject and PDX nucleic acid is introduced into the cells isolated in vitro. Cells are reintroduced into an appropriate mammalian subject. Preferably, the cell is introduced into an autologous subject. The routes of administration of the compounds include, for example, parenteral, intravenous, intradermal, subcutaneous, oral (eg inhalation), transdermal (topical), transmucosal, and rectal administration. In one embodiment, the compound is administered intravenously. Preferably the compound is implanted under the renal capsule or injected into the portal vein.

  The cell can be any cell capable of producing pancreatic hormones, such as bone marrow, muscle, spleen, kidney, blood, skin, pancreas or liver. In one embodiment, the cells are capable of functioning as islet cells, i.e., capable of storing, processing, or secreting pancreatic hormones, preferably insulin, by an extracellular trigger. In another embodiment, the cell is a hepatocyte. In another embodiment, the cell is totipotent or pluripotent. In another embodiment, the cells are hematopoietic stem cells, embryonic stem cells, or preferably hepatic stem cells.

  The subject is preferably a mammal. The mammal can be, for example, a human, non-human primate, mouse, rat, dog, cat, horse or cow.

(Method of inducing pancreatic hormone production)
In various aspects, the present invention provides a method of inducing pancreatic hormone production in a subject. For example, the method includes administering to the subject a compound that increases PDX expression or activity in an amount sufficient to induce pancreatic hormone production.

  In another aspect, the method provides for preparing cells from a subject, contacting the cells with a compound that increases PDX expression in an amount sufficient to increase pancreatic hormone production, and introducing the cells into the subject. Including that. In one embodiment, pancreatic hormone production occurs in vitro or in vivo by introduction of cells into the subject. In another embodiment, pancreatic hormone production occurs in vivo upon introduction of cells into the subject.

  The pancreatic hormone can be, for example, insulin, glucogon, somatostatin or islet amyloid polypeptide (IAPP). Insulin can be liver insulin or serum insulin. In other embodiments, the pancreatic hormone is liver insulin. In another embodiment, the pancreatic hormone is serum insulin (ie, a fully processed form of insulin capable of promoting glucose utilization, carbohydrate, fat and protein metabolism, for example).

  In some embodiments, the pancreatic hormone is of the “prohormone” type. In other embodiments, the pancreatic hormone is a fully processed biologically active form of the hormone. In other embodiments, the pancreatic hormone is under regulatory control, that is, the secretion of the hormone is under nutritional and hormonal control, as is the endogenously produced pancreatic hormone. For example, in one aspect of the invention, the hormone is under the regulatory control of glucose.

  The cell population exposed to, eg, contacted with, the compound can be any quantity of cells, ie, one or more cells, and is provided in vitro, in vivo or ex vivo.

(Methods for treating or preventing pancreatic-related disorders)
The invention further encompasses methods for treating, ie preventing, or delaying onset or ameliorating symptoms in a subject. In various aspects, the method includes administering to the subject a compound that modulates PDX expression or activity. “Modulate” includes increasing or decreasing PDX expression or activity. Preferably, the modulation results in alteration of PDX expression or activity in the subject to the same or the same level as a subject not suffering from a pancreatic disorder. In another aspect, the method includes administering to the subject a compound that induces non-pancreatic cells to express pancreatic islet cell function, eg, insulin, somatostatin or glucagon. In one embodiment, the compound modulates PDX expression or activity.

  The pancreatic disorder can be any disorder associated with the pancreas. For example, the methods are useful in treating pancreatic hormone dysfunction (eg, diabetes (type I and type II)), insulinoma, and hyperglycemia. Basically, any disorder that is etiologically related to PDX activity is considered sensitive to treatment.

  Subjects with or at risk for developing diabetes are identified by methods known in the art, such as measuring blood glucose levels. For example, a blood glucose level higher than 140 mg / dL after an overnight fast on at least two occasions means that the patient is diabetic. Those who have diabetes or who are not at risk of developing are characterized as having fasting blood glucose levels of 70-110 mg / dL.

  Diabetes symptoms include fatigue, nausea, frequent urination, increased drinking craving, weight loss, blurred vision, frequent infection and slow healing of wounds and ulcers, sustained blood pressure of 140/90 or higher, HDL cholesterol less than 35 mg / dL or triglyceride 250 mg / Includes over dL, hyperglycemia, hypoglycemia, insulin failure or tolerance. Diabetic or pre-diabetic patients receiving the compound are identified using diagnostic methods known in the art.

  The PDX-modulating compounds described herein are referred to herein as “therapeutic agents” when used in therapy. Methods of administering therapeutic agents include, for example, intradermal, intramuscular, intraperitoneal, intravenous, subcutaneous, intranasal, epidural and oral routes. The therapeutics of the invention may be administered by any convenient route, such as by infusion or single injection, by absorption via epithelial or mucosal epidermal linings (eg, oral mucosa, rectum and intestinal mucosa, etc.), and It may be administered with other biologically active agents. Administration can be systemic or local. Furthermore, it may be advantageous to administer the therapeutic agent to the central nervous system by any suitable route, such as intraventricular and intrathecal injection. Intraventricular injection can be facilitated by an intraventricular catheter connected to a reservoir (eg, Ommaya reservoir). Pulmonary administration may be used by using a formulation containing an inhaler or nebulizer and an aerosolizing agent. It may be desirable to administer the therapeutic agent locally to the area in need of treatment, for example by local injection during surgery, topical application, injection, catheterization, suppository use or the use of implants. Various delivery systems are known and can be used to administer the therapeutic agents of the present invention, examples of which are (i) encapsulated in liposomes, microparticles, microcapsules, (ii) recombinant capable of expressing therapeutic agents. A therapeutic agent as part of a cell, (iii) receptor mediated endocytosis (see eg Wu and Wu, 1987, J. Biol. Chem. 262: 4429-4432), (iv) retrovirus, adenovirus or other vector Such as the construction of nucleic acids. In one embodiment of the invention, the therapeutic agent may be delivered in vesicles, particularly liposomes. In liposomes, the protein of the present invention is in addition to other pharmaceutically acceptable carriers, for example, amphipathic drugs such as lipids present in aggregated form as micelles, insoluble monolayers, liquid crystals or lamellar layers, Combine in aqueous solution. Lipids suitable for liposome formulations include, for example, monoglycerides, diglycerides, sulfatides, lysolecithin, phospholipids, saponins, bile acids and the like. The preparation of such liposome formulations is as known in the art and is described, for example, in US Pat. No. 4,837,028; and US Pat. No. 4,737,323, all of which are incorporated herein by reference. It is. In yet another embodiment, the therapeutic agent is, for example, a delivery pump (see, eg, Saudek et al., 1989, New Engl. J. Med. 321: 572) and a semipermeable polymeric material (eg, Howard et al., 1989). , J. Neurosurg. 71: 105). Furthermore, the controlled release system can be placed in close proximity to the therapeutic target (eg, the brain), ie, only a small portion of the systemic dose is required. See, for example, Goodson, Medical Applications of Controlled Release 1984 (CRC Press, Boca Raton, FL).

  In certain embodiments of the invention where the therapeutic agent is a nucleic acid encoding a protein, the therapeutic nucleic acid is a suitable nucleic acid expression vector such that it is intracellular (eg, by use of a retroviral vector). Constructed and administered as a part, linked by direct injection, by use of microparticle bombardment, by lipid coating or cell surface coating or transfection agent, or linked to a homeobox-like peptide known to enter the nucleus (See, for example, Joliot et al., 1991, Proc. Natl. Acad. Sci. USA 88: 1864-1868) and the like, and may be administered in vivo so as to promote expression of the encoded protein. Alternatively, the nucleic acid therapeutic can be introduced into the cell and taken up into the host cell DNA for expression by homologous recombination, or can remain as an episome.

  As used herein, the term “therapeutically effective amount” means meaningful patient benefit, ie, treatment, cure, prevention or amelioration of the relevant medical condition, or treatment, cure, prevention or amelioration of such condition. Means the total amount of each active compound in a pharmaceutical composition or method sufficient to show an increase in the rate of When applied to an individual active ingredient administered alone, the term refers only to that ingredient. When applied to a combination, the term refers to a combined amount of active ingredients that provides a therapeutic effect, whether combined, sequential or simultaneous administration.

  The amount of the therapeutic agent of the invention that is effective in the treatment of a particular disorder or condition will vary with the nature of the disorder or condition and may be determined by standard clinical techniques according to average techniques in the art. In addition, in vitro testing can optionally be used to help find the optimal dose range. The exact dose to be used in the formulation will depend on the route of administration and the overall severity of the disease or disorder and should be determined according to the judgment of the physician and the circumstances of each patient. Ultimately, the attending physician will decide the amount of protein of the invention to be used in the treatment of each individual patient. Initially, the attending physician will administer small doses of the protein of the invention and observe the patient's response. Increasing doses of the protein of the invention are administered until an optimal therapeutic effect is obtained for the patient, after which the dose is not increased further. However, suitable dosage ranges for intravenous administration of the therapeutic agents of the invention are generally about 20-500 micrograms (μg) of active compound per kilogram (Kg) body weight. Suitable dosage ranges for intranasal administration are generally about 0.01 pg / kg body weight to 1 mg / kg body weight. Effective doses may be extrapolated from dose-response curves derived from in vitro or animal model test systems. Suppositories generally contain active ingredient in the range of 0.5% to 10% by weight; oral formulations preferably contain 10-95% active ingredient.

  The duration of intravenous therapy using the therapeutic agents of the present invention will vary depending on the severity and condition of the disease to be treated and the potential idiosyncratic response between individuals. It is believed that the duration of each application of the protein of the invention ranges from 12 to 24 hours of continuous intravenous administration. Ultimately, the attending physician will decide on the appropriate duration of intravenous therapy using the pharmaceutical composition of the present invention.

  A cell can also be increased or brought to a desired effect or activity on the cell by culturing ex vivo in the presence of a therapeutic agent or protein of the invention.

(Methods of inducing islet cell phenotype or function)
The invention also encompasses a method of inducing or enhancing one or more islet cell phenotypes in a cell. In one embodiment, the pancreatic cell phenotype is induced in a non-islet cell type. For example, non-pancreatic cells are converted to pancreatic cells (ie, metastasized) by contacting the cells with a PDX-1 inducer compound. The cells are contacted with an amount of PDX inducer that induces expression of endogenous PDX-1, embryonic marker, insulin, glucogon or somatostatin in non-pancreatic cells. Alternatively, the cells are contacted with an amount of PDX inducer that suppresses the expression of C / EBPβ, albumin or ADH-1 in non-pancreatic cells. The method involves an amount sufficient to induce or enhance an islet cell phenotype, eg, beta, alpha and delta islet cells, eg, PDX-1, beta 2, ISL-2, Nkx6.1, Ngn3.1 or Nkx2. . Contacting the cell with a compound that modulates an islet cell-specific transcription factor such as .2. Preferably, the compound increases PDX expression (eg, endogenous PDX-1 expression), production or activity. Preferably the method induces an islet β cell phenotype.

  “Islet cell phenotype” refers to one or more of the characteristics typical of islet cells, namely hormone production, processing, preservation in secretory granules, nutritionally and hormonally regulated secretion or characteristic islands. It is a cell that exhibits the gene expression characteristics of the cell. The islet cell phenotype can be examined, for example, by measuring pancreatic hormone production, such as insulin, somatostatin or glucagon. Hormone production can be examined by methods known in the art, such as immunoassays, Western blots, receptor binding tests, or functionally by the ability to ameliorate hyperglycemia after transplantation into a diabetic host.

  The cell can be any cell capable of expressing an islet cell phenotype, such as muscle, bone marrow, spleen, kidney, skin, pancreas or liver. In one embodiment, the cells are capable of functioning as islet cells, i.e., capable of storing, processing, or secreting pancreatic hormones, preferably insulin, by an extracellular trigger. In another embodiment, the cell is a hepatocyte. The cell is a mature cell, ie a differentiated cell. In another embodiment, it is totipotent or pluripotent. In another embodiment, the cells are hematopoietic stem cells, embryonic stem cells, or preferably hepatic stem cells.

  The cell population exposed to, or contacted with, the compound can be any number of cells, ie, one or more cells, and is provided in vitro, in vivo or ex vivo.

(Method of inducing islet gene expression characteristics)
The invention also encompasses a method of inducing or enhancing islet gene expression characteristics in a subject or cell. “Pancreatic gene expression profile” is intended to encompass one or more genes that are normally transcriptionally silent in non-endocrine tissues, such as pancreatic transcription factors, endocrine genes or exocrine genes. For example, expression of PC1 / 3, insulin, glucagon, somatostatin or endogenous PDX-1. The method includes administering to the subject a compound that increases PDX expression or activity in an amount sufficient to induce islet or endocrine gene expression characteristics. In one embodiment, the method induces PC1 / 3 gene expression in the subject.

  Induction of pancreatic gene expression characteristics can be detected using techniques known in the art. For example, pancreatic hormone RNA sequences can be detected by Northern blot hybridization analysis, amplification system detection methods such as systematic detection by reverse transcription system polymerase chain reaction or microarray chip analysis. Alternatively, expression can also be measured at the protein level, i.e. by measuring the concentration of the polypeptide encoded by the gene. In certain embodiments, the expression of the PC1 / 3 gene or protein can be measured by its activity when processing the prohormone to its active mature form. Such methods are known in the art and include, for example, antibody-based immunoassays or processed hormone HPLC for the protein encoded by the gene.

(Method for identifying genes whose expression is modulated by PDX)
The invention also includes a method of identifying nucleic acids whose expression is modulated by PDX. The method includes measuring the expression of one or more nucleic acids in a test cell population exposed to a compound that modulates PDX activity or expression. The expression of the nucleic acid sequence in the test cell population is then compared to the expression of the nucleic acid sequence in a control cell population that is a cell population that has not been exposed to the compound or, in some embodiments, a cell population that has been exposed to the compound. To do. Comparisons are performed on test and comparative samples measured at the same time or at different times. The latter example is the use of a sequence database that compiles compiled expression information, for example information on the expression concentration of known sequences after administration of various drugs. For example, modification of the expression concentration after administration of the compound is compared to the change in expression observed in the nucleic acid sequence after administration of a control agent such as PDX nucleic acid.

  The altered expression of the nucleic acid sequence in the test cell population when compared to the expression of the nucleic acid sequence in a control cell population not exposed to the compound indicates that the nucleic acid expression was modulated by PDX. Yes.

  Test cells can be obtained from any tissue that can be modulated by PDX, such as the pancreas, liver, spleen or kidney. In one embodiment, the cells are derived from non-endocrine tissue. Preferably, the cell is liver tissue.

  Preferably, the cells in the control cell population are obtained from the same tissue type as possible as the test cells, eg liver tissue. In some embodiments, the control cells are obtained from the same subject as the test cells, eg, from an area proximate to the source area of the test cells. In another embodiment, the control cell population is obtained from a database of molecular information obtained from cells with known parameters or conditions tested.

  Nucleic acid expression can be measured at the RNA level using any method known in the art. For example, gene expression can be measured using Northern hybridization analysis using probes that specifically recognize one or more of these sequences. Alternatively, expression can be measured using reverse transcription-based PCR analysis. Expression can also be measured at the protein level, ie by measuring the concentration of the polypeptide encoded by the gene product. Such methods are known in the art and include, for example, immunoassays based on antibodies to proteins encoded by genes.

  Where the altered gene expression is associated with gene amplification or deletion, the sequence comparison of the test and control populations may be made by comparing the relative amounts of the tested DNA sequences in the test and control cell populations. it can.

  The present invention also encompasses PDX modulated nucleic acids identified according to the present screening methods and pharmaceutical compositions comprising PDX modulated nucleic acids so identified.

(PDX recombinant expression vector and host cell)
Another feature of the present invention relates to a vector, preferably an expression vector, containing a nucleic acid encoding PDX protein or a derivative, fragment, analog or homologue thereof. As used herein, the term “vector” refers to a nucleic acid molecule capable of transporting another nucleic acid to which it has been linked. One type of vector is a “plasmid”, which refers to a linear or circular double stranded DNA loop into which another DNA segment can be ligated. Another type of vector is a viral vector, in which another DNA segment can be ligated into the viral genome. Certain vectors are capable of autonomous replication in a host cell into which they are introduced (eg, bacterial vectors having a bacterial origin of replication and episomal mammalian vectors). Other vectors (eg, non-episomal mammalian vectors) are integrated into the genome of the host cell upon introduction into the host cell, and thereby are replicated along with the host genome. Furthermore, certain vectors can direct the expression of genes to which they are operably linked. Such vectors are referred to herein as “expression vectors”. In general, expression vectors used in recombinant DNA methods often take the form of plasmids. In the present specification, “plasmid” and “vector” are used interchangeably as the plasmid is the most commonly used form of vector. However, the present invention is intended to encompass other forms of expression vectors such as viral vectors that function equally (eg, replication defective retroviruses, lentiviruses, adenoviruses and adeno-associated viruses). In addition, some viral vectors can target specific cell types either specifically or non-specifically.

  A recombinant expression vector of the present invention comprises a nucleic acid of the present invention in a form suitable for expression of the nucleic acid in a host cell, wherein the recombinant expression vector is expressed operably linked to the nucleic acid sequence to be expressed. It is meant to include one or more regulatory sequences selected based on the host cell to be used for the purpose. Within a recombinant expression vector, “operably linked” refers to expression of a nucleic acid sequence of interest in a nucleic acid sequence (eg, in an in vitro transcription / translation system or in a host cell if the vector is introduced into a host cell). It means linked to the regulatory sequence in such a way as to allow. The term “regulatory sequence” is intended to include promoters, enhancers and other expression control elements (eg, polyadenylation signals). Such regulatory sequences are described in, for example, Goeddel; Gene Expression Technology: Methods in Enzymology 185, Academic Press, San Diego, Calif. (1990). Regulatory sequences include those that direct constitutive expression of nucleotide sequences in many types of host cells and those that direct expression of nucleotide sequences only in specific host cells (eg, tissue-specific regulatory sequences). As is known to those skilled in the art, the design of an expression vector varies depending on factors such as the choice of host cell to be transformed and the expression level of the desired protein. By introducing the expression vector of the present invention into a host cell, a protein or peptide containing a fusion protein or peptide encoded by the nucleic acid described herein can be produced (eg, PDX protein, PDX mutant). , Fusion proteins, etc.).

  The recombinant expression vectors of the invention can be designed for the expression of PDX in prokaryotic or eukaryotic cells. For example, PDX is a bacterial cell such as E. coli. It can be expressed in E. coli, insect cells (using baculovirus expression vectors), yeast cells or mammalian cells. Suitable host cells include Goeddel; Gene Expression Technology: Methods in Enzymology 185, Academic Press, San Diego, Calif. (1990). Alternatively, the recombinant expression vector can be transcribed and translated in vitro, for example using T7 promoter regulatory sequences and T7 polymerase.

  Expression of proteins in prokaryotic cells is most often performed in E. coli using vectors containing a constitutive or inducible promoter that directs the expression of fused or unfused proteins. performed in E. coli. Fusion vectors usually add many amino acids to the protein encoded therein at the amino terminus of the recombinant protein. Such fusion vectors typically act as a ligand for three purposes: (1) to increase expression of the recombinant protein, (2) to increase the solubility of the recombinant protein, and (3) to affinity purification. It functions to contribute to the purification of recombinant proteins. In many cases, in fusion expression vectors, a proteolytic cleavage site is introduced at the junction between the fusion part and the recombinant protein, thereby allowing the recombinant protein to be separated from the fusion part after purification of the fusion protein. Such enzymes and their congener recognition sequences include Factor Xa, thrombin and enterokinase. Typical fusion expression vectors are glutathione S-transferase (GST), maltose E binding protein, or pGEX (Pharmacia Biotech Inc., Smith and Johnson (1988) Gene 67: 31-40), which fuses protein A to a target recombinant protein, respectively. PMAL (New England Biolabs, Beverly, Mass.) And pRIT5 (Pharmacia, Piscataway, NJ).

  Suitable induction non-fusion E. Examples of E. coli expression vectors include pTrc (Amann et al., (1988) Gene 69: 301-315) and pET 11d (Studenter et al., Gene Expression Technology: Methods in Enzymology 185, Academy. (1990) 60-89).

  E. One way to maximize recombinant protein expression in E. coli is to express the protein in a host bacterium that has impaired ability to proteolytically cleave the recombinant protein. Gottesman, Gene Expression Technology: Methods in Enzymology 185, Academic Press, San Diego, Calif. (1990) 119-128. Another method is that the individual codons for each amino acid are E. coli. modifying the nucleic acid sequence of the nucleic acid to be inserted into the expression vector so that it is preferentially used by E. coli (Wada et al., (1992) Nucleic Acids Res. 20: 2111-2118). Such modifications of the nucleic acid sequences of the present invention can be performed by standard DNA synthesis techniques.

  In another embodiment, the PDX expression vector is a yeast expression vector. Examples of vectors for expression in S. cerevisiae are pYepSec1 (Baldari, et al., (1987) EMBO J6: 229-234), pMFa (Kurjan and Herskowitz, (1982) Cell 30: 933-943), pJRY88 (Schultz et al., (1987) Gene 54: 113-123), pYES2 (Invitrogen Corporation, San Diego, Calif.) and picZ (InVitrogen Corp, San Diego, Calif.).

  Alternatively, PDX can be expressed in insect cells using baculovirus expression vectors. Baculovirus vectors that can be used for the expression of proteins in cultured insect cells (eg SF9 cells) are the pAc series (Smith et al., (1983) Mol Cell Biol 3: 2156-2165) and the pVL series (Lucklow and Summers ( 1989) Virology 170: 31-39).

  In yet another embodiment, the nucleic acids of the invention are expressed in mammalian cells using mammalian expression vectors. Examples of mammalian expression vectors include pCDM8 (Seed (1987) Nature 329: 840) and pMT2PC (Kaufman et al. (1987) EMBO J 6: 187-195). When used in mammalian cells, the expression vector's control functions are often provided by viral regulatory elements. For example, commonly used promoters are derived from polyoma, adenovirus 2, cytomegalovirus and simian virus 40. For other suitable expression systems for both prokaryotic and eukaryotic cells, see, for example, Sambrook et al. , Molecular Cloning: A Laboratory Manual. 2nd ed. , Cold Spring Harbor Laboratory, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N .; Y. 1989, chapters 16 and 17.

  In another embodiment, the recombinant mammalian expression vector can direct nucleic acid expression preferentially in certain cell types (eg, use a tissue-specific regulatory element to express the nucleic acid). Tissue specific regulatory elements are known in the art. Non-limiting examples of suitable tissue specific promoters include albumin promoters (liver specific; Pinkert et al. (1987) Genes Dev 1: 268-277), lymphoid specific promoters (Callame and Eaton (1988) Adv Immunol). 43: 235-275), in particular the promoters of the T cell receptor (Winoto and Baltimore (1989) EMBO J8: 729-733) and immunoglobulins (Banerji et al., (1983) Cell 33: 729-740; Queen and Baltimore. (1983) Cell 33: 741-748), neuron-specific promoters (eg, neurofilament promoters, Byrne and Ruddle). 1989) PNAS 86: 5473-5477), pancreatic specific promoters (Edrund et al., (1985) Science 230: 912-916) and mammary gland specific promoters (eg, the whey promoter, US Pat. No. 4,873,316 and Europe) Patent application 264,166). Developmentally regulated promoters are also encompassed, including the murine hox promoter (Kessel and Gross (1990) Science 249: 374-379) and the alpha-fetoprotein plasmid (Campes and Tilghman (1989) Genes Dev 3: 537-546). .

The present invention further provides a recombinant expression vector comprising the DNA molecule of the present invention cloned in the antisense direction into the expression vector. That is, the DNA molecule is operably linked to a regulatory sequence in a manner that allows expression of an RNA molecule that is antisense to PDX mRNA (by transcription of the DNA molecule). Regulatory sequences operably linked to nucleic acids cloned in the antisense orientation can be selected to direct the sustained expression of antisense RNA molecules in various cell types, for example viral promoters and / or enhancers or regulatory sequences include One can select to direct expression of constitutive, tissue-specific or cell-specific antisense RNA. Antisense expression vectors can be in the form of recombinant plasmids, phagemids or titer-reducing viruses that produce antisense nucleic acids under the control of highly efficient regulatory regions, the activity depending on the cell type into which the vector is introduced. It is determined. A discussion on the regulation of gene expression using antisense genes can be found in Weintraub et al. , "Antisense RNA as a molecular tool
for genetic analysis, “Reviews-Trends in
Genetics, Vol. 1 (1) 1986.

  Another feature of the invention relates to host cells into which a recombinant expression vector of the invention has been introduced. The terms “host cell” and “recombinant host cell” are used interchangeably herein. Such terms are intended to refer not only to the particular subject cell, but also to the progeny or potential progeny of such a cell. Such progeny may not actually be identical to the parent cell because certain modifications may occur during passage due to mutations or environmental effects, but the scope of the terms used herein is still To be included. Furthermore, the host cell may be modulated after expressing PDX and may retain or lose its original properties.

  The host cell can be a prokaryotic cell or a eukaryotic cell. For example, PDX protein is E. coli. It can be expressed in bacterial cells such as E. coli, insect cells, yeast or mammalian cells (eg Chinese hamster ovary cells (CHO) or COS cells). Alternatively, the host cell can be an immature mammalian cell, ie a pluripotent stem cell. Host cells can also be derived from other human tissues. Other suitable host cells are known in the art.

  Vector DNA can be introduced into prokaryotic or eukaryotic cells via conventional transformation, transduction, infection or transfection techniques. As used herein, the terms “transformation”, “transduction”, “infection” and “transfection” are well-known techniques in the art for introducing foreign nucleic acid (eg, DNA) into a host cell. A variety of such as calcium phosphate or calcium chloride coprecipitation, DEAE dextran mediated transfection, lipofection or electroporation. Furthermore, transfection can be mediated by a transfection agent. By “transfection agent” is meant any compound that mediates uptake of DNA into a host cell, such as those comprising liposomes. Suitable methods for transforming or transfecting host cells can be found in Sambrook et al. (Molecular Cloning: A Laboratory Manual. 2nd ed., Cold Spring Harbor Laboratory, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, et al., 1989) and in the Manual of Lab., 1989).

  Transfection may be “stable” (ie, the integration of foreign DNA into the host cell genome) or “transient” (ie, the DNA is episomally expressed in the host cell).

  For stable transfection of mammalian cells, depending on the expression vector and transfection method used, only a small fraction of the cell is found to incorporate foreign DNA into its genome and the remainder of the DNA is episomal. ing. In order to identify and select these integrants, a gene that encodes a selectable marker (eg, resistance to antibiotics) is generally introduced into the host cells along with the gene of interest. Various selectable markers include those that confer resistance to drugs such as G418, hygromycin and methotrexate. Nucleic acid encoding a selectable marker can be introduced into a host cell on a vector similar to the vector encoding PDX or on a separate vector. Cells stably transfected with the introduced nucleic acid can be distinguished by drug selectivity (eg, cells incorporating a selectable marker survive and other cells die). In another embodiment, cells modulated or transfected with PDX are identified by induction of expression of an endogenous reporter gene. In certain embodiments, the promoter is an insulin promoter that drives expression of green fluorescent protein (GFP).

  In one embodiment, the PDX nucleic acid is present in a viral vector. In another embodiment, the PDX nucleic acid is encapsulated within the virus. In some embodiments, the virus preferably infects pluripotent cells of various tissue types, such as hematopoietic stem cells, neuronal stem cells, hepatic stem cells or embryonic stem cells, preferably the virus is hepatic tropic. “Liver tropism” means that the virus has the ability to specifically or non-specifically target liver cells. In yet another embodiment, the virus is a modulated hepatitis virus, SV-40 or Epstein-Barr virus. In yet another embodiment, the virus is an adenovirus.

(Gene therapy)
In one aspect of the invention, the nucleic acid encoding the nucleic acid or functional derivative thereof is administered by gene therapy. Gene therapy is a treatment performed by administering a specific nucleic acid to a subject. In this aspect of the invention, the nucleic acid produces its encoded peptide, which then exerts a therapeutic effect by modulating the function of the diseases or disorders described above, eg, diabetes. Any method involving gene therapy that can be used in the art may be used in the practice of the present invention. See, for example, Goldspiel et al. 1993, Clin Pharm 12: 488-505.

  In a preferred embodiment, the treatment comprises a nucleic acid that is part of an expression vector that expresses any one or more of the above-mentioned PDX polypeptides or fragments, derivatives or analogs thereof in a suitable host. In certain embodiments, such nucleic acids carry a promoter operably linked to the coding region of the PDX polypeptide. Promoters can be inducible or constitutive and are optionally tissue specific. The promoter may be of viral or mammalian origin, for example. In another specific embodiment, the coding sequence (and any other desired sequence) is flanked by regions that induce homologous recombination at the desired site in the genome, thereby chromosomal expression of the nucleic acid. Use nucleic acid molecules that result in See, for example, Koller and Smithies, 1989, Proc Natl Acad Sci USA 86: 8932-8935. In yet another embodiment, the delivered nucleic acid remains episomal and induces an endogenous, otherwise silent gene.

  Delivery of therapeutic nucleic acid to the patient is either direct (ie, exposing the patient directly to the nucleic acid or nucleic acid-containing vector) or indirectly (ie, the cell is first contacted with the nucleic acid in vitro and then transplanted into the patient). It may be. These two methods are known as in vivo or ex vivo gene therapy, respectively. In certain embodiments of the invention, the nucleic acid is administered directly in vivo where it is expressed to produce the encoded product. This can be done in any of a number of ways known in the art, such as constructing the nucleic acid as part of a suitable nucleic acid expression vector and administering it in a manner that makes it intracellular (eg, a defective or attenuated form). By infection with retrovirus or other viral vectors; see US Pat. No. 4,980,286; direct injection of naked DNA; using microparticle bombardment (eg Gene Gun®; Biolistic, DuPont) Coating the nucleic acid with lipids; using relevant cell surface receptors / transfection agents; encapsulating in liposomes, microparticles or microcapsules; administering linked to peptides known to enter the nucleus Or “target” a cell type that specifically expresses the receptor of interest. Ligated to easily ligand cause receptor-mediated endocytosis can use to be administered (e.g., Wu and Wu, 1987, J.Biol.Chem.262: 4429-4432 reference) is achieved by like.

  In another method of gene therapy in the practice of the present invention, genes are transferred to cells in in vitro tissue culture by methods such as electroporation, lipofection, calcium phosphate mediated transfection, viral infection and the like. In general, the method of transfer involves the simultaneous transfer of selectable markers to cells. The cells are then subjected to selection pressure (eg, antibiotic resistance) to facilitate isolation of cells that have taken up and are expressing the transferred gene. These cells are then delivered to the patient. In certain embodiments, prior to in vivo administration of the resulting recombinant cells, the nucleic acid is transferred to a method known in the art, such as transfection with a virus or bacteriophage vector containing the nucleic acid sequence of interest, electro Cells by poration, microinjection, infection, cell fusion, chromosome-mediated gene transfer, microcell-mediated gene transfer, spheroplast fusion, and similar methods in which the necessary developmental physiology of the recipient cell is not impaired by the transfer Nucleic acid is introduced into the inside. See, for example, Loeffler and Behr, 1993, Meth Enzymol 217: 599-618. The technique selected should result in a stable transfer of the nucleic acid into the cell such that the nucleic acid can be expressed by the cell. Preferably, the transfer nucleic acid is inheritable and can be expressed in the progeny of the cell. In another embodiment, the transferred nucleic acid remains episomal and induces endogenous nucleic acid expression that is otherwise silent.

  In a preferred embodiment of the present invention, the resulting recombinant cells are subjected to various methods known in the art, such as injection of epithelial cells (eg subcutaneously), application of recombinant skin cells as a skin graft to a patient, and Delivered to the patient by intravenous injection of recombinant blood cells (eg, hematopoietic stem or progenitor cells) or hepatocytes. The total amount of cells to be used will vary depending on the desired effect, patient condition, etc., and may be determined by one skilled in the art.

  Cells into which the nucleic acid can be introduced for gene therapy purposes include any desired available cell type and may be exogenous, xenogeneic, allogeneic or autologous. The cell type can be, for example, differentiated cells such as epithelial cells, endothelial cells, keratinocytes, fibroblasts, myocytes, hepatocytes and blood cells, or various stem cells or progenitor cells, especially embryonic cardiomyocytes, hepatic stem cells (international patent applications) WO94 / 08598), neural stem cells (Steple and Anderson, 1992, Cell 71: 973-985), hematopoietic stem cells or progenitor cells such as those obtained from bone marrow, umbilical cord blood, peripheral blood, fetal liver and the like. In a preferred embodiment, the cells used for gene therapy are the patient's own.

DNA for gene therapy can be administered to patients parenterally, for example intravenously, subcutaneously, intramuscularly and intraperitoneally. The DNA or inducer is administered in a pharmaceutically acceptable carrier, i.e. a biocompatible vehicle suitable for administration to animals, such as saline. A therapeutically effective amount is an amount that can result in a medically desirable result in the treated animal, such as an increase or decrease in PDX or gene product. Such amount can be determined by one skilled in the art. As is known in the medical field, the dose for any given patient will depend on many factors such as the patient's size, body surface area, age, the particular compound being administered, sex, time and route of administration, general condition and simultaneously. It varies depending on other drugs to be administered. Although the dose varies, the preferred dose for intravenous administration of DNA is about 10 ⁶ to 10 ²² copies of the DNA molecule. For example, DNA is administered at about 2 × 10 ¹² virions per kg.

(Pharmaceutical composition)
Compounds of the invention, eg, PDX polypeptides, nucleic acids encoding PDX polypeptides, nucleic acids that increase the expression of nucleic acids encoding PDX polypeptides (also referred to herein as “active compounds”) and derivatives, fragments thereof, Analogs and homologues can be formulated into pharmaceutical compositions suitable for administration. Such compositions typically comprise a nucleic acid molecule, or protein, and a pharmaceutically acceptable carrier. As used herein, “pharmaceutically acceptable carrier” refers to any and all of solvents, dispersion media, coatings, antibacterial and antifungal agents, isotonicity and absorption delaying agents, and the like that are compatible with pharmaceutical administration. Is included. Suitable carriers are described in the latest edition of Remington's Pharmaceutical Sciences, a standard reference book in this field, incorporated herein by reference. Preferred examples of such carriers or diluents include water, saline, finger solution, dextrose solution, and 5% human serum albumin. Liposomes and non-aqueous vehicles such as fixed oils may also be used. The use of such media and reagents for pharmaceutically active substances is well known in the art. As long as any conventional medium or reagent is not incompatible with the active compound, its use in the composition is contemplated. Supplementary active compounds can also be incorporated into the compositions.

  A pharmaceutical composition of the invention is formulated to be compatible with its intended route of administration. Examples of routes of administration include parenteral, eg intravenous, intradermal, subcutaneous, oral (eg inhalation), transdermal (topical), transmucosal and rectal administration. Solutions or suspensions used for parenteral, transdermal or subcutaneous applications may contain the following ingredients: sterile diluents such as water for injection, saline, fixed oil, polyethylene glycol, glycerin, propylene glycol or others Synthetic solvents, antibacterial agents such as benzyl alcohol or methyl paraben, antioxidants such as ascorbic acid or sodium bisulfite, chelating agents such as ethylenediaminetetraacetic acid, buffers such as acetate, citrate or phosphate, And agents for regulating osmotic pressure, such as sodium chloride or dextrose. The pH can be adjusted with acids or bases, such as hydrochloric acid or sodium hydroxide. The parenteral preparation can be enclosed in ampoules, disposable syringes or multiple dose vials made of glass or plastic.

  Pharmaceutical compositions suitable for injection include sterile aqueous solutions (where water soluble) or dispersions and sterile powders for the extemporaneous preparation of sterile injectable solutions or dispersion. For intravenous administration, suitable carriers include physiological saline, sterile water, Cremophor EL® (BASF, Parsippany, NJ) or phosphate buffered saline (PBS). In all cases, the composition must be sterile and must be fluid to the extent that easy syringability exists. It must be stable under the conditions of manufacture and storage and must be preserved against contamination by microorganisms such as bacteria and mold. The carrier can be a solvent or dispersion medium containing, for example, water, ethanol, polyol (for example, glycerol, propylene glycol, and liquid polyethylene glycol, and the like), and suitable mixtures thereof. The proper fluidity can be maintained, for example, by the use of a coating such as lecithin, by the maintenance of the desired particle size in the case of dispersion and by the use of surfactants. Prevention of the action of microorganisms can be achieved by various antibacterial and antifungal agents, for example, parabens, chlorobutanol, phenol, ascorbic acid, thimerosal, and the like. In many cases, it will be preferable to include isotonic agents, for example, sugars, polyalcohols such as mannitol, sorbitol, sodium chloride in the composition. Long-lasting absorption of injectable compositions can be achieved by including in the composition an agent that delays absorption, for example, aluminum monostearate and gelatin.

  Sterile injectable solutions can be prepared by formulating the required amount of the active compound (eg, PDX polypeptide or PDX-encoding nucleic acid) in an appropriate solvent with one or a combination of the above ingredients, if desired, followed by filter sterilization. . Generally, dispersions are prepared by incorporating the active compound into a sterile vehicle that contains a dispersion medium as a base and the required other ingredients from those enumerated above. In the case of sterile powders for the preparation of sterile injectable solutions, the method of preparation is vacuum or lyophilized to give a powder of the active ingredient and another desired ingredient obtained from a pre-sterilized filtered solution.

  Oral compositions generally contain an inert diluent or an edible carrier. They can be enclosed in gelatin capsules or compressed into tablets. For the purpose of oral therapeutic treatment, the active compound is incorporated with excipients and used in the form of tablets, troches, or capsules. Oral compositions can also be prepared using a liquid carrier for use as a mouthwash to apply the compound in a liquid carrier to the oral cavity, to wrinkle, expel or swallow. Pharmaceutically compatible binding agents, and / or adjuvant materials can be included as part of the composition. Tablets, pills, capsules, troches, etc. are any of the following ingredients or compounds of similar properties, ie binders such as microcrystalline cellulose, tragacanth gum or gelatin; excipients such as starch or lactose, disintegrants such as alginic acid , Primogel or corn starch; lubricants such as magnesium stearate or Sterote; lubricants such as colloidally silicon oxide; sweeteners such as sucrose or saccharin; or flavoring agents such as peppermint, methyl salicylate or orange flavor.

  For administration by inhalation, the compounds are delivered in the form of an aerosol spray from pressured container or dispenser with a suitable high pressure gas, such as carbon dioxide, or a nebulizer.

  Systemic administration can also be accomplished by transmucosal or transdermal means. For transmucosal or transdermal administration, penetrants appropriate to the barrier to be permeated are used in the formulation. Such penetrants are known in the art and include, for example, for transmucosal administration, detergents, bile salts and fusidic acid derivatives. Transmucosal administration can be accomplished through the use of nasal sprays or suppositories. For transdermal administration, the active compounds are formulated into ointments, salves, gels, or creams as generally known in the art.

  The compounds can also be prepared in the form of suppositories (eg, using conventional suppository bases such as cocoa butter or other glycerides) or retention enemas for rectal administration.

  In one embodiment, the active compounds are prepared with carriers that will protect the compound against rapid elimination from the body, including, for example, controlled release formulations such as implants and microcapsule delivery systems. Biodegradable, biocompatible polymers can be used, such as ethylene vinyl acetate, polyanhydrides, polyglycolic acid, collagen, polyorthoesters, and polylactic acid. Those skilled in the art know how to prepare such formulations. Materials are also available from Alza Corporation and Nova Pharmaceuticals, Inc. More can be purchased. Liposomal suspensions (including liposomes targeted to infected cells using monoclonal antibodies against viral antigens) can also be used as pharmaceutically acceptable carriers. These can be prepared according to methods known in the art, for example, as described in US Pat. No. 4,522,811, incorporated herein by reference in its entirety.

  It is especially advantageous to formulate oral or parenteral compositions in dosage unit form for ease of administration and uniformity of dosage. As used herein, a unit dosage form refers to a physically discrete unit suitable for a unified dosage for a subject to be treated, each unit together with a desired pharmaceutically acceptable carrier to obtain a desired therapeutic effect. Contains a predetermined amount of calculated active compound. The details of the unit dosage form of the present invention are determined by and depend directly on the unique nature of the active compound and the particular therapeutic effect to be achieved.

  The nucleic acid molecules of the invention can be inserted into vectors and used as gene therapy vectors. Gene therapy vectors can be delivered to a subject by any of the many routes described, for example, in US Pat. No. 5,703,055. Thus delivery can also include, for example, intravenous injection, topical administration (see US Pat. No. 5,328,470) or stereotaxic injection (see, eg, Chen et al., (1994) PNAS 91: 3054-3057). The gene therapy vector pharmaceutical preparation may contain the gene therapy vector in a suitable diluent or may include a slow release matrix embedded with the gene delivery vehicle. Alternatively, where a complete gene delivery vector, such as a retroviral vector, can be produced intact from recombinant cells, the pharmaceutical formulation can include one or more cells that provide a gene delivery system.

  The pharmaceutical composition can be placed in a container, pack or dispenser together with instructions for administration.

  The invention will be further described in the following examples, which do not limit the invention described in the claims.

(Example 1: General method)
The experiments described herein were performed using the following general method.

(Recombinant adenovirus)
AdCMVPDX-1 is R.I. Seijffers et al. , Endocrinology 140: 1133 (1999). This includes the rat homologue of PDX-1 ligated to the BamH1 site of the STF-1 cDNA, pACCMVpLpA vector.

  AdCMV β-gal contains the nuclear localization signal of β-galactosidase.

  AdCMV-hIns contains human insulin cDNA under the control of a heterologous cytomegalovirus promoter.

  AdRIP-1-hIns contains human insulin cDNA under the control of rat insulin promoter-1 (RIP-1). RIP-1 is 410 bases in the 5 'flanking DNA region of the rat insulin-1 gene.

All first generation recombinant adenoviruses were constructed according to Becker et al, ³⁹ . The gene of interest is pACCMV. Ligation into the pLpA plasmid followed by co-transfection with the adenovirus plasmid pJM17 followed by recovery of the recombinant virions from HEK-293 cells. Ad-CMV-PDX-1 has a rat homologue of PDX-1, Ad-CMV-hIns has human insulin cDNA distal from the CMV promoter ⁴⁰ . Ad-RIP-GFP-CMV-PDX-1 is a pACCMV. 410 nucleotides of the 5′-flanking region of the rat insulin-1 gene (provided by Dr. Larry Moss) instead of the viral CMV promoter (HindIII / PstI) in the pLpA plasmid, followed by pACCMV-PDX-1. A bifunctional recombinant adenovirus prepared by insertion of a NotI / NotI insert containing CMV-mPDX-1 (a mouse homolog of PDX-1) from the pLpA plasmid ⁴⁰ . The specific function of the recombinant virus was analyzed in an insulinoma cell line compared to a non-β cell line. Preparation of virus stocks was performed as previously reported ⁴⁰ .

(Cell culture)
Mouse pancreatic derived cell lines β-TC-1, α-TC-1 and rat pancreatic cell line RIN 1046-38 were cultured according to previously reported conditions (21, 22).

(Animals and recombinant adenoviruses)
Mice were housed in an air-conditioned environment with a 12-hour light on / off cycle and handled according to regulations on the welfare of research animals. Balb / c mice (8-9 weeks old, 24-27 gr) were administered predetermined recombinant adenovirus 1-5 × ^{10 10} moi by systemic administration into the tail vein (volume of physiological saline 200-300 μl). Blood was collected from the tail and the glucose concentration was measured (Accutrend® GC, Boehringer Mannheim, Mannheim, Germany). Livers were collected for immunohistochemical staining (4% formaldehyde fixation, paraffin embedding), gene expression analysis (total RNA), and measurement of pancreatic hormone content in the liver. For the latter two analyses, liver specimens were immediately frozen in liquid nitrogen and stored at -70 ° C.

  Male NOD / LtJ and NOD / Scid mice were bred under pathogen-free conditions in the Animal Breeding Center at Weizmann Institute of Science. The experiment was conducted under the direction and guidance of the Animal Welfare Committee. The mice were 1 month old at the start of the experiment.

(Human hepatocytes)
Mature human liver tissue was obtained from 8 different liver transplant operations from 2-10 year old children and 2 patients over 40 years old.

  Fetal human liver was obtained from 4 different abortions at 20-22 weeks of gestation. Both mature and fetal liver tissue were used with the permission of the Committee on Clinical Investigations (Institutional Review Board).

(Cell collection and culture conditions)
Isolation of human hepatocytes was performed as previously reported ⁴¹ . In summary, liver samples were perfused with cold Hanks Balanced Salt solution (HBSS), cut into slices (thickness 1-2 mm) and digested with 0.03% collagenase type I (Worthington Biochemical Corp.) for 20 minutes at 37 ° C. . Dissociated cells were collected, washed twice with HBSS + EGTA (5 mM), and collected by centrifugation at 500 × g for 5 minutes at 4 ° C. The cells were resuspended in Dulbecco's minimal essential medium (1 gr / L glucose) supplemented with 10% FCS, 100 U / ml penicillin, 100 μg / ml streptomycin and 250 ng / ml amphotericin B (Biological Industries, Israel). Cell viability and number were measured and cells were plated at 1-2 × 10 ⁵ cells / ml on fibronectin (3 μg / cm ² , Biological Industries, Israel) pre-coated plates. Non-adherent cells were removed by changing the medium daily for the first 3 days. Confluent cultures were split 1: 3 using 0.05% trypsin-EDTA solution. Cells were maintained at 37 ° C. in a humidified atmosphere of 5% CO ₂ and 95% air.

(Virus infection and administration of growth factors)
Hepatocytes were cultured individually in Dulbecco's minimal essential medium (1 gr / L glucose) in the presence or absence of growth factors (EGF 20 ng / ml, Cytolab Ltd .; nicotinamide 10 mM, Sigma) as indicated individually and recombined for 5 days. Infected with adenovirus (500 moi). Recombinant adenovirus used in this study was Ad-RIP-GFP-CMV- PDX-1, Ad-CMV-PDX-1, Ad-CMV-hIns 40, Ad-CMV-GFP (Clontech, BD Biosciences).

(RNA isolation and RT-PCR analysis)
Total RNA was isolated from frozen tissue using Tri-Reagent (Molecular Research Center, Ohio). RNA samples were treated with 10 units of RQ1 RNase-free DNase I (Promega) for 60 minutes. cDNA was prepared by reverse transcription (native AMV reverse transcriptase, Chimerx) using 4 μg of DNA-free total RNA and 0.5 μg oligo (dT) ₁₅ . PCR was performed using a T3 thermocycler (Biometra, Gottingen, Germany) and the products were separated on a 1.8% agarose gel and visualized with ethidium bromide. The primer sequences and reaction conditions used for PCR are as shown in Tables 1 and 3. Note that two sets of specific oligonucleotide primers were designed for discrimination between endogenous mouse PDX-1 expression and ectopic rat homologues (see Tables 1 and 3).

(Real-time PCR)
RT-PCR was performed on a LightCycler (Roche Applied Science, Mannheim, Germany) using SYBR-Green I dye.

  The amplification conditions used were initial denaturation at 95 ° C. for 10 minutes, then 55 cycles for both mouse and rat PDX-1, or 30 cycles for β-actin. For both PDX-1 homologues, the content of each cycle was denaturation 95 ° C. for 15 seconds, annealing 59 ° C., and extension 72 ° C. for 15 seconds. Annealing of β-actin was performed at 56 ° C. for 10 minutes. The fluorescence signal was monitored for 5 seconds after each cycle at 90 ° C. for β-actin, 87 ° C. for mouse PDX-1 and 88 ° C. for rat PDX-1. The melting curve program was carried out at 68 ° C. for 40 seconds, and the specificity of the generated product was analyzed.

  Mouse PDX-1 RT-PCR was performed 3 times and rat PDX-1 was performed twice.

  Both rat and mouse PDX-1 concentrations were normalized to their respective β-actin mRNA concentrations in the same sample.

  Alternatively, quantitative real-time RT-PCR was performed using the ABI Prism 7000 sequence detection system (Applied Biosystems).

  The TaqMan® fluorogenic probe, Assay-On-Demand (Applied Biosystems) used in this study was human β-actin Hs9999993_ml, human insulin Hs00355773_ml, human glucagon Hs00174967_ml, human somatostatin Hs00356144_ml0017, human lux14144 ml -2Hs00165775_ml, human glucokinase Hs00175951_ml, human PC2Hs00159922_ml, human SCG2Hs00185761_ml, human SGNE1Hs00161638_ml.

  The amplification conditions were 50 ° C. for 2 minutes at the start, denaturation at 95 ° C. for 10 minutes, then denaturation at 95 ° C. for 15 minutes and annealing at 60 ° C. for 1 minute for 40 cycles, and TaqMan PCR Master Mix (Applied Biosystems) was used. Relative quantitative analysis was performed according to ABI Prism 7000 SDS software using the 2 ^ (-ΔCt) equation. The mRNA concentration was corrected for human β-actin mRNA.

(Pancreatic hormone immunohistochemistry)
Slides of 4 μm paraffin-embedded sections were deparaffinized, incubated in 3% H ₂ O ₂ , and blocked using a commercially available Histomouse®-SP kit (Zymed laboratories, South San Francisco, Calif.). Incubation in both insulin and glucagon detection). The sections were then incubated for 1 hour at 37 ° C. with a 1: 200 dilution of human insulin and a monoclonal antibody to human glucagon (Sigma). Slides were exposed to secondary biotinylated IgG for 30 minutes at room temperature and then incubated in streptavidin-peroxidase followed by chromogenic peroxide solution. The possible background of the system was eliminated by providing a control group using only the secondary antibody and no streptavidin-peroxidase and chromogenic peroxide solution, without using the primary antibody.

(Radioimmunoassay for pancreatic hormones (RIA))
Pancreas and liver were isolated and immediately frozen in liquid nitrogen and stored at -70 ° C. Frozen tissues were homogenized in 0.18N HCl / 35% ethanol. The homogenate was extracted overnight at 4 ° C. with stirring, and the supernatant was lyophilized. Samples were dissolved in 0.8 ml RIA assay buffer (Sigma) with protease inhibitor cocktail. Hepatic insulin and glucagon concentrations were measured using rat radioimmunoassay (RIA, catalog numbers SRI-13K and GL-32K, Linco, Missouri, USA and Coat-A-Count, DPC; CA, USA). Somatostatin concentration was measured by RIA (Euro-diagnostica, Sweden). The liver content of pancreatic hormone was normalized to the weight of the extracted tissue.

(Measurement of liver function)
Serum biochemical values consisting of albumin, AST (aspartate aminotransferase), ALT (alanine aminotransferase) and total bilirubin in serum samples were measured using Olympus AU2700 Apparatus (Olympus, Germany).

(Insulin and C-peptide detection)
Insulin and C-peptide secretion and content in primary mature hepatocytes was measured by static incubation for 48 hours 3 days after the initial virus and growth factor administration. Insulin secretion into the medium was measured with RIA using the Ultra Sensitive Human Insulin RIA kit (Linco Research), and C-peptide secretion was measured with the Human C-Peptide RIA kit (Linco Research).

  Insulin content was determined after homogenizing the cell pellet in 0.18N HCl, 35% ethanol. The homogenate was extracted overnight at 4 ° C. with stirring, and the supernatant was lyophilized. Samples were dissolved in 0.5 ml PBS containing 0.2% BSA and protease inhibitor cocktail (Sigma). 100 μl of sample was used for RIA. Insulin content was normalized to total cellular protein measured with the Bio-Rad protein test kit.

(Glucose tolerance test)
Adult liver cells were administered Ad-CMV-PDX-1 and growth factors for 5 days. Cells were plated in 6-well plates at a density of 10 ⁵ cells / well.

  For time-lapse analysis, cells were preincubated in Krebs-Ringer buffer (KRB) containing 0.1% BSA for 2 hours, and then incubated for a predetermined time in medium containing 2 mM or 25 mM glucose. At each time point, the medium samples were analyzed for insulin (Ultra Sensitive Human Insulin RIA Kit-Linco Research) and C-peptide (Human C-Peptide RIA Kit).

  Glucose dose response; cells were preincubated with KRB containing 0.1% BSA for 2 hours, washed, and then loaded with increasing concentrations of D-glucose or 2-deoxyglucose (0-25 mM) for 2 hours. At the end of the incubation in 25 mM glucose, the cells were washed with KRB and incubated for a further 2 hours in medium containing 2 mM glucose.

(Electron microscope observation)
Hepatocytes were fixed in 2.5% glutaraldehyde, stained with osmate, dehydrated with a series of grades of ethanol and propylene oxide, and embedded in Araladite solution (Polyscience Inc.). Ultrathin sections were cut with an ultramicrotome and stained with 2% uranyl acetate and Reynold lead citrate solution. A 50-90 nm liver section was placed on a nickel grid for post-embedding immunogold reaction. The grid is incubated overnight at room temperature with an antibody against insulin (guinea pig polyclonal; 7.8 μg / ml, Dako), then immunogold-conjugated antibody against guinea pig IgG for 1.5 hours at room temperature (15 nm gold; 1:40 dilution, Dako) Incubated with. Sections were observed under an electron microscope (Jeol 1200EX2).

(Cell transplantation)
Hyperglycemia was achieved by intraperitoneal injection of streptozotocin at 180 mg / kg body weight into 5-week-old non-obese diabetic severely combined immunodeficient (SCID-NOD) male mice (Weizmann Institute, Israel). When the blood glucose concentration reached approximately 300 mg / dl in two consecutive measurements, PDX-1 and growth factors were used for 5 days in 50 μl of Matrigel (Sigma) using a 30 gauge needle under the kidney capsule of mice. 3 × 10 ⁶ human hepatocytes were administered in advance. Blood was collected from the tail twice a week and subjected to glucose concentration measurement (Accutrend® GC, Roche Applied Science). According to the manufacturer's instructions, an ultrasensitive human C-peptide ELISA kit (Mercodia) with 0% cross-reactivity to mouse C-peptide and a mouse insulin ELISA kit (Mercodia) with 0% cross-reactivity to human insulin By using, serum in the blood of fed mice was collected for analysis of C-peptide and insulin concentrations. Kidneys and pancreas were collected for immunohistochemical analysis.

(Histological examination and staining)
Kidneys and pancreas were fixed in 4% formaldehyde and embedded in paraffin. Paraffin embedded tissue 5 m thick sections are deparaffinized and incubated in 3% H ₂ O ₂ and then microwaved in citrate buffer for antigen retrieval prior to incubation in blocking solution. (PDX-1 detection) or immediately exposed to blocking solution using Histomouse-SP kit (Zymed laboratories) (insulin detection). For detection of PDX-1, sections were incubated overnight at 4 ° C. with antisera constructed against the N-terminal portion of the frog PDX-1 (1: 5000, obtained from CVE Wright). . For detection of insulin, sections were incubated with a monoclonal antibody against human insulin (1: 100, Sigma) for 1 hour at 37 ° C. Slides were exposed to secondary biotinylated IgG for 30 minutes and then incubated in streptavidin-peroxidase followed by chromogenic peroxide solution.

(Cyclophosphamide accelerated diabetes (CAD))
As described above, the onset of diabetes was accelerated by (3) cyclophosphamide (Sigma, Rehovot, Israel). Male NOD mice were injected intraperitoneally with 200 mg / kg of cyclophosphamide at the age of 4 weeks. If the mouse did not become diabetic within 2 weeks, a second intraperitoneal injection of Cy (200 mg / kg) was performed and the process was repeated again after 1 week. The diabetic mice were removed from the SPF, bred in an air-conditioned environment under a 12-hour lighting / extinction cycle, and after acclimatization for 72 hours, blood glucose levels were newly measured to confirm diabetes.

(Hyperglycemia)
Blood glucose was measured twice a week using Accutrend® GC, Glucose Analyzed (Boehringer Mannheim, Mannheim, Germany). A mouse was considered diabetic if the blood glucose concentration was higher than 300 mg / dl in two consecutive measurements.

(Virus infection)
Predetermined recombinant adenovirus 1.5 × ^{10 10} pfu was administered to 8-10 week old diabetic NOD mice (body weight 20-22 gr) by systemic administration into the tail vein. Virus was administered in a volume of 200-300 μl in PBS.

(Examination of pancreatic tissue)
Pancreas and liver were fixed in 4% formaldehyde, embedded in paraffin, excised and stained with standard hematoxylin and eosin. Immunohistochemically stained 4 μm paraffin-embedded slides were deparaffinized and blocked using Histomouse®-SP kit (Zymed laboratories, South San Francisco, Calif.) As described in (21). analyzed. Sections were incubated with a 1/100 dilution of a monoclonal antibody against human insulin (Sigma, Rehovot, Israel). The slides were developed with an anti-mouse IgG biotinylated antibody combined with streptavidin-peroxidase and then with a chromogenic peroxide solution. Control slides were developed in parallel according to the same protocol except that no insulin specific antibody was added.

Example 2: Measurement of PDX-1-induced endogenous insulin gene expression and activation of an ectopically co-delivered insulin promoter
To examine the effects of ectopic PDX-1 expression in the liver, Ad-CMV-PDX-1 recombinant adenovirus 2 × 10 ⁹ plaque forming units were placed in the tail vein of male Balb / c and C57BL / 6 mice (11-14 weeks old) (0.2 ml saline) was injected. As controls, mice were similarly injected with AdCMV-β-gal or AdCMV-hIns and AdRIP-I-hIns recombinant adenovirus. Animals were housed in a non-restricted diet in an air-conditioned environment with a 12 hour light / light cycle and sacrificed one week after virus administration. Liver, spleen, pancreas and kidney were removed, quickly frozen in liquid nitrogen, stored at -70 ° C and subjected to total RNA isolation.

PDX-1 and insulin gene expression was measured by RT-PCR. Total RNA was isolated from frozen tissue using RNAzol (CINNA-BIOTEX). RNA samples were treated with 10 ul DNase I (Promega). cDNA was prepared by reverse transcription using 1 μg DNA-free total RNA and 0.5 μg oligo (dT) ₁₅ . 1.5 μl of the RT reaction solution was amplified using the primers and PCR conditions shown in Table 1 below. PCR was performed on a GeneAmp PCR system 2400 (Perkin Elmer) and the products were separated on a 1.7% agarose gel. A separate PCR reaction was performed on each RNA sample without using reverse transcriptase to confirm that the amplified product was not due to DNA contamination. Primers were designed to detect only ectopic rat PDX-1 expression, not mouse homologues. Primers for mI-2 amplification are located on different exons. The first step of sample denaturation was the same for all amplified genes and was 94 ° C. for 1 minute.

  The analysis of total RNA shows that PDCM-1 expression occurred mainly in the liver by administration of AdCMV-PDX-1. Spleen, pancreas and kidneys from the same mouse were negative for rat homologues of PDX-1 by RT-PCR.

  75% (25/35) of mice positive for ectopic rat PDX-1 message expressed mI-2 gene, whereas 35% of mice expressed mI-1 gene ( FIG. 1). Whether such expression differences between mI-2 and mI-1 are due to the mI-1 promoter being affected differently by the nature or amount of transcription factors present in PDX-1 expressing hepatocytes. For clarity, mice were co-delivered with AdRIP-I-hIns recombinant adenovirus with AdCMV-PDX-1 as described above. As shown in FIG. 1, in the liver where PDX-1 induced only endogenous mI-2 expression, it also activated the rat insulin-1 promoter (RIP-1). This suggests that different levels of DNA methylation or individual chromatin structures may be responsible for the low efficiency of activation of endogenous mI-1 expression by PDX-1 expression in the liver. Furthermore, these data indicate the ability to activate the β-cell specific insulin promoter in the liver when co-delivered with PDX.

  Expression of endogenous mouse insulin and ectopic human insulin genes was not induced by administration of the same concentration of control recombinant adenovirus AdCMV-β-gal or AdCMV-hIns and AdRIP-hIns, respectively (n = 20). These results indicate that PDX-1 is essential and sufficient for inducing the expression of the endogenous insulin gene and for activation of RIP-1 in tissues outside the pancreas.

Example 3: Measurement of PDX-1-induced somatostatin gene expression and in vivo protein production
Recombinant adenovirus was administered to animals as described in Example 2. The gene expression of somatostatin was measured by RT-PCR as described in Example 2 according to the conditions shown in Table 1.

  As shown in FIG. 3, the liver of the mouse administered with AdCMV-PDX-1 showed gene expression of somatostatin. Mice administered with AdCMV-PDX-1 stained positive for somatostatin protein in the liver tissue subjected to immunochemical analysis. Mice administered AdCMV-β-gal did not express somatostatin.

(Example 4: Measurement of PDX-1 induced glucagon gene expression)
The AdCMVPDX-1 recombinant adenovirus was administered to the animals as described in Example 2. Glucagon gene expression was measured by RT-PCR as described in Example 2 using the conditions and primers shown in Table 1.

  As shown in FIG. 3, the livers of mice administered with AdCMV-PDX-1 expressed the glucagon gene. Mice administered with AdCMV-β-gal did not express glucagon.

(Example 5: Measurement of prohormone converting enzyme 1/3 induction gene expression)
Recombinant adenovirus was administered to animals as described in Example 2. Prohormone converting enzyme 1/3 (PC1 / 3) gene expression is described in Example 2 except that cDNA was reverse transcribed using a gene specific oligonucleotide (TCCAGGTGCCTACAGGATTCTCT) (SEQ ID NO: 1) instead of oligo (dT) ₁₅ As measured by RT-PCR. As shown in FIG. 3, only liver derived from animals administered PDX-1 induces the expression of PC1 / 3, a member of the Kexin family protease, which is expressed in endocrine and regulated secretion pathways. Limited to neuroendocrine cells. Combined with the ability to store hormones produced in intracellular compartments, PDX-1-dependent induction of endocrine phenotypes including induction of regulated pathways involved in hormone production, processing, storage and secretion is suggested Is done.

(Example 6: PDX-1-induced proinsulin synthesis in the liver)
Recombinant adenovirus was administered to animals as described in Example 2. The liver, spleen, pancreas and kidney were removed. A portion of the tissue was fixed in 4% formaldehyde, embedded in paraffin, and subjected to immunohistochemical staining. The remaining liver and pancreatic tissues were homogenized in 70% ethanol-0.18N hydrochloric acid, lyophilized, resuspended in PBS (phosphate buffered saline) and subjected to RIA measurement of IRI content.

(Immunohistochemical study)
A 5 μm section of paraffin-embedded tissue is deparaffinized and incubated in 3% H ₂ O ₂ and then microwaved in citrate buffer for antigen retrieval prior to incubation in blocking solution ( PDX-1 detection) or immediately exposed to blocking solution (insulin detection) (Histomouse-SP kit, Zymed laboratories, CA, USA).

  Detection of PDX-1: Sections were incubated overnight at 4 ° C. with antisera constructed against the N-terminal portion of the frog PDX-1.

  Insulin detection: Sections were incubated with monoclonal anti-human insulin (Sigma, St-Louis MO) for 1 hour at 37 ° C.

  Slides were exposed to secondary biotinylated IgG for 30 minutes and incubated in streptavidin-peroxidase followed by chromogenic peroxide solution.

  According to immunohistochemical analysis of liver sections of mice administered with PDX-1, there is homeoprotein expression in 30-60% of hepatocyte nuclei, and 0.1-1% of hepatocytes are positive for (pro) insulin. Was found to be stained. Control AdCMV β-gal treated livers did not stain positively for (pro) insulin, but β-galactosidase activity was evident in 50% of the nuclei. The liver of mice administered with AdCMV-hIns did not stain positively for insulin in liver sections, but the serum IRI of the same mice was three times higher, similar to the serum IRI concentration in PDX-1-treated mice. The fact that the ectopic expression of PDX-1 but not insulin was immunostained positively for (pro) insulin is the result of a small subpopulation of hepatocytes (hepatocytes) that appears to have shifted to the β-cell phenotype Rather, it suggests the induction of cell modulation that supports insulin storage in secretory vesicles belonging to regulatory pathways, characteristic of endocrine cells).

(Radioimmunoassay)
In order to examine whether liver insulin mRNA is efficiently translated into protein, the immunoreactive insulin (IRI) content in the extract derived from liver tissue was examined by radioimmunoassay (RIA). The liver of PDX-1 treated mice that were positive for insulin gene expression by RT-PCR (FIG. 1) contained about 25 times higher IRI than the liver of animals that received control virus (Table 2). The average IRI concentration in the PDX-1-administered liver-derived extract was 20.7 ± 3.97 μU / mg protein, and in the control liver, the IRI was only 0.78 ± 0.25 μU / mg protein. The background concentration of insulin measured in the control liver sample may indicate insulin bound to its receptor (pancreatic origin), probably present in large quantities in this organ. The IRI detected in the PDX-1 treated liver extract was <0.1% of the concentration detected in the pancreatic extract (Table 2), but the serum IRI concentration in the PDX-1 administered mice was the control Almost three times higher than the group (323 ± 48.4 vs. 118.2 ± 23.7 μU / ml, respectively) (Table 2), insulin is synthesized and most of it is secreted into the bloodstream It shows that. These data indicate that insulin gene expression induced by molecular manipulation was successfully translated into pro / hormone specific liver production.

  Immunoreactive insulin detected in PDX-1 treated liver was less than 1% of the IRI concentration in the pancreatic extract (Table 2). The IRI value measured by radioimmunoassay (RIA) in the liver extract is considered to underestimate the actual insulin production in this organ. The antibodies we used for RIA bind preferentially to processed hormones, crossover with proinsulin presumed to be predominantly present in hepatocytes and in much lower concentrations in the pancreas The reactivity is only 60%.

(Example 7: Concentrations of blood glucose and serum insulin)
Recombinant adenovirus was administered to animals as described in Example 2. Before sacrifice, glucose concentration (Accutren® GC, Boehringer Mannheim, Mannheim, Germany) and insulin concentration by radioimmunoassay (Coat-a-Count, DPC, Los Angeles, CA, USA, rat insulin standard (Linco) Blood was collected from the inferior vena cava for the measurement of the anti-insulin antibody used and the cross-reactivity with human proinsulin being only 60%.

  Mice treated with AdCMV-PDX-1 recombinant adenovirus were not hyperglycemic, but their blood glucose levels were significantly lower than those administered AdCMV-β-gal or AdCMV-Luc [respectively 197 ± 11.2 vs. 228 ± 15.74 mg / dl, (Table 2)]. Plasma immunoreactive insulin levels were significantly higher in PDX-1 treated mice compared to the control group [323 ± 48.4 vs 118.2 ± 23.7 μU / ml, respectively (Table 2)].

  A three-fold increase in serum IRI concentration in PDX-1-treated mice cannot itself explain the 25-fold increase in liver IRI content (Table 2) shown in the PDX-1-treated liver extract. That is, the increase in hepatic pro / insulin content is due to local production.

(Example 8: HPLC analysis of insulin-related peptide)
Recombinant adenovirus was administered to the animals as described in Example 2. The liver and pancreas were removed, homogenized in 70% ethanol-0.18N hydrochloric acid, lyophilized, resuspended in 0.1M hydrochloric acid-0.1% BSA, and subjected to HPLC analysis.

  Insulin-related peptides from liver and pancreatic extracts were resolved by reverse phase HPLC using a Lichrospher 100R-18 column (Merck, Darmstadt, Germany) and Gross et al elution conditions. 1 ml fraction was collected in a test tube containing 0.1 ml of 0.1% BSA in water, dried on a Speed-Vac device, reconstituted in 1 ml of RIA buffer (0.1% BSA in PBS) It was subjected to peptide measurement by RIA. Mouse or human IRI was measured using guinea pig anti-pig insulin antibody (Linco, St Charles, MO) and either rat or human insulin standards, respectively.

  According to HPLC analysis of liver IRI content of mice treated with PDX-1, the conversion to fully processed mI-1 and mI-2 was 59 ± 7% (n = 3). In comparison, the pancreatic extract contained 85 ± 5% (n = 3) mature insulin (FIG. 2). In contrast, ectopic expression of human insulin (AdCMV-hIns) did not result in retention of IRI in hepatocytes, except in one case where the extracted IRI was mostly immature insulin. This is consistent with previous observations in transfected FAO cells in which no accumulation of insulin gene product was observed and most of it was secreted by a constitutive secretion pathway. These data indicate that ectopic PDX-1 expression in the liver induces a cellular mechanism characteristic of endocrine tissues capable of processing the induced prohormone, and only proinsulin is ectopically expressed in the liver The case shows that it is not induced. That is, it shows induction of an expanded β cell phenotype in hepatocytes by ectopic PDX-1 expression.

Example 9: Biological activity of hepatic pro / insulin production
The ability of PDX-1 induced hepatic insulin production to control blood glucose levels in diabetic mice was tested. C57BL / 6 mice were diabetic (> 600 mg / dl) with ketoacidosis 24 hours after intraperitoneal STZ injection at 200 mg / kg. 24-48 hours after STZ injection, mice received AdCMV-PDX-1 or AdCMVβ-gal (control) recombinant adenovirus in saline from the tail vein. As shown in FIG. 4, AdCMV-PDX-1 treated mice showed a gradual decrease in blood glucose levels from about 600 to 200-300 mg / dl starting 2 days after recombinant adenovirus administration. In contrast, in control AdCMVβ-gal treated mice, hyperglycemia persisted, with increased mortality, 12 of the 22 animals tested died, and 1 to 3 days after adenovirus administration. Had severe ketoacidosis. Furthermore, both groups showed weight loss after induction of hyperglycemia and did not recover until before sacrifice. In summary, the data show that PDX-1 expression is sufficient to induce the production of mature biologically active insulin that reduces hyperglycemia in mice with impaired β-cell function. Show.

Example 10 In Vitro Activation of Insulin Promoter by Ectopic PDX-1 Expression
PDX-1 activates the rat insulin-1 promoter when co-delivered with recombinant adenovirus AdRip-1hIns that delivers human insulin expression via the rat insulin-1 promoter (see Example 2 and FIG. 1). PDX-1 has been found to be sufficient to activate rat insulin promoter-1 in rat hepatocytes in vitro. Primary cultures of mature and fetal hepatocytes were cultured on collagen-1 coated tissue culture dishes in chemically defined medium without serum. Two days after plating, cells were administered either AdCMV-PDX-1 & AdRIP-1 hIns or AdCMVβ-gal & AdRIP-1 hIns. 48 hours after adenovirus administration, total RNA was extracted and proinsulin gene expression was examined as described in Example 2.

  PDX-1 activates ectopically expressed RIP-hIns (rat insulin promoter-1, 410 bp of this promoter, human insulin driven, introduced by recombinant adenovirus), β-gal possesses such ability None (Figure 5).

Example 11: In vitro induction of endogenous somatostatin gene expression in hepatocytes
Primary cultures of hepatocytes isolated from fetuses (E14-Fisher-344 rats) were cultured and recombinant adenovirus was administered as described in Example 9. Somatostatin gene expression was detected in reverse transcribed total RNA samples as described in Example 2 using the primers and RT-PCR conditions shown in Table 1.

  The data show that ectopic PDX-1 expression in hepatocytes in vitro induces expression of the somatostatin gene that is endogenous in hepatocytes and otherwise silent (FIG. 6). .

Example 12: In vitro induction of endogenous insulin gene expression in hepatocytes
Primary cultures of fetuses (E14-Fisher-344 rats) were cultured as described in Example 10, and recombinant adenovirus was administered. Rat insulin 1 gene expression was detected in reverse transcribed total RNA samples as described in Example 2 using the primers and RT-PCR conditions shown in Table 1.

  The data show that ectopic PDX-1 expression in primary cultures of fetal hepatocytes in vitro induces endogenous, otherwise silent gene expression of insulin (FIG. 6).

Example 13: Induction of hepatocyte ectopic PDX-1 expression of intracellular compartments characteristic of endocrine and neuroendocrine enabling the retention of the produced hormone and its regulated secretion
Mice were administered either Ad-CMVhIns or AdCMVPDX-1 as described in Example 2. Administration resulted in a 3-fold increase in serum IRI indicating production of human insulin by hepatocytes (FIG. 1). Cells that were positive for insulin protein by immunocytochemistry were detected only by AdCMVPDX administration. Furthermore, in the HPLC analysis of the liver extract, only a trace amount of IRI was detected in the liver extract, all of which were unprocessed in the Ad-CMVhIns-administered mice, whereas the AdCMVPDX-1-administered mice A 25-fold increase was observed. Furthermore, 59% of the insulin produced in AdCMVPDX-1 treated mice was processed. Furthermore, only the liver administered with AdCMVPDX-1 shows induction of the prohormone processing enzyme PC1 / 3, which is characteristic only for cells that are capable of a regulated pathway for the preservation and regulated secretion of insulin processing. It was. These data indicate that PDX induces regulated secretion of insulin in hepatocytes.

(Example 14: Identification of nucleic acid whose expression is modulated by PDX)
Nucleic acids modulated by PDX are distinguished by ectopic PDX expression. Nucleic acids that are not expressed in control administered extrapancreatic islet tissue when compared to pancreatic tissue are nucleic acids that are modulated by PDX. These nucleic acids thus identified are used as therapeutic compounds for treating pancreatic related disorders.

  Target gene identification can be done either by subtractive library, commercially available microarray chip (Incyte or Affimetrix) or membrane hybridization (CLONTECH, Atlas® expression array or Multiple Tissue Northern (MTN®) blot) carry out. Isolation of RNA from the administered tissue, its purification, and synthesis of the cDNA probe are performed according to the manufacturer's instructions.

  A gene that is expressed in PDX-administered non-islet tissue and is also present in the islet-probeed membrane or chip but not in control-administered non-islet tissue is a direct or non-direct PDX target gene, which is a gene expression gene Shows islet cell characteristic properties. Discrimination between direct and indirect can be performed by analyzing the candidate target gene promoter by the electron mobility shift test (EMSA) shown in FIG. 7 and promoter footprinting (Sambrook et al., Molecular Cloning: A Laboratory Manual, 2nd ed.,). Cold Spring Harbor Laboratory, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, 1989).

(Example 15: Induction of regulated expression of desired ectopic expression gene in host tissue)
This example illustrates the induction of regulated expression of any receptor other than insulin. When PDX activates the insulin promoter in non-islet tissue and mediates its glucose and growth factor sensing ability, some other promoter is similarly regulated by glucose and growth factor. That is, the invention includes eg glucagon, growth hormone, steroid hormone driven by an insulin promoter driven by an insulin promoter, thereby controlling its transcription and otherwise regulated secretion from non-endocrine tissue It can be used to nutritionally and hormonally regulate the expression of many secreted and / or non-secreted factors (Figure 7).

(Example 16: Identification of PDX position in the hierarchical structure of β- or islet cell-specific transcription factor)
This example illustrates the identification of the position of PDX in the hierarchical structure of transcription factors specific to β cells or islet cells. Each transcription factor that is expressed in islets but not induced by ectopic PDX-1 expression in the liver induces a more comprehensive, complete or near-complete β-cell phenotype in non-endocrine pancreatic tissues such as liver For this reason, it is considered to cooperate with PDX. Detection of induced expression of islet cell-specific transcription factors in the liver is performed as described in Example 2 using the appropriate primers and conditions exemplified in Table 1.

  Another method for analyzing transcription factor activity is performed by footprinting and is performed as follows.

  Electron mobility shift test (EMSA): Nuclear extract (3-4 μg protein) in 10% glycerol, 15 mM Hepes (pH 7.9), 150 mM KCl, 5 mM DTT and 0.3 g poly dIdC, poly dAdT (SIGMA St Louis MO) Incubated on ice for 10 minutes in the contained DNA binding mixture. After the initial incubation, approximately 0.2 ng of probe was added and subjected to an additional 25 minute incubation on ice. The binding reaction was analyzed on a native 4% polyacrylamide gel.

Oligonucleotide (probe). Synthetic double-stranded oligonucleotides are end-labeled with [α ³² P] ATP using Klenow fragment of DNA polymerase. The sequence of oligonucleotide A3 / A4, which is an example for (one of) the PDX-1 binding sites on the insulin promoter, is 5′GATCTGCCCCCTGTTAATAATCTAATG3 ′ (SEQ ID NO: 24). The sequence of A1 (another PDX-1 binding site on the insulin promoter) is 5′GATCCGCCCTTAATGGGCCAAACGGGCA-3 ′ (SEQ ID NO: 25). As shown in FIG. 7, labeled oligos are used as probes for electron mobility shift testing. Identification of PDX-1 prevents binding of PDX-1 to its homologous locus on the promoter, or PAGE (antibody + pdx-1 + probe compared to that containing only pdx-1 + labeled probe) ) Double presumed by supershift with a specific antibody that increases the molecular weight of the complex separated above (last 2 lanes in FIG. 7).

(Example 17: Induction of pancreatic endocrine and exocrine markers in liver by ectopic PDX-1 expression)
Ectopic PDX-1 expression in mature liver in vivo activates a broad repertoire of pancreatic genes. Both endocrine and exocrine markers, such as exocrine pancreatic transcription factor p48, showed unique expression in response to ectopic PDX-1 expression in the liver (FIG. 8). Control-treated mice were almost negative for pancreatic gene expression. Insulin gene expression was induced in almost 100% of ectopic PDX-1 treated mice but was expressed at very low concentrations that were not translated into protein in 20% of control treated mice.

  In the developing pancreas, PDX-1 acts as an early molecular marker that temporarily correlates with pancreatic involvement. This data indicates that PDX-1 repeats its role in pancreatic organogenesis in mature, fully differentiated tissues such as the liver.

(Example 18: Induction by PDX-1 for a long-lasting process of developmental shift from liver to pancreas)
Insulin, glucagon and somatostatin gene expression and protein production 6 months after the first single adenovirus-mediated PDX-1 administration to mouse in vivo liver were examined.

  8- to 9-week-old mice were systemically administered with Ad-CMV-PDX-1, that is, a recombinant adenovirus carrying the rat PDX-1 gene (STF-1) under the control of the CMV promoter. Pancreatic gene expression in the liver was analyzed in comparison to age-matched control mice (Ad-CMV-β-galactosidase administered or not).

  Despite the predicted transient PDX-1 expression achieved by adenovirus-mediated delivery of genes to the liver (recombinant PDX-1 expression decays between 30 and 56 days after virus injection) Insulin and somatostatin expression persisted for 6 months at both mRNA (FIG. 9) and protein levels (FIG. 11). Glucagon gene expression became prominent during the first 4 months (FIGS. 9 and 10). Importantly, insulin I and insulin II gene expression was evident in 80-100% of PDX-1 treated mice even at 6-8 months after the initial PDX-1.

  Transient differences between insulin and glucagon gene expression reflect a unique phenomenon that characterizes pancreatic organogenesis in the mature liver, suggesting that there is a more stable interconversion towards β and δ cell phenotypes is doing. The glucagon gene is not a direct PDX-1 target gene and its sustained expression in the liver suggests that PDX-1 functions as a differentiation factor in this organ.

(Example 19: Quantitative analysis of insulin, glucagon and somatostatin hormone production in the liver treated with PDX-1)
Immunohistochemical analysis (FIG. 10) identifies the location of insulin-producing cells primarily in the central vein proximity even 4-6 months after PDX-1 ectopic gene delivery (FIGS. 10A and 10C). Although glucagon-positive cells are also localized in the central vein vicinity (FIG. 10B), according to immunohistochemical analysis of these two hormones performed on sequential slides, these hormones are not located in the same cell. It is suggested that they are not localized at the same time. It has been found that hepatocytes present in the region close to the central vein in the liver correspond to mature cells.

  According to the quantitative analysis of hepatic insulin stored in the liver of PDX-1 treated mice, the liver insulin content is about 30-75 ng / g tissue even in 4-6 months after administration, whereas In matched control livers, it was 1-9 ng / g tissue (FIG. 11A). Significant 2-fold increases in hepatic pro / glucagon and somatostatin content were observed for at least 4 months after the first Ad-CMV-PDX-1 administration (FIGS. 11B and C). The large difference in the liver content of insulin when compared to the other two pancreatic hormones after PDX-1 administration appears to be similar to the ratio of these hormones in the pancreas. Despite hepatic insulin production, serum insulin and glucose concentrations in PDX-1 treated mice with normal pancreatic function were normal throughout the experimental period (in the comparison of PDX-1 administration and control, respectively, : 1.0 ± 0.5 vs. 0.9 ± 0.4 ng / ml and glucagon: 0.16 ± 0.08 vs. 0.12 ± 0.05 ng / ml).

  The sustained production of pancreatic hormones in the liver suggests that ectopic PDX-1 triggers a cascade of events that do not require the persistent presence of the PDX-1 transgene.

Example 20: Ectopic PDX-1 Induction of Silent PDX-1 Gene Expression in Other Endogenous Endogenous Livers
To assess the persistent developmental shift in the liver caused by transient ectopic PDX-1 expression, we analyzed whether the transgene induces expression of otherwise silent pancreatic transcription factors.

  Recombinant adenovirus directed to the expression of rat PDX-1 homolog is administered to mice by systemic delivery to analyze endogenous and otherwise silent PDX-1 gene induction in the liver by ectopic genes And specific oligonucleotide primers were used to discriminate between ectopic PDX-1 transgene (rat) mRNA (cDNA) and endogenous mouse mRNA by RT-PCR.

  PCR analysis of DNA samples isolated from the livers of mice treated with Ad-CMV-PDX-1 confirms that the virus-coded transgene disappears 30-56 days after adenovirus injection (FIG. 12A).

  FIG. 12B also shows that ectopic rat PDX-1 expression parallels the observed presence of delivered viral DNA in the liver and disappears after one month (FIG. 12A). The only PDX-1 homologue expressed in the treated liver for the entire duration of the experiment is an endogenous and otherwise silent mouse homologue (FIG. 12B). Endogenous PDX-1 expression is restricted to mice receiving rat PDX-1 transgene, 75% of ectopic PDX-1 treated mice (21 of 28) and analyzed control liver 25 It became clear in 0 cases. Using real-time PCR, the discriminating and quantified relative amount of mouse-to-rat PDX-1 gene expression in the liver was analyzed as a function of time after the first dose using the same conditions (but different primers). Normalized to β-actin in the sample.

  As shown in FIG. 12C, mRNA encoding ectopic rat PDX-1 showed the highest value on day 5, decreased by 85% on day 30, and disappeared thereafter. In contrast, endogenous mouse PDX-1 was expressed at significant concentrations throughout the duration of the experiment. A summary of these data suggests that the self-induction of PDX-1 in the liver, which is endogenous but otherwise silent, is a long-lasting mode of the liver-to-pancreas interconversion process. It is suggested that the mechanism is explained.

Example 21: Insulin produced in the liver in response to PDX-1 transgene expression that is functional and prevents STZ-induced hyperglycemia
To investigate whether long-lasting production of biologically active insulin can be induced by PDX-1 gene delivery, it was analyzed whether it provided a protective effect against STZ-induced diabetes. Mice were administered 220 mg / kg STZ 8 months after the first Ad-CMV-PDX-1 administration, and the incidence of hyperglycemia was compared with the age-matched control group. 60% of control Balb / c mice (6 out of 10) developed hyperglycemia within 3-5 days after STZ injection. In contrast, in 5 PDX-1 treated mice, only 1 responded to STZ administration despite the fact that they were analyzed 8 months after Ad-CMV-PDX-1 administration. And developed hyperglycemia (20%).

  According to immunohistochemical studies and quantification of insulin content by RIA, most pancreatic β cells were destroyed in response to STZ administration, and, importantly, control diabetic mice and, more importantly, PDX-1 treated mice ( It was found that the pancreatic insulin content was reduced by 95 ± 1% in both cases. In contrast, hepatic immunoreactive insulin (IRI) content in PDX-1 treated mice was 40 times higher compared to control diabetic mice not administered PDX-1 (FIG. 13). In healthy mice, hepatic insulin was only 1% of production in the pancreas, but in response to STZ administration, hepatic insulin production was 25. of the amount of immunoreactive insulin produced in the same mouse STZ-administered pancreas. 6%.

  From these results, the PDX-1-induced developmental shift is long-lasting and functional, and the relatively moderate IRI concentration contributed by the liver is that insulin produced in the liver It is suggested that efficient regulation of the balance between glucose disposal also shows a protective effect against STZ-induced hyperglycemia. Importantly, this also suggests that cells shifted in the liver are resistant to β-cell specific toxins.

  Importantly, liver function was not impaired despite local insulin production continuing in the liver even 6-8 months after the initial viral infection (Table 4a). Transient changes in liver function occurred in response to adenovirus administration, but liver function returned to normal within 1-2 months. Furthermore, serum amylase concentrations did not increase at all time points despite endogenous PDX-1 and pancreatic hormone expression (Table 4b). The rate of weight gain of PDX-1 treated mice was similar to age-matched control mice.

Blood biochemical measurements of mice after PDX administration (mean ± SEM). ALB: albumin; ST: aspartate aminotransferase; ALT: alanine aminotransferase; bil: Total bilirubin. Data are mean ± SEM; ^* Pooled samples, number of mice analyzed are shown in parentheses.

Example 22: Induction of metastatic differentiation in primary cultures of human keratinocytes by PDX-1 and growth factors
(Cell culture)
Keratinocyte culture was initiated from small biopsy specimens (2-4 cm ² ) of exfoliated skin. After overnight (ON) incubation in trypsin-EDTA, the epidermis was separated and the epithelium was disrupted in trypsin-EDTA to form a single cell suspension. The cell suspension was cultured in keratinocyte medium (Nature 265: 421-4, 1977) and the cell suspension was bound to a Falcon culture plate and used at passages 2-5. When the cells reached 70% confluence, they were administered for 48 to 96 hours according to the prescribed administration method described below.

(Gene expression)
Gene expression analysis was performed using Taqman real-time PCR (ABI).

(Administration of cells)
K1: EGF + KGF + NIC + PDX-1 (100moi)
K2: EGF + KGF + NIC + PDX-1 (10moi)
K3: EGF + KGF
K4: EGF + KGF + RGCI
EGF and KGF were 20 ng / ml in all administrations; NIC: 10 ng / ml.

(Control group)
Control group cells were administered unrelated Ad-CMV-H insulin, ie, recombinant adenovirus expressing human insulin gene under the control of CMV promoter. RGCI is a bifunctional recombinant adenovirus construct Ad-CMV-PDX-1-RIP-GFP, which identified cells undergoing PDX-1-mediated transdifferentiation towards insulin gene expression. PDX-1 expression in this virus was driven by a CMV promoter, whereas GFP expression was driven by a tissue specific promoter (RIP) for insulin.

(result)
In administrations K1-K4, an otherwise endogenous pancreatic gene was expressed in keratinocytes. Interestingly, glucagon gene expression was induced by low concentrations of PDX-1 (K4) and, importantly, EGF + KGF administration alone, without the need for ectopic PDX-1 (FIG. 15).

(Example 23: Activation of insulin promoter by PDX-1 in human hepatocytes)
Human hepatocytes were isolated from adult and fetal tissues. The cells showed a heterogeneous phenotype and grew efficiently in culture until passage 20. Analyzes whether human cells isolated from fully differentiated livers of adults without any prior selection undergo a developmental reorientation process towards the pancreatic phenotype in response to ectopic PDX-1 expression did. The first indicator of pancreatic characteristics is activation of the insulin promoter, which is otherwise inactive in the liver. The cells were administered bifunctional recombinant adenovirus Ad-RIP-GFP-CMV-PDX-1 expressing PDX-1 under the control of a heterologous CMV promoter, and the GFP expression (FIG. 17a) was controlled by the insulin promoter. PDX-1 “responder” cells were identified by green fluorescence (FIG. 17b). The total ability of adult human hepatocytes to infect recombinant adenovirus was examined by Ad-CMV-GFP infection, with 40 ± 7% of adult hepatocytes showing green fluorescence in response to Ad-CMV-GFP infection at passage 1-6. Indicated. Surprisingly, about half of these cells (23 ± 3.5%) responded to ectopic PDX-1 expression upon activation of the pancreatic promoter, as revealed by FACS analysis (data not shown) ( FIG. 17b). Development of fetal human hepatocytes with a low degree of differentiation and possibly more pluripotent cells than adult human hepatocytes to determine whether partial responses are affected and limited by the differentiation state of adult hepatocytes The ability of PDX-1 to induce redirection was analyzed. Indeed, 27 ± 7.8% of fetal human hepatocytes in culture (isolated at 22 weeks gestation) responded to ectopic PDX-1 expression by activation of pancreatic promoter, and Ad-CMV-GFP transduction Its response to was similar to cells isolated from adult liver (FIG. 17c). This moderate increase in responding cells is thought to suggest that the differentiation state of the cell plays only a limited role in the developmental shift process induced by PDX-1.

  Three important observations are obtained from the primary culture of human hepatocytes. First, both adult and fetal cells grow efficiently up to 6 months when cultured in vitro and can activate the insulin promoter in response to PDX-1 administration. However, its ability to infect and “metastasize” decreases as the number of passages increases (FIGS. 17c and d). Secondly, fetal human liver tissue consists of a greater number of pluripotent cells than cells isolated from adult liver, but they have a similar ability to undergo a metastatic differentiation process to the pancreas (FIG. 17c). Third, the ability to activate the insulin promoter in human hepatocytes ectopically expressing PDX-1 indicates that half of the cells that can be infected by recombinant adenovirus are PDX-1-dependent in low passage cultures. It also activates the ectopic insulin promoter and thus does not occur in a rare population of cells (FIG. 17d).

(Example 24: Promotion of PDX-1-induced liver-to-pancreas differentiation by a soluble factor)
A better discrimination of the extent of the metastatic differentiation process is to analyze the induction of endogenous pancreatic gene expression in PDX-1 treated hepatocytes.

  The expression of the three major pancreatic hormone gene expressions was induced by PDX-1 which was two orders of magnitude higher compared to control untreated hepatocytes (FIG. 18).

  Nicotinamide and epidermal growth factor (EGF) have been shown to promote pancreatic endocrine differentiation of undifferentiated pancreatic cells, including embryonic pancreatic organ cultures. Interestingly, pancreatic hormone gene expression increased dramatically when nicotinamide and EGF (collectively referred to as GF) were added to PDX-1 administration. Insulin gene expression in primary cultures of adult hepatocytes was 7 orders of magnitude higher than in control untreated hepatocytes. Nicotinamide and EGF, both alone and in combination, showed a PDX-1 dependent effect on pancreatic gene expression in hepatocytes. These data suggest that PDX-1 is required for the process of metastatic differentiation from liver to pancreas, but GF has a synergistic effect on a process that is not sufficient to induce independently. Yes. Importantly, fetal and adult human hepatocytes showed pancreatic gene expression in response to ectopic PDX-1 expression and GF administration, as demonstrated by real-time PCR quantification of insulin gene expression in both cultures. It shows a similar level (FIG. 18b).

  Culture of hepatocytes in the presence of GF for several weeks prior to PDX-1 administration did not result in increased insulin gene expression compared to cells administered PDX-1 and GF simultaneously. In contrast, removal of GF from the pre-dosing culture resulted in insulin gene expression at a concentration similar to PDX-1 alone. In summary, the facilitating effect of GF on PDX-1 induced metastatic differentiation does not induce the growth of a rare subpopulation that is susceptible to this process, but rather they are still in an unknown manner It is suggested that the intracellular signal transduction resulting in the PDX-1 induction process is enhanced by contributing in the above. A similar multiplicity of infection of Ad-CMV-hIns, a recombinant adenovirus that causes constitutive expression of human proinsulin cDNA under the control of the CMV promoter, is comparable to that of PDX-1 and GF treated cells. This resulted in expression (without induction of glucagon and somatostatin gene expression as in PDX-1 administration). The number of cells that express insulin when Ad-CMV-hIns is administered is twice the number of cells that express the PDX-1-induced endogenous insulin gene (only 23% of the cells undergo the metastatic differentiation process) Waking up and 40% of the cells express the ectopic human insulin gene (see FIGS. 17c and 18c), the (endogenous) insulin promoter in PDX-1 treated hepatocytes is similar to the heterologous CMV promoter It is suggested to have activity and potency.

(Example 25: Giving endocrine properties to adult human hepatocytes by PDX-1)
In order to analyze whether adult human hepatocytes already metastasized differentiated to acquire endocrine cell characteristics, the ability of these cells to store and process PDX-1-induced insulin was analyzed. FIG. 19 shows insulin and C-peptide secretion and insulin content in PDX-1 treated cells. PDX-1 administration alone increased immunoreactive insulin (IRI) content by 34.5 ± 4.5 fold, IRI secretion increased by 38.7 ± 8.7 fold, and C-peptide secretion increased by 7.5 ± 2 Increased by a factor of 1. When GF was added to the medium, the effect of PDX-1 on the process was greatly enhanced, the IRI content increased by 91.3 ± 20.3 times compared to untreated hepatocytes, and its secretion was 74.5 ± 33. .3 fold increase and C-peptide secretion increased by 33.9 ± 14.6 fold. The effect of PDX-1 on the process was compared to the effect of ectopic expression of human proinsulin (using Ad-CMV-hIns recombinant adenovirus). Although most of the produced IRI was released in cells administered Ad-CMV-hIns, most of the IRI in PDX-1-treated cells was retained intracellularly. The moderate secretion of C-peptide by Ad-CMV-hIns administration is thought to be due to existing endopeptidases such as furin in hepatocytes. Importantly, induction of prohormone converting enzyme 2 was significant only when PDX-1 was administered, and was not observed in Ad-CMV-hIns-treated hepatocytes (FIG. 21a).

  According to immunogold histochemical electron microscopic analysis using an antibody against insulin, insulin was stored in secretory granules (FIG. 20a). These granules do not contain the dense core that is characteristic for undamaged islets in vivo, but were similar to those present in beta cell lines with a lower concentration of insulin storage. The endocrine phenotype was associated with specific induction of neuroendocrine vesicle-specific gene expression. Specific expression of SCG-2 (secretogranin-2) and SGNE1 (secretory granule neuroendocrine-1, FIG. 21b) was observed only in cells treated with PDX-1, but not with Ad-CMV-hIns .

  To summarize these data, adult human hepatocytes administered PDX-1 and appropriate factors have extensive and efficient metastasis to pancreatic hormone-producing cells that mimic many of the characteristics characteristic of pancreatic endocrine cells. It is suggested that differentiation occurs.

(Example 26: Glucose sensing ability of metastasized adult human hepatocytes)
Glucose sensing ability and the link between glucose sensing and insulin secretion guarantee pancreatic beta cell function.

  PDX-1 induced metastatic hepatocytes expressed GLUT-2 and glucokinase (GK, FIG. 21a) genes and were shown to secrete insulin in a glucose-regulated manner. Exposure of adult human hepatocytes treated with PDX-1 to 25 mM glucose results in an immediate increase in insulin secretion (FIG. 21b). A time course analysis of glucose-stimulated insulin (FIG. 21b) and C-peptide (FIG. 21c) reveals a biphasic dynamic characteristic similar to that of pancreatic beta cells, which is immediate. It was accompanied by a sharp first peak followed by an extended second peak secretion. When glucose induction was eliminated, insulin secretion immediately declined (FIG. 21d). The decrease in extracellular insulin concentration 60-90 minutes after the initial glucose challenge (FIG. 21b) is more intense than in the case of C-peptide (FIG. 21c), indicating a broad uptake of secreted insulin by hepatocytes in heterogeneous cultures. It is thought that it represents. According to the glucose dose response, maximal C-peptide secretion occurred at 25 mM glucose compared to maximal insulin secretion at 8-16 mM in normal islets (FIG. 21d), so that the right side compared to normal pancreatic β cells. The shift to became clear. The important point is that the link between glucose sensing ability and insulin secretion occurred in metastatic differentiated hepatocytes in a manner similar to normal pancreatic β cells, and glucose must exert its effect on insulin secretion. Must be metabolized. 2-Deoxy-glucose (2DOG), a non-metabolic glucose analog, did not elicit secretion of C-peptide in metastatic differentiated hepatocytes (FIG. 21d). As expected, ectopic expression of human insulin driven by a constitutive promoter (Ad-CMV-hIns) did not result in glucose-regulated secretion of the prohormone. These data indicate that the relationship between glucose sensing ability and insulin secretion is a result of the metastatic differentiation process.

(Example 27: Reduction of hyperglycemia in diabetic mice by metastatic differentiated adult human hepatocytes)
To examine the ability of metastatic differentiated adult human hepatocytes to substitute for β-cell function, cells were transplanted into immunodeficient SCID-NOD mice rendered diabetic by STZ administration. FIG. 22 shows that control-treated mice remained hyperglycemic, whereas mice transplanted with adult human hepatocytes treated with PDX-1 showed a gradual but significant decrease in blood glucose levels. Yes. According to immunohistochemical analysis, the pancreas of these mice was insulin depleted, but human hepatocytes transplanted under the renal capsule stained positive for PDX-1 and insulin (FIG. 18b). Human C-peptide was detected in the serum of STZ-treated mice transplanted with PDX-1-treated human hepatocytes. Human C-peptide concentration showed a significant 6-7 fold increase compared to 0.04 ± 0.02 ng / ml (p <0.01) in normal SCID-NOD and STZ treated control mice, with an average of 0. 26 ± 0.03 ng / ml (FIG. 22c). Serum mouse insulin concentrations in human cell transplanted mice remain unchanged and are significantly lower (0.16 ± 0.00%) than control normoglycemic SCID-NOC mice (0.45 ± 0.03 ng / ml). 03 ng / ml). In summary, these findings indicate that hyperglycemia in transplanted mice was normalized by human insulin secreted from metastatic differentiated human hepatocytes. These results demonstrate the ability of PDX-1 administered metastatic differentiated adult human hepatocytes to function in vivo as a substitute for β cells.

Example 28: Regression of hyperglycemia in CAD-NOD mice due to PDX-1-induced liver-to-pancreas metastatic differentiation
In order to examine the effect of PDX-1-induced liver-to-pancreas metastatic differentiation on apparent autoimmune diabetes, Adeno-CMV-PDX-1 or Ad-Rip-βGal was administered as described above to diabetic NOD mice. One group of mice remained untreated as a control. Blood glucose concentration and body weight were monitored to examine the regulation of glucose metabolism. Untreated mice and Ad-Rip-βGal treated mice remained hyperglycemic, lost weight and died within the first 2 weeks after administration (FIG. 24). In contrast, 65% (20/34) of mice receiving Ad-CMV-PDX-1 became normoglycemic within the first 5 days after administration. However, this normoglycemia was transient in some mice. 38% (13/34) of mice receiving PDX1 remained normoglycemic one month after administration, and the other 20% (7/34) receiving Ad-CMV-PDX-1 Hyperglycemia (FIG. 24a) occurred after 14 days, but maintained a stable weight throughout the experiment (FIG. 24b).

  These data suggest that the process of metastatic differentiation from liver to pancreas induced by PDX-1 regresses autoimmune diabetes (eg, type 1).

(Example 29: Synthesis and regulation of insulin in diabetic mice treated with Ad-CMV-PDX-1)
Immunohistochemical analysis of pancreatic and hepatic insulin expression revealed the presence of insulin-producing cells in the liver of Ad-CMV-PDX-1 treated mice, but not in the pancreas (Fig. 25). Liver insulin-producing cells were located close to the central vein as described above. Furthermore, hepatic insulin content and serum insulin concentration were significantly higher in mice administered with Ad-CMV-PDX-1 than in the control group (FIG. 26). That is, Ad-CMV-PDX-1 induced the expression of insulin in the liver and its secretion into the blood.

  In order to analyze the regulation of hepatic insulin release by blood glucose, a glucose tolerance test was conducted in 5 diabetic mice 2 to 3 weeks after becoming normoglycemia after administration of Ad-CMV-PDX-1. As controls, diabetic mice and healthy BALB / c mice treated with Ad-CMV-βGal were used. No difference in glucose clearance rate was observed between healthy BALB / c and Ad-CMV-PDX-1 treated mice, indicating that insulin secretion by liver metastatic differentiated cells is actually regulated by glucose ( FIG. 27). In contrast, diabetic Ad-CMV-βGal treated mice showed no glucose clearance and remained hyperglycemic throughout the study. To summarize these data, PDX-1-induced functional liver-to-pancreatic metastatic differentiation also occurs in mouse models of autoimmunity. PDX-1 induced normoglycemia was associated with induction of insulin production in the liver and its release in a glucose-regulated manner.

(Example 30: Induction of bone marrow cell development by PDX-1)
The ability of ectopic PDX-1 to induce a developmental shift from bone marrow cells to functional pancreatic cells is measured as follows. AC133 + cells isolated from fresh frozen human BM of greater than 90% purity were either IL-6, TPO, Flt-3 in either (a) a 24-well tissue culture plastic plate or (b) a Teflon bag. Growth was continued for 3 weeks in the presence or absence of TEPA in the continuous presence of ligand and SCF. The composition and capacity of progenitor cells is examined at the end of administration and after long incubation cultures.

In order to optimize infection and experimental conditions, the bifunctional adenovirus (AdRIP-GFP-CMV-PDX-1) is used to infect cultures. Expression of the GFP-reporter gene as a function of time after infection at 2-10 ³ MOI (number of virus particles divided by number of cells in culture, MOI, multiplicity of infection) is as follows.

  Responder cells (which activate the insulin promoter and thereby express GFP) are sorted, cultured from non-responder cells and subjected to subsequent analysis. Isolated cultures of control BM cells (TEPA administered or not) receive AdCMV-insulin as a control for insulin production without metastatic differentiation.

  RT-PCR is performed after gene expression. The concentration of gene expression and the time after induction after the developmental shift are analyzed by real-time PCR using real-time PCR (ABI, USA) in a quantitative test. The expression of pancreatic hormones, insulin, glucagon, somatostatin and prohormone converting enzyme and specific pancreatic transcription factors, namely BETA2, Isl-1, Nkx6.1, Pax4 and Pax6 and endogenous PDX-1, are analyzed.

  Hormone production is detected immunohistochemically using specific antibodies: guinea pig anti-pig insulin; rabbit anti-human glucagon; rabbit anti-human somatostatin (all DAKO A / S, Glostrup, Denmark). Insulin and glucagon production and secretion are analyzed by commercially available RIA-specific kits, Sensitive Human Insulin and C-peptide RIA kit and Glucagon RIA kit (Linco research ICN, Missouri, USA). Dose response of glucose and the process of pro / insulin synthesis and conversion to mature biologically active insulin was as described (2) by reverse phase HPLC and a specific human c-peptide RIA kit (Linco) Decompose by analyzing the secretion of C-peptide into the medium used. Analyze intracellular insulin content at different glucose concentrations.

  The dynamic characteristics of the insulin secretory response to glucose in PDX-1 induced BM cells are analyzed in vitro and compared to the case of ectopic insulin expression (AdCMV-hIns). Cells are incubated in various concentrations of glucose on 6-well dishes, and the dose response and time course of IRI secretion into the medium is measured by radioimmunoassay (RIA). Increased insulin secretion by forskolin / IBMX indicates the induction of regulation related to protein secretion in modulated hepatocytes. Sensitivity to glucose but not to 2-DOC or L-glucose indicates a specific association of the insulin secretion pathway to nutrient metabolism in “modulated” hepatocytes.

  By analyzing the ability of proliferating and metastatic differentiated bone marrow cells to control blood glucose levels and diabetic diabetes in diabetic SCID mice, one can fully examine their ability to mimic pancreatic beta cell function.

(Example 31: DNA microarray chip analysis of PDX-1-administered human hepatocytes)
As shown in the figure, DNA microarray analysis of PDX-1-administered human hepatocytes revealed that more than 500 genes were up-regulated or down-regulated compared to control cells. Genes modulated in response to PDX-1 administration include pancreatic transcription factors (see Table 5) and catalase and liver dismutase polypeptides (see Table 6).

The pancreatic genes up-regulated by PDX-1 administration are shown in Table 7.

PDX-1 administration in liver culture down-regulated the expression of various pancreatic genes. Table 8 shows these pancreatic genes that were down-regulated by PDX-1 administration.

The following abbreviations are used in the second column of Table 8. ADH1B = alcohol dehydrogenase 1B (class 1); GPR65 = G protein-coupled receptor 65; DDO = D-aspartate oxidase; RDH5 = retinol dehydrogenase 5 (11-cis and 9-cis); RARRES3 = retinoic acid receptor responder (Tazarotene induction) 3; VCAM = vascular cell adhesion molecule 1; HML2 = macrophage lectin 2 (calcium dependent); PPP1R3C = protein phosphatase 1, regulatory (suppression) subunit 3C; SULT1A1 = sulfotransferase family, cytosolic, 1A, Phenolic preference, member 1; MAF = v-maf sarcolemmal fibrosarcoma oncogene homolog (bird); BLVRB = biliverdin reductase B (flavin reductase (NADPH)); APOL1 = apolipoprotein L, 1; P8 = p8 protein (candidate for transfer 1); PYGL = phosphorylase, glycogen; liver; FCGRT = Fc fragment of IgG, receptor, transporter, alpha; SULT1A3 = sulfotransferase family, cytosolic, 1A, phenol Preference, member 3; AKRIC3 = Aldo-keto reductase family 1, member C3 (3-alpha hydroxysteroid dehydrogenase, type II); “sulfotransf-” = sulfotransferase family, cytosolic, 1A, phenol preference, member 2 Sulfotransferase family 1A, phenol preference, member 2 [homosapiens]; RRAS2 = related RAS virus (r-ras) oncogene homolog 2; SERPINF1 = se (Or cysteine) proteinase inhibitor, clade F (alpha-2 antiplasmin, pigment epithelium inducing factor); RXRA = retinoid X receptor, α; C1R = complement component 1, r subcomponent; CARHSP1 = calcium-regulated thermostability Sex protein 1, 24 kDa; FST = follistatin.

(Equivalent)
From the above detailed description of specific embodiments of the invention, it is evident that unique methods for inducing pancreatic hormone production have been described. Although specific embodiments have been described in detail herein, this is for illustrative purposes only and is not intended to be limiting with respect to the scope of the appended claims. In particular, it is intended by the inventors that various substitutions, alterations, and modifications may be made to the invention without departing from the spirit and scope of the invention as claimed.

Claims (1)

Invention described in the specification.