JP2011045386A - Method of collecting dna from environmental sample - Google Patents

Abstract

<P>PROBLEM TO BE SOLVED: To provide a method of collecting DNA from an environmental sample. <P>SOLUTION: The method of extracting DNA from the environmental sample is characterized by comprising treating the environmental sample with beads-beating in the presence of a DNA extract liquid containing not more than 5% of a surfactant and/or heating the same. <P>COPYRIGHT: (C)2011,JPO&INPIT

Description

  The present invention relates to a method for recovering DNA from environmental samples.

  Various microorganisms inhabit the environment such as soil, and it has enormous diversity. However, it is said that over 99% of them cannot be cultivated or are extremely difficult to cultivate, and there is a limit to the analysis of the community structure of soil microorganisms that relies on the culture method, and as long as it depends on the culture method, it cannot be cultured. It is clear that genetic analysis of soil microorganisms is not possible (Rondon et al. 1999). If the DNA contained in the soil can be directly extracted and analyzed, it is possible to know what microorganisms are present in the soil, including those that cannot be cultured, and it is also possible to obtain information on new genes in the form of nucleotide sequences It becomes possible.

  In community structure analysis, universal primers or target organism groups (genus, species level) are only suitable for genes commonly possessed by a wide range of organisms such as bacteria and fungi, such as 16S rRNA genes and 18S rRNA genes. Analysis is carried out by PCR amplification using such primers, decoding the base sequence through DGGE, TGGE or cloning. “Bias” is the most serious problem in this community structure analysis. The problem of PCR bias cannot be ignored, but before that, there is a question whether DNA was extracted without any bias from any microorganisms during the extraction from the soil. In order to analyze the community structure of microorganisms more accurately, first, DNA must be extracted from all microorganisms without any bias at the stage of extraction from soil.

  Recently, the term environmental DNA (= eDNA, environmental DNA) is sometimes used. DNA extracted directly from the environment (soil, sludge, lake water, seawater, etc.) without culturing (especially DNA directly extracted from soil is called soil DNA (= sDNA, soil DNA)), information on new microorganisms Is considered to be a large pool of genes that are retained in large quantities, and based on this, a library is created, cloned, and introduced into a gene expression system, so that useful substances derived from soil microorganism genes (antibiotics, Enzymes etc.) have been attempted to be produced in a host such as Escherichia coli (Seow 1997, Handelsman et al. 1998). New microorganisms that are difficult to cultivate are thought to exist at least 100 times more than currently known species, so the potential use value of environmental DNA and soil DNA containing information on these genes is very high. Possible (Ueda 2000, Hasebe 2003). Research using these methods is called Combinatorial Biology or Combinatorial Genetics, and is a field that is expected to develop in the future. For such research, techniques for extracting DNA from various soils and from more microorganisms will be important.

History of development of soil DNA extraction method The first attempt to extract DNA from soil was performed by Torsvik & Goksoyr (1978, 1980) (Torsvik VL, Goksoyr J; Soil Biology and Biochemistry; 1978, 10: p.7-12). ). In their method, microorganisms are separated and recovered from soil using a pyrophosphate buffer solution, and DNA is extracted from this microorganism fraction. The DNA thus obtained is referred to as “soil DNA”. This method is called an indirect extraction method because a microbial fraction is once recovered from soil and DNA is extracted therefrom. However, this method cannot obtain microbial DNA that cannot be recovered by washing the soil with a buffer solution. In other words, DNA that is strongly adsorbed on soil particles such as part of actinomycetes, microorganisms that inhabit plant remains, and microorganisms that inhabit the aggregates cannot be extracted by this method. There is a possibility. Later, direct extraction methods were successively developed by Ogram et al. (1987), Tsai & Olson (1991), Zhou et al. (1996), and others. In these methods, soil is treated with an alkaline extract containing enzymes such as lysozyme and proteinase K and SDS, and the protein is denatured without separating the cells from the soil, that is, in a solution containing a matrix called soil. In this method, DNA is extracted by lysis. In principle, this method is considered to yield DNA having a composition that reflects the actual microbial community structure of soil than the indirect extraction method, and is superior in terms of yield. However, in this method, the soil is heat-treated for a long time under the alkaline condition of the buffer solution, so that a considerable amount of humic substances is a problem.

Although the indirect extraction method may not accurately reflect the community structure of the soil, DNA is extracted after separating the microorganisms from the soil, so not only humic substances are less mixed than the direct extraction method, It is possible to suppress DNA fragmentation due to physical shearing caused by collision of soil particles with DNA, and higher molecular DNA can be obtained. In recent years, vectors that can introduce high-molecular-weight DNA with high cloning efficiency have been developed, and indirect extraction methods have been used more often in gene search research than in community structure analysis (Bakken & Lindahl 1995, Saano et al. 1995, Berry et al. 2003, Gabor et al. 2003).

  On the other hand, a new method of mechanically destroying cells using beads beater has been introduced for the purpose of extracting DNA from more soil microorganisms in a shorter time (Kuske CR, Banton KL, Adorada DL, et al .; Applied and Environmental Microbiology, 1998, 64: (7) p.2463-2472). Examination of beads-beating conditions has been studied in great detail by Burgmann et al. (2001) (Burgmann H., Pesaro M., Widmer F. and Zeyer J .; Journal of Microbiological Methods; 2001, 45: (1 ) p.7-20). This method has the advantage that DNA can be extracted in a very high yield because it has an extracellular polysaccharide membrane and even gram-positive bacteria that are not easily affected by surfactants such as SDS are mechanically disrupted. . In addition, since beads-beating can be completed in a short time, a soil DNA sample with little contamination with humic substances can be obtained. However, mechanical impact crushing with beads (glass beads, silica zirconia beads, alumina beads, etc.) also acts on DNA, which is a polymer extracted from bacterial cells, and the DNA may be physically sheared. . In this way, DNA can be taken from various microbial groups without any bias. On the other hand, this method is often used for community structure analysis of DGGE and the like that target relatively short sequences because of the low molecular weight of DNA.

In recent years, kits for preparing DNA from soil in a short time by a reagent manufacturer's original method such as Bio101 Fast DNA spin kit (Qbio, USA) and UltraClean Soil DNA kit (MoBio, USA) have been commercialized. All use beads beater, and soil DNA can be extracted in a short time.
As described above, various extraction methods for soil DNA have been devised, but the composition and concentration of surfactants and buffers used vary depending on the research. These conditions and DNA extraction efficiency, or extraction There are few examples of systematic studies on the relationship between DNA quality (purity, degree of fragmentation, etc.).

Previous knowledge on soil DNA purification methods
Even very small amounts of humic substances in DNA samples inhibit the PCR reaction (Tsai et al. 1991). For this reason, Zhou et al. (1996) et al. Used a method in which extracted soil DNA was once electrophoresed on an agarose gel to separate humic substances and DNA, and then only DNA was recovered from the gel (Zhou JZ Bruns MA, Tiedje JM; Applied and environmental microbiology; 1996; 62: (2) p.316-322). Moreover, agarose-embedded preparation is mentioned as a method using a low melting point agarose gel (Moreira 1998). This utilizes the fact that DNA is higher than humic substances, and once solidified so that the soil DNA solution containing humic substances is trapped in a low melting point agarose gel, the gel piece is dialyzed with TE buffer and low It gradually removes the humic substances that are molecules. In the dialysis treatment, the high molecular weight DNA stays in the agarose gel, and the low molecular weight humic substance is removed from the agarose gel by diffusion, and after removing the humic substance from the gel piece, the agarose is dissolved and the DNA is recovered. Thus, the difference in molecular weight is raised as the difference in physical properties that can separate DNA and humic substances, and many purification methods are based on this principle. A typical separation method based on the molecular weight is a gel filtration method. A porous resin such as Sephadex or Sepharose is used to separate and recover relatively large DNA molecules from small humic substances by size fractionation (eg Jackson et al. 1997, Miller 2001). In addition, in a chaotropic salt solution, DNA is first adsorbed on glass powder, silica gel powder, silica membrane, etc. by taking advantage of the fact that DNA is easily adsorbed on the glass surface due to the chaotropic effect. There is a purification method that removes unnecessary impurities by washing and re-extracts DNA using highly polar water. Bio101 Fast DNA spin kit (Qbio, USA) and UltraClean Soil DNA kit (MoBio, USA) are considered to use this principle for purification of extracted soil DNA. Further, a purification method using magnetic beads has been put into practical use (product name Wizard Magnetic, Promega, Madison WI, USA). On the other hand, polyvinylpolypyrrolidone (PVPP) and cetyltrimethylammonium bromide (CTAB) have also been used as humic substances removal agents, but the effect of reducing the contamination of humic substances into soil DNA samples can be seen by their use. However, it was not completely removed, and PVPP sometimes had problems such as reduced DNA yield (Zhou et al. 1996).

  An object of the present invention is to provide a method for extracting high-yield and high-purity DNA from soil.

In order to develop a method for extracting soil DNA with high yield and purity, the present inventor is suitable for lysis of soil microbial cells as a chemical condition, and various substances such as soil-derived humic substances and clay coexist. We searched for surfactants that can sufficiently lyse microorganisms even under conditions. Next, as physical conditions for cell disruption, crushing by beads-beating and heating conditions were examined. In addition, characteristics of Tris-HCl buffer, EDTA solution, and phosphate buffer used for the extract, and purification with CTAB, which is a cationic surfactant, and polyethylene glycol (PEG In order to establish an extraction-purification method for obtaining higher yields and purity of DNA from various soils with different properties, such as combining DNA precipitation operations under the optimal conditions) It was.
As a result, the present inventors have succeeded in developing a method for extracting high yield and high purity soil DNA, and completed the present invention. That is, the present invention is as follows.

(1) A method for extracting DNA from an environmental sample, which comprises treating the environmental sample in the presence of a DNA extract containing 5% or less of a surfactant.
(2) The method according to (1), wherein the surfactant is any one selected from the group consisting of SDS, CTAB, Triton X-100 and N-lauroyl sarcosine sodium.
(3) The method according to (1), wherein the DNA extract further contains a phosphate buffer and / or EDTA.
(4) The method according to (1), wherein the pH of the DNA extract is 7 or more.
(5) The method according to (3), wherein the concentration of the phosphate buffer is 100 mM to 1500 mM.

(6) The method according to (3), wherein the concentration of EDTA is 50 mM to 600 mM.
(7) The method according to (3), wherein the phosphate buffer has a concentration of 100 mM to 750 mM, and the EDTA has a concentration of 50 mM to 600 mM.
(8) The method according to (1), wherein the environmental sample is at least one selected from the group consisting of soil, compost, aqueous sediment, activated sludge, and feces.
(9) The method according to (1), wherein the treatment of the environmental sample is a bead-beating treatment and / or a heat treatment of the environmental sample.
(10) A method for extracting DNA from an environmental sample,
(a) bead-beating treatment and / or heat treatment of environmental sample in the presence of DNA extract containing 5% or less surfactant,
(b) Centrifuge the extract after beads-beating treatment and / or heat treatment,
(c) Collect the supernatant after centrifugation,
(d) The method comprising the steps of repeating the steps (a) to (c) once to four times for the remaining environmental sample after collecting the supernatant.

(11) The method according to (10), wherein the DNA extract further contains a phosphate buffer and / or EDTA.
(12) The method according to (11), wherein the EDTA concentration is 50 to 600 mM.
(13) The method according to (11), wherein the concentration of the phosphate buffer is 100 to 2000 mM.
(14) A method for extracting DNA from an environmental sample,
(a) bead-beating and / or heat-treating the environmental sample in the presence of a DNA extract containing 5% or less surfactant and 50-600 mM EDTA,
(b) Centrifuge the extract after beads-beating treatment and / or heat treatment, collect the supernatant,
(c) The method comprising the step of mixing the collected supernatant with 600 to 1100 mM EDTA.
(15) A method for extracting DNA from an environmental sample,
(a) bead-beating and / or heat-treating the environmental sample in the presence of a DNA extract containing 5% or less surfactant and 50-600 mM EDTA,
(b) Centrifuge the extract after beads-beating treatment and / or heat treatment,
(c) The said method including the process of heat-processing the mixture of the supernatant obtained and 600-1100 mM EDTA.

(16) A method for extracting DNA from an environmental sample,
The method comprising the steps of beads-beating treatment and / or heat treatment of an environmental sample in the presence of a DNA extract containing 5% or less surfactant and 250-2000 mM phosphate buffer.
(17) A method for extracting DNA from an environmental sample,
The method comprising the steps of beads-beating and / or heat-treating an environmental sample in the presence of a DNA extract containing 5% or less surfactant, 100-800 mM EDTA and 250-2000 mM phosphate buffer.
(18) The method according to (17), wherein the concentration of EDTA is 400 mM and the concentration of the phosphate buffer is 750 mM.
(19) A method for extracting DNA from an environmental sample,
(a) bead-beating and / or heat-treating the environmental sample in the presence of DNA extract I containing 5% or less of a surfactant;
(b) Extraction solution I after beads-beating treatment and / or heat treatment is extracted by mixing with 75-1200 mM EDTA, 250-3000 mM phosphate buffer, or a mixture of the EDTA and phosphate buffer Prepare liquid II,
(c) The method comprising the step of extracting DNA from the extract II.
(20) The method according to (19), wherein the concentration of EDTA mixed with the extract I is 400 to 800 mM.

(21) The method according to (19), wherein the concentration of the phosphate buffer mixed with the extract I is 750 to 1500 mM.
(22) The method according to (19), wherein the concentration of EDTA mixed with the extract I is 400 mM, and the concentration of the phosphate buffer mixed with the extract I is 750 mM.
(23) A method for extracting DNA from an environmental sample,
(a) beads-beating the soil sample in the presence of DNA extract III containing 5% or less surfactant, 400 mM or less EDTA and 250 mM or less phosphate buffer;
(b) Extract IV after mixing beads-beating with 400-1000 mM EDTA, 750-2050 mM phosphate buffer, or a mixture of the EDTA and phosphate buffer to prepare extract IV ,
(c) The method comprising the step of extracting DNA from the extract IV.
(24) The method according to (23), wherein the step of extracting DNA comprises subjecting the extract IV to a heat treatment followed by centrifugation.
(25) The method according to (23), wherein, in the extract III, the concentration of EDTA is 300 mM, and the concentration of the phosphate buffer is 100 mM.

(26) The method according to (23), wherein the concentration of EDTA mixed with the extract III is 400 mM, and the concentration of the phosphate buffer mixed with the extract III is 750 mM.
(27) A method for extracting DNA from an environmental sample,
(a) heat treating the environmental sample in the presence of DNA extract V containing 100-400 mM EDTA and 250-1500 mM phosphate buffer;
(b) Centrifuge the extract V after heat treatment and collect the supernatant,
(c) The remaining environmental sample is subjected to beads-beating treatment in the presence of DNA extract III containing 5% or less surfactant, 400 mM or less EDTA and 250 mM or less phosphate buffer,
(d) The method comprising the step of centrifuging the extract III after beads-beating treatment and collecting the supernatant.
(28) A method for extracting DNA from an environmental sample,
(a) beads-beating the environmental sample in the presence of DNA extract V containing 100-400 mM EDTA and 250-1500 mM phosphate buffer;
(b) Centrifuge the extract V after beads-beating treatment and collect the supernatant,
(c) The remaining environmental sample is subjected to beads-beating treatment in the presence of DNA extract III containing 5% or less surfactant, 400 mM or less EDTA and 250 mM or less phosphate buffer,
(d) The method comprising the step of centrifuging the extract III after beads-beating treatment and collecting the supernatant.
(29) A method for extracting DNA from an environmental sample,
(a) first heat treating the environmental sample in the presence of a DNA extract containing 200-800 mM EDTA and 250-2000 mM phosphate buffer;
(b) The said method including the process of mixing the environmental sample after 1st heat processing, and 5% or less of surfactant, and carrying out the 2nd heat processing of the said mixture.
(30) A method for extracting DNA from environmental samples,
(a) beads-beating the environmental sample in the presence of a DNA extract containing 100-400 mM EDTA and 250-1500 mM phosphate buffer;
(b) The said method including the process of mixing the environmental sample after bead-beating processing, and 5% or less of surfactant, and heat-processing the said mixture.

(31) The method according to (27) or (28), wherein in the extract V, the concentration of EDTA is 400 mM and the concentration of the phosphate buffer is 750 mM.
(32) The method according to (29) or (30), wherein the concentration of EDTA is 400 mM and the concentration of the phosphate buffer is 750 mM.
(33) A DNA purification method comprising purifying DNA derived from an environmental sample in the presence of a cationic surfactant and a salt.
(34) The method according to (33), wherein the DNA derived from the environmental sample is DNA extracted by the method according to any one of (1) to (32).
(35) The method according to (33) or (34), wherein the cationic surfactant is CTAB.

(36) The salt according to (33) or (34), wherein the salt is at least one selected from the group consisting of sodium chloride, sodium acetate, potassium acetate, ammonium acetate, sodium phosphate, potassium phosphate, and ammonium phosphate Method.
(37) The method according to (33) or (34), wherein the concentration of the cationic surfactant is 1 to 3%.
(38) The method according to (33) or (34), wherein the salt concentration is 0.7 to 2.1M.
(39) The method according to (33) or (34), wherein the concentration of the cationic surfactant is 2-3% and the concentration of the salt is 1.0M.
(40) The method according to (33) or (34), wherein the purification is performed under conditions of pH 7.0 or less.

(41) A DNA recovery method comprising precipitating DNA purified by the method according to any one of (33) to (40) in the presence of 2-propanol, ethanol or polyethylene glycol .
(42) The method according to (41), wherein the precipitation is performed under conditions of pH 7.0 or more.
(43) The method according to (41), wherein the concentration of polyethylene glycol is 5 to 7.5%.
(44) A DNA recovery method comprising precipitating DNA extracted by the method according to any one of (1) to (9) in the presence of 2-propanol, ethanol or polyethylene glycol .
(45) A method for recovering DNA from an environmental sample,
(a) bead-beating treatment and / or heat treatment of environmental sample in the presence of DNA extract containing 5% or less surfactant,
(b) Centrifuge the extract after beads-beating treatment and / or heat treatment,
(c) The said method including the process of collect | recovering DNA from the obtained supernatant.

(46) The method according to (45), wherein the DNA extract further contains a phosphate buffer and / or EDTA.
(47) The method according to (46), wherein the concentration of EDTA is 50 to 600 mM.
(48) The method according to (46), wherein the concentration of the phosphate buffer is 100 to 2000 mM.
(49) A method for recovering DNA from an environmental sample,
(a) bead-beating or heating the environmental sample in the presence of a DNA extract containing 5% or less surfactant,
(b) Centrifuge the extract after beads-beating treatment or heat treatment,
(c) recovering DNA from the resulting supernatant;
(d) The said method including the process of repeating said (a)-(c) process 1 to 4 times about the residual environmental sample after DNA collection | recovery.
(50) The method according to (49), wherein the DNA extract further contains a phosphate buffer and EDTA.

(51) The method according to (50), wherein the concentration of EDTA is 50 mM to 600 mM.
(52) The method according to (50), wherein the concentration of the phosphate buffer is 100 to 2000 mM.
(53) A method for recovering DNA from an environmental sample,
(a) bead-beating and / or heat-treating the environmental sample in the presence of a DNA extract containing 5% or less surfactant and 50-600 mM EDTA,
(b) Centrifuge the extract after beads-beating treatment and / or heat treatment, collect the supernatant,
(c) The collected supernatant and 600-1100 mM EDTA are mixed, and the mixture is centrifuged.
(d) The said method including the process of collect | recovering DNA from the obtained supernatant.
(54) A method for recovering DNA from an environmental sample,
(a) bead-beating and / or heat-treating the environmental sample in the presence of a DNA extract containing 5% or less surfactant and 50-600 mM EDTA,
(b) Centrifuge the extract after beads-beating treatment and / or heat treatment,
(c) Mixing the resulting supernatant with 600-1100 mM EDTA and heating the mixture,
(d) Centrifuge the extract after heating,
(e) The method comprising the step of recovering DNA from the resulting supernatant.
(55) A method for recovering DNA from an environmental sample,
(a) beads-beating and / or heat-treating environmental samples in the presence of a DNA extract containing 5% or less surfactant and 250-2000 mM phosphate buffer;
(b) Centrifuge the extract after beads-beating treatment and / or heat treatment,
(c) The said method including the process of collect | recovering DNA from the obtained supernatant.

(56) A method for recovering DNA from an environmental sample,
(a) beads-beating and / or heat-treating an environmental sample in the presence of a DNA extract containing 5% or less surfactant, 100-800 mM EDTA and 250-2000 mM phosphate buffer;
(b) Centrifuge the extract after beads-beating treatment and / or heat treatment,
(c) The said method including the process of collect | recovering DNA from the obtained supernatant.
(57) The method according to (56), wherein the concentration of EDTA is 400 mM and the concentration of the phosphate buffer is 750 mM.
(58) A method for recovering DNA from an environmental sample,
(a) bead-beating and / or heat-treating the environmental sample in the presence of DNA extract I containing 5% or less of a surfactant;
(b) Extraction solution I after beads-beating treatment and / or heat treatment is extracted by mixing with 75-1200 mM EDTA, 250-3000 mM phosphate buffer, or a mixture of the EDTA and phosphate buffer Prepare liquid II,
(c) Centrifuge Extract II,
(d) The said method including the process of collect | recovering DNA from the obtained supernatant.
(59) The method according to (58), wherein the concentration of EDTA mixed with the extract I is 400 to 800 mM.
(60) The method according to (58), wherein the concentration of the phosphate buffer mixed with the extract I is 750 to 1500 mM.

(61) The method according to (58), wherein the concentration of EDTA mixed with the extract I is 400 mM, and the concentration of the phosphate buffer mixed with the extract I is 750 mM.
(62) A method for recovering DNA from an environmental sample,
(a) beads-beating the environmental sample in the presence of DNA extract III containing 5% or less surfactant, 400 mM or less EDTA and 250 mM or less phosphate buffer;
(b) Extract IV after mixing beads-beating with 400-1000 mM EDTA, 750-2050 mM phosphate buffer, or a mixture of the EDTA and phosphate buffer to prepare extract IV ,
(c) Centrifuge Extract IV,
(d) The said method including the process of collect | recovering DNA from the obtained supernatant.
(63) The method according to (62), wherein the extract IV is heated and then centrifuged.
(64) The method according to (62) or (63), wherein, in the extract III, the concentration of EDTA is 300 mM and the concentration of the phosphate buffer is 100 mM.
(65) The method according to (62) or (63), wherein the concentration of EDTA mixed with the extract III is 400 mM, and the concentration of the phosphate buffer mixed with the extract III is 750 mM.

(66) A method for recovering DNA from an environmental sample,
(a) heat treating the environmental sample in the presence of DNA extract V containing 100-400 mM EDTA and 250-1500 mM phosphate buffer;
(b) Centrifuge the extract V after heat treatment and collect the supernatant,
(c) The remaining environmental sample is subjected to beads-beating treatment in the presence of DNA extract III containing 5% or less surfactant, 400 mM or less EDTA and 250 mM or less phosphate buffer,
(d) Centrifuge the extract III after beads-beating treatment, collect the supernatant,
(e) The method comprising the step of recovering DNA from the supernatant obtained in step (b) and / or (d).
(67) A method for recovering DNA from an environmental sample,
(a) beads-beating the environmental sample in the presence of DNA extract V containing 100-400 mM EDTA and 250-1500 mM phosphate buffer;
(b) Centrifuge the extract V after beads-beating treatment and collect the supernatant,
(c) The remaining environmental sample is subjected to beads-beating treatment in the presence of DNA extract III containing 5% or less of SDS, 400 mM or less of EDTA and 250 mM or less of phosphate buffer,
(d) Centrifuge the extract III after beads-beating treatment, collect the supernatant,
(e) The method comprising the step of recovering DNA from the supernatant obtained in step (b) and / or (d).
(68) A method for recovering DNA from an environmental sample,
(a) first heat treating the environmental sample in the presence of a DNA extract containing 200-800 mM EDTA and 250-2000 mM phosphate buffer;
(b) Mixing 5% or less surfactant with an environmental sample and subjecting the mixture to a second heat treatment,
(c) Centrifuge the extract after the second heat treatment,
(d) The said method including the process of collect | recovering DNA from the obtained supernatant.
(69) A method for recovering DNA from an environmental sample,
(a) beads-beating the environmental sample in the presence of a DNA extract containing 100-400 mM EDTA and 250-1500 mM phosphate buffer;
(b) Mixing the environment sample after beads-beating treatment with 5% or less surfactant and heating the mixture,
(c) Centrifuge the extract after heat treatment,
(d) The said method including the process of collect | recovering DNA from the obtained supernatant.
(70) The method according to (66) or (67), wherein in the extract V, the concentration of EDTA is 400 mM and the concentration of the phosphate buffer is 750 mM.

(71) The method according to (68) or (69), wherein the concentration of EDTA is 400 mM and the concentration of the phosphate buffer is 750 mM.
(72) The method according to any one of (45) to (57), wherein the DNA recovery comprises a step of purifying DNA by mixing the supernatant after centrifugation, a cationic surfactant and a salt.
(73) The method according to any one of (58) to (61), wherein the DNA recovery comprises a step of purifying DNA by mixing the extract II, a cationic surfactant and a salt.
(74) The method according to any one of (62) to (65), wherein the DNA recovery comprises a step of purifying DNA by mixing the extract IV with a cationic surfactant and a salt.
(75) The DNA recovery includes a step of purifying DNA by mixing the extract V after heat treatment and / or the extract III after beads-beating with a cationic surfactant and salt (66) the method of.
(76) The recovery of DNA includes a step of purifying DNA by mixing extract III after beads-beating and / or extract V after beads-beating with a cationic surfactant and salt (67) The method described.
(77) The method according to (68), wherein the DNA recovery comprises a step of purifying DNA by mixing the extract after the second heating, a cationic surfactant and a salt.
(78) The method according to (69), wherein the DNA recovery comprises a step of purifying DNA by mixing the extract after heat treatment with a cationic surfactant and a salt.
(79) The method according to any one of (72) to (78), wherein the cationic surfactant is CTAB.
(80) The salt is at least one selected from the group consisting of sodium chloride, sodium acetate, potassium acetate, ammonium acetate, sodium phosphate, potassium phosphate and ammonium phosphate, any of (72) to (78) The method according to claim 1.

(81) The method according to any one of (72) to (78), wherein the concentration of the cationic surfactant in the mixed solution is 1 to 3%.
(82) The method according to any one of (72) to (78), wherein the salt concentration in the mixed solution is 0.7 to 2.1M.
(83) The concentration of the cationic surfactant in the mixed solution is 2 to 3%, and the concentration of the salt in the mixed solution is 1.0 M, according to any one of (72) to (78) the method of.
(84) The method according to any one of (72) to (78), wherein the purification is performed under a condition of less than pH 7.0.
(85) The method according to any one of (45) to (84), wherein the recovery of DNA comprises a step of precipitating DNA in the presence of 2-propanol, ethanol or polyethylene glycol.
(86) The method according to (85), wherein the concentration of polyethylene glycol is 5.0 to 7.5%.
(87) The method according to (85), wherein DNA is precipitated under conditions of pH 7.0 or higher.
(88) A method for recovering DNA from an environmental sample,
(a) Extracting DNA by treating an environmental sample in the presence of a DNA extract containing 1% surfactant, 400 mM EDTA and 750 mM phosphate buffer;
(b) Purify DNA by mixing DNA extract with 2% CTAB and 1M salt,
(d) The method comprising the step of precipitating the purified DNA in the presence of polyethylene glycol.
(89) A method for recovering DNA from an environmental sample,
(a) beads-beating the environmental sample in the presence of a DNA extract containing 1% surfactant, 300 mM EDTA and 100 mM phosphate buffer;
(b) Mix the extract after beads-beating treatment with 600 mM EDTA and 2050 mM phosphate buffer,
(c) centrifuge the extract obtained in step (b),
(d) Purify DNA by mixing the resulting supernatant with 2% CTAB and 1M salt;
(e) The method comprising the step of precipitating the purified DNA in the presence of polyethylene glycol.
(90) A method of recovering DNA from an environmental sample,
(a) beads-beating the environmental sample in the presence of a DNA extract containing 1% surfactant, 300 mM EDTA and 100 mM phosphate buffer;
(b) The extract after beads-beating treatment and 600 mM EDTA and 2050 mM phosphate buffer are mixed and heat-treated,
(c) Centrifuge the extract after heat treatment,
(d) Purify DNA by mixing the resulting supernatant with 2% CTAB and 1M salt;
(e) The method comprising the step of precipitating the purified DNA in the presence of polyethylene glycol.

(91) A method for recovering DNA from an environmental sample,
(a) beads-beating the environmental sample in the presence of a DNA extract containing 1% surfactant, 300 mM EDTA and 100 mM phosphate buffer;
(b) Centrifuge the extract after beads-beating treatment,
(c) Purify DNA by mixing the resulting supernatant with 2% CTAB and 1M salt;
(d) The method comprising the step of precipitating the purified DNA in the presence of polyethylene glycol.
(92) Any of (88) to (91), wherein the salt is at least one selected from the group consisting of sodium chloride, sodium acetate, potassium acetate, ammonium acetate, sodium phosphate, potassium phosphate, and ammonium phosphate Or the method according to claim 1.
(93) The method according to any one of (88) to (91), wherein the polyethylene glycol concentration is 5.0 to 7.5%.
(94) The method according to any one of (88) to (91), wherein the DNA is precipitated under conditions of pH 7.0 or higher.
(95) A kit for extracting DNA from an environmental sample, comprising 5% or less surfactant or a combination of the surfactant and beads for beads-beating.

(96) The kit according to (95), further comprising an alkaline buffer and EDTA and / or a phosphate buffer.
(97) The kit according to (96), wherein the alkaline buffer is a Tris buffer.
(98) The kit according to (96), wherein the EDTA concentration is any one selected from the range of 50 mM to 1200 mM.
(99) The kit according to (96), wherein the phosphate buffer concentration is any one selected from the range of 50 mM to 3000 mM.
(100) The kit according to (96), wherein the pH of the DNA extract can be adjusted to 7.0 or higher.

(101) A kit for purifying DNA from an environmental sample, comprising a salt solution containing a pH buffer having an acidic pKa, a cationic surfactant, or a mixture of the salt solution and a cationic surfactant.
(102) The kit according to (101), wherein the pH buffer solution having pKa on the acidic side is an acetate buffer solution, a phosphate buffer solution, a hydrochloric acid buffer solution or a sulfate buffer solution.
(103) The kit according to (101), wherein the cationic surfactant is CTAB.
(104) The kit according to (101), wherein the salt is at least one selected from the group consisting of sodium chloride, sodium acetate, potassium acetate, ammonium acetate, sodium phosphate, potassium phosphate, and ammonium phosphate.
(105) The kit according to (101), wherein the pH of the DNA-containing solution can be adjusted to less than 7.0.

(106) A kit for recovering DNA from an environmental sample containing an alkaline buffer.
(107) The kit according to (106), wherein the alkaline buffer is a Tris buffer.
(108) The kit according to (106), further comprising 2-propanol, ethanol or polyethylene glycol.
(109) The kit according to (106), wherein the pH of the DNA-containing solution can be adjusted to 7.0 or more.
(110) The DNA extraction kit according to any one of (95) to (100), the DNA purification kit according to any one of (101) to (105), and the (106) A kit set for obtaining DNA from an environmental sample, comprising at least two kits selected from the group consisting of the kit for collecting DNA according to any one of -109.

  The present invention provides a method capable of recovering DNA from soil with high yield and high purity. The DNA obtained by the method of the present invention contains almost no contaminants, and the loss of DNA during extraction and purification can be minimized. Further, when implementing the present invention, no special technique is required, and it is simple and inexpensive. Therefore, the method of the present invention can be used to analyze the community structure of soil microorganisms and to search for new genes from environmental DNA such as soil microbial ecology, combinatorial biology, or combinatorial genetics. This is extremely useful.

It is a figure which shows the example of fixed_quantity | quantitative_assay of soil DNA. It is a figure which shows the amount of extraction of soil DNA by various surfactant. It is a figure which shows the influence which SDS density | concentration has on DNA extraction from Yayoi field compost area soil. It is a figure which shows the influence which SDS density | concentration has on soil DNA extraction. It is a figure which shows the influence which pH of an extract has on soil DNA. The number described above each bar represents the pH of the extract after beads-beating. It is a figure which shows the influence which EDTA density | concentration has on DNA extraction from volcanic ash soil. It is a figure which shows the influence which EDTA density | concentration has on the amount of DNA extraction. It is a figure which shows the relationship between the EDTA density | concentration of an extract, and the extraction amount of a metal element. It is a figure which shows the relationship between the EDTA density | concentration of an extract, and the extraction amount of a metal element. It is a figure which shows the relationship between the EDTA density | concentration of an extract, and the extraction amount of a metal element. It is a figure which shows the relationship between the EDTA density | concentration of an extract, and an EDTA-metal element complex formation rate. It is a figure which shows the relationship between the EDTA density | concentration of an extract, and an EDTA-metal element complex formation rate. It is a figure which shows the relationship between the EDTA density | concentration of an extract, and an EDTA-metal element complex formation rate. It is a figure which shows DNA yield when DNA is extracted repeatedly from soil. It is a figure which shows DNA yield when DNA is extracted repeatedly from soil. It is a figure which shows DNA yield when DNA is extracted repeatedly from soil. It is a figure which shows the calculation result of the extraction amount of the new soil DNA of the re-added EDTA solution. It is a figure which shows the amount of soil DNA considered that it was able to extract with the newly added EDTA. It is a figure which shows the metal amount (Al and Fe) extracted from the soil by the newly added EDTA. It is a figure which shows the metal amount (Ca and Mg) extracted from the soil by the newly added EDTA. It is a figure which shows the soil DNA extraction result from the Yayoi field control zone soil which added the high concentration EDTA solution after beads-beating. It is a figure which shows the influence which the EDTA density | concentration of an extract has on soil DNA extraction amount. Extract of PO ₄ ³ - concentration is a diagram showing the effect on the soil DNA extract amount. It is a figure which shows the influence which EDTA-phosphate density | concentration in the extract in volcanic ash soil has on soil DNA extraction. It is a figure which shows the influence which EDTA-phosphate concentration in the extract in non-volcanic ash soil has on soil DNA extraction. It is a figure which shows the relationship between the phosphate ion density | concentration of the extraction solution in 2 steps DNA extraction, and the yield of soil DNA. FIG. 18A is a diagram showing the yield of soil DNA extracted in a two-step operation using high-concentration EDTA and phosphate buffer. FIG. 18B is a graph showing the yield of soil DNA extracted from Yayoi field control soil using the improved two-step method using EDTA and phosphate buffer. The EDTA concentration and PO ₄ ³⁻ concentration shown in the figure are concentrations in the extract during beads-beating, and the final concentrations after addition of the solutions prepared after beads-beating are all 400 mM EDTA / 750 mM PO ₄ ³⁻ . . It is an electrophoresis photograph which shows the DNA extraction result by improved 2step. It is a figure which shows the collection | recovery result of DNA when using each precipitant. It is a figure which shows the removal effect of humus by the difference in the precipitation method of soil DNA. It is a figure which shows the influence which the PEG density | concentration has on collection | recovery of soil DNA. It is a figure which shows the collection amount of DNA at the time of performing the simple purification by CTAB. It is a figure which shows the removal effect of humic substance by CTAB process. It is a figure which shows the removal effect of humic substance by CTAB process. It is a figure which shows the comparison of the yield of soil DNA by four original conditions. It is an electrophoresis photograph which shows the size of extracted DNA by four original conditions. It is a figure which shows the comparison with the method of this invention, and the past method in soil DNA yield. It is an electrophoresis photograph which shows the purity test result using PCR reaction of soil DNA extracted by the original 1 step method. The top two panels have a template concentration of 100 ng / 50 μl, the middle two have a template concentration of 50 ng / 50 μl, and the two panels have a template concentration of 10 ng / 50 μl. It is an electrophoresis photograph which shows the purity test result using PCR reaction of soil DNA extracted by the original 2-step heating method. The template concentration in each panel is the same as in FIG. 26A. It is an electrophoresis photograph which shows the evaluation result of extracted DNA. Lanes 1 to 5 are Yayoi field control soils, lanes 6 to 10 are Chiba Agricultural Experiment Forest soils, lanes 11 to 15 are Ibaraki Agricultural Experiment Forest soils, and lanes 16 to 20 are Tanashi farm pasture soils. It is. Lanes in each soil represent PCR products of soil DNA extracted by the original 1Step method, 2Step method, 2Step heating method, LCB method and Zhou et al. (1996) in order from the left. It is an electrophoresis photograph which shows the evaluation result of extracted DNA. Lanes 1-8 are Gunma livestock pastures, and lanes 9-16 are electrophoreses of DNA extracted from Tochigi forest soil. The lanes in each soil are the original 1Step method, 2Step method, 2Step heating method, LCB method, Zhou et al. (1996) method, Cullen & Hirsch (1996) method, UltraClean Soil DNA kit, Bio 101 Fast DNA spin in order from the left. It is a PCR product of soil DNA extracted by the kit. It is an electrophoresis photograph which shows the evaluation result of extracted DNA. Lanes 1 to 8 are Tohoku University forest soils, and lanes 9 to 16 are electrophoreses of DNA extracted from the grassland test ground perennial grassland soil. Lanes in each soil are the same as in FIG. 27A. It is an electrophoresis photograph which shows the evaluation result of extracted DNA. Lanes 1 to 8 are Saitama agricultural test field soils, and lanes 9 to 16 are DNA migration diagrams extracted from Osaka agricultural test field soils. Lanes in each soil are the same as in FIG. 27A. It is an electrophoresis photograph which shows the evaluation result of extracted DNA. Lanes 1 to 8 are Hyogo agricultural test field soils, and lanes 9 to 16 are DNA migration diagrams extracted from Nara agricultural test field soils. Lanes in each soil are the same as in FIG. 27A. It is a figure which shows the influence which the pH reduction by the acidic buffer capacity of a salt solution has on the purity of a DNA extract at the time of DNA refinement | purification by CTAB. It is a figure which shows the influence which the pH reduction by the acidic buffer capacity of a salt solution has on the purity of the DNA solution after precipitation collection | recovery at the time of DNA purification by CTAB. It is a figure which shows the influence influence which the pH reduction by the acidic buffer capacity of a salt solution has on the recovery amount of DNA at the time of DNA refinement | purification by CTAB (PEG solution is used for recovery of DNA). Is possible to reduce the pH by acidic buffering capacity of the salt solution during purification by CTAB is a diagram showing the effect on the purity of the DNA extract (using a mixture of CH ₃ COONa and NaCl salt solution). It is a figure which shows the influence which it has on the purity of DNA collect | recovered with PEG solution that the pH by the acidic buffer ability of a salt solution reduces at the time of the refinement | purification by CTAB (when the mixed solution of CH3COONa and NaCl is used for a salt solution). It is a figure which shows the influence which the pH reduction by the acidic buffer capacity of the salt solution has on the recovery amount of DNA during the purification by CTAB (The mixed solution of CH3COONa and NaCl is used for the salt solution, and the PEG solution is used for the recovery of DNA. ). It is a figure which shows the influence which the presence or absence of the alkaline buffer ability of a PEG solution has on the purity of DNA collect | recovered. It is a figure which shows the influence which the presence or absence of the alkaline buffer ability of a PEG solution has on the recovery amount of DNA. It is a figure which shows the influence which the alkaline buffer capacity of the PEG solution used when collect | recovering DNA has on the purity of the collect | recovered DNA (for the soil DNA extract obtained by the extract of EDTA 200mM / Na2HPO4 375mM). It is a figure which shows the influence which the salt solution composition at the time of the refinement | purification by CTAB and the alkaline buffer capacity of the PEG solution used at the time of DNA collection have on the amount of DNA recovery (soil DNA extraction obtained with EDTA 200mM / Na2HPO4 375mM extract For liquids). It is a figure which shows the examination result of the extraction conditions of polymer soil DNA by heating extraction (about the Yayoi control ward soil). It is a figure which shows the examination result of the extraction conditions of polymer soil DNA by heat extraction. It is a figure which shows the influence which an extract liquid composition and physical processing have on the amount of DNA extraction from feces. It is an electrophoresis photograph of DNA extracted from feces. It is a figure which shows the examination result of the DNA extraction method from feces. It is a figure which shows the purity of DNA extracted from feces. It is a figure which shows the influence which an extract liquid composition and a physical process have on the amount of DNA extraction from compost. It is an electrophoretic photograph of DNA extracted from compost and activated sludge. It is a figure which shows the examination result of the DNA extraction method from compost. It is a figure which shows the purity of DNA extracted from compost. It is a figure which shows the examination result of the DNA extraction method from activated sludge. It is a figure which shows the purity of DNA extracted from activated sludge. It is an electrophoretic photograph of DNA extracted from lake bottom sediment. It is a figure which shows the examination result of the DNA extraction method from a lake bottom sediment. It is a figure which shows the purity of DNA extracted from the lake bottom sediment. It is a figure which shows the DGGE analysis result of soil DNA. It is a figure which shows the DGGE analysis result of feces DNA. It is a figure which shows the DGGE analysis result of compost DNA and activated sludge DNA. It is a figure which shows the DGGE analysis result of lake sediment DNA.

Hereinafter, the present invention will be described in detail.
1. Outline The present invention is a method for efficiently extracting, purifying or recovering DNA from an environmental sample, and includes a step of extracting DNA and a step of purifying by removing contaminants other than DNA from the DNA extract.
In the present invention, first, as one of conditions suitable for extraction of DNA from an environmental sample, the type of surfactant used and its concentration were examined. Next, we examined the concentration conditions of EDTA and phosphate buffer solutions and their mixtures to obtain high yields of DNA even in volcanic ash soils where extraction of DNA is difficult. Furthermore, in recovering DNA, the optimal precipitation conditions and the optimal purification conditions which do not contain impurities were examined, and a method for recovering DNA from soil efficiently and with high purity was found.

  In the present invention, treatment with a DNA extract containing a surfactant is adopted as the basic operation of DNA extraction. Then, extraction can be efficiently performed by combining beads-beating or heat treatment at the time of extraction. For example, an environmental sample, microparticles, and a DNA extract containing a surfactant at a predetermined concentration are mixed, and the mixture is subjected to beads-beating treatment to extract DNA. Or DNA is extracted by heat-processing the mixture of the said soil sample and surfactant of predetermined concentration. In this DNA extraction operation, the pH of the extract, the concentration conditions of the EDTA or phosphate buffer and a mixture of both, heating conditions, the concentration conditions of a cationic surfactant such as CTAB, the type of salt added during CTAB treatment, Set appropriate extraction conditions, recovery conditions and purification conditions according to the type and nature of the soil by examining various conditions such as concentration, polyethylene glycol concentration conditions, and pH during DNA precipitation with polyethylene glycol. Is possible.

The total pH of the extract used for extracting DNA from the sample is adjusted to 7 or more, and the optimum pH is 8.6 (details will be described later).
The basic extract composition to be mixed with a surfactant according to each environmental sample includes an EDTA solution and a phosphate buffer.
When DNA is extracted from soil, which is a representative example of environmental samples, DNA is adsorbed by amorphous aluminum contained in the soil when extracting from volcanic ash soil such as the Kanto Loam Layer, resulting in a very high recovery rate. Get worse. This adsorption by soil can be solved by using a solution containing EDTA, phosphoric acid, or both at high concentrations. It is also effective to use EDTA, phosphoric acid, or both in the extraction of DNA from normal soil and other environmental samples containing microorganisms, ie compost, water-based sediments, activated sludge and feces. .

In this case, the concentrations of EDTA and phosphoric acid are 50 mM to 600 mM and 100 mM to 1500 mM, respectively, and EDTA is 50 mM to 600 mM and phosphoric acid is 100 mM to 750 mM in a mixed solution of EDTA and phosphoric acid.
However, the above-mentioned concentration is an example, and the concentration can be appropriately changed depending on the difference in physical treatment after the extraction liquid is added during the extraction operation.
For purification of DNA obtained from environmental samples, quaternary ammonium salts (cationic surfactants) such as CTAB can be used. Examples of quaternary ammonium salts include CTAB and DTAB, which are cationic surfactants.
In the present invention, it is preferred to purify DNA using CTAB in the presence of a salt. Examples of the salt include sodium salts such as sodium chloride and sodium acetate, and potassium salts such as potassium chloride.

The present invention is characterized in that the pH during purification is lower than the pH during extraction by adding a cationic surfactant and a salt solution to the extract.
Here, in the present invention, “addition” means that one solution is added to the other solution, and also includes the meaning of mixing one solution with the other solution.
The extraction solution containing DNA after the extraction operation is adjusted to a pH of 7.0 or more, preferably 8.0 or more with a buffer solution contained in the extraction solution. The pH is lowered to less than 7.0 by mixing the extract with a salt solution having a buffer capacity that lowers the pH. Therefore, it is preferable that the salt solution contains a pH buffer solution having an acidic pKa such as acetic acid. The optimum salt solution in this case is a solution of 3.33M sodium acetate / 1.67M sodium chloride (pH 5.2). By mixing these two sodium salts, the pH of the extract can be lowered to 6.0 or lower. In addition, after mixing both a cationic surfactant and a salt solution, it is also possible to add a liquid mixture to an extract.

To recover DNA, add CTAB and a salt solution, and after stirring, add chloroform, stir further, and collect the aqueous phase (supernatant) after centrifugation as a DNA solution.
By adding a solution such as polyethylene glycol (PEG) to the collected solution, only DNA is selectively precipitated. The solution containing PEG has a buffering capacity to raise the pH lowered during the purification to alkaline again. By reducing the pH to the acidic side during purification and raising the pH to the alkaline side during recovery, more selective precipitation and recovery of DNA is possible, preventing coprecipitation of humus and sugars and other contaminants. it can. As the PEG solution having an alkaline buffer capacity, a PEG solution having a pH of 8.0 or more can be prepared and used by, for example, a Tris-HCl buffer system. The optimal condition is to mix a solution of 12% PEG / 1.5M Tris-HCl (pH 8.6) with the DNA extract and perform centrifugation. By mixing this solution, the pH of the solution when DNA is recovered rises to 7.5 or higher, preferably 8.0 or higher. The PEG solution and the Tris-HCl solution may be prepared separately and mixed so that the final pH is 7.5 or more.

Here, the meanings of the abbreviations used in this specification are as follows.
CTAB: cetyltrimethylammonium bromide
DTAB: dodecyltrimethylammonium bromide
EDTA: ethylenediaminetetraacetic acid
PEG: polyethylene glycol
SDS: sodium dodecyl sulfate

2. Environmental Sample In the present invention, the environmental sample to be subjected to DNA extraction is not particularly limited as long as it is a solid or liquid component present in the environment. For example, soil, compost, water-based sediment, activated sludge, feces, etc. can be mentioned, and these environmental samples can be appropriately selected according to the purpose of use.

(1) Soil In the present invention, the soil sample to be collected is not particularly limited, and any soil can be used. In Japan, volcanic ash soil is distributed over a relatively wide range, and volcanic ash soil is often the target soil for DNA extraction, but the target soil may be non-volcanic ash soil.
The volcanic ash soil is found in the Kanto Loam Formation, which is a deposit of the Fuji volcanic ash mainly distributed in the Kanto region, and in allophane black soil and a part of the Tohoku region based on volcanic eruptions and ash fallen volcanic ash. Non-allophenous black soil such as gray lowland soil, lowland paddy soil in plains throughout Japan, brown forest soil not affected by volcanic ash, red soil, yellow soil, etc. Is mentioned.

(2) Compost Compost is an organic fertilizer that is indispensable for growing crops and maintaining soil productivity. Compost is usually deposited by adding inorganic fertilizer or livestock dung as a nitrogen source to plant residues of woodland crops such as slaughter and wheat straw or woody materials such as fallen leaves and wood chips, and then decomposed by microorganisms (fermentation effect) ) Is partly disassembled. It is also produced by depositing and fermenting livestock feces such as cow dung, horse dung, pig dung, and chicken dung. The characteristics of these composts are that the samples after composting contain a large amount of microbial cells grown by the decomposition action of organic matter compared to before fermentation. These microorganisms are not only useful as fertilizer sources after being added to the soil, but are also important as useful microorganisms that promote the growth of crops. In recent years, compost-derived microorganisms are often used for the treatment of persistent organic substances such as agricultural chemicals and PCBs.

(3) Aqueous sediments Aqueous sediments refer to sediments such as lakes, ponds, rivers and seas that have settled there, such as soil, organic matter, and microorganisms. In these samples, a large amount of plants and zooplankton grown in water and their dead bodies are deposited, and there are many microorganisms that decompose them. These dead bodies are decomposed by microorganisms, and nutrients such as nitrogen contained therein are mineralized and released again into water. In this way, the microorganisms contained in the sediment play a role in circulating nutrients. It is considered that it is extremely important to clarify the number and type of the microorganisms in order to clarify the material circulation in the water system.

(4) Activated sludge The activated sludge method is one of the most common methods for treating sewage. Typical examples of sewage include general urban wastewater and livestock excreta. The sewage is purified by subjecting the sewage to aeration with air, decomposing organic matter by microorganisms, and collecting the degradation products and microbial cells grown by the decomposition. Microorganisms grown by this treatment, that is, activated sludge, have different structures depending on the quality of the wastewater to be treated and the treatment conditions, and analysis of these microorganisms is extremely important in the purification treatment of wastewater.

(5) Feces Feces such as humans, livestock, and insects contain a very large amount of microorganisms. Human feces contain an extremely large number of microorganisms including Escherichia coli and lactic acid bacteria grown in the intestine. It has been clarified to date that useful microorganisms are contained therein. In addition, since harmful microorganisms that cause food poisoning and the like are included, analysis of microorganisms contained in these feces is extremely important. In addition, ruminant herbivores such as cattle are partially decomposed in ingested plants using intestinal microorganisms, and it is extremely important to clarify these microbial communities by analyzing feces .

3. Beads-beating or heat treatment Beads-beating means adding soil and DNA extract to a screw cap tube, adding microparticles (glass beads, silica zirconia beads, alumina beads, etc.) and physically This is a method for destroying the bead, and has been studied in detail by Burgmann et al. (2001) including beads composition. In this method, since it has an extracellular polysaccharide membrane, even Gram-positive bacteria that are not easily affected by surfactants such as SDS are mechanically disrupted, so that DNA can be extracted with extremely high yield. Moreover, since extraction is completed in a short time, a soil DNA sample with little contamination with humic substances can be obtained.
Specifically, soil, beads and DNA extract are added to a screw cap tube and stirred vigorously. During beads-beating, the strongest physical impact is applied to the DNA, so the strength of beads-beating is adjusted accordingly.
In the present invention, heat treatment can be performed during DNA extraction. The heating conditions are 45 ° C to 70 ° C for 0.5 to 24 hours, preferably 60 ° C for 1 hour.

4). DNA extract
(4-1) Surfactant To extract DNA from bacteria and fungi, it is necessary to first denature cellular proteins and destroy the cell structure with surfactants such as SDS and CTAB. In addition, organic solvents that have strong protein denaturation ability such as phenol and benzyl chloride and can also destroy cell walls and cell membranes may be used.
SDS is a surfactant often used in molecular biology and is widely used for DNA extraction regardless of microorganism, animal or plant (Marmur 1961). The method using CTAB was originally developed as a method for extracting DNA from plants (Murray & Thompson 1980), but has also been used in part for the extraction of DNA from microorganisms (Velegraki et al. 1999). CTAB has the property of preferentially binding to DNA and precipitating at low salt concentrations in addition to denature proteins as a surfactant (Murray & Thompson 1980). CTAB is also known to be effective in removing polysaccharides in solution (Sambrook 1989) and humic substances (Wilstrom et al. 1996, Zhou et al. 1996).

  Guazinidine thiocyanate is a powerful protein denaturant and is often used not only for DNA extraction but also for RNA extraction (eg Chirgwin et al. 1979, Pitcher et al. 1989, Chomczynski & Sacchi 1987, Logemann et al. al. 1987, Ausubel et al. 2000). In this method, sarkosyl is added as a surfactant. The benzyl chloride method (Zhu et al. 1993) was developed as a simple and rapid method using benzyl chloride for cell destruction. Benzyl chloride reacts with polysaccharides, which are synthesized by bacteria, filamentous fungi, and plants as components of cell walls, that is, cellulose, and the OH group of hemicellulose, and destroys cells. As a result, DNA, which is a water-soluble molecule, is extracted from the organic layer of benzyl chloride to the aqueous layer, and this method has the advantage that protein can be removed simultaneously at the bilayer interface between the organic layer and the aqueous layer consisting of benzyl chloride by subsequent centrifugation. There is. Kits applying this method are also available (product names Isoplant, Nippon Gene, Japan).

Triton X100 is a nonionic surfactant, has a milder surface activity than ionic surfactants such as SDS and CTAB, and weaker protein denaturation. For this reason, it may be used for the purpose of extracting a membrane protein to be prepared while maintaining the activity, or maintaining and enhancing the activity of the enzyme in an enzyme reaction solution such as PCR. Triton X100 does not inhibit the PCR reaction up to a concentration of 1%, so it is used for simple DNA analysis combined with colony PCR and enzymatic reaction (Agersborg et al. 1997).
In the present invention, the type of surfactant is not limited as long as DNA can be extracted. For example, SDS, TritonX-100, N-lauroyl sarcosine sodium and the like are preferable, and SDS is more preferable.
In the case of SDS, the concentration of the surfactant used is 5.0% or less, preferably 0.1 to 2.0%, more preferably 0.5% to 2.0%, and even more preferably 0.5 to 1.0%. In the case of TritonX-100, it is 5.0% or less, preferably 0.1 to 2.0%, more preferably 0.5% to 2.0%, and further preferably 0.5 to 1.0%.

(4-2) pH of the extract
A weakly alkaline buffer having a pH of about 8.0 to 8.3 is usually used for DNA extraction. This pH condition is considered to be applied to the extract due to the stability of DNA, and is the same pH as the TE buffer used for storing the extracted DNA as a solution. On the other hand, most soils in Japan are weakly acidic with a pH of about 5.5 to 6.5, and some volcanic ash soils and non-allophane black soils also have an acidic soil with a pH of 4.5 to pH 5.5. Therefore, when extracting DNA from soil, not only the influence of the pH of the extract itself on the amount of extraction, but also the pH of the extract is affected by the acidity of the soil, and the pH during extraction changes. It is also necessary to consider.
In the present invention, the pH of the whole extract is 7 or more, preferably 8.0 to 9.0, more preferably around 8.6.

(4-3) EDTA concentration, Tris-HCl concentration and heat treatment Generally, when extracting DNA from organisms, EDTA is used to prevent DNA from being degraded by DNase released from cells. Is 1-100 mM. In DNA extraction from soil, the Tris-EDTA combination, which is often used in the field of molecular biology, is also used. In many soil DNA extraction methods, EDTA in the extract is considered to be used mainly for the purpose of DNase inactivation, and its concentration is 100 mM or less, which is sufficient to meet the purpose of use. (Eg Kuske et al. 1998, Arlene Porteous et al. 1994, Bell et al. 1999, Miller et al. 1999, Watson & Blackwell 2000, Burgmann et al. 2001).
At present, 100 mM EDTA (and 100 mM Tris, 100 mM Na ₂ HPO ₄ (pH 8.0)) is also used in the method of Zhou et al. (1996), which is a representative soil DNA extraction method. When the EDTA concentration is increased, the enzymatic degradation of DNA is suppressed and at the same time the adsorption to soil particles is reduced. There are reports that lower concentrations are preferred (Krsek & Wellington 1999). That is, the use of high-concentration EDTA has been avoided because of the disadvantage of contamination with humic substances rather than the advantage of increasing the yield of DNA, and the level of “high concentration” in this case is about 100 mM.

  As described above, volcanic ash soil, which is representative of Japan, is considered to be a soil that easily absorbs DNA. Soil rich in amorphous aluminum, such as Japan's volcanic ash soil, is scattered overseas only in a limited number of countries and regions such as New Zealand, and is not distributed over a wide area in the world. For many overseas researchers, allophane-rich soils are not the subject of study, and therefore most conventional soil DNA extraction methods have been developed without considering volcanic ash soils. Therefore, the setting of EDTA concentration was also examined in soils other than volcanic ash soil. However, EDTA, which is a strong chelating agent for metal ions that form many multivalent ions, is thought to form a complex with active aluminum that causes DNA adsorption in volcanic ash soil. It was considered that EDTA at other concentrations could be effective. In addition, even in soils other than volcanic ash soil, if DNA adsorption to the soil occurred, it was considered possible to extract more DNA by increasing the EDTA concentration.

For the analysis of amorphous components in volcanic ash soil, chelators with different complexing ability depending on the form of Al and Fe in the soil such as citric acid, oxalic acid and pyrophosphoric acid are usually used. By using these chelators with different reactivities, the amorphous components of the soil are selectively melted and quantitative analysis is performed. On the other hand, EDTA is a compound having an extremely excellent chelate stability constant for most metal ions among chelating agents. EDTA is used in DNA extraction and storage because DNase chelates the Mg ions necessary for maintaining its activity and inactivates DNase.
Therefore, similar to the chelator in the selective melting method, it may be possible to remove amorphous Al that causes DNA adsorption from soil using EDTA, or by adsorbing EDTA to the soil by carboxyl groups. We presumed that the adsorption could be canceled and examined the EDTA concentration in the extract. Since metal ions chelated by EDTA are extracted as a metal ion-EDTA complex in the solution, it was thought that it was possible to estimate which metal element caused the adsorption through this determination.

The concentration of EDTA used as the extract in the present invention is, for example, 20 mM or more.
When volcanic ash soil is subjected to soil DNA extraction by beads-beating treatment, the EDTA concentration is 50 mM or more, preferably 100 mM to 600 mM, preferably 200 to 400 mM, and more preferably 300 mM to 400 mM.
In the present invention, the extract containing EDTA having the above concentration is mixed with soil, and after beads-beating treatment, further containing a high concentration EDTA solution, the concentration is, for example, 600 to 1100 mM, preferably 600 to 800 mM. Heat treatment can be used in combination in an elevated state. The heating conditions are 45 ° C to 70 ° C for 0.5 to 24 hours, preferably 60 ° C for 1 hour. Thereby, DNA can be extracted from soil with higher yield.
In the present invention, the extract may contain a buffer such as Tris-HCl. The concentration of Tris-HCl is, for example, 100 mM. Tris-HCl can be included in the DNA extract throughout the present invention.

(4-4) Number of extractions In the present invention, the number of DNA extractions is not limited to one. The DNA extract containing EDTA is subjected to beads-beating and then centrifuged, and the supernatant is collected to obtain a DNA extract. The soil remains in the tube after collecting the supernatant. It is considered that this soil contains DNA which cannot be extracted by one extraction operation and remains adsorbed on the soil.
Therefore, in the present invention, the beads-beating step of the extract, the centrifugation step, and the supernatant collecting step can be repeated a plurality of times. The number of repetitions is, for example, 1 to 4 times (the total number of times is 2 to 5 times).

(4-5) Phosphate buffer Phosphate buffer is one of the typical buffers used in biological experiments. In DNA extraction from soil, many indirect extraction methods use phosphate buffer to separate microorganisms from soil (eg Torsvik et al. 1980), and direct extraction also uses phosphate buffer. Are often used (eg Ogram et al. 1987, Cullen & Hirsch 1998). Regardless of the direct extraction method or the indirect extraction method, the phosphate concentration when a phosphate buffer is used for DNA extraction is set to 100 to 120 mM. However, as reported by Bell et al. (1999), phosphate buffer causes more humic substance elution than Tris-EDTA buffer, which is very difficult to remove, Is better to use Tris-EDTA buffer than phosphate buffer. However, since EDTA and allophane-type Al in the soil have a slow reaction rate for complex formation, soil DNA cannot be sufficiently extracted using only EDTA buffer unless the reaction is accelerated by heat treatment. On the other hand, when phosphate ions are added to volcanic ash soil, it is known that they are adsorbed and passivated by Al and Fe in the soil in a very short time. In the volcanic ash soil rich in amorphous Al, that is, active Al, since the passivation of phosphoric acid is a major limitation in crop production, “phosphoric acid absorption coefficient” is regarded as important.

From these facts, it is considered that by adding phosphate ions to the soil, allophane-type Al involved in DNA adsorption can be masked and DNA adsorption can be suppressed.
The phosphate buffer that can be used in the present invention is not particularly limited, and examples thereof include a phosphate buffer such as a potassium phosphate buffer and a sodium phosphate buffer.
The concentration of the phosphate buffer used for the DNA extract is 250-2000 mM.
In the case of volcanic ash soil, it is 250-2000 mM, for example, and in the case of non-volcanic ash soil, it is 250-1000 mM, for example.

(4-6) Combined use of high-concentration EDTA and phosphate buffer
Regardless of whether EDTA or phosphate buffer is used as the DNA extract, the conditions (EDTA, phosphate, SDS concentration, etc.) for obtaining the maximum yield of DNA vary depending on the soil. In addition, in the precipitation purification operation, problems such as the high-concentration buffer not being mixed with each other caused problems, so an attempt was made to use EDTA and phosphate buffer together.
In the present invention, the concentration of EDTA is 100 to 800 mM, for example, 200 to 800 mM, and the concentration of phosphate buffer (for example, potassium phosphate buffer) is 250 to 2000 mM, for example, 250 to 1250 mM. it can. By using EDTA and phosphate buffer in combination, the concentrations of EDTA and phosphate buffer can be kept lower than when using each of them alone.
The combination when used for volcanic ash soil is preferably 100-600 mM EDTA and the phosphate buffer is 250-1500 mM (eg 250-1250 mM), the combination when used for non-volcanic ash soil is EDTA Is preferably 100 to 400 mM and the phosphate buffer is preferably 250 to 1250 mM. In both cases of volcanic ash soil and non-volcanic ash soil, a combination of 400 mM EDTA and 750 mM phosphate buffer is most preferable. The combination of the 400 mM EDTA and the 750 mM phosphate buffer can provide almost the maximum yield of DNA for almost all soils, so this combination can be said to be a so-called “universal buffer composition”.

However, the universal buffer composition may cause soil DNA to have a low molecular weight (20 to 7 kbp) depending on the soil. In analyzing the microbial community structure, since only a comparatively short DNA region (200 to 1500 bp) is generally targeted for analysis, the objective can be sufficiently achieved even with a somewhat low molecular weight DNA. However, if the fragmented DNA such as cloning is inconvenient, or if you want to analyze more accurately even in the case of community structure analysis, the extraction conditions (concentration of EDTA and phosphate buffer) will give you higher molecular weight DNA. Is set as appropriate.
In the present invention, the soil sample can be mixed with an extract containing SDS or TritonX-100, EDTA and phosphate buffer, and this can be heat-treated. The concentration of SDS or TritonX-100 is 5% or less, the concentration of EDTA is 100 to 800 mM, for example 200 to 800 mM, and the concentration of phosphate buffer (for example, potassium phosphate buffer) is 250 to 2000 mM, for example 250. It can be used in a range of ˜1250 mM. The heating conditions are 45 ° C to 70 ° C for 0.5 to 24 hours, preferably 60 ° C for 1 hour.

(4-7) Two-step method In the present invention, when recovering DNA from soil, beads-beating (first stage) uses a low-concentration EDTA / phosphate buffer solution, and the extraction stage (second stage). ), DNA can be extracted more efficiently by using a high concentration EDTA / phosphate buffer. In this way, the operation of setting the concentration to two levels and extracting is called “two-step method”. By adopting the two-step method, it is possible to extract DNA efficiently and to avoid lowering the molecular weight of DNA.
In the first stage, 5% or less of SDS (preferably 1% SDS) or 5% or less of a mixture of TritonX-100 and Tris-HCl buffer (this is referred to as “extract I”) is used.

After beads-beating the soil sample in the presence of DNA extract I above, perform a simple high-speed centrifugation for several seconds to collect the soil solution at the bottom of the tube, and then extract with high concentrations of EDTA and phosphate buffer Prepare a liquid (referred to as “Extract II”) and stir well. The composition of the extract II is the above extract I, for example,
(i) 75-1200 mM, preferably 600-1200 mM EDTA,
(ii) 250-3000 mM, preferably 750-2250 mM phosphate buffer, or
(iii) It can be prepared by mixing a mixture of the above EDTA (preferably 100 to 600 mM) and a phosphate buffer (preferably 250 to 1250 mM). For EDTA and phosphate buffer mixed with Extract I to make Extract II, the concentration of EDTA is 400-800 mM, and the concentration of phosphate buffer is more preferably 750-1500 mM, Most preferably, the EDTA concentration is 400 mM and the phosphate buffer concentration is 750 mM.

Thereafter, the extract II is centrifuged to extract DNA, and the DNA is recovered from the supernatant.
In the present invention, the two-step method described above can be further improved to increase the DNA extraction efficiency and to suppress the reduction in the molecular weight of the DNA. This improvement method is referred to as “two-step improvement method”.
In this case, the extract used in the first step is 5% or less SDS (preferably 1% SDS) or 5% or less TritonX-100, Tris-HCl buffer, 400 mM or less EDTA and 250 mM or less phosphorus. It contains an acid buffer (referred to as “extract III”). In Extract III, EDTA is preferably 300 mM, and the phosphate buffer is preferably 100 mM. Then, the soil sample is subjected to beads-beating treatment in the presence of the extract III.

Next, 400 to 1000 mM (preferably 400 to 600 mM) EDTA, 750 to 2050 mM phosphate buffer, or a mixture of the EDTA and phosphate buffer is mixed with the extract III after beads-beating treatment. Prepare the extract. The extract thus prepared is referred to as “Extract IV”.
For EDTA and phosphate buffer mixed with Extract III to prepare Extract IV, the EDTA concentration is preferably 400 mM, and the phosphate buffer concentration is preferably 750 mM.
Thereafter, the extract IV is centrifuged, and the DNA is recovered from the supernatant.

  In the present invention, when performing the above-described two-step method and two-step improvement method, after preparing the extract II in the two-step method, and after preparing the extract IV in the two-step improvement method, It is also possible to extract the soil DNA by heating the soil sample in the presence (for example, at 60 ° C. for 1 hour) to increase the recovery rate of the soil DNA from the soil. Further, in the present invention, before performing the above-described two-step method and two-step improvement method, soil in the presence of an extract (referred to as “extract V”) containing 100 to 400 mM EDTA and 250 to 1500 mM phosphate buffer. The sample is heated (for example, at 60 ° C. for 1 hour) or beads-beating, and the treated extract V is centrifuged and the supernatant is recovered (referred to as “supernatant I”). Extract III can be added to beads-beating, the treated solution can be centrifuged to obtain a supernatant (referred to as supernatant II), and soil DNA can be recovered from supernatant I and supernatant II.

In addition, a soil sample is heated (for example, 1 hour at 60 ° C.) or beads-beating treatment in the presence of a solution containing 100 to 800 mM EDTA and 250 to 2000 mM phosphate buffer, and the treated solution is subjected to SDS or It is also possible to recover the soil DNA from this supernatant by adding the extract III and further heat-treating and then centrifuging.
Furthermore, in the present invention, DNA can be extracted by combining heat treatment and beads-beating in the absence of SDS first (the following (i) to (iv)).

(i) SDS Free heating + beads-beating method First, heat-treat a soil sample in the presence of a DNA extract containing 100 to 400 mM EDTA and 250 to 1500 mM phosphate buffer (referred to as “extract V”). . As in the above, the heat treatment conditions are 45 ° C. to 70 ° C. for 0.5 to 24 hours, preferably 60 ° C. for 1 hour. In this case, the extract V is preferably 400 mM EDTA and 750 mM phosphate buffer.
Next, the supernatant V is collected by centrifuging the extract V after the heat treatment. Since the soil sample remains in the tube after collecting the supernatant, this is converted to DNA containing 5% or less of SDS, Tris-HCl buffer, 400 mM or less of EDTA, and 250 mM or less of phosphate buffer. The beads-beating process is performed in the presence of the extract III. Thereafter, the extract III is centrifuged to collect a supernatant, and DNA is collected from the two collected supernatants.

(ii) SDS Free beads-beating + beads-beating method
The soil sample is beads-beating in the presence of DNA extract V containing 100-400 mM EDTA and 250-1500 mM phosphate buffer. Next, the supernatant is collected by centrifuging the extract V after the beads-beating treatment. The remaining soil sample is subjected to beads-beating treatment in the presence of DNA extract IV containing 5% or less of SDS, Tris-HCl buffer, 400 mM or less of EDTA and 250 mM or less of phosphate buffer. Thereafter, the extract IV is centrifuged to collect a supernatant, and DNA is collected from the two collected supernatants.

(iii) SDS Free heating + heating method
The soil sample is first heat treated in the presence of a DNA extract containing 200-800 mM EDTA and 250-2000 mM phosphate buffer. This is mixed with 5% or less SDS and the soil sample is subjected to a second heat treatment. Then, after the second heat-treated extract is centrifuged, DNA is recovered from the supernatant. In this case, the extract is preferably 400 mM EDTA and 750 mM phosphate buffer.
(iv) SDS Free beads-beating + heating method
Soil samples are beats-beated in the presence of a DNA extract containing 100-400 mM EDTA and 250-1500 mM phosphate buffer. The soil sample is heat-treated by mixing this with 5% or less of SDS. Thereafter, the extract is centrifuged, and DNA is collected from the supernatant.

(4-8) Summary -Extraction of soil DNA-
In the present invention, as a result of various studies on DNA extraction, the following can be said.
(i) When extracting DNA from soil, the pH of the extract must be stable at around 8.6.
(ii) The biggest cause of difficulty in extracting DNA from volcanic ash soil is the adsorption of DNA by the soil.
(iii) For extracting DNA from volcanic ash soil, it is effective to use high concentrations of EDTA and phosphoric acid to eliminate the adsorption of DNA by amorphous Al.

(iv) The concentration of EDTA and phosphate in the extract from which the maximum yield of soil DNA is obtained varies depending on the soil.
(v) Phosphoric acid has a high DNA extraction effect. However, when using it for volcanic ash soil, it is necessary to use it at a very high concentration, so be careful about reducing the molecular weight of DNA.
(vi) By coexisting EDTA and phosphoric acid, a complementary effect to soil DNA extraction is observed, and the DNA extraction effect is high even when used at a relatively low concentration.
(vii) 400 mM EDTA / 750 mM phosphate buffer / 1% SDS extract can be said to have a universal extract composition that can extract most soil DNA regardless of whether it is volcanic ash soil or non-volcanic ash soil.

(viii) It is necessary to pay attention to the salt concentration at the time of beads-beating in order to prevent the lowering of the molecular weight of the DNA, and the lowering of the salt concentration during the operation can prevent the lowering of the molecular weight of the DNA.
(ix) Polymer DNA can also be obtained by performing beads-beating with a low-concentration buffer and then peeling the DNA with a high-concentration EDTA-phosphate buffer. In this case as well, the recovery rate of soil DNA with 400 mM EDTA / 750 mM phosphoric acid is the best.
(x) Even if beads-beating or heat treatment is performed with a high-concentration EDTA-phosphate buffer, if the surfactants SDS and TritonX100 are not included, the molecular weight of the soil DNA can be suppressed. Polymer DNA can be extracted by adding and extracting an extract containing a surfactant in beads-beating or heat treatment.

5). Purification and recovery of DNA Techniques often used for gene analysis include PCR reaction, cloning, sequencing, hybridization, gene expression test and the like. In particular, the PCR reaction is an essential and indispensable elemental technique for many gene analyses, and is also an essential operation for microbial community structure analysis based on genetic information. Also in the case of DNA extraction from soil, attention is paid to whether or not a PCR product can be obtained using the extracted DNA as a template, and the success or failure may be used as one index for judging the purity of soil DNA. (Tsai & Olson 1992, Watson & Blackwell 2000).
The DNA extract from soil contains debris such as cell membranes and cell walls of microorganisms and plants, proteins denatured by surfactants, soil organic matter such as humic substances accumulated in the soil itself, and heavy metals. It is desirable to remove these impurities as much as possible for subsequent analysis.

  In the case of a small amount of contamination of cell components derived from microbial cells, the PCR reaction is not significantly inhibited. The reason is that these bacterial cell constituents do not inhibit the action of DNA polymerase that originally functions in the same bacterial cell. In fact, colony PCR using E. coli and other cultured strains as a material is frequently performed, and these are added to the PCR reaction solution and the bacterial protein is denatured by heating the PCR reaction to transform the DNA. The product is released into the reaction solution and undergoes a PCR reaction. Although the cells themselves are present in the PCR reaction solution, PCR is not inhibited. However, when DNA is extracted from soil, a large amount of various substances other than such cell constituents are present, and these are mixed into the DNA sample along with the extraction operation. In particular, it is known that humic substances strongly inhibit the PCR reaction even with trace amounts of nanograms (Tsai & Olson 1992, Boon et al. 2002, Watson & Blackwell 2000). Therefore, it is important to remove this humic substance from the DNA solution as much as possible.

  A number of studies have been conducted on soil DNA purification. Of these, gel filtration, agarose electrophoretic excision, hydroxyapatite columns, glass powder or silica membrane purification utilizing chaotropic effects, separation and purification using magnetic beads, etc. are often performed. Purification of DNA by gel filtration is most commonly used to separate soil DNA and humic substances (Miller et al. 1999, Howeler et al. 2003). Spin columns that can be purified by simply centrifuging the sample between the resin packed in the column have also been commercialized. The principle of purification of soil DNA by gel filtration has been studied in detail by Miller (2000). Resin products used for gel filtration include Sephadex, Sepharose, Bio-Gel, and Toyopearl, but their molecular sieving effects and properties are different, and Sepharose 4B is the most highly evaluated for the purpose of separating humic substances and DNA. (Miller 2001, Jackson et al 1997).

  However, purification by gel filtration requires complicated packing of the resin into the column and fractionation of the DNA fraction (because the conditions for the amount of resin packed and the amount of eluate are quite strict), and all humus The problem is that some of the humic substances are not mixed in the DNA fraction. The humic substances accumulated in the soil are all different in nature, form and molecular weight, and even if we try to purify based on the knowledge obtained about the humic substances contained in several types of soil samples, It is thought that this is because the characteristics of humic substances mixed in are different. In addition, a column with a volume of 2 ml or less, which is usually used, naturally has a small sample load and can purify only a very small amount of DNA solution.

The DNA excision operation after agarose gel electrophoresis is to separate only macromolecules from lower molecular weight humic substances and recover only DNA (Zhou et al. 1996, Kurien et al. 2001, Kurien & Scofield 2002, Chandler et al. 1997), but the excision operation from an agarose gel is extremely complicated.
In addition to these, in order to reduce the contamination of humic substances as much as possible during DNA extraction, many studies have examined the composition of the buffer solution, etc.In addition, in order to remove rough humic substances from the soil DNA extract, CTAB and A humic substance remover such as PVPP is often used.

(5-1) Purification
The DNA purification step is a step of purifying DNA by mixing the aforementioned bead-beating treatment or heat-treated extract with CTAB and salt, or centrifuging the bead-beating treatment or heat-treated extract. And a step of purifying DNA by mixing the supernatant after centrifugation with CTAB and a salt. DNA purification means removal of impurities other than DNA contained in the DNA extract. In addition, the purification method of the present invention not only targets the extraction solution or the extracted DNA in the extraction step, but also the DNA extracted by a method other than the extraction method (or a solution containing DNA). Can also be purified.
For purification using CTAB and salt, CTAB and any salt solution are mixed with the soil DNA extract (to make the acid side weakly acidic with a buffer having a buffering capacity on the acidic side), and 45 ° C to 70 ° C (eg 60 ° C) ℃) and deproteinization with chloroform.
The concentration of CTAB is 1 to 3%, preferably 2 to 3%.

In general, DNA is more easily extracted from soil under alkaline conditions, so the extract contains highly buffered substances such as Tris-HCl, EDTA, and phosphate buffer, and the extract remains alkaline. . Therefore, it is necessary to make the pH weakly acidic after canceling these buffering capacities. Therefore, it is preferable to use a salt having a buffering capacity on the weakly acidic side.
“Salt” refers to a substance that can add a monovalent cation of 1.0 M or more to an extract and adjust the pH to a weak acidity of 5.0 to 6.5.

Such salts include, for example, sodium chloride (NaCl), sodium acetate, potassium acetate, ammonium acetate, sodium phosphate, potassium phosphate, and ammonium phosphate. In this case, the concentration of NaCl, sodium acetate, potassium acetate, ammonium acetate, sodium phosphate, potassium phosphate and ammonium phosphate is 0.7 to 2.1M. And about NaCl, sodium acetate, potassium acetate, and ammonium acetate, 1.0M or more is preferable, and about 0.7M or more about sodium phosphate, potassium phosphate, and ammonium phosphate, and any salt should be 1.0-1.4M. More preferred. The pH of sodium acetate, potassium acetate, ammonium acetate, sodium phosphate, potassium phosphate, and ammonium phosphate is preferably 5.0 to 6.0. The monovalent cation refers to Na ⁺ , K ⁺ , NH ₄ ^{+ and the} like.

However, the salt is not limited to the above-mentioned substances, and all salts that can add 1.0 M or more monovalent cation to the extract and can be adjusted to pH 5.0 to 6.5 are included in the present invention.
In the present invention, humic substances can be removed from the soil DNA solution to a level at which PCR is not inhibited by adding CTAB to the extract. Then, a method suitable for sedimentation of soil DNA can be searched and optimum purification conditions can be determined in combination with the soil DNA extraction method developed above.
In the present invention, it is more preferable that the CTAB concentration is 2-3% and the salt concentration is 1.4M.

(5-2) Precipitation
Methods for separating and recovering DNA from a solution include a method of precipitating DNA, a method of adsorbing on a silica surface by a chaotropic effect, and a method of separating from a solution using magnetic beads. The most commonly used method is a method of precipitating DNA, which utilizes the fact that DNA is precipitated in the presence of ethanol or 2-propanol at a certain concentration or higher. Since ethanol precipitates DNA at a concentration of about 70%, it is necessary to add 2 to 2.5 times the amount of ethanol compared to the extract, and it can be used for ethanol precipitation when extracting on a mini-scale using a microtube. The amount of extract is small and the efficiency is poor.
On the other hand, 2-propanol has the stronger effect of precipitating DNA than ethanol, and DNA is obtained in 6/10 equivalents of the extract. Therefore, 2-propanol is most often used for DNA extraction on a mini scale.

In the present invention, as described above, DNA is collected by making it weakly acidic with acetic acid or phosphate buffer having a buffering capacity on the acidic side, and then precipitating soil DNA. In the present invention, precipitation includes both (i) the step of precipitating the sample after the extraction and purification steps, and (ii) the step of precipitating the sample after the purification step.
Substances used for precipitation include 2-propanol, ethanol or polyethylene glycol, with polyethylene glycol (PEG) being preferred. The concentration of PEG is 10 to 15%, preferably 12% (PEG concentration in solution: 5 to 7.5%). In addition, polyethylene glycol 8000 (PEG) is also used. PEG is often used to remove primers from PCR products prior to sequencing reactions (Kusukawa et al. 1990). PEG solutions are highly selective for the substances to be precipitated, and RNA that is structurally very similar to DNA does not precipitate. Moreover, even if it is the same DNA, the primer which is a short chain does not precipitate, but it has been shown that the size is also selective (Paithanker & Prasad 1991, Lis 1980, Sambrook et al 1989). Since PEG precipitates less contaminants than other alcohols, it is often used in research to extract DNA from samples that are prone to contamination, such as soil and compost (Ogram et al 1987, Porteous et al 1997, Howeler et al 2003, LaMontagne et al 2002).

By the way, when PEG precipitation is performed under weakly acidic conditions, there is a possibility that humic substances or contaminants that could not be completely removed may be precipitated together with DNA.
Therefore, the present invention can preferably employ one of the following two means.
(a) After purification of CTAB, the supernatant (so-called aqueous layer) recovered by deproteinization with chloroform or the like is mixed with Tris buffer (pH 8.0 or higher) etc., and the pH is again adjusted to the alkaline side (pH 8.0). Return to ~ 8.6), add PEG, and centrifuge at high speed to recover DNA.
(b) Improve the composition of the PEG solution. That is, PEG / Tris-HCl is prepared (the pH of this solution is 8.0 to 8.6), thereby precipitating with PEG. However, the buffer solution combined with PEG is not limited to the above Tris-HCl as long as the pH can be raised, and other buffer solutions such as a phosphate buffer solution can also be used.

(5-3) Summary
(i) The combination of CTAB purification (purification on the weak acid side) and PEG precipitation (precipitation on the alkali side) can be used only for the purification of soil DNA.
(ii) It is also possible to carry out the purification treatment on the weakly acidic side using a salt having a buffer capacity other than NaCl during CTAB purification.
(iii) With a series of protocols such as extraction, purification, and precipitation, soil DNA can be obtained even if each step is used independently even if not all are performed, or extracted by a method other than the above extraction method. Soil DNA can be purified.

6). DNA Extraction, Purification and / or Recovery Kit The present invention provides a kit for extracting, purifying or recovering the soil DNA.
A kit for extracting DNA from an environmental sample contains 5% or less surfactant or a combination of the surfactant and beads for beads-beating. That is, the DNA extraction kit of the present invention is basically composed of a surfactant (SDS, CTAB, Triton X-100 or N-lauroyl sarcosine sodium), and beads, EDTA, phosphate buffer used for beads-beating. Solution, alkaline buffer (Tris buffer such as Tris-HCl), pH adjuster and the like. The DNA extraction kit of the present invention can be adjusted to pH 7.0 or higher with an alkaline buffer.
In the extract used in the present invention, the concentration of EDTA can be arbitrarily selected from the range of 50 mM to 1200 mM. Further, the concentration of the phosphate buffer can be arbitrarily selected from the range of 50 mM to 3000 mM.

  In addition, the DNA extract can be divided into stages in stages so that the concentration can be appropriately set according to the soil used. For example, the SDS may be adjusted in several steps in the range of 0.1% to 2.0%. Prepare one type of high-concentration SDS so that the experimenter can adjust the concentration. It can also be made possible. In the case of EDTA or phosphate buffer, it is also possible to include one with a concentration adjusted stepwise such as 50 mM, 100 mM, 200 mM, 300 mM, 400 mM, or one with a high concentration (for example, 1 M). Further, it can be diluted with a diluting solution to an arbitrary concentration. Further, a combination of 400 mM EDTA and 750 mM phosphate buffer can be included in the kit as a universal buffer composition.

Furthermore, the present invention provides a kit for purifying DNA from an environmental sample, comprising a salt solution containing a pH buffer having an acidic pKa, a cationic surfactant, or a mixture of the salt solution and a cationic surfactant. I will provide a. Examples of the pH buffer solution having pKa on the acidic side include an acetate buffer solution, a phosphate buffer solution, a hydrochloric acid buffer solution, and a sulfate buffer solution. This kit can contain a cationic surfactant (such as CTAB) for DNA purification and the salt. It is possible to adjust the pH during purification to less than 7.0 by using the pH buffer having the above acidic pKa in a mixture with a salt.
Furthermore, the present invention provides a kit for recovering DNA from an environmental sample containing an alkaline buffer (for example, a Tris buffer). This kit can also contain 2-propanol, ethanol, PEG, or the like for use in precipitation. With the buffer solution, the pH of the DNA solution at the time of recovery can be adjusted to 7.0 or higher.

  Further, in the present invention, two or more sets are appropriately selected from the above DNA extraction kit, DNA purification kit, and DNA recovery kit, and the DNA extraction and purification, DNA extraction and recovery, DNA purification and recovery, or DNA of the present invention A kit set for extraction, purification and recovery is also provided. In the present invention, a combination of two or more of such DNA extraction, purification and recovery is referred to as DNA acquisition. Therefore, DNA can be obtained (extraction, purification, recovery, or a combination thereof) by using a combination of kits.

  Hereinafter, the present invention will be described more specifically with reference to examples. However, the present invention is not limited to these examples.

  In the present invention, the detailed concentration range is described in the examples, but the concentration range is an exemplification, and is not limited as long as it does not depart from the object of the present invention.

[Example 1] Examination of use conditions of surfactants In this example, DNA was extracted by two types of treatments using representative surfactants and benzyl chloride, and heating and beads-beating as cell destruction treatments. Experiments were conducted to examine the most suitable surfactant for extracting DNA from soil and the conditions for its use.

(1) Materials and methods For the extraction test, soil in the compost area of the soil area science laboratory pesticide continuous field installed in the Yayoi field of the University of Tokyo's Faculty of Agriculture, paddy field soil in the Saitama Agricultural Experiment Station (formerly paddy field in Nagano) 3 types of forest soils were used, which were transferred from the soils that had been used as customer soils (hereinafter referred to as Konosu paddy soils) and Tohoku University farms (Kawawatari). They are allophane black soil, gray lowland soil, and non-allophane black soil, and their physicochemical properties are greatly different from each other (Table 1).

The physicochemical properties of each soil were determined by extracting pH (H ₂ O) and pH (KCl) with a 1: 5 water and 1 N KCl extraction method, and total nitrogen and total carbon with an N / C analyzer. And pyrophosphoric acid extraction Al and Fe were performed by the method of soil environment analysis method (edited by the soil environment analysis method editorial committee 1997) and the method of Blackmore et al. (1981). All soils used throughout this study should be stored moist in a cold room at 4 ° C if not used for experiments immediately after sampling, and pass through a 2mm sieve to 70% of maximum water capacity when used. The test soil was prepared by preparing a water content and preincubating at room temperature for about 2 weeks.

  Five kinds of extracts of 2% SDS extract, 2% CTAB / 1.4 M NaCl extract, 8 M guanidine thiocyanate extract, 2% SDS and benzyl chloride extract, and 2% TritonX100 extract were added to 0.5 g of these soils. 1.2 ml each was added, followed by beads-beating treatment (treatment at an intensity of 5 m / sec for 30 seconds) or heat treatment at 65 ° C. for 1 hour. Thereafter, the mixture was centrifuged at 12000 × g for 10 minutes, the supernatant was recovered, an equal amount of chloroform was added, the mixture was stirred well, and centrifuged again to remove proteins. 700 μl of the aqueous layer was collected, 1/10 volume of 3 M sodium acetate was added thereto, 6/10 volume of 2-propanol was added, and the mixture was centrifuged at 20000 × g to precipitate DNA. After centrifugation, the DNA precipitate was washed with 70% ethanol, dried and dissolved in 100 μl of TE buffer, and this was used as extracted DNA.

Since the extracted soil DNA solution purification operation was not performed, a considerable amount of humic substances were mixed. In this state, the amount of DNA could not be measured by absorbance or the like. Therefore, in order to quantify DNA without the influence of humic substances, the extracted DNA was electrophoresed on a 1% agarose gel, and humic substances with long migration distances were sufficiently separated from DNA due to low molecular weight, and then SYBR Green I The sample was stained with (diluted 10,000 times with TAE buffer), and the luminance of the DNA band was measured. In order to create a calibration curve that shows the correlation between DNA brightness and DNA amount, each gel was run with 10 ng to 50 ng at 10 ng intervals using λHind III Digest as a standard sample. Created. In addition, DNA with a size of 2000 bp or more was used as a quantification target. The measuring instrument used was a fluoro image analyzer Fla-5000 (Fuji Photo Film Co., Ltd.), and ImageGauge 4.0 (Fuji Photo Film Co., Ltd.) was used for image processing to quantify the luminance. A quantitative example in an agarose gel is shown in FIG.
Table 2 shows the buffer composition and various physical conditions of each surfactant.

  In addition, the beads-beating process was performed under the conditions shown in Table 3 in all experiments described later including this test.

  This bead composition was prepared with reference to the knowledge of Burgmann et al. (2001). All experiments were performed in triplicate.

(2) Results and discussion The results regarding the amount of soil DNA extracted are shown in FIG. Regardless of the heat treatment and beads-beating treatment, when using SDS and Triton X100, the extraction efficiency of soil DNA was good, and the molecular weight of the DNA, which was probably caused by the surfactant, was not observed. The combination of beads-beating treatment and SDS was more extracted than the other combinations, and for Yayoi field compost continuous soil, it was possible to extract nearly 30 μg of DNA from 1 g of soil.
CTAB and guanidinium thiocyanate failed to extract a sufficient amount of DNA from soil samples, but the extract was almost colorless, and the effect of preventing the extraction of humic substances from the soil was very strong. It became.

  For the benzyl chloride method, a considerable amount of DNA was confirmed by electrophoresis, but the molecular weight of the extracted DNA was remarkable. That is, when extracted by heating, the size was 8000 bp or less, and most of beads-beating size was 2000 bp or less, and it was found that benzyl chloride easily causes DNA fragmentation. In addition, since the result of quantifying only DNA having a size of 2000 bp or more is shown in FIG. 2, the yield of the benzyl chloride method appears extremely small.

Comparing the heat treatment and the beads-beating treatment, the beads-beating treatment could be extracted in a very short time, and the yield of DNA was larger than that of the heat treatment. In addition, it was speculated that the heat treatment extracted more humic substances than the beads-beating process, and it was difficult to remove the humic substances. The size of the DNA estimated from the electrophoresis gel was slightly reduced in the range of 20 kbp to 7 kbp mainly from those obtained by beads-beating treatment with a size of about 20 kbp. On the other hand, the DNA obtained by heat treatment had a size of 23 kbp or more and almost no decrease in molecular weight.
Based on the above results, in the future experiments, SDS with high extraction efficiency will be used as a surfactant, and the bead-beating process, which requires a short operation and high yield, will be used as the cell destruction process. did.

[Example 2] Determination of optimum concentration of SDS In Example 2, based on the result of Example 1, the optimum concentration of SDS used for the extract of soil DNA was examined.

(1) Material and method experiment 1
In the Yayoi field compost soil, we set the level of SDS concentration from 0% to 2%, and examined the optimal SDS concentration conditions for soil DNA extraction. The experimental conditions other than the SDS concentration were 100 mM Tris-HCl 100 mM EDTA (pH 8.6), and the other conditions were the same as in Example 1 (beads-beating conditions). All experiments were performed in triplicate.
Experiment 2
The composition of the extract was 100 mM Tris-HCl 300 mM EDTA (pH 8.6). Otherwise, using the same conditions as in Example 1, a step from 0% to 2% was provided for the SDS concentration, and soil DNA was prepared. The optimal SDS concentration for extraction was studied. Details regarding the EDTA concentration will be described later. For the experiment, six types of soil shown in Table 4 were used as test soils.

  Of these, Yayoi field compost continuous soil and Tochigi agricultural soil, Tohoku University forest soil is volcanic ash soil, Osaka agricultural soil soil, Hyogo agricultural soil soil, Saitama agricultural soil soil is non-volcanic ash soil (alluvial soil) It is. The experiment was performed in triplicate.

(2) Results and Discussion The results of Experiment 1 are shown in FIG. 3, and the results of Experiment 2 are shown in FIG. In the case of 100 mM EDTA and 300 mM EDTA, the amount of extracted soil DNA increased as the SDS concentration increased from 0% by 0.5, compared to 0.5% even at SDS concentrations higher than 0.5%. There was no significant difference in the amount extracted. Therefore, in order to extract the maximum amount of soil DNA under the test conditions, it was shown that an SDS concentration of 0.5% was required. However, as the SDS concentration increases, the amount of extracted humic substances also increases (estimation based on visual observation of the degree of coloration of the extract), and there is a problem that the extract becomes bubbling and the sample becomes difficult to handle. Therefore, it is better to keep the SDS concentration at 0.5 to 1%.

[Example 3] Examination of pH of extract In this example, appropriate pH and buffer capacity of the extract were examined.

(1) Material and method The soil used was two points, Yayoi field compost continuous soil and Saitama agricultural trial soil. The physicochemical properties are shown in Table 5.

  The extract was a Tris-EDTA buffer extract. Add 1.2 ml of an extract consisting of 100 mM Tris-HCl / 100 mM EDTA / 1% SDS with pH of the extract to four levels of 9.0, 8.0, 7.0, and 6.0 to 0.5 g of soil, and perform beads-beating treatment. DNA was extracted, and after protein removal, DNA precipitation and quantification were performed.

(2) Results and discussion The results are shown in FIG. For DNA extraction from any soil, the higher the alkaline extract, the higher the yield within the pH range tested. When the pH of the crude extract immediately after the beads-beating treatment was measured, it was found that the pH of all soils decreased due to the acidity of the soil. It was found that lowering the pH during extraction not only impairs the chemical stability of the DNA, but it also needs to be maintained alkaline because the yield of soil DNA is reduced. For this reason, it was considered necessary to use an extract with a buffering capacity in consideration of the acidity of the soil in a low concentration buffer system.
However, when the extract is prepared by mixing a 1M Tris-HCl solution and a 0.5M EDTA solution having a pH of 8.3, the pH rises to 8.6 and is stable. It was confirmed that the pH of the solution after extraction was almost the same as that of the extract before extraction because of the buffer capacity of these EDTA and phosphate buffer. Therefore, in the extract using high-concentration EDTA and phosphate buffer, the pH of the solution before and after the extraction was almost constant at 8.6, and it was considered that the pH change at the time of extraction need not be considered.

Example 4 Elimination of DNA Adsorption by Soil In this example, the influence of the EDTA concentration of the extract on DNA yield and metal ion extraction amount was examined.

(1) Materials and methods The basic conditions for soil DNA extraction are the same as in Example 1, and only the EDTA concentration of the extract is 9 levels of 0, 10, 20, 30, 50, 100, 200, 300, 400 mM. 6 types of soil are used as test soils: Yayoi field compost continuous soil, Tochigi agricultural forest soil, Tohoku University forest soil, Saitama agricultural experimental soil, Osaka agricultural experimental soil, Hyogo agricultural experimental soil It was. The physicochemical properties are shown in Table 6.

  The amount of soil DNA extracted and the concentrations of Al, Fe, Ca, and Mg dissolved in the crude DNA extract (supernatant centrifuged after beads-beating) were analyzed. These metal elements are the main elements in soil, and are thought to be elements that can cause DNA adsorption by soil. The amount of extracted soil DNA was quantified by the same method as in Example 1, and the metal element was quantified by ICP emission analysis (Seiko SPS-1200) after appropriate dilution. The experiment was performed in triplicate.

(2) Results and discussion
About the influence which EDTA density | concentration has on soil extraction DNA, FIG. 6 shows an example of a photograph of DNA stained after agarose gel electrophoresis, and FIG. 7 shows the result of quantifying the amount of soil DNA extraction. In addition, the quantitative results of the metal elements in the crude extracted DNA solution are shown in FIGS. The metal element considered to be chelated and extracted by EDTA is considered to be an EDTA-metal element complex. EDTA-metal element complex formation rate relative to the total amount of EDTA, that is, the ratio of actual EDTA used, the complex formation rate of each of the four elements and the EDTA metal element complex formation rate of the four elements combined Asked. This is shown in FIGS.

(2-1) Volcanic ash soils In volcanic ash soils, the amount of DNA extracted increased with increasing EDTA concentration in the extract in all three types of soil. In particular, in Tochigi Agricultural Experiment Forest soil, DNA was not extracted at all unless the EDTA concentration was 100 mM or higher, and more polymer DNA was obtained when the concentration was 300 mM or higher. As mentioned above, the phosphate group, which is presumed to be the main cause of DNA adsorbing to soil, exists for each nucleotide that is a constituent unit of DNA, and part of the phosphate group of long DNA molecules It is thought that DNA is not released into the solution by being adsorbed to the soil particles. In view of this, it is presumed that the higher the DNA, the higher the ability to adsorb firmly to soil particles. From the electrophoresis results of agarose gel, only low molecular weight DNA can be extracted if the EDTA concentration is low in Yayoi field compost continuous soil or Tochigi agricultural forest soil, and high molecular weight DNA has begun to be extracted for the first time by high concentration EDTA. Yes. In order to extract polymer DNA from volcanic ash soil, it became clear that a high concentration EDTA solution should be used.

  A high concentration of EDTA eluted a large amount of metal elements from the soil. DNA was extracted from Yayoi field compost continuous soil by EDTA at a relatively low concentration. Most of the metal elements extracted from Yayoi field compost continuous soil are Ca and Al is little. The Yayoi field is a volcanic ash soil, but it is known that Ca accumulated in the soil due to long-term composting, and the metal element composition contained in the soil was greatly affected. In soil containing a large amount of amorphous aluminum, such as forest soil from Tochigi Agricultural Trial and Tohoku University forest soil, if amorphous aluminum in the soil that adsorbs DNA is not removed by a sufficient amount of EDTA, the soil Most DNA is not extracted.

  For Tochigi Agricultural Experiment Forest soil and Tohoku University forest soil, metals other than Al, that is, Fe, Ca, and Mg, have already obtained the maximum extraction amount at an EDTA concentration of 50 mM or less. Even when the concentrations were set, the amount of extraction was hardly increased. However, Al is significantly affected by the EDTA concentration, and the complex formation rate is high until the EDTA concentration reaches 100 mM, and Al is eluted from the soil corresponding to the EDTA concentration. In addition, the elution amount of Al gradually increases even at a concentration of 100 mM or more. In Tohoku University forest soil, EDTA concentration is 50 mM, and in Tochigi Agricultural Experiment Forest soil, soil DNA begins to be extracted at a concentration of EDTA of 100 mM, and beyond that, the amount of DNA extracted increases in proportion to the EDTA concentration. Yes. Adsorption of DNA by soil is caused by amorphous Al in the soil, and it is suggested that extraction is possible only after the amount of Al adsorbing DNA is removed by EDTA. From these facts, it was considered that one of the reasons why DNA could not be extracted from volcanic ash soil by the conventional method was adsorption of DNA by EDTA-soluble amorphous Al.

(2-2) Non-volcanic ash soil In non-volcanic ash soil, soil DNA was extracted even when the EDTA concentration was 50 mM or less. In all three types of soil, the yield was the highest at an EDTA concentration of about 100 to 200 mM, and the DNA yield decreased at higher concentrations. Most of the metal ions extracted from non-volcanic ash soils are Ca. In these soils, even if the EDTA has a low concentration of 50 mM or less where the total amount of Ca that is considered to be extracted by EDTA cannot be extracted, that is, even if Ca is not sufficiently removed from the soil, the yield of DNA is low. Since it is sufficiently obtained (see FIG. 7 and FIG. 8A), it is shown that Ca contained in the soil does not adsorb to the extent that it affects DNA extraction. Moreover, Saitama agricultural trials contain some volcanic ash soil, and the amount of Al elution is larger than that of Osaka agricultural trial soil and Hyogo agricultural trial soil. There was almost no difference in the elution amount of Al even when the EDTA concentration was increased.

(2-3) EDTA-metal element complex formation rate From Fig. 8B, EDTA is the four types of metals most analyzed in this study at low concentrations of about 10-20 mM in both volcanic ash soil and non-volcanic ash soil. It became clear that it formed a complex with the element. As the concentration increases, the complex formation rate decreases regardless of the type of metal element, and when the EDTA concentration increases to 300-400 mM, the EDTA-metal element complex formation rate is about It was almost constant at 20%. This was thought to be because the equilibrium of the chelate reaction of EDTA with metal elements reached a certain complex formation rate at high concentrations regardless of the EDTA concentration and the metal element composition of the soil. That is, it is considered that EDTA having a low concentration of about 10 to 20 mM chelates a metal element at a rate of 100%, and that EDTA chelates about 20% of the metal element at a high concentration of 300 to 400 mM. Therefore, there is a possibility that soil DNA can be extracted by repeating extraction with a low concentration EDTA solution or increasing the ratio of the extract to soil without using high concentration EDTA from the first stage of extraction. it was thought.

(2-4) Notes on high-concentration EDTA
A point to be noted when using EDTA is that when EDTA is 400 mM or more, the molecular weight of DNA is reduced. In a solution having a pH of about 8.3, there are approximately 3 molecules of sodium ions as counter ions per molecule of EDTA. The 400 mM EDTA solution is a high-concentration salt solution equivalent to a 1.2 M NaCl solution in ionic strength. Therefore, it was thought that DNA was electrically neutralized due to the sodium ions contained in a large amount, and due to this influence, it was easily sheared during the beads-beating treatment. In addition, when the EDTA concentration is 300 mM or higher, SDS precipitates as white crystals at room temperature due to high-concentration salt. Therefore, it was necessary to heat and dissolve the solution at about 40 ° C. during use. In alluvial soil, when the EDTA concentration reached a high concentration of 200 mM or higher, the amount of DNA extracted decreased in contrast to the case of volcanic ash soil. This was thought to be due to the fact that SDS, which is a surfactant, was micellized or precipitated due to the high salt concentration of the high-concentration EDTA solution, resulting in a decrease in the lysis rate of soil microorganisms. .
Based on the above, when performing beads-beating treatment, the maximum use concentration of EDTA was set to 300 mM, and it was considered necessary to conduct experiments on the assumption that DNA would be reduced in molecular weight when this concentration was exceeded.

[Example 5] Effect of number of extractions on soil DNA extraction
EDTA is a compound with an excellent chelate stability constant for most metal ions (Dojin Chemical Laboratory Catalog 22nd Edition). This means that even at very low concentrations, most EDTA will form complexes with the target metal ions. In the DNA extraction using the beads-beating treatment examined this time, the extract volume is 1.0 ml per 0.5 g of soil. By repeating the extraction and increasing the ratio of the amount of the extract to the soil, it may be possible to remove the amorphous Al in the target soil even with a low concentration EDTA solution. In this example, in order to clarify whether the absolute amount of EDTA is important or whether the concentration is important, the EDTA concentration is set in several stages, and the total DNA when DNA extraction is repeated several times from the same soil is performed. The yield was examined.

(1) Materials and methods Three types of soil were used as soil for the test: Yayoi field compost continuous soil, Tochigi agricultural soil, and Tohoku University forest soil. The basic extract composition is the same as in the previous section, using Tris-HCl 100 mM, SDS 1%, and using an extract with 5 levels of EDTA concentration: 0 mM, 50 mM, 100 mM, 200 mM, 300 mM. It was. 0.5 g of soil was dispensed into a tube with a screw cap containing 1 g of beads, 1.0 ml of extract was added, and then beads-beating treatment was performed for 30 seconds at an intensity of 5 m / sec. Thereafter, after centrifugation at 12000 × g for 5 minutes, 500 μl of the supernatant was recovered. Add 500 μl of EDTA extract at the same concentration as the first extraction to the remaining soil from which the supernatant was collected, and perform beads-beating treatment at a strength of 4 m / sec for 5 seconds for agitation. Qing was recovered. This operation was repeated 5 times. Of 500 μl of the collected supernatant, 20 μl was diluted and subjected to metal ion quantification by ICP emission analysis. The remaining 480 μl was deproteinized using chloroform, and finally 400 μl was collected. To this, 5 M sodium acetate solution (pH 5.2) was added to a final concentration of 0.3 M, and DNA was collected using 6/10 amount of 2-propanol. DNA was quantified in the same manner as 2-2-1. The experiment was performed in triplicate.

The amount of soil DNA and the amount of eluted metal elements that are considered to be newly obtained by the extract added again at each repeated extraction stage are described by the following calculation formula according to the above operation. However, the extraction amount of DNA or metal element at the nth time is Xn (value converted to the yield of DNA or metal element per 1 g of soil, the unit is μg / g soil).

The amount newly obtained by the second extraction = X2-X1 x 1/2
New amount obtained by the third extraction = X3-X2 × 1/2-X1 × 1/4
New amount obtained by the fourth extraction = X4-X3 x 1/2-X2 x 1/4-X1 x 1/8
New amount obtained by 5th extraction = X5-X4 x 1/2-X3 x 1/4 -X 2 x 1/8-X1 x 1/16

All experiments were performed in triplicate.

(2) Results and discussion Yield of each stage of soil DNA obtained by repeated extraction using EDTA extracts with different concentrations (converted to the yield from 1 g of soil) and soil DNA extracted from soil 5 times The total yield is shown in FIGS. FIG. 12 shows the amount of soil DNA (value according to the above calculation; calculation example is given in FIG. 11) that is considered to have been extracted by additionally added EDTA during repeated extraction. 13A and 13B show the amount of metal element considered to be extracted by chelate formation of EDTA added additionally.
The amount of soil DNA obtained by extraction five times was the most due to the extract containing 300 mM EDTA in all three types of soil (FIGS. 10A to 10C). Repeated extraction with an extract containing 300 mM EDTA, which had the best DNA yield, showed almost no change in the amount of soil DNA extracted after the second time (FIG. 12). In the extraction using 300 mM EDTA, it was considered that almost all of the soil DNA was extracted by the first extraction, and even if the EDTA solution was newly added after the second extraction, it was collected at the first extraction. The solution that could not be removed (the part contained in the gap between the soil after the centrifugation and the beads) was recovered little by little, and the amount of extraction increased, and the DNA adsorbed on the soil was peeled off and recovered. I thought it was not.

When extracted repeatedly from Tochigi Agricultural Experiment Forest with an extract containing 100 mM or less of EDTA, soil DNA was obtained in the amount of soil DNA that was nearly twice the amount of soil DNA obtained the first time. About this, it is considered that the adsorbed DNA was recovered by removing Al from the soil by EDTA added for the second time. In Tohoku University forest soil, about one third of the first extraction amount was newly obtained in the second extraction with an extract solution at a concentration of 100 mM or less. It was considered that the DNA was recovered and DNA was recovered.
When the absolute amount of EDTA used for soil extraction is the same, for example, when the absolute amount of EDTA is 300 μmol per 0.5 g of soil, that is, the first extraction amount with 300 mM EDTA extract and 200 mM EDTA In comparison of the first and second extraction total amounts, almost the same amount of soil DNA was obtained in Yayoi field compost continuous soil and Tohoku University forest soil. This was the same even when the absolute amount of EDTA was 200 nmol and 100 nmol. However, this calculation did not apply to the Tochigi Agricultural Experiment Forest soil, and even if the EDTA was the same in absolute quantity, there was a large difference in the amount of extracted DNA. That is, even when the amount of EDTA was the same, the amount extracted was higher when extracted at the first concentration, and even when extracted repeatedly, the amount of DNA extracted at a high concentration at one time was not reached.

  From these results, Yayoi field compost continuous soil and Tohoku University forest soil are relatively weak in the action of amorphous Al adsorbing DNA, and a certain amount of soil DNA can be obtained with a relatively low concentration of EDTA solution of about 50 mM. It was revealed that DNA extracted and adsorbed on the soil by EDTA more than that was recovered, and soil DNA corresponding to the amount of EDTA could be recovered almost stably. However, the action of amorphous Al is strong in Tochigi Agricultural Experiment Forest soil, and extraction of DNA requires EDTA of 200 mM or more, and it is difficult to dissociate and recover DNA once adsorbed to the soil. It was thought that there was.

(3) Extraction amount of metallic elements Almost causing the adsorption was hardly extracted from the soil of Yayoi field compost, unlike the other two types of volcanic ash soil. Yayoi field compost continuous soil has accumulated a large amount of Ca in soil due to long-term compost, and the amount of Al in the soil is small compared to the control zone where compost is not used continuously, and the soil is strongly affected by Ca It was considered. Another feature of this soil is that it contains a lot of amorphous Si, and most of the amorphous Al may form aluminosilicate (or allophane with a high silicon ratio) with this Si. it was thought. In this soil, Al is mostly complexed with negatively charged Si, so the soil DNA adsorption is considered to be small.
A large amount of Al was extracted from Tohoku University forest soil. This soil is a special soil among the volcanic ash soils called non-allophane black-boiled soil, which has a high amount of pyrophosphate-extracted Al (that is, in the form of a humus-Al complex) and a low allophane content. Al in the humus-Al complex has reached about half the total amount of amorphous Al in the soil, and there are many Al complexed with humic substances. Although the Tohoku University forest soil contains a large amount of amorphous aluminum, DNA can be extracted even with an extract containing a relatively low concentration of EDTA of 50 mM. From this soil, it is suggested that Al is removed from the soil with high efficiency by EDTA. Therefore, EDTA at the time of DNA extraction is considered to bring about the same effect on the soil as pyrophosphate at the time of pyrophosphate extraction.

Tochigi forest soil is also rich in pyrophosphate-extracted Al, but also contains a lot of allophane. As described above, even if repeated extraction is performed in this soil, the DNA yield does not increase, and it is possible that newly added EDTA from the second time onward hardly affects the elimination of DNA adsorption. However, as in the case of Tohoku University forest soil, Al is newly removed by EDTA from the soil added after the second time. Due to the phenomenon seen in Tochigi Agricultural Experiment Forest soil, even if Al is further removed from the soil by EDTA, there are multiple main forms of amorphous Al that adsorb DNA by the soil. In some soils, it is speculated that the form of amorphous Al removed by EDTA may be different from the form of Al that adsorbs DNA in the soil.
In all three types of soil, Ca and Mg were almost completely extracted in the solution by the first extraction regardless of the EDTA concentration, and Ca and Mg newly extracted by the newly added EDTA from the second time onwards. There was almost no. From these results, it was confirmed that Ca and Mg can be easily removed from soil even at low concentrations of EDTA and are not so much involved in the adsorption of soil DNA.

Based on the above, using EDTA at a high concentration of 300 mM is effective for extracting soil DNA from volcanic ash soil, and depending on the type of soil, high concentration EDTA is used for the first extraction. It became clear that the total DNA yield depends on whether or not This means that there are soils that are difficult to release once adsorbed DNA.
In addition, soil where DNA is gradually extracted as Al that causes adsorption is removed by repeated extraction (Tohoku University forest soil), and soil where DNA extraction does not increase even if Al is removed (Tochigi Agricultural Experiment Station) Forest soil). The forest soil of Tohoku University is non-allophane black soil, and most of the amorphous Al is humus-Al complex, which has less allophane content than allophane black soil. Therefore, in Al that adsorbs soil DNA, in addition to Al in the humus-Al complex, allophane-type Al exists, and EDTA mainly eliminates adsorption of DNA. -Al was presumed to be Al of the composite.

[Example 6] DNA extraction from soil in which DNA is not extracted even with high-concentration EDTA From the results thus far, the biggest cause of the difficulty in extracting DNA from volcanic ash soil by conventional extraction methods is the adsorption of DNA by soil It was strongly suggested that
Therefore, in order to further investigate the optimal concentration of EDTA to eliminate DNA adsorption, high concentration EDTA is added again after beads-beating for soil that is considered to have strong DNA adsorption power, and heat treatment is performed with high concentration EDTA. The method and conditions for recovering the DNA adsorbed on the soil were studied.

(1) Materials and methods Yayoi field control soil was used for the test. The following three points were examined. The EDTA concentration of the first extract (the extract during beads-beating), the EDTA concentration of the DNA recovery solution (EDTA solution to be re-added), and the treatment (stirring or heat treatment) after the recovery solution is added. Table 7 shows combinations of the processing contents, the extract and the recovered solution.

  After beads-beating with 1.2 ml of an extract consisting of 100 mM Tris-HCl / 1% SDS (pH 8.3) and different concentrations of EDTA, the microbial cells were destroyed, and then centrifuged once to recover 600 μl of supernatant. Further, 600 μl of a collected solution containing EDTA having a high concentration was added and stirred alone, or after the stirring, heat treatment was added at 60 ° C. for 1 hour. Thereafter, the mixture was centrifuged, and together with the supernatant collected earlier, DNA after protein removal treatment was collected and quantified.

(2) Results and discussion The results are shown in FIG. A significant difference in the DNA yield was caused by the operation after addition of the recovery solution. Compared to the treatment with only stirring, it was possible to extract more soil DNA with the heat-treated one. This suggests that the reaction between EDTA and soil, that is, the reaction in which EDTA chelates and sequesters amorphous Al adsorbing DNA, is accelerated by temperature. In addition, the higher the EDTA concentration, the higher the DNA extraction effect. In this experiment, since the highest amount of soil DNA was obtained at the highest concentration of EDTA used, there is a possibility that more DNA is adsorbed in the soil, so knowing the total amount of DNA in the soil could not. However, since the solubility of EDTA is about 1.5 M at maximum under normal conditions, when collecting adsorbed DNA by adding to soil, small-scale extraction should treat the soil at a final concentration of 1 M or higher. Is considered to be extremely difficult, and it seems that increasing the reaction time rather than increasing the EDTA concentration is more effective for increasing the extraction efficiency of soil DNA. This is because EDTA forms a 1: 1 complex with Al. Assuming that 1 ml of 1000 mM EDTA solution is 100% reactive, 1 mmol or 27 mg of Al can be chelated. On the other hand, amorphous Al is about 100 mg in 1 g of volcanic ash soil (dry soil) with a lot of amorphous components. Considering this, 0.5 g of soil (wet soil) will contain up to about 40 mg of amorphous Al. When 1 ml of 1 M EDTA solution is used as the recovery solution, almost all This is because EDTA that can dissolve crystalline Al is used.

As described above, even when EDTA is used at a concentration of 300 to 400 mM, only about 15 to 20% of the EDTA forms a complex with a metal element in the soil without heating. In addition, EDTA can estimate that humus-Al complex has been removed mainly from volcanic ash soil by experiments that increased the number of extractions and quantified the amount of amorphous Al removed from the soil. By adding high-concentration EDTA solution and heat treatment, complex formation reaction proceeds with Al in the humus-Al complex and other forms of amorphous Al, including allophane, and the removal rate of Al from the soil It was speculated that soil DNA could be extracted.
However, if the reaction time is increased, it is not possible to take advantage of the beads-beating process that can be extracted in a short time. Also, after performing centrifugation and supernatant recovery in the first extraction process, the work of incubation by adding the recovery buffer again is cumbersome, and the solution often contains foam and often repeats manual operations. As a result, there is an increased risk of the sample adhering to the hand or the experimental equipment being mixed into another sample. In addition, the addition of high concentrations of EDTA and heat treatment also caused large amounts of humic substances to elute.

Humic substances are thought to be stabilized by forming a complex with amorphous Al in the soil based on the same principle as the adsorption of DNA to the soil. Since EDTA gradually removes amorphous Al that had retained soil organic matter such as humus during the heat treatment, even the humic substances retained inside the aggregate and soil particles were gradually eluted into the extract. The problem of increased humus contamination in DNA samples is considered.
From the above, volcanic ash soil with little humus and a lot of allophane-type Al is considered to be inefficient to remove Al using complex formation reaction of EDTA, and was adsorbed by allophane-type Al In order to extract soil DNA, it was thought that other methods should be examined (Example 7).

[Example 7] Use of phosphate buffer in soil DNA extract Phosphate was added to the extract at various concentrations, and the amount of soil DNA extracted was measured.

(1) Materials and methods As test soils, volcanic ash soils such as Yayoi field control soil, Tanashi farm uncultivated soil, and Tochigi agricultural test forest soil, which were difficult to extract DNA even when high concentration EDTA was used. Three types of allophane black soils were used, and three types of alluvial soils were used as non-volcanic ash soils: Saitama Agricultural Experiment Field Soil, Grassland Experimental Field Permanent Pasture Soil, and Hyogo Agricultural Experiment Field Soil (Table 8).

The conditions for beads-beating were set in the same manner as in Example 1. The composition of the extract is based on 100 mM Tris-HCl / 1% SDS (pH 8.3), and K ₂ HPO ₄ (pH 8.3) is added to 0, 50, 100, 250, 500, 750, 1000, 1250, 1500 Extraction buffer added to 1750 and 2000 mM was prepared, and 1.2 ml each was added to 0.5 g of soil to extract soil DNA. After removing the protein from the crude extract, add an equal volume of 12% PEG / 1M NaCl solution, and collect the DNA by centrifugation at 20000 xg for 20 minutes at 4 ° C. DNA of 2000 bp or more by agarose electrophoresis (In the subsequent experiments, an equal amount of 12% PEG / 1M NaCl solution was used for the DNA recovery method). In addition, for comparison with phosphoric acid, EDTA was also prepared with an extract set to 50, 100, 200, 300, 400, 500, 600, and 800 mM, and DNA was extracted and quantified in the same manner. All experiments were performed in triplicate.

(2) Results and discussion
(2-1) Effect of EDTA concentration of extract on soil DNA extractability In volcanic ash soil, as described in the previous section, it is again shown that soil DNA cannot be sufficiently extracted unless a sufficiently high concentration of EDTA is used. (Figure 15A). Especially in Tochigi Agricultural Experiment Forest soil and Tanashi Farm uncultivated soil, the maximum yield of DNA was obtained when the EDTA concentration was the maximum. The possibility that DNA was adsorbed was considered.
In non-volcanic ash soil, a decrease in DNA yield was observed as the EDTA concentration increased in Saitama agricultural soil and Hyogo agricultural soil. A similar phenomenon was observed in the EDTA concentration study experiment (see Example 4), but as described above, it was thought to be caused by the precipitation of SDS.

In addition, even in the volcanic ash soil, the amount of DNA extracted from the Yayoi field control soil was the maximum when the EDTA concentration was 500 mM, and the yield decreased when the EDTA concentration was higher than that. Even in volcanic ash soil, SDS precipitation due to high-concentration EDTA and a decrease in the lysis rate of soil microorganisms are thought to have occurred, but since the recovery rate of adsorbed DNA has increased remarkably, a decrease in the lysis rate has resulted in a decrease in DNA yield. It is only difficult, and if the lysis rate of soil microorganisms by SDS increases, it is thought that more soil DNA can be obtained.
Unlike other non-volcanic ash soils, the perennial pasture soils of the grassland test site showed a tendency to extract volcanic ash soil types (Fig. 15A). The grassland test site is located in the Nasu volcanic zone, and most of the soil in this area is allophane black soil. However, the perennial grassland, which is the collection site, loses the volcanic ash layer due to river erosion, and the original stratum part covered with volcanic ash appears on the ground surface, which is the base material of the current topsoil. Therefore, although it is located in the volcanic zone, it shows the properties of non-volcanic ash soil. However, as estimated from the amount of Al and Fe obtained by acidic oxalate extraction, it is thought that amorphous Al actually remained in the soil and the amorphous Al adsorbed soil DNA. It was. Thus, it was suggested that amorphous Al present in the soil strongly adsorbs DNA and inhibits DNA extraction even if it is a small amount of contamination of volcanic ash soil.

(2-2) Effect of phosphate concentration on soil DNA extraction With regard to the amount of DNA extracted from volcanic ash soil, phosphate buffer is used to extract 35 μg of DNA from 1 g soil in Yayoi field control soil. In Tanashi Farm uncultivated land where yield was low even with EDTA buffer, 15 μg of DNA could be extracted from 1 g soil (FIG. 15B). The phosphate concentration at which the maximum yield of soil DNA was obtained was 1500 mM for Yayoi field control soil, 750 mM for Tochigi Agricultural Forest soil, and 1500 mM for Tanashi farm uncultivated soil. Even when the concentration was higher than that, the extraction amount was almost the same or slightly decreased, so almost all soil DNA adsorbed on the soil could be recovered with the phosphate buffer solution at these concentrations. It has been suggested. In addition, DNA extraction from non-volcanic ash soil was also good, and soil DNA was extracted with high yield from the soil at the grassland test site where some volcanic ash soil was mixed.

Comparing EDTA and phosphoric acid at the same molar concentration, except for Tochigi Agricultural Experiment Forest soil and Perennial grassland soil, EDTA was more effective in extracting soil DNA, but phosphate solubility was higher and dissolved in water. The solubility of EDTA is 1.5 M (pH 8.3) at maximum, whereas the solubility of potassium phosphate is as high as 3 M, so it can be used at a much higher concentration than EDTA. When phosphate ions were used at high concentrations, more than twice the maximum yield of DNA obtained using EDTA could be extracted from Yayoi field control soil and Tanashi farm uncultivated soil.
As described above, it can be said that the phosphate buffer is excellent in DNA yield. However, the following matters need to be considered.

In other words, the buffer for extracting soil DNA from volcanic ash soils, regardless of whether EDTA or phosphoric acid is used, the conditions for obtaining the maximum DNA yield (EDTA, phosphoric acid, SDS concentration, etc.) depend on the soil. Different. This shows that it is extremely important. When extracting soil DNA, using high-concentration EDTA and phosphate buffer to increase the recovery rate of soil DNA will decrease the cell destruction efficiency by SDS.To increase the cell destruction efficiency, use a low-concentration buffer to increase cell destruction efficiency. If used, DNA adsorption to the soil will increase. This result shows that the balance between the two differs depending on the soil. Therefore, it seems necessary to further study to establish universal extraction conditions that enable maximum yield of DNA extraction in all soils.
If the maximum yield of soil DNA is to be extracted from all soil samples to be analyzed, it will be necessary to test the physicochemical properties of all soils, and depending on the results, the optimum extraction buffer for each soil must be individually tested. It can be said that it is necessary to create it.

[Example 8] Extraction of soil DNA with high-concentration EDTA-phosphate mixture In this example, the combined use of both was attempted in anticipation of the synergistic effect of EDTA and potassium phosphate buffer on soil DNA extraction.

(1) Materials and Methods Six types of soil shown in Example 7 were used for the experiment. As the extract, EDTA and phosphoric acid were used in 100 mM Tris-HCl / 1% SDS at a combination concentration shown in No. 1 to No. 16 in Table 9. Extraction conditions and DNA quantification conditions are the same as in Example 6.

(2) Results and Discussion The results of soil DNA extraction are shown in FIGS. Rather than using EDTA and phosphoric acid alone, a high DNA extraction effect was obtained even at a low concentration in the mixed solution, and a complementary effect of EDTA and phosphoric acid was observed for soil DNA extraction. In addition, in non-volcanic ash soils, a decrease in DNA yield was observed with an increase in EDTA concentration, but when EDTA and phosphate buffer were combined, the decrease in yield was relatively high even with high EDTA concentration. It was kept low.
From the results so far, DNA can be extracted with high yield from phosphate-buffered solutions from Yayoi field control soil and Tanashi farm uncultivated soil rich in allophane-type Al, which was difficult to extract even with high concentrations of EDTA. Became clear. Compared with the other two types of volcanic ash soils, Tochigi Agricultural Experiment Forest soils with less allophane-like Al yielded almost the same amount of extraction with either EDTA or phosphoric acid. Then, by using a mixed solution of EDTA-phosphate buffer, an amount of soil DNA almost equal to the total amount of soil DNA obtained with EDTA alone and phosphate alone was obtained. Considering the results so far, it is considered that EDTA mainly removes Al from the humus-Al complex, and phosphoric acid has an effect of masking allophane Al.

  One advantage of the combined use of EDTA-phosphate buffer is that, when it is desired to obtain the same DNA yield, each concentration can be kept lower than the concentration when each is extracted alone. Second, the concentration at which the maximum yield of DNA is obtained varies slightly depending on the soil. However, when 750 mM potassium phosphate is combined with 400 mM EDTA, it is clear that the maximum yield of DNA can be obtained from most soils. (Fig. 16A-B). This means that the composition of the universal DNA extract is determined regardless of the type of soil. In addition, at this concentration, since the dilution operation to reduce the salt concentration during the subsequent DNA purification and precipitation operations was unnecessary, the above composition was applied to the soil DNA extraction buffer in the future. .

  This universal buffer composition can yield the highest yield of DNA from almost all of the soil tested. However, it was found that low molecular weight (20-7 kbp) of soil DNA occurs depending on the soil. The soil microbial community structure analysis, which often targets a large number of samples, requires simple experimental operations, and generally only a relatively short DNA region (200-1500 bp) is targeted for analysis. It was considered that the objective could be sufficiently achieved even if the molecular weight was lowered. Therefore, in analyzing the microbial community structure, it was considered that there was no problem in extracting soil DNA under the conditions of this example. However, if fragmented DNA such as cloning is inconvenient, or if you want to analyze more accurately even in community structure analysis (chimera sequences are generated when PCR amplification is performed using highly depolymerized DNA as a template. It was thought that an extraction method that can obtain higher molecular DNA was necessary.

[Example 9] Examination of “two-step method” As shown in Example 8, extraction with a high concentration of EDTA-phosphate can extract DNA with high yield, but there is a possibility of lowering the molecular weight of DNA. . Therefore, by using a low concentration EDTA-phosphate solution during beads-beating when the physical impact is the strongest, and then extracting the DNA adsorbed on the soil with a high concentration EDTA-phosphate solution, We investigated whether it was possible to avoid low molecular weight while extracting efficiently.

(1) Material and method The soil shown in Table 10 was used as the test soil.

  Add 400 μl of 100 mM Tris-HCl / 1% SDS (pH 8.3) to a screw cap tube containing 0.5 g of soil, and after beads-beating, collect the soil solution at the bottom of the tube by high-speed centrifugation for several seconds. 800 μl of high-concentration EDTA solution, phosphate solution or EDTA-phosphate mixed buffer was added. Thereafter, the soil and the solution were thoroughly stirred with vortex and immediately centrifuged, and the supernatant was recovered and deproteinized, and the DNA was collected by precipitation. Table 11 shows the composition of the solution added to the tube after beads-beating and the final concentration of the extract after the addition.

(2) Results and discussion The results are shown in FIG. When using beads-beating Tris-HCl buffer without EDTA or phosphate, and then using high-concentration EDTA and phosphate, EDTA-phosphate buffer, Yayoi field control soil and paddy-free soil From the above, it was possible to obtain approximately the same amount of DNA as when extracted with a high-concentration buffer during beads-beating (see Example 6). However, from the Tochigi Agricultural Experiment Forest soil, only about half the amount of DNA extracted was obtained compared to the concentration at which the highest yield was obtained. As in the case of extraction with an extract containing a high concentration of EDTA and phosphate buffer from the beginning, the extract with the concentrations of EDTA 400 mM and phosphate 750 mM had the highest amount of DNA recovered in all three types of soil. As a result, the mixed solution of EDTA 400 mM and phosphoric acid 750 mM prevents the DNA released from the lysed microorganisms from adsorbing to the soil, and the effect of recovering the DNA adsorbed on the soil is also within the range of combinations studied. Was considered the highest.

Although DNA molecular weight decreased somewhat, some samples still showed DNA molecular weight reduction. This was greater because of the need to vigorously vortex after the addition of high concentration buffer to resuspend the pelleted soil by centrifugation, and beads-beating in a small volume of 400 μl initially. This is thought to be due to the addition of physical destructive power. When beads-beating is performed with a small amount of liquid, DNA is easily sheared into small molecules as reported by Burgmann et al. (2001). In addition, depending on the type of soil, DNA was irreversibly adsorbed to the soil, and it was thought that there were soils that were difficult to separate.
Therefore, as an additional study condition, we examined the use of a buffer solution with an upper limit concentration that does not cause a decrease in the molecular weight of DNA in the extract during beads-beating. That is, the final concentration of the DNA extract was fixed with 400 mM EDTA-750 mM phosphoric acid, and beads-beating was performed with 800 μl of the extract shown in Table 12 and the cap was opened after flash centrifugation. The recovery solution was added and stirred to separate the DNA from the soil.

The results of the improved method are shown in FIGS. 18A and 18B (DNA extraction amount) and FIG. 19 (Agarose electrophoresis photograph). With regard to these three types of soil, it was considered that the limit concentrations that do not cause DNA molecular weight reduction during beads-beating were about 400 mM for EDTA and about 250 mM for phosphoric acid. In both mixed systems, it was considered that the mixed solution of 400 mM EDTA and 100 mM phosphoric acid had a limit concentration that did not cause a decrease in molecular weight.
From the results so far, as a two-step method, the extract with the highest yield while suppressing the low molecular weight of DNA, that is, the buffer containing 300 mM EDTA and 100 mM phosphate is used as the extract during beads-beating treatment. We propose a method for extracting soil adsorbed on soil (2nd step) as an efficient method for extracting soil DNA (1st step), then adding high-concentration EDTA-phosphate buffer and stirring.

[Example 10] Selection of soil DNA precipitation method In this example, regarding the DNA precipitation method using 2-propanol, ethanol, and PEG, the recovery rate of DNA and the amount of humic substances that precipitate together with DNA were determined. It was measured.

(1) Materials and methods Tochigi Agricultural Experiment Forest soil, Tohoku University forest soil, and Saitama Agricultural Experiment Field soil were used. Their physicochemical properties are shown in Table 13.

Tochigi Agricultural Experiment Forest soil and Tohoku University forest soil have a total carbon content of 9% and a large amount of humic substances. When soil DNA was extracted from 30 types of soil, the extract of other black soil was colored brown, whereas the extract of these soils was colored black. However, a large amount of humic substances was estimated.
For extraction of soil DNA, an extract of 100 mM Tris-HCl / 300 mM EDTA / 1% SDS was used. After 1 ml of the extract was added to 0.5 g of soil, a bead-beateing treatment was performed. Deproteinization treatment was performed. Add 1/10 amount of 5 M sodium acetate (pH 5.2) to 500 μl of this extract, add 7/10 equivalent of 2-propanol, 2 equivalent of ethanol, 6/10 equivalent of 20% PEG, Centrifugation at 20000 × g for 20 minutes at 4 ° C. gave a precipitate. The precipitate was dissolved in 500 μl of TE buffer, and the amount of soil DNA recovered was quantified. One characteristic of humic substances is that they have visible light absorption of 400 nm or more. In the humus analysis method (Yamamoto 1997), the absorbance at wavelengths of 400 nm and 600 nm is defined as the amount of soil humus, so the absorbance at these two wavelengths is used to estimate the amount of humic substances mixed in the soil DNA solution. Was measured. The measurement used UV / VIS Spectrophotometer V-550 (JASCO).

(2) Results and Discussion The amount of soil DNA recovered is shown in FIG. 20A, and the absorbance of the soil DNA solution at 400 nm and 600 nm is shown in FIG. 20B.
The recovery rate of soil DNA by 2-propanol and PEG was high. In ethanol, the amount of soil DNA recovered was small, and most of the DNA was not precipitated. The PEG precipitation method removed most of the RNA contaminated with soil DNA. The absorbance at 400 nm and 600 nm of the soil DNA solution showed that the DNA obtained by precipitation with PEG had the least contamination with humic substances. It was found that the precipitation operation using PEG was less than half the contamination of humic substances compared to the case of using 2-propanol, and the purity of the recovered DNA was high. From the results of agarose electrophoresis, it was found that the rRNA recovered by 2-Propanol was removed by precipitation with PEG. Thus, since PEG has excellent points such as high DNA recovery rate, low humic substance contamination, and RNA removal, this method was adopted as a soil DNA precipitation method. However, when PCR was performed on almost the entire length of the 16S rRNA gene using the soil DNA obtained by this method as a template, there was no amplification at all, and it was thought that further removal of contaminated humic substances was necessary. It was.

[Example 11] Examination of conditions for precipitation with PEG In this example, the amount of DNA recovered by the concentration of PEG was examined.

(1) Material and method Soil DNA was extracted by beads-beating treatment using 400 mM EDTA / 750 mM phosphoric acid / 1% SDS from Yayoi field control soil and Tochigi agricultural forest soil. After deproteinization treatment, soil DNA was precipitated and collected using an equal amount of 10, 11, 12, 13, 14, and 15% PEG solution, and the relationship between the recovered amount and PEG concentration was examined. The PEG concentrations in the solution during DNA precipitation are 5, 5.5, 6, 6.5, 7, and 7.5%, respectively.
(2) Results and discussion The results are shown in FIG. In the concentration range examined, the amount of DNA recovered was highest when the PEG concentration added was 12%. Since there was no significant difference in the amount of humic substances mixed, considering only the amount of DNA recovered, the future DNA precipitation recovery method was to add an equal amount of 12% PEG solution to the extract. .

[Example 12] Study on purification method of soil DNA As described above (see Example 1), when studying the optimal surfactant for DNA extraction, soil DNA could not be extracted by CTAB. However, the solution after extraction with CTAB was found to be very clear and extremely effective in removing humic substances. According to reports by Zhou et al. (1996), Porteous et al. (1997), and Wilstrom et al. (1996), CTAB is effective in removing humic substances. Therefore, we attempted to prepare soil DNA capable of PCR by combining simple purification of soil DNA using CTAB and precipitation with PEG in the previous section.

(1) Materials and Methods As the test soil, the same three types of soil as in Example 10 were used: Tochigi Agricultural Experiment Forest Soil, Tohoku University Forest Soil, and Saitama Agricultural Experiment Field Soil. For extraction of soil DNA, an extract of 100 mM Tris-HCl / 300 mM EDTA / 1% SDS was used. After 1 ml of extract was added to 0.5 g of soil, bead-beateing treatment was performed, and a crude extract was obtained by centrifugation. It was. For 300 μl of this crude extract, using 10% CTAB solution and 5 M NaCl, the final concentration of CTAB is 0%, 1%, 2%, 3%, 4 steps, NaCl concentration is 0.7 M, It added so that it might become any combination of 1.4 M and three steps of 2.1 M. Mix the solution well and heat-treat at 60 ° C for 10 minutes. Mix well with the extract, add an equal volume of chloroform to perform protein removal, collect the aqueous layer and collect 20% PEG in 6 / Ten equivalents were added, and soil DNA was recovered and dissolved in TE buffer.
In this case, the humic substance combined with CTAB gathers in the denatured layer and is removed during deproteinization with chloroform.
The amount of soil DNA recovered was quantified, and the absorbance at 400 nm was measured in the same manner as in 2-4-2 for contamination with humic substances.

(2) Results and Discussion The amount of soil DNA recovered is shown in FIG. 22A. Moreover, the light absorbency in 400 nm of soil DNA after refinement | purification operation is shown to FIG.
Purification by CTAB showed little loss of soil DNA. Among them, the amount of soil DNA recovered was highest when the treatment was performed in the presence of 1.4 M NaCl or more. In addition, the use of CTAB removed humic substances from any soil sample, and most of the humic substances were removed, especially when CTAB was used at 2% or more. The CTAB concentration normally used for refining is 1%, but at 1%, the removal rate of humic substances was poor, and the use of 2% or more was effective. CTAB is a cationic surfactant, and binds quickly with hydrophilic groups with SDS, which is an anionic surfactant, and precipitates by forming micelles or salts with hydrophobic groups facing outward. Therefore, when CTAB is used at 1%, most of the CTAB is consumed by the reaction with the remaining SDS in the solution, and CTAB that works to remove humic substances is reduced. As a result, the absorbance increases. it was thought. The use of 2% or more of CTAB means that after all remaining SDS is removed by CTAB, there is a sufficient amount of excess CTAB, and the removal of humic substances can be done, so that the humic substances are removed and the absorbance is low. it was thought.

Zhou et al. (1996) already devised adding CTAB to the extract, but using 2% SDS for 1% CTAB. With this, CTAB has lost its function due to SDS, and it is speculated that the removal of humus is not sufficient.
Based on the above, when extracting soil DNA with an extract containing 1% SDS, add 2% or more of CTAB, 1.4 M or more of NaCl, incubate at 60 ° C for 10 minutes, and deproteinize with chloroform. Later, it was clarified that soil DNA from which most humic substances were removed could be obtained by precipitation collection of soil DNA with PEG.

What is required about the precipitation method of soil DNA is
(i) High DNA recovery rate,
(ii) To selectively precipitate only DNA and not to precipitate impurities such as humic substances.
In addition, DNA purification methods require
(i) removing impurities and increasing DNA purity;
(ii) DNA is not lost during purification,
(iii) be simple and inexpensive
(iv) No special technology or equipment is required.

  The combination of simple purification by CTAB and DNA recovery by PEG is considered to satisfy all the above conditions, and should be used as the original extraction method in the present invention by combining this purification, precipitation method and extraction method. Can do.

[Example 13] Comparison of soil DNA yield by the method of the present invention and the conventional method DNA was extracted from various soils using the method of the present invention and the conventional method, and the yield of soil DNA was compared.

(1) Materials and methods Twelve kinds of soils showing various physicochemical properties in the experiments up to now were used as test soils. The physicochemical properties are shown in Table 14.

As methods developed in the present invention, the following four types of methods with different extraction operation conditions were compared and examined.
1. Extract DNA from 0.5 g of soil with 1200 μl of an extract consisting of 100 mM Tris-HCl / 400 mM EDTA / 750 mM potassium phosphate / 1% SDS (pH 8.6), and 2% CTAB / 1 M NaCl. A method of collecting and recovering soil DNA with 12% PEG after simple purification. This method is hereinafter referred to as “original 1-step method”.
2. To 800 g of soil, add 800 μl of an extract of 100 mM Tris-HCl / 300 mM EDTA / 100 mM potassium phosphate / 1% SDS (pH 8.6), perform beads-beating treatment, and after flash centrifugation Add 400 μl of 600 mM EDTA, 2050 mM potassium phosphate buffer (pH 8.6), and after centrifugation, collect the supernatant. After simple purification with 2% CTAB / 1 M NaCl, use an equal volume of 12% PEG. A method for sediment collection of soil DNA. This method is hereinafter referred to as “original 2Step method”.

3. Add 0.5 μg of soil to the beads-beating procedure, and then add 400 μl of 600 mM EDTA / 2050 mM potassium phosphate buffer (pH 8.6) and heat at 60 ° C for 1 hour. A method in which centrifugation, simple purification, and DNA precipitation recovery were performed in the same manner as in 2, after the treatment. This method is hereinafter referred to as “original 2Step heating method”.
4.Beads-beating treatment with 1200 μl of an extract solution consisting of 100 mM Tris-HCl / 300 mM EDTA / 100 mM potassium phosphate / 1% SDS on 0.5 g of soil, and centrifuged to collect the supernatant. A method of precipitation recovery of soil DNA with an equal amount of 12% PEG after simple purification with% CTAB / 1 M MaCl. This method is hereinafter referred to as “original LowConcBuffer (LCB) method”.

Previous methods include the two methods of Zhou et al. (1996) and Cullen & Hirsch (1998), Bio 101 Fast DNA spin kit (Qbio, USA), and UltraClean ^™ Soil DNA kit (MoBio, USA). Soil DNA was extracted by the method using these two types of kits. Soil DNA extraction was performed based on the respective protocols. However, the Cullen & Hirsch (1998) method and the UltraClean Soil DNA kit (MoBio USA) required special equipment for crushing with beads. Both used Fast Prep FP101 (Qbio, USA) as a substitute, and extracted with a treatment of strength 5 m / sec and 30 sec.
Moreover, although the purpose of this example was to evaluate the efficiency of DNA extraction from soil, the method of Zhou et al. (1996), which purifies DNA by cutting out after agarose electrophoresis, and purifies DNA by gel filtration. In the method of Cullen & Hirsch (1998), it was thought that a considerable error occurred in the extraction amount due to the researcher's technique, operation method, and equipment used, so the yields of DNA solutions before purification were compared.

  During the extraction of soil DNA, the suspension of the soil and the extract is centrifuged to precipitate the soil (or a mixture of soil and beads in the method using beads-beating treatment), and the extract is recovered. At this time, an extract that cannot be recovered remains in the gap between the soil and beads. Due to differences in purification operations and the like, the amount of extract recovered varies depending on the method. When calculating the extraction efficiency from the soil, it is assumed that the supernatant collected by centrifugation and the solution contained in the gap between the soil and beads contain DNA at the same concentration, and the amount of extracted soil DNA is The amount was calculated in terms of the amount corresponding to the total amount of the added extract.

(Calculation example)
When 1200 μl of extract is added to 0.5 g of soil, after beads-beating treatment, 750 μl is recovered from it, and the subsequent purification operation results in 1250 μl of the solution. Finally, DNA is precipitated and collected from 1000 μl of the solution. ,
Amount of DNA extracted per gram of soil = Amount of DNA recovered by precipitation x 1250/1000 x 1200/750 x 2

(2) Results and Discussion DNA was extracted from 12 types of soils by the above four types of original methods, which are examples of the method developed in the present invention.
The results are shown in FIG. FIG. 24 shows the size of the extracted DNA obtained by the four methods. FIG. 25 shows the amount of soil DNA extracted by the original 1Step method, the 2Step heating method, and the conventional representative method.

(2-1) Comparison of soil DNA yield of four kinds of original methods From Yayoi field control soil, which is volcanic ash soil, Tochigi agricultural forest soil, Tohoku University forest soil, and all non-volcanic ash soils, original 1Step method and original 2Step Almost the same amount of soil DNA could be extracted by the heating method. However, for the Chiba Agricultural Experiment Forest soil, the Ibaraki Agricultural Experiment Field soil, the Tanashi Farmland Soil, and the Gunma Livestock Soil, soil DNA is hardly extracted by the original LCB method. Also in the original 2Step method, the amount of soil DNA extracted is 1/3 to 1/5 or less compared to that of the original 1Step method. In these soils, a sufficient amount of soil DNA could not be recovered even with the original 2Step heating method, which has a strong effect of eluting DNA adsorbed on the soil. All of these four types of soil are 50 mg / g soil with allophane-type Al and volcanic ash soils, and the adsorption of DNA to the soil is strong. Extraction and recovery seemed difficult. From non-volcanic ash soil, it was possible to recover soil DNA with extremely high yield even by the 2Step method without heating, and the DNA adsorption by the soil was easily eliminated.

The soil DNA obtained by the original 1Step method was reduced to 20-7 kbp, whereas the soil DNA obtained by the original 2Step method, the original 2Step heating method, and the original LCB method was 20 kbp or more. It was kept in a polymer, and the molecular weight reduction was suppressed.
The contamination of the humic substances into the final DNA solution was hardly observed in the original 2Step method and the original LCB method, and the solution was almost colorless. However, in the original 1Step method and the original 2Step heating method, the DNA solution extracted from Tochigi Agricultural Experiment Forest soil and Tohoku University forest soil was colored brown, and it was not possible to completely remove humic substances. These two types of soil had a large amount of accumulated humus, and a large amount of humic substances had been extracted at the time of extraction. However, as will be described later, humic substances were mixed in such a range that the PCR reaction was successful when the amount of template DNA was reduced.

(2-2) Yield Comparison with Past Methods In any soil, the original 1Step method and 2Step heating method of the present invention were able to extract more soil DNA than the past methods. In particular, from allophane black soil and soil from a long-term pasture field, soil DNA was obtained only by the method of Zhou et al. (1996), and the yield of DNA was still low. It was.
Soil DNA was obtained from non-volcanic ash soil and Tohoku University forest soil by the conventional method except for UltraClean ^™ Soil DNA kit. In the previous method, the amount extracted by Bio101 FastSpinKit was large, and soil DNA was also extracted by the Cullen & Hirsch (1998) method. However, the amount extracted by the method of Zhou et al. (1996) was small even in non-volcanic ash soil, and this difference in yield was thought to have been caused by the presence or absence of heat treatment and bead-beating treatment. However, in the method of Zhou et al. (1996), polymer soil DNA of 23 kbp or more was obtained.
From the results of this comparative study, the original method of the present invention can extract soil DNA from various soils with high yield, and from the soil rich in allophane Al, the original method must be used. It became clear that there was not enough or no soil DNA.

[Example 14] Comparison of DNA purity The purity of soil DNA was examined using as an index how much DNA can be used as a template for PCR reaction. This is because the higher the concentration, the greater the amount of contaminants, and the PCR reaction is inhibited when used at a high concentration unless it is a highly pure DNA sample.

(1) Materials and methods
Due to the difference in DNA extraction efficiency, the soil DNA content is completely different even if the final DNA solution amount is constant. Therefore, based on the quantified soil DNA concentration, the purity of the soil DNA was tested by using the soil DNA as a template in three stages of 100 ng, 50 ng, and 10 ng to test the success or failure of the PCR reaction.
The examined soil DNA was obtained by the original 1Step method and the original 2Step heating method. In these two methods, the crude extract after bead-beating is colored brown or black due to contamination with humic substances, and the amount of humic substances is considered to be larger than the other two methods. This is because it was considered suitable for studying the removal efficiency of humic substances.
PCR was performed in triplicate, and the reaction conditions and primers used were as follows.

PCR reaction conditions

Primer set 27F-1494R
27Fmix: AGAGTTTGATCMTGGCTCAG (SEQ ID NO: 1)
1494R: GGTTACCTTGTTACGACTT (SEQ ID NO: 2)
The primer set can amplify almost the entire length of the 16S rRNA gene.

The composition of the reaction solution is as follows.
Reaction solution: 50 μl
Primer: 0.5 mM
Taq DNA Polymerase (sigma): 2.5unit
Contains BSA at a final concentration of 400 ng / μl.

The reaction conditions are as follows. First, the reaction was carried out at 94 ° C. for 2.5 minutes, and then denaturation at 94 ° C. for 30 seconds, annealing at 50 ° C. for 30 seconds, and extension reaction at 72 ° C. for 2 minutes were carried out for 30 cycles. And allowed to react at 72 ° C. for 10 minutes.

(2) Results and discussion
The results of soil DNA purity test by PCR are shown in FIGS.
Except for the two types of soils with high humic substance accumulation and contamination, ie, Tochigi Agricultural Experiment Forest soil and Tohoku University forest soil, 50 ng of soil DNA obtained by the original 1Step method was added to 50 μl of the PCR reaction solution. Even after use, the PCR reaction was successful. Similar results were obtained with soil DNA obtained by the original 2Step heating method. Tochigi Agricultural Experiment Forest soil and Tohoku University forest soil obtained by the original 1-step method succeeded in PCR when 10 ng soil DNA was used as a template.
On the other hand, in the Tochigi agricultural forest soil DNA obtained by the 2Step heating method, the PCR reaction was not successful in any DNA amount. PCR did not succeed unless the soil DNA obtained from Tohoku University forest soil by the original 2Step heating method was further diluted to a use amount of about 1 ng as a template. For this reason, DNA extracted from soil with a large amount of humus accumulated using a high-concentration EDTA-phosphate mixture and further subjected to heat treatment is sufficiently humic substance even after CTAB purification and PEG precipitation. It was thought that could not be removed.

  However, for most of the soils excluding these two types of soil, even if 50 ng of soil DNA was used as a template in a 50 μl PCR reaction, high purity soil DNA was obtained by the original method. It is thought that it was done. Since soil DNA obtained by the original method can be used in large quantities as a template for PCR reactions, it is possible to set the number of PCR reaction cycles to be small, and to detect minor microbial groups in soil efficiently. Indicated.

[Example 15] Comparison of soil DNA composition In this example, the composition of soil DNA obtained by the various methods of the present invention was compared and examined by the PCR-DGGE method.

(1) Material and Method Using 1 μl of extracted soil DNA as a template, the V3 region of 16S rRNA gene was amplified by PCR and analyzed by DGGE. The PCR reaction conditions, the primers used, and the DGGE conditions are shown below.

(1-1) PCR
Primer set 341FGC-534R
Amplifies the V3 region of 16S rRNA gene
341FGC:
CGCCCGCCGC GCCCCGCGCC CGGCCCGCCG CCCCCGCCCC CCTACGGGAG GCAGCAG (SEQ ID NO: 3)
534R:
ATTACCGCGGCTGCTGGCAC (SEQ ID NO: 4)

The reaction conditions are as follows. First, the reaction was carried out at 94 ° C. for 2.5 minutes, and then denaturation at 94 ° C. for 30 seconds, annealing at 55 ° C. for 30 seconds, and extension reaction at 72 ° C. for 1 minute were carried out for 24 or 30 cycles. Finally, the reaction was carried out at 72 ° C. for 10 minutes. The composition of the reaction solution is as follows.
Contains BSA at a final concentration of 400 ng / μl.
Taq DNA Polymerase (sigma) 2.5unit
Reaction solution 50μl

(1-2) DGGE
Gel concentration 8%
Denaturant gradient 35% to 65%
Buffer temperature 60 ℃
Voltage 100V
Run time 10 hours

  The soil DNA solution obtained by the original four methods and the method of Zhou et al. (1996) is approximately 5-50 ng / μl. Using this 10-20 μg as a template, 24 cycles of PCR reaction were performed. In other existing methods, a sufficient amount of soil DNA could not be obtained from volcanic ash soil, but in order to make the conditions consistent, PCR reactions were performed for 30 cycles using 1 μl each as a template. For soil DNA obtained from non-volcanic ash soil by the conventional method, PCR reaction of 24 cycles was similarly performed using 1 μl as a template.

(2) Results and Discussion FIGS. 27A to 27E show the results of DGGE analysis of soil DNA obtained by each method.
The original method is sufficient for the six types of soil, Yayoi Field Control Zone soil, Chiba agricultural trial soil, Ibaraki agricultural experimental soil, Tanashi farm pasture soil, Gunma livestock experimental soil, Tochigi agricultural experimental soil. An amplification product was obtained, but in the PCR reaction using the soil DNA extracted by the conventional method as a template, no amplification product could be obtained except by the Zhou et al. (1996) method. In non-volcanic ash soil, sufficient amplification products were obtained by the original method and the previous method. As a result of analyzing the amplification product obtained by these PCR reactions by DGGE and examining the origin biological composition of the soil DNA, a DGGE band that seems to have been mixed from other than the soil may occur in some extraction processes. However, all extraction methods yielded similar DGGE profiles. In other words, at least for the bacteria with 16S rRNA targeted in this experiment, it was shown that the DNA extraction ratio and the ratio of the DNA extraction rate between each bacterial group were the same for all extraction methods.

In summary, the following was shown.
1. The original 1Step method and the original 2Step heating method were able to extract soil DNA at a higher yield than previous methods.
2. The original 1Step method and the original 2Step heating method were able to extract soil DNA from volcanic ash soil rich in allophane-like Al, which was difficult to extract by the existing methods.
3. The original 1Step method and the original 2Step heating method could be used for PCR using as much as 50 ng of soil DNA obtained from most soils, indicating that high-purity soil DNA was obtained.
From the results of PCR-DGGE, it was estimated that the DNA composition derived from bacteria contained in the soil DNA obtained by each method was almost the same.

[Example 16] Improvement of purification rate by lowering pH during CTAB purification (when CH ₃ COONa is used alone)
Most of the humic substances extracted from the soil under alkaline conditions are humic acids. Humic acid is defined as a substance that is alkaline in terms of soil chemistry, extracted from soil, loses its charge under acidic conditions at pH 2, and precipitates.
It is thought that most of the contaminants mixed in when extracting DNA from soil is this humic acid.
Usually, purification of DNA solution by CTAB is performed in the presence of NaCl, but in this example, this NaCl was changed to CH ₃ COONa whose pH was adjusted to the acidic side, and the pH was lowered during purification by CTAB. We tried to improve the efficiency of removing humus.

(1) Materials and methods For 10 g of Tohoku University forest soil, the following three types of extracts were used to obtain a DNA extract from the soil.
(i) 1% SDS / 100 mM Tris-HCl / 100 mM EDTA / 100 mM Na ₂ HPO ₄ (pH 8.6),
(ii) 1% SDS / 200 mM EDTA / 375 mM Na ₂ HPO ₄ (pH 8.6),
(iii) 1% SDS / 400 mM EDTA / 750 mM Na ₂ HPO ₄ (pH 8.6)

24 ml of the above extract was added to the soil, heat-treated at 65 ° C. for 30 minutes, and DNA was heated and extracted from the soil. When the soil is extracted by heating with an extract for a long time, more humic substances are extracted together with DNA than in the case of BeadsBeating treatment. In order to clarify the difference, soil DNA was extracted by heating extraction in this experiment, and the obtained soil DNA solution was purified as a contaminated sample containing a large amount of humic substances.
Thereafter, a supernatant was obtained by centrifugation at 6000 × g for 10 minutes. This supernatant was confirmed to contain much more humic substances than the extraction operation by BeadsBeating treatment.
This solution was used as a soil DNA extract and subjected to the following purification experiment.

250 μl of 10% CTAB solution and 5 M NaCl solution or 5 M CH ₃ COONa solution adjusted to pH 5.2, 5.4, 5.6, 5.8, 6.0, 6.2, 6.5 were added to 750 μl of 3 types of soil DNA extracts . That is, by adding these solutions to the soil DNA extract, 2% CTAB / 1M NaCl or 1 M CH ₃ COONa (pH is 7 conditions) is prepared, chloroform is added to these solutions in equal amounts, and after vortex Centrifugation was performed at 12000 × g at 25 ° C. for 10 minutes, and the aqueous phase was recovered as a purified DNA extract. In order to clarify the influence of the purity of the DNA solution by lowering the pH by adding acidic buffering capacity to the salt during purification by CTAB, the supernatant was diluted at 400 nm at appropriate times. Absorbance was measured.
The results are shown in FIG.

Further, an equal amount of 12% PEG solution was added to 750 μl of this supernatant, and soil DNA was precipitated by centrifugation at 20000 × g at 4 ° C. for 20 minutes. After removing the supernatant, washing with 70% ethanol, and drying, this DNA precipitate was dissolved in 200 μl of TE buffer (pH 8.0) to obtain a DNA solution.
FIG. 29 shows the results of measuring the absorbance at 400 nm after timely dilution of this DNA solution. In addition, the DNA concentration of the final DNA solution was measured, and the soil DNA recovery rate was quantified for the DNA extract with 1% SDS / 200 mM EDTA / 375 mM Na ₂ HPO ₄ (pH 8.6). As shown in FIG.

(2) Results and discussion From Fig. 28, it was found that the CH ₃ COONa solution with acidic buffering capacity was used for the salt solution during purification by CTAB, and compared with the case where a normal NaCl solution was used, chloroform was extracted from the DNA extract. It was shown that 30% to 60% of humic substances could be removed during centrifugation after the addition. In this case, there was no difference depending on the pH of the CH ₃ COONa solution.
From Fig. 29, the use of CH ₃ COONa with acidic buffering capacity for the purification of soil DNA extract obtained from any of the three extracts in the purity of DNA finally recovered with 12% PEG solution Showed that it was possible to obtain soil DNA with higher purity than that of NaCl.

In addition, for DNA extracts extracted with 1% SDS / 100 mM Tris-HCl / 100 mM EDTA / 100 mM Na ₂ HPO ₄ (pH 8.6), the effect of CH ₃ COONa with acidic buffering capacity is high and pH is 5.2. In some cases, the purity was highest. However, the other two types of extracts did not show much effect due to pH.
However, as can be seen from FIG. 30, the pH of CH ₃ COONa has a great influence on the DNA recovery rate, and when CH ₃ COONa is used, the higher the pH, the worse the DNA recovery rate. Became clear.
Based on the above results, it is considered that the use of CH ₃ COONa with acidic buffering capacity is extremely effective for removing humus during purification by CTAB, and that pH 5.2 should be used because DNA recovery is good. It was.

[Example 17] Improvement of purification rate by lowering pH during CTAB purification (when using a mixture of NaCl and CH ₃ COONa)
In this example, an attempt was made to use a mixed solution of NaCl and CH ₃ COONa as a salt solution at the time of purification by CTAB.

(1) Materials and Methods The experimental procedure was the same as in Example 16 (1), and a mixture of NaCl and CH ₃ COONa was used as the salt to be added during CTAB purification. 250 μl of a mixture of the following salt and 250 μl of 10% CTAB solution was added to 750 μl of the DNA extract.
2.5 M CH ₃ COONa / 2.5 M NaCl (pH 5.2),
1.67 M CH ₃ COONa / 3.33 M NaCl (pH 5.2),
1.25 M CH ₃ COONa / 3.75 M NaCl (pH 5.2),
3.33 M CH ₃ COONa / 1.67M NaCl (pH 5.2),
3.75 M CH ₃ COONa / 1.25 M NaCl (pH5.2),
5 M CH ₃ COONa / 1.25 M NaCl (pH 5.2),
5 M CH ₃ COONa / 2.5 M NaCl (pH 5.2),
3.75 M CH ₃ COONa / 2.5 M NaCl (pH 5.2),
3.75 M CH ₃ COONa / 3.75 M NaCl (pH 5.2)

The composition of the salt after addition is 0.5 M / 0.5 M, 0.33 M / 0.67 M, 0.25 M / 0.75 M, 0.67 M / 0.33 M, 0.75 M /0.25 M, 1 M / 0.25 M, respectively for CH ₃ COONa / NaCl 1 M / 0.5 M, 0.75 M / 0.5 M, 0.75 M / 0.75 M.
FIG. 31 shows the results of adding these solutions, adding an equal amount of chloroform, collecting the aqueous phase after vortexing and centrifugation, and measuring the absorbance at 400 nm after appropriate dilution. Further, FIG. 32 shows the absorbance at 400 nm of the DNA solution finally recovered with a 12% PEG solution and dissolved in TE Buffer.
The amount of soil DNA recovered is shown in FIG.

(2) Results and discussion From Fig. 31, even when a mixed solution of NaCl and CH ₃ COONa was used as the salt solution, the salt composition after addition was 0.63 M / 0.33 M, 0.75 M / 0.25 M with CH ₃ COONa / NaCl. , 1 M / 0.25 M, 1 M / 0.5 M, 0.75 M / 0.5 M, 0.75 M / 0.75 M, it is clear that the humus removal rate is almost the same as or higher than 1M CH ₃ COONa. It was. Further, as shown in FIG. 32, the purity of the soil DNA recovered by the PEG solution was also higher than that of the conventionally used NaCl when purified by CTAB. As shown in FIG. 33, when a mixed solution of CH ₃ COONa and NaCl was used, the recovery rate of DNA was higher than that in the case of NaCl used conventionally. Under the conditions examined, it was considered that the effects when the salt composition during purification by CTAB was CH ₃ COONa / NaCl at 0.25 M / 0.75 M and 0.67 M / 0.33 M were the highest in both DNA purity and recovery. .

[Example 18] Use of PEG solution with alkali buffering capacity for precipitation recovery of DNA Contaminants accompanying DNA extraction from soil are considered to be mostly humic acid, but humic acid is as described above. It has the property of being precipitated by acidity and being ionized again and dissolved in an aqueous solution by alkaline.
The removal rate of humic substances could be increased by adding a salt solution with acidic buffer capacity during purification by CTAB. However, humic substances that could not be removed during subsequent precipitation of DNA by PEG have been precipitated together with DNA, and this removal is necessary.

Therefore, the pH lowered during purification by CTAB is raised again during the precipitation recovery of DNA by PEG, so that the humic substance is ionized again and adjusted to a condition where humic substance is more difficult to precipitate. It was examined whether or not precipitation was possible. In order to raise the pH, a solution having an alkaline buffering capacity is required. Since the PEG solution is an aqueous solution, an attempt was made to dissolve the PEG and a reagent having an alkaline buffering capacity and to prepare and use it as a single solution.
Tris (trishydroxyaminomethane), CAPS, CAPSO, CHES, TAPS, Bicine, and the like are listed as reagents having an alkaline buffering capacity. Tris, which is most frequently used in this experiment, was used.

(1) Materials and Methods Soil DNA was extracted in the same manner as in Example 16, and purified with CTAB. In this purification treatment, in addition to NaCl, CH ₃ COONa having an acidic buffering capacity and a mixed solution of NaCl and CH ₃ COONa were used as salt solutions under the same conditions as in Example 17.
Purify by CTAB, add an equal amount of chloroform, vortex, collect the aqueous phase after centrifugation, collect 12% PEG / 3M Tris-HCl (12% PEG solution or PEG solution with alkaline buffer capacity for 750 μl of this solution ( pH 8.6) was added in an equal amount, and the precipitate of soil DNA obtained by centrifugation at 20000 × g 4 ° C for 20 minutes was washed with 70% ethanol, dried, dissolved in 200 μl of TE buffer (pH 8.0), and soil DNA It was set as the solution.
FIG. 34 shows the results of measuring the absorbance at 400 nm after appropriately diluting the soil DNA solution thus obtained. Further, FIG. 35 shows the influence of the use of PEG solutions having these alkaline buffering capacities on the recovery rate of soil DNA.

In addition, as a more detailed examination of conditions for a PEG solution with alkaline buffering capacity, the same procedure as in the above experiment was performed on the soil DNA extract extracted with 1% SDS / 200 mM EDTA / 375 mM Na ₂ HPO ₄ (pH 8.6). 12% PEG, 12% PEG / 3 M Tris-HCl (pH 8.6), 12% PEG / 2 M Tris-HCl (pH 8.6), 12% PEG / 1.5 M Tris-HCl (pH 8.6) FIG. 36 shows the results of the purity of the soil DNA solution obtained when using. The recovery rate is shown in FIG.

(2) Results and discussion Based on Fig. 34, 12% PEG / 3M Tris-HCl (pH 8.6) with alkaline buffering capacity was used in any conditions during purification with CTAB by using it for sediment collection of soil DNA. It was revealed that the purity of DNA was higher than that of the existing method.
From FIG. 35, it was clarified that the recovery rate of the PEG solution having an alkaline buffering capacity is not different from that of a normal PEG solution when used for DNA recovery from the purified DNA extract.
From the above, it was clarified that the PEG solution with alkaline buffering ability has the same ability to precipitate and recover DNA as normal PEG solution, but hardly precipitates humic substances.
In combination with the operation of lowering the pH by using a salt solution having an acidic buffer capacity during CTAB treatment, DNA with the highest purity could be obtained.

As for the PEG solution having an alkaline buffering capacity, a DNA having a higher purity than that of the PEG solution having no alkaline buffering capacity was obtained from FIG. For the soil DNA extract that had been purified by CTAB with 0.67 M CH ₃ COONa / 0.33 M NaCl, which was adopted as the salt condition for CTAB purification, 12% PEG / 3 M Tris-HCl (pH 8.6), High-purity DNA was obtained under both conditions of 12% PEG / 2 M Tris-HCl (pH 8.6) and 12% PEG / 2 1.5 Tris-HCl (pH 8.6).
From Fig. 37, it was confirmed that 12% PEG / 3 M Tris-HCl (for the soil DNA extract that had been purified by CTAB with 0.67 M CH ₃ COONa / 0.33 M NaCl, which was adopted as the salt condition for CTAB purification. It became clear that the recovery rate of DNA was almost the same regardless of pH 8.6), 12% PEG / 2 M Tris-HCl (pH 8.6), 12% PEG / 1.5 M Tris-HCl (pH 8.6). It was.

[Example 19] Additional conditions for the extraction method Polymeric DNA is less damaged by DNA, and is necessary for cloning and for studies involving longer base sequences for analysis. In order to obtain high molecular weight DNA, it is desirable to treat the soil under a mild condition of heat treatment rather than the BeadsBeating method in order to avoid physical shearing.
It was difficult to remove the humic substances because the humic substances were mixed in the soil DNA extract extracted by adding the extract to the soil and heat-treating for a long time, but it was difficult to remove the humic substances. The purification method achieved almost complete removal of humic substances, and it became possible to extract soil DNA by the heat treatment method.
Therefore, in this example, conditions for performing DNA extraction by heat extraction were examined.

(1) Yayoi field control soil, University of Tokyo farm, Tanashi pasture soil, Tochigi agricultural soil, forest soil, Saitama agricultural soil, and Hyogo agricultural soil A DNA extraction experiment was performed. As an extract, an extract having the following composition was used for extraction from soil in the Yayoi field control zone.

1% SDS / 200 mM EDTA (pH8.6),
1% SDS / 400 mM EDTA (pH8.6),
1% SDS / 250 mM Na ₂ HPO ₄ (pH 8.6),
1% SDS / 375 mM Na ₂ HPO ₄ (pH 8.6),
1% SDS / 500 mM Na ₂ HPO ₄ (pH8.6),
1% SDS / 100 mM Tris-HCl / 100 mM EDTA / 100 mM Na ₂ HPO ₄ (pH 8.6),
1% SDS / 200 mM EDTA / 250 mM Na ₂ HPO ₄ (pH 8.6),
1% SDS / 200 mM EDTA / 375 mM Na ₂ HPO ₄ (pH 8.6),
1% SDS / 200 mM EDTA / 500 mM Na ₂ HPO ₄ (pH 8.6),
1% SDS / 400 mM EDTA / 250 mM Na ₂ HPO ₄ (pH 8.6),
1% SDS / 400 mM EDTA / 375 mM Na ₂ HPO ₄ (pH 8.6),
1% SDS / 400 mM EDTA / 500 mM Na ₂ HPO ₄ (pH 8.6),
1% SDS / 400 mM EDTA / 750 mM Na ₂ HPO ₄ (pH 8.6)

For other soils, extracts of the following composition were used.
1% SDS / 100 mM Tris-HCl / 100 mM EDTA / 100 mM Na ₂ HPO ₄ (pH 8.6),
1% SDS / 200 mM EDTA / 250 mM Na ₂ HPO ₄ (pH 8.6),
1% SDS / 200 mM EDTA / 375 mM Na ₂ HPO ₄ (pH 8.6),
1% SDS / 200 mM EDTA / 500 mM Na ₂ HPO ₄ (pH 8.6),
1% SDS / 400 mM EDTA / 250 mM Na ₂ HPO ₄ (pH 8.6),
1% SDS / 400 mM EDTA / 375 mM Na ₂ HPO ₄ (pH 8.6),
1% SDS / 400 mM EDTA / 500 mM Na ₂ HPO ₄ (pH 8.6),
1% SDS / 400 mM EDTA / 750 mM Na ₂ HPO ₄ (pH 8.6)

To 0.5 g of soil, 1.2 ml of the extract was added and heat-treated at 65 ° C. for 1 hour with appropriate stirring. Thereafter, a supernatant was obtained by centrifugation at 12,000 × g at 25 ° C. for 5 minutes. Add 250 μl of 10% CTAB solution and 250 μl of 3.33 M CH ₃ COONa / 1.67 M NaCl solution to 750 μl of this supernatant, add equal volume of chloroform after vortex, and centrifuge at 12000 × g at 25 ° C for 20 minutes after vortex. It was. Collect the aqueous phase and add an equal amount of 12% PEG / 1.5 M Tris-HCl (pH 8.6). After vortexing, centrifuge at 20000 xg 4 ° C for 20 minutes to collect the precipitate of soil DNA. 70% ethanol After washing and drying, the sample was dissolved in 200 μl of TE buffer (pH 8.0) to obtain a soil DNA solution.
FIG. 38 shows the amount of DNA extracted using the extract of various compositions using Yayoi field control soil. Fig. 39 shows the results of DNA extraction extracted from the Yayoi field control soil, Tanashi pasture soil, Tochigi agricultural soil, Saitama agricultural soil, and Hyogo agricultural soil for the refined conditions.

(2) Results and Discussion From FIG. 38, it was found that the extraction amount was high in the following extract solutions.
1% SDS / 250 mM Na ₂ HPO ₄ (pH 8.6),
1% SDS / 375 mM Na ₂ HPO ₄ (pH 8.6),
1% SDS / 100 mM Tris-HCl / 100 mM EDTA / 100 mM Na ₂ HPO ₄ (pH 8.6),
1% SDS / 200 mM EDTA / 250 mM Na ₂ HPO ₄ (pH 8.6)

Further, from FIG. 39, it was revealed that the composition of 1% SDS / 200 mM EDTA / 250 mM Na ₂ HPO ₄ (pH 8.6) yielded a high yield in any soil.

[Example 20] DNA from environmental samples other than soil
Examples of environmental samples containing microorganisms other than soil include human and livestock feces, compost, activated sludge, and water-based sediments such as lake bottoms.
In this example, it was examined whether DNA could be extracted from other environmental samples by the DNA extraction method developed using soil as a sample.

(1) DNA extraction from stool DNA was extracted from stool samples that were sampled for 3 days from two adult males.
There are 6 types of samples: R-1, R-2, R-3, N-1, N-2, N-3.
First, the composition of the extract was examined using sample R-1. Extracts having the following compositions were used, and both BeadsBeating and extraction methods by heating extraction were studied.
1% SDS / 100 mM Tris-HCl / 200 mM EDTA / 500 mM Na ₂ HPO ₄ (pH 8.6),
1% SDS / 100 mM Tris-HCl / 200 mM EDTA / 250 mM Na ₂ HPO ₄ (pH 8.6),
1% SDS / 100 mM Tris-HCl / 100 mM EDTA / 100 mM Na ₂ HPO ₄ (pH 8.6),
1% SDS / 100 mM Tris-HCl / 200 mM EDTA (pH 8.6),
1% SDS / 100 mM Tris-HCl / 100 mM EDTA (pH 8.6),
1% SDS / 100 mM Tris-HCl / 50 mM EDTA (pH 8.6),
1% SDS / 100 mM Tris-HCl / 10 mM EDTA (pH 8.6)

1.2 ml of the extract was added to 0.5 g of the stool sample, and BeadsBeating was performed at 4 m / sec for 30 seconds, followed by centrifugation at 12000 × g at 25 ° C. for 5 minutes to obtain a supernatant. Add 250 μl of 10% CTAB solution and 250 μl of 3.33 M CH ₃ COONa / 1.67 M NaCl solution to 750 μl of this supernatant, add equal volume of chloroform after vortex, and centrifuge at 12000 × g at 25 ° C for 20 minutes after vortex. It was. Collect the aqueous phase and add an equal amount of 12% PEG / 1.5 M Tris-HCl (pH 8.6). After vortexing, centrifuge at 20000 xg 4 ° C for 20 minutes to collect the DNA precipitate and collect with 70% ethanol. After washing and drying, it was dissolved in TE buffer (pH 8.0) to obtain a fecal DNA solution.

Extraction by the heat treatment method was performed by incubation at 65 ° C. for 1 hour, and then the supernatant was obtained by centrifugation at 12000 × g at 25 ° C. for 5 minutes. Add 250 μl of 10% CTAB solution and 250 μl of 3.33 M CH ₃ COONa / 1.67 M NaCl solution to 750 μl of this supernatant, add equal volume of chloroform after vortex, and centrifuge at 12000 × g at 25 ° C for 20 minutes after vortex. It was. Collect the aqueous phase and add an equal amount of 12% PEG / 1.5 M Tris-HCl (pH 8.6). After vortexing, centrifuge at 20000 xg 4 ° C for 20 minutes to collect the DNA precipitate and collect with 70% ethanol. After washing and drying, it was dissolved in TE buffer (pH 8.0) to obtain a fecal DNA solution.
FIG. 40 shows the amount of DNA extracted by each method.
In addition, the BeadsBeating method and the heat extraction method were also extracted from other samples using 1% SDS / 100 mM Tris-HCl / 50 mM EDTA (pH 8.6) in the same manner as described above.
FIG. 41 shows the result of electrophoresis for the obtained fecal DNA.

In addition, the conventional method was compared in terms of purity and yield. In the conventional method, 1% SDS / 100 mM Tris-HCl / 50 mM EDTA (pH 8.6) extract is heated and extracted by incubation at 65 ° C for 1 hour, and then the supernatant is centrifuged at 12000 × g at 25 ° C for 5 minutes. Got. To this supernatant, an equal amount of chloroform was added, and after vortexing, centrifugation was performed at 12000 × g at 25 ° C. for 20 minutes. Collect the aqueous phase, add 0.6 volumes of 2-propanol, vortex, centrifuge at 20000 xg 4 ° C for 20 minutes, collect the DNA precipitate, wash and dry with 70% ethanol, TE buffer (pH 8.0) to obtain a fecal DNA solution.
FIG. 42 shows the result of the yield of fecal DNA obtained by the BeadsBeating method, the heat extraction method, and the conventional method, and FIG. 43 shows the result of the purity.

(2) Results and Discussion From FIG. 40, the extraction amount with 1% SDS / 100 mM Tris-HCl / 50 mM EDTA (pH 8.6) was the highest in both BeadsBeating method and heat extraction method.
From FIG. 42, it became clear that the amount of DNA extracted by the newly developed BeadsBeating method and the heat extraction method was lower than the conventional method in terms of yield. However, the newly developed BeadsBeating method and heat extraction method perform purification operations as a series of operations, and there is some DNA loss during the operation. In the newly developed method, RNA is not precipitated because DNA is collected using a PEG solution, whereas RNA is also precipitated because 2-propanol is used for DNA precipitation in the conventional method. Therefore, it seems that this RNA has affected the quantitative results of DNA, resulting in a difference in yield.
From FIG. 43, it became clear that the purity of fecal DNA extracted by the newly developed BeadsBeating method and heat extraction method is much higher than that of the conventional method.
As a result, it was shown that the DNA purification and precipitation method developed this time is extremely effective for selectively extracting only DNA from a DNA extract obtained from a stool sample.

[Example 21] DNA extraction from compost and activated sludge In this example, DNA was extracted from compost and activated sludge samples.
Samples are five types of compost: fallen leaf compost, cow dung rose compost, fermented cow dung compost, chicken manure compost, humus soil, and activated sludge samples are Kanagawa, Ochiai1, and Ochiai2.
First, the composition of the extract was examined using fallen leaf compost. The extract is as follows.
1% SDS / 100 mM Tris-HCl / 200 mM EDTA / 500 mM Na ₂ HPO ₄ (pH 8.6),
1% SDS / 100 mM Tris-HCl / 200 mM EDTA / 250 mM Na ₂ HPO ₄ (pH 8.6),
1% SDS / 100 mM Tris-HCl / 100 mM EDTA / 100 mM Na ₂ HPO ₄ (pH 8.6),
1% SDS / 100 mM Tris-HCl / 200 mM EDTA (pH 8.6),
1% SDS / 100 mM Tris-HCl / 100 mM EDTA (pH 8.6),
1% SDS / 100 mM Tris-HCl / 50 mM EDTA (pH 8.6),
1% SDS / 100 mM Tris-HCl / 10 mM EDTA (pH 8.6)

Using the above extract, both the extraction method by BeadsBeating and the extraction method by heat extraction were examined.
1.2 ml of the extract was added to 0.5 g of a compost sample, and BeadsBeating was performed at 4 m / sec for 30 seconds, followed by centrifugation at 12000 × g at 25 ° C. for 5 minutes to obtain a supernatant. Add 250 μl of 10% CTAB solution and 250 μl of 3.33 M CH ₃ COONa / 1.67 M NaCl solution to 750 μl of this supernatant, add equal volume of chloroform after vortex, and centrifuge at 12000 × g at 25 ° C for 20 minutes after vortex. It was. Collect the aqueous phase and add an equal amount of 12% PEG / 1.5 M Tris-HCl (pH 8.6). After vortexing, centrifuge at 20000 xg 4 ° C for 20 minutes to collect the DNA precipitate and collect with 70% ethanol. After washing and drying, it was dissolved in TE buffer (pH 8.0) to obtain a compost DNA solution.

Extraction by the heat treatment method was performed by incubation at 65 ° C. for 1 hour, and then the supernatant was obtained by centrifugation at 12000 × g at 25 ° C. for 5 minutes. Add 250 μl of 10% CTAB solution and 250 μl of 3.33 M CH ₃ COONa / 1.67 M NaCl solution to 750 μl of this supernatant, add equal volume of chloroform after vortex, and centrifuge at 12000 × g at 25 ° C for 20 minutes after vortex. It was. Collect the aqueous phase and add an equal amount of 12% PEG / 1.5 M Tris-HCl (pH 8.6). After vortexing, centrifuge at 20000 xg 4 ° C for 20 minutes to collect the DNA precipitate and collect with 70% ethanol. After washing and drying, it was dissolved in TE buffer (pH 8.0) to obtain a compost DNA solution.
FIG. 44 shows the amount of DNA extracted by each method.
In addition, the BeadsBeating method and the heat extraction method were also extracted from other samples using 1% SDS / 100 mM Tris-HCl / 50 mM EDTA (pH 8.6) in the same manner as described above.

At this time, since the activated sludge sample was in a suspended state, 500 μl was used as the sample, and 2 μ% of 500 μl was used to be 1% SDS / 100 mM Tris-HCl / 50 mM EDTA (pH 8.6) during BeadsBeating treatment and heat extraction. SDS / 200 mM Tris-HCl / 100 mM EDTA (pH 8.6) was added, and DNA was extracted by performing BeadsBeating treatment and heat treatment. The subsequent operation was performed in the same manner as the compost sample.
FIG. 45 shows the results of electrophoresis for the obtained compost DNA and activated sludge DNA.
In addition, the conventional method was compared in terms of purity and yield.

In the conventional method, a 1% SDS / 100 mM Tris-HCl / 50 mM EDTA (pH 8.6) extract is heated and extracted by incubation at 65 ° C for 1 hour, and then centrifuged at 12000 xg at 25 ° C for 5 minutes. I got Qing. (As for the activated sludge sample, an equivalent amount of 2% SDS / 200 mM Tris-HCl / 100 mM EDTA (pH 8.6) was added as described above, and the extraction operation was performed.) Chloroform was added and centrifuged at 12000 × g at 25 ° C. for 20 minutes after vortexing. Collect the aqueous phase, add 0.6 volumes of 2-propanol, vortex, centrifuge at 20000 xg 4 ° C for 20 minutes, collect the DNA precipitate, wash and dry with 70% ethanol, TE buffer (pH 8.0) to prepare a compost DNA solution and an activated sludge DNA solution.
FIG. 46 shows the result of the yield of compost DNA obtained by the BeadsBeating method, the heat extraction method, and the conventional method, and FIG. 47 shows the result of the purity. FIG. 48 shows the results for the weight of the activated sludge sample, and FIG. 49 shows the results for the purity.

(2) Results and discussion From Fig. 44, 1% SDS / 100 mM Tris-HCl / 100 mM EDTA / 100 mM Na ₂ HPO ₄ (pH 8.6), 1% SDS / 100 mM Tris-HCl / 50 mM in BeadsBeating method The amount of extraction with EDTA (pH 8.6) was large. Although there was not much difference in the heat extraction method, the extraction amount of 1% SDS / 100 mM Tris-HCl / 100 mM EDTA / 100 mM Na ₂ HPO ₄ (pH 8.6) was the largest.
From FIG. 46, it became clear that the amount of DNA extracted from compost by the BeadsBeating method and the heat extraction method developed this time was higher than that of the conventional method in terms of yield. In particular, the extraction amount by BeadsBeating method was large, and yields of 3 to 6 times were obtained compared with the conventional method.
FIG. 48 shows that the amount of DNA extracted from activated sludge is almost the same as the conventional method.

From FIG. 47, it was revealed that the purity of DNA extracted from compost by the newly developed BeadsBeating method and heat extraction method was much higher than that of the conventional method.
From FIG. 49, it has been clarified that the purity of DNA extracted from activated sludge can be obtained by the newly developed BeadsBeating method and heat extraction method.
From the above, it was shown that the DNA purification and precipitation method developed this time can extract DNA from compost samples and activated sludge samples with high yield, and can selectively extract only DNA.

[Example 22] DNA extraction from lake sediment In this example, DNA was extracted from a lake sediment sample.
Samples were collected from 6 types of Ueno Park, Shinobazu Pond, Sanshiro Pond of the University of Tokyo, and 2 farm ponds of the University of Tokyo.
Since the lake sediment sample was in suspension, 500 μl was used as the sample, and 500 μl of 2% SDS was used so that 1% SDS / 100 mM Tris-HCl / 50 mM EDTA (pH 8.6) was obtained during BeadsBeating treatment and heat extraction. DNA was extracted by adding / 200 mM Tris-HCl / 100 mM EDTA (pH 8.6) and performing BeadsBeating treatment and heat treatment.

In the method using BeadsBeating, BeadsBeating treatment was performed at 4 m / sec for 30 seconds, and then the supernatant was obtained by centrifugation at 12000 × g at 25 ° C. for 5 minutes. Add 250 μl of 10% CTAB solution and 250 μl of 3.33 M CH ₃ COONa / 1.67 M NaCl solution to 750 μl of this supernatant, add equal volume of chloroform after vortex, and centrifuge at 12000 × g at 25 ° C for 20 minutes after vortex. It was. Collect the aqueous phase and add an equal amount of 12% PEG / 1.5 M Tris-HCl (pH 8.6). After vortexing, centrifuge at 20000 xg 4 ° C for 20 minutes to collect the DNA precipitate and collect with 70% ethanol. After washing and drying, it was dissolved in TE buffer (pH 8.0) to obtain a lake bottom sediment DNA solution.
Extraction by the heat treatment method was performed by incubation at 65 ° C. for 1 hour, and then the supernatant was obtained by centrifugation at 12000 × g at 25 ° C. for 5 minutes. Add 250 μl of 10% CTAB solution and 250 μl of 3.33 M CH ₃ COONa / 1.67 M NaCl solution to 750 μl of this supernatant, add equal volume of chloroform after vortex, and centrifuge at 12000 × g at 25 ° C for 20 minutes after vortex. It was. Collect the aqueous phase and add an equal amount of 12% PEG / 1.5 M Tris-HCl (pH 8.6). After vortexing, centrifuge at 20000 xg 4 ° C for 20 minutes to collect the DNA precipitate and collect with 70% ethanol. After washing and drying, it was dissolved in TE buffer (pH 8.0) to obtain a lake bottom sediment DNA solution.

FIG. 50 shows the result of electrophoresis of the obtained lake sediment DNA.
In addition, the conventional method was compared in terms of purity and yield.
In the conventional method, an equal amount of 2% SDS / 200 mM Tris-HCl / 100 mM EDTA (pH 8.6) was added to 500 μl of the sample in the same manner as described above, and extraction was performed by heating at 65 ° C. for 1 hour. To this supernatant, an equal amount of chloroform was added, and after vortexing, centrifugation was performed at 12000 × g at 25 ° C. for 20 minutes. Collect the aqueous phase, add 0.6 volumes of 2-propanol, vortex, centrifuge at 20000 xg 4 ° C for 20 minutes, collect the DNA precipitate, wash and dry with 70% ethanol, TE buffer (pH 8.0) to obtain a lake sediment DNA solution.
FIG. 51 shows the results for the yield of lake sediment DNA obtained by the BeadsBeating method, the heat extraction method, and the conventional method, and FIG. 52 shows the results for the purity.

(2) Results and discussion From Fig. 51, it was revealed that the amount of DNA extracted from the lake sediment by the BeadsBeating method and the heat extraction method developed this time was higher than the conventional method in terms of yield. In particular, the amount of extraction by BeadsBeating method was large, and the yield was nearly 3 to 7 times that of the conventional method.
From FIG. 52, it has been clarified that the purity of DNA extracted from compost by the newly developed BeadsBeating method and heat extraction method is much higher than that of the conventional method.
As a result, the newly developed DNA extraction method can extract DNA from lake sediments at a higher yield than conventional methods, and the purification and precipitation methods selectively extract only DNA from the DNA extract obtained from lake sediment samples. It was shown to be extremely effective.

As described above, the DNA extraction and purification method developed this time can extract DNA from environmental samples other than soil in a high yield, and the obtained DNA has extremely high purity compared to conventional methods. It was obtained and considered to be suitable for DNA extraction from environmental samples in general.

[Example 23] DGGE analysis In this example, DNA samples extracted from soil, feces, compost, activated sludge, and lake sediments by the BeadsBeating method and heat extraction method using the final extraction and purification method developed this time. DGGE analysis was performed.
The V3 region of 16S rRNA gene was amplified by PCR using 1 μl of DNA solution as a template, and analyzed by DGGE. The PCR reaction conditions, the primers used, and the DGGE conditions are shown below.

(1-1) PCR
Primer set 341FGC-534R
Amplifies the V3 region of 16S rRNA gene
341FGC:
CGCCCGCCGC GCCCCGCGCC CGGCCCGCCG CCCCCGCCCC CCTACGGGAG GCAGCAG (SEQ ID NO: 3)
534R:
ATTACCGCGGCTGCTGGCAC (SEQ ID NO: 4)

The reaction conditions are as follows. First, the reaction was carried out at 94 ° C. for 2.5 minutes, then denaturation at 94 ° C. for 30 seconds, annealing at 55 ° C. for 30 seconds, and extension reaction at 72 ° C. for 1 minute were carried out for 25 cycles. And allowed to react at 72 ° C. for 10 minutes. The composition of the reaction solution is as follows.
Contains BSA at a final concentration of 400 ng / μl.
Taq DNA Polymerase (sigma) 2.5unit
Reaction solution 50μl

(1-2) DGGE
Gel concentration 8%
Denaturant gradient 35% to 65%
Buffer temperature 60 ℃
Voltage 100V
Run time 10 hours

FIG. 53 shows the results of DGGE analysis of soil DNA.
FIG. 54 shows the results of DGGE analysis of fecal DNA.
Fig. 55 shows the results of DGGE analysis of compost DNA and activated sludge DNA.
FIG. 56 shows the results of DGGE analysis of lake sediment DNA.

References
Aasta Agersborg, Reidun Dahl and Iciar Martinez 1997 Sample preparation and DNA extraction procedures for polymerase chain reaction identification of Listeria monocytogenes in seafoods International Journal of Food Microbiology 35: (3) 275-280
A. Frostegard, A. Tunlid and E. Baath 1996 Changes in Microbial Community Structure during Long-Term Incubation in Two Soils Experimentally Contaminated with Metals Soil Biology and Biochemistry 28; (1) 55-63
Aimo Saano and Kristina Lindstrom 1995 Small scale extraction of DNA from soil with spun column cleanup Molecular Microbial Ecology Manual 1.3.4 1-6
Akira Hiraishi 1999 Isoprenoid Quinones as Biomarkers of Microbial Populations in the Environment Journal of Bioscience and Bioengineering 88; (5) 449-460
Akira Hiraishi 1990 Ecological study of activated sludge bacteria by quinone profile method Yousui to Haisui 32; (12) 13-24
Akira Hiraishi 1988 Respiratory Quinone Profiles as Tools for Identifying Different Bacterial Populations in Activated Sludge Journal of General and Applied Microbiology 34; 39-56
Akira Hiraishi and Kenji Kato 1999 Quinone profiles in lake sediments: Implications for microbial diversity and community structures Journal of General and Applied Microbiology 45; 221-227
Akira Hiraishi, Kiyoshi Masamune and Hiroshi Kitamura 1989 Characterization of the Bacterial Population Structure in an Anaerobic-Aerobic Activated Sludge System on the Basis of Respiratory Quinone Profiles Applied and Environmental Microbiology 55; (4) 897-901
Akira Hiraishi, Yoko Ueda, Junko Ishihara and Tadahiro Mori 1996 Comparative Lipoquinone Analysis of Influent Sewage and Activated Sludge by High-Performance Liquid Chromatography and Photodiode Array Detection Journal of General and Applied Microbiology 42; 457-469
AM Ibekwe, AC Kennedy, PS Frohne, SK Papiernik, C.-H. Yang, DE Crowley
2002 Microbial diversity along a transect of agronomic zones FEMS Microbiology Ecology 39; 183-191
Anders Tunlid and David C. White 1992 Biochemical Analysis of Biomass, Community Structure, Nutritional Status, and Metabolic Activity of Microbial Communities in Soil Soil Biochemistry 7; 229-262
Tomoto Arao, Masao Okano, Tetsuo Kanamori 1998 Soil phospholipids and microbial biomass, community soil and microorganisms 51; 49-58
Tomoto Arao, Masago Okano, Tetsuo Kanamori 1998 Analysis of phospholipid fatty acid composition and its relationship with microbial biomass in light-colored black soil field soil Japan Journal of Soil Fertilizer Science 69; (1) 38-46
Tomoto Arao, Masago Okano, Tetsuo Kanamori 1998 Analysis of phospholipid fatty acid composition in various soils Japanese Journal of Soil Fertilizer Science 69; (1) 47-52

Arata Katayama 2000 Structure and behavior of microorganisms involved in pesticide degradation in soil nippon Noyakugaku kaishi 25; 300-309
Arata Katayama, Keiko Funasaka and Koichi Fujie 2001 Changes in the respiratory quinone profile of a soil treated with pesticides Biology and Fertility of Soils 33; 454-459
Arata Katayama, Hong-Ying Hu, Mamie Nozawa, Haruyoshi Yamakawa and Koichi Fujie 1998 Long-Term Changes in Microbial Community Structure in Soils Subjected to Different Fertilizing Practices Revealed by Quinone Profile Analysis Soil Science and Plant Nutrition 44; (4) 559-569
Arjen GCL Speksnijder, George A. Kowalchuk, Sander de jong, Elizabeth Kline, John R. Stephen and Hendrikus J. Laanbroek 2001 Microvariation Aritifacts Introduced by PCR and Cloning of Closely Related 16S rRNA Gene Sequences Applied and Environmental Microbiology 67; (1) 469 -472
Bakken LR, Lindahl V Recovery of bacterial cells from soil Nucleic Acids in Environment
Bell KS, Kuyukina MS, Heidbrink S, Philp JC, Aw dwj, Ivshina IB and Christofi N 1999 Identification and environmental detection of Rhodococcus species by 16S rDNA-targeted PCR Journal of Industrial Microbiology 87: 472-480
Berry AE, Chiocchini C, Selby T, et al. 2003 Isolation of high molecular weight DNA from soil for cloning into BAC vectors FEMS Microbiology Letters 223: (1) 15-20
B. Bolin and RBCook The major biogeochemical cycles and their interactions Fhon Wiley & Sons 1983
Bonnet R, Suau A, Dore J, et al. 2002 Differences in rDNA libraries of faecal bacteria derived from 10-and 25-cycle PCRs Internaional Journal of Systematic and Evolutionary Microbiology 52: 757-763
Boon N, De Windt W, Verstraete W, et al. 2002 Evaluation of nested PCR-DGGE (denaturing gradient gel electrophoresis) with group-specific 16S rRNA primers for the analysis of bacterial communities from different wastewater treatment plants FEMS Microbiology Ecology 39: ( 2) 101-112
Chandler DP, Fredrickson JK, Brockman FJ 1997 Effect of PCR template concentration on the composition and distribution of total community 16S rDNA clone libraries Molecular Ecology 6: (5) 475-482
DN Miller, * JE Bryant, EL Madsen, and WC Ghiorse 1999 Evaluation and Optimization of DNA Extraction and Purification Procedures for Soil and Sediment Samples Applied and Environmental Microbiology 65: (11) 4715-4724
Darrell P. Chandler, Randall W. Schreckhise, Jeffrey L. Smith and Harvey Bolton Jr. 1997 Electroelution to remove humic compounds from soil DNA and RNA extracts Journal of Microbiological Methods 28: (1) 11-19
David B. Hedrick and David C. White 1986 Microbaial respiratory quinones in the environment Journal of Microbiological Methods 5; 243-254
EG Bligh and WJ Dyer 1959 A RAPID OF TOTAL LIPID EXTRACTION AND PURIFICATION Canadian Journal of Biochemistry and Physiology 37; 911-917
E. Molina Grima, A. Robles Medina, A. Gimenez Gimenez, JA Sanchez Perez, F. Garcia Cmamacho and JL Garcia Sanchez 1994 Comparison Between Extraction of Lipids and Fatty Acids from Microalgal Biomass Journal of the American Oil Chemists' Society 71; ( 9) 955-959

Esther M. Gabor, Erik J. de Vries and Dick B. Janssen 2003 Efficient recovery of environmental DNA for expression cloning by indirect extraction methods FEMS Microbiology Ecology 44: (2) 153-163
Ezra S. Abrams and Vincent P. Stanton, JR. 1992 Use of Denaturing Gradient Gel Electrophoresis to Study Conformational Transitions in Nucleic Acids Methods in enzymology 212; 71-104
Foppe Smedes and Torsten K. Askland 1999 Revisiting the Development of the Bligh and Dyer Total Lipid Determination Method Marine Pollution Bulletin 38; (3) 193-201
Foppe Smedes and Torsten K. Thomasen 1996 Evaluation of the Bligh & Dyer Lipid Determination Method Marine Pollution Bulletin 32; (8,9) 681-688
Frostegard A and Baath E 1996 The use of phospholipid fatty acid analysis to estimate bacterial and fungal biomass in soil Biol. Fertil Soils 22: 59-65
Frostegard A, Tunlid A and Baath E 1991 Microbaial biomass measured as total lipid phosphate in soils of different organic content Journal of Microbiological Methods 14: 151-163
Mitsuru Fujima, Masahiko Saegusa 1997 Regulation of decomposition of rice straw and rice straw compost by plaster Japanese Journal of Soil Fertilizer Science 68; (6) 645-650
Futoshi Kurisu, Hiroyasu Satoh, Takashi Mino, Tomonori Matsuo 2002 Microbial community analysis of thermophilic contact oxidation process by using robosomal RNA approaches ans the quinone profile method Water Research 36; 429-438
G. Lloyd-Jones and DWF Hunter 2001 Comparison of rapid DNA extraction methods applied to contrasting New Zealand soils Soil Biology and Biochemistry 33: (15) 2053-2059
Gabor EM, de Vries EJ, Janssen DB 2003 Efficient recovery of environmental DNA for expression cloning by indirect extraction methods FEMS Microbiology Ecology 44: (2) 153-163
Gerard Muyzer 1999 DGGE / TGGE a method for identifying genes from natural ecosystems Current Opinion in Microbiology 2; 317-322
Gerard Muyzer and Ellen C. de Waal 1994 Determination of the genetic diversity of micorbial communities using DGGE analysis of PCR-amplified 16S rDNA NATO ASI Series G 35; 207-214
Gerard Muyzer and Kornelia Smalla 1998 Application of denaturing gradient gel electrophoresis (DGGE) and temperature gradient gel electrophoresis (TGGE) in microbial ecology Antonie van Leeuwenhoek 73; 127-141
Grace C.-Y.Wang and Yue Wang 1997 Frequency of Formation of Chimeric Molecules as a Consequence of PCR Coamplification of 16S rRNA Genes from Mixed Bacterial Genomes Applied and Environmental Microbiology 63; (12) 4645-4650
Hasebe Akira 2003 Is the soil a treasure mountain? -Approach to soil microbial resources using eDNA Nippon Nogeikagaku kaishi 77: (12) 1230-1239
Helmut Burgmann, Manuel Pesaro, Franco Widmer and Josef Zeyer 2001 A strategy for optimizing quality and quantity of DNA extracted from soil Journal of Microbiological Methods 45: (1) 7-20
Taguchi Higuchi 1981 Extraction characteristics of courageous nitrogen and soil organic nitrogen with buffer solution Japanese Journal of Soil Fertilizer Science 52; (6) 481-489

Holger Heuer, Martin Krsek, Paul Baker, Kornelia Smalla, and Elizabeth MH Wellington 1997 Analysis of Actinomycete Communities by Specific Amplification of Genes Encoding 16S rRNA and Gel-Electrophoretic Separation in Denatruing Gradients Applied and Environmental Microbiology 63; (8) 3233-3241
Hongoh Y, Yuzawa H, Ohkuma M, et al. 2003 Evaluation of primers and PCR conditions for the analysis of 16S rRNA genes from a natural environment FEMS Microbiology Letters 221: (2) 299-304
Hong -Ying Hu, Koichi Fujie and Kohei urano 1999 Development of a Novel Solid Phase Extraction Method for the Analysis of Bacterial Quinones in Activated Sludge with a Higher Reliability Journal of Bioscience and Bioengineering 87; (3) 378-382
Hugenholtz P, Huber T 2003 Chimeric 16S rDNA sequences of diverse origin are accumulating in the public databases Internaional Journal of Systematic and Evolutionary Microbiology 53: 289-293
Ishii K, Fukui M 2001 Optimization of annealing temperature to reduce bias caused by a primer mismatch in multitemplate PCR Applied and Environmental Microbiology 67: (8) 3753-3755
Kosuke Ishii, Tatsuyoshi Nakagawa, Manabu Fukui 2000 Application of denaturing gradient gel electrophoresis to microbial ecology Microbes and Environments 15; (1) 59-73
Jacek Kozdroj, Jan Dirk van Elsas 2001 Structual diversity of microbial communities in arable soils of a heavily industrialized area determined by PCR-DGGE fingerprinting and FAME profiling Applied Soil Ecology 17; 31-42
Jacek Kozdroj, Jan Dirk van Elsas 2000 Response of the bacterial community to root exudates in soil polluted with heavy metals according by molecular and culutural approaches Soil Biology and Biochemistry 32; 1405-1417
Jackson CR, Harper JP, Willoughby D, Roden EE, Churchill PF 1997 A simple, efficient method for the separation of humic substances and DNA from environmental samples Applied and Environmental Microbiology 63: (12) 4993-4995
JA McKeague, JE Brydon and NM Miles 1971 Differentiation of Forms of Extractable Iron and Aluminum in Soils Soil Science Society of American Proceeding 35; 33-38
James B. Guckert, Christopher P. Antworth, Peter D. Nichols and David C. White 1985 Phospholipid, ester-linked fatty acid profiles as reproducible assays for changes in prokaryotic community structure of estuarine sediments FEMS Microbiology Ecology 31; 147-158
Jan Dirk Van Elsas and Kornelia Smalla 1995 Extraction of microbial community DNA from soils Molecular Microbial Ecology Manual 1.3.3 1-11
Janelle R. Thompson, Luisa A. Marcelino and Martin F. Polz 2002 Heteroduplexes in mixed-template amplifications: fomation, consequence and elimination by 'recoditioning PCR' Nucleic Acids Research 30; (9) 2083-2088
John T. Lis 1980 Fractionation of DNA Fragments by Polyethlene Glycol Induced Precipitation Methods in enzymology 65 347-353
Jorg Gerke 1994 Kinetiks of soil phosphate desorption as affected by citric acid Z. Pflanzenernahr. Bodenk .. 157; 17-22
JR Lawrence, MJ Hendry, LI Wassenaar, JJ Germida, GM Wolfaardt, N. Fortin, CW Greer 2000 Distribution and Biogeochemical Importance of Bacterial Populations in a Thick Clay-Rich Aquitard System Microbial Ecology 40; 273-291

J. Ruhlmann 1999 A new approach to controlling the pool of stable organic matter in soil using data from long-term field experiments Plant and Soil 213; 149-160
J. Tamaoka, Y. Katayama-Fujimura and H. Kuraishi 1983 Analysis of bacterial menaquinone combination by high performance liquid chromatography Journal of Applied Bacteriology 54; 31-56
Julie Tans-Kersten, Yanfen Guan, and Caitilyn Allen 1998 Ralstonia solanacearum Pectin Methylesterase Is Required for Growth on Methylated Pectin but Not for Bacterial Wilt Virulence Applied and Environmental Microbiology 64; (12) 4918-4923
Katsuaki Saitou, Koichi Fujie and Arata Katayama 1999 Detection of Microbial Groups Metabolizing a Substrate in Soil Based on the [14C] Quinone Profile Soil Science and Plant Nutrition 45; (3) 669-679
Kazunori Yamamoto, Rituko Murakami, Yoshichika Takamura 1998 Isoprenoid quinone, cellular fatty acid composition and diaminopimelic acid isomers of newly classified thermophilic anaerobic Gram-positive bacteria FEMS Microbiology Letters 16; (2) 351-358
Kazuya Watanabe, Yumiko Kodama and Shigeaki Harayama 2001 Design and evaluation of PCR primers to amplify bacterial 16S ribosomal DNA fragments used for community fingerprinting Journal of Microbiological Methods 44: (3) 253-262
Koichi Fujie, Hong-Ying Hu, Hajime Tanaka, Kohei Urano, Katsuaki Saitou and Arata Katayama 1998 Analysis of Respiratory Quinones in Soil for Characterization of Microbiota Soil Science and Plant Nutrition 44; (3) 393-404
Koji Wada and Teruo Higashi 1976 The Categolies of Aluminum- and Iron-Humus Complexes in Ando Soils Determined by Selective Dissolution Journal of Soil Science 27; 357-687
Kozdroj J., Elsas JD 2000 Application of polymerase chein reaction-denaturing gradient gel electrophoresis for comparison of direct and indirect extraction methods of soil DNA used for microbial community fingerprinting Biol. Fertil Soils 31: 372-378
Krsek M, Wellington EMH 1999 Comparison of different methods for the isolation and purification of total community DNA from soil Journal of Microbiological Methods 39: (1) 1-16
Toru Kubota, Tadashi Hakoishi, Shigeru Takahashi 1986 Suppression of compost decomposition by hydroxyaluminum treatment Japan Soil Fertilizer Science Journal 57; (2) 155-160
Satoshi Kuraishi 1985 9 Categorization of activated sludge microflora by chemical taxonomic technique Microbiology 13-On chemical methods-125-138
Satoshi Kuraishi 1982 2. Experimental method for chemical classification of lipids and microorganisms 87-143
Kurien BT, Kaufman KM, Harley JB, et al. 2001 Pellet pestle homogenization of agarose gel slices at 45 degrees C for deoxyribonucleic acid extraction Analytical Biochemistry 296: (2) 162-166
Kurien BT, Scofield RH 2002 Extraction of nucleic acid fragments from gels Analytical Biochemistry 302: (1) 1-9
Kuske CR, Banton KL, Adorada DL, et al. 1998 Small-scale DNA sample preparation method for field PCR detection of microbial cells and spores in soil Applied and Environmental Microbiology 64: (7) 2463-2472
Kusukawa N, Umemori T, Asada K and Kato I 1990 DNA Sequencing Report Rapid and Reliable Protocol for Direct Squencing of Material Amplified by the Polymerase Chain Reactio Biotechniques 9: (1) 66- &
KW Perrot 1978 The Influence of Organic Matter Extracted from Humified Clover on the Properties of Amorphous Aluminosilicates.I Surface Charge Australian Journal of Soil Reserch 16; 327-346

Liesack W, Weyland H, St Ackerandt E 1991 Potential risks of gene amplification by PCR as determined by 16S rDNA analysis of a mixed-culture of strict barophilic bacteria Molecular Microbial Ecology Manual 21: (3) 191-198
Lowell JL, Klein DA 2000 Heteroduplex resolution using T7 endonuclease I in microbial community analyzes BIOTECHNIQUES 28: (4) 676- + APR 2000
L. Ovreas, V. Torsvik 1998 Microbial Diversity and Community Structures in Two Different Agricultural Soil Communities Microbial Ecology 36; 303-315
L. Zelles and QY Bai 1993 Fractionation of Fatty Acids Derived from Soil Lipids by Solid Phase Extraction and Their Quantitative Analysis by GC-MS Soil biology and biochemistry 25; (4) 495-507
Matthew D. Collins and Dorothy Jones 1981 Distribution of Isoprenoid Quinone Structural Types in Bacteria and Their Taxonomic Impications Microbiological Reviesws 45; (2) 316-354
MD Collins Analysis of Isoprenoid Quinones Methods in Microbiology 18; 329-366
MG LaMontagne, FC Michel, Jr., PA Holden and CA Reddy 2002 Evaluation of extraction and purification methods for obtaining PCR-amplifiable DNA from compost for microbial community analysis Journal of Microbiological Methods 49: (3) 255-264
Manirakiza P, Covaci A, Schepens P 2001 Comparative study on total lipid determination using Soxhlet, Roese-Gottlied, Bligh & Dyer, and modified Bligh & Dyer extraction methods Journal of Food Composition and Analysis 14: 93-100
Michael Howeler, William C. Ghiorse and Larry P. Walker 2003 A quantitative analysis of DNA extraction and purification from compost Journal of Microbiological Methods 54: (1) 37-45
Miller DN 2001 Evaluation of gel filtration resins for the removal of PCR-inhibitory substances from soils and sediments Journal of Microbiological Methods 44: (1) 49-58
Mirbod F, Mori S, Nozawa Y 1993 Methods for phospholipid extraction in Candida albicans: an extraction method with high efficacy Journal of Medical and Veterinary Mycology 31: 405-409
Mituru Iwasaki and Akira Hiraishi 1998 A New Approach to Numerical Analysis of Microbial Quinone Profiles in the Environment Microbes and Environments 13; (2) 67-76
Moreira D 1998 Efficient removal of PCR inhibitors using agarose-embedded DNA preparations Nucleic Acids Research 26: (13) 3309-3310
M. Russell, RL Parfitt and GGC Claridge 1981 Estimation of the Amounts of Allophane and Other Materials in the Clay Fraction of an Egmont Loam Profile and Other Volcanic Ash Soils, New Zealand Australian Journal of Soil Reserch 19; 185-95
MT Suzuki and SJ Giovannoni 1996 Bias caused by template annealing in the amplification of mixtures of 16S rRNA genes by PCR Applied and Environmental Microbiology 62: (2) 625-630
Murray MG, Thompson WF 1980 Rapid isolation of high molecular-weight plant DNA Nucleic Acids Research 8: (19) 4321-4325

Paithankar KR, Prasad KSN 1991 Precipitation of DNA by polyethylene-glycol and ethanal Nucleic Acids Research 19: (6) 1346-1346
Per Wikstrom, Anna Wiklund, Ann-Christin Andersson and Mats Forsman 1996 DNA recovery and PCR quantification of catechol 2,3-dioxygenase genes from different soil types Journal of Biotechnology 52: (2) 107-120
P. Garbeva, LS van Overbeek, JWL van Vuurde, JD van Elsas 2001 Analysis of Endophytic Bacterial Communities of Potato by Plating and Denaturing Gradient Gel Electrophoresis (DGGE) of 16S rDNA Based PCR Fragments Microbial Ecology 41; 369-383
Pitcher DG, Saunders NA, Owen RJ 1989 Rapid extraction of bacterial genomic DNA with guanidium thiocyanate Letters in Applied Microbiology 8: (4) 151-156
PJ Loveland and P. Digby 1984 the extractions of Fe and Al by 0.1 M pyrophosphate solutions: a comparison of some techniques Journal of Soil Science 35; 243-250
P. Marschner, C.-H. Yang, R. Lieberei, DE Crowley 2001 Soil and plant specific effects on bacterial community composition in the rhizosphere Soil Biology and Biochemistry 33; 1437-1445
Polz MF, Cavanaugh CM 1998 Bias in template-to-product ratios in multitemplate PCR Applied and Environmental Microbiology 64: (10) 3724-3730
Porteous LA, Armstrong JL, Seidler RJ, et al. 1994 An effective method to extract DNA from environmental-samples for polymerase chain-reaction amplification and DNA fingerprint analysis Current Microbiology 29: (5) 301-307
Porteous LA, Seidler RJ, Watrud LS 1997 An improved method for purifying DNA from soil for polymerase chain reaction amplification and molecular ecology applications Molecular Ecology 6: (8) 787-791
Qiu XY, Wu LY, Huang HS, et al. 2001 Evaluation of PCR-generated chimeras: Mutations, and heteroduplexes with 16S rRNA gene-based cloning Applied and Environmental Microbiology 67: (2) 880-887
Richard J. Ellis, Barry Neish, Marcus W. Trett, J. George Best, Andrew J. Weightman, Philip Morgan, John C. Fry 2001 Comparison of microbial and meiofaunal community analyzes for determining impact of heavy metal contamination Journal of Microbiological Methods 45 ; 171-185
Richard M. Myers, Stuart G. Fischer, Leonard S. Lerman and Tom Maniatis 1985 Modification of the melting properties of duplex DNA by attachment of a GC-rich DNA sequence as determined by denaturing gradient gel electrophoresis Nucleic Acids Research 13; (9) 3111-3129
Richard M. Myers, Stuart G. Fischer, Tom Maniatis and Leonard S. Lerman 1985 Nearly all sigle base substitutions in DNA fragments joined to a GC-clamp can be detected by denaturing gradient gel electrophoresis Nucleic Acids Research 13; (9) 3131- 3145
RL Parfitt 1992 Potassium-Calcium Exchange in Some New Zealand Soils Australian Journal of Soil Reserch 30; 145-58
RL Parfitt 1992 Surface Charge in Some New Zealand Soils Measured at Typical Ionic Strength Australian Journal of Soil Reserch 30; 331-41
RL Parfitt 1990 Allophane in New Zealand-A Review Australian Journal of Soil Reserch 28; 343-60
RL Parfitt, M. Russel and GE Orbell 1988 Estimation of Forms of Fe and Al: A Review, and Analysis of Contrasting Soils by Dissolution and Moessbauer Methods Soil Chemistry and Mineralogy 26; 121-44
RL Parfitt and M. Saigusa 1983 Weathering Sequence of Soils from Volcanic Ash Involving Allophane and Halloysite, New Zealand Geoderma 29; 41-57
RL Parfitt and CW Childs 1985 Allophane and Humus-Aluminum in Spodosols and Andepts Formed from the Same Volcanic Ash Beds in New Zealand Soil Science 139; (2) 149-155

Rogstad SH 1992 Saturated NaCl-CTAB solution as a means of field preservation of leaves forDNA analyzes Taxon 41: 701-708
Rondon MR, Goodman RM, Handelsman J 1999 The Earth's bounty: assessing and accessing soil microbial diversity Trends in Biotechnology 17: (10) 403-409
Saano A, Tas E, Pippola S, Lindstrom K and van Elsas JD Extraction and analysis of microbial DNA from soil Nucleic Acids in Environment
Masahiko Saegusa, Nobuhiko Matsuyama 1996 Activated aluminum in arable black soil in the Tohoku region and a few chemistry related to it Japanese Journal of Soil Fertilizer Science 67; (2) 174-178
Sarah Macnaughton, John R. Stephen, Yun-Juan Chang, Aaron Peacock, Cecily A. Flemming, KamTin Leung, and David C. White 1999 Characterization of metal-resisitant soil eubacteria by polymerase chain reaction-denaturing gradient gel electrophoresis with isolation of resistatnt strains Canadian Journal of Microbiology 45; 116-124
Sarah J. Macnaughton, John R. Stephen, Albert D. Venosa, Gregory A. Davis, Yun-Juan Chang, and David C. White 1999 Microbial Population Changes during Bioremediation of an Experimental Oil Spill Applied and Environmental Microbiology 65; (8) 3566-3574
Schnitzer M. and SI> M Skinner 2000 A Lifetime Perspective on the Chemistry of Soil Organic Matter Advances in Agronomy 68; 1-58
Schnitzer M. 1966 Organo-Metallic Interactions in Soils: 5.Stability Constants of Cu ++-, FE ++-, and Z N ++-, Fulvic Acid Complexes Soil Sceince 102; (6) 361-365
Shin onda, Akira Hiraishi, Yoshitaka Matsuo, and Susumu Takii 2002 Polyphasic approaches to the identification of predominant polyphosphate-accumulating organisms in a laboratoryscale anaerobic / aerobic activated sludge system Journal of General and Applied Microbiology 48; 43-54
Smedes F, Thomasen TK 1996 Evaluation of Bligh & Dyer lipid determination method Marine Pollution Bulletin32: 681-688
Sneh Goyal, Kazunorj Sakamoto and Kazuyuki Inubushi 2000 Microbial Biomass and Activities along an Andosol Profile in Relation to Soil Organic Mtatter Level Microbes and Environments 15; (3) 143-150
Soren O. Petersen and Michael J. Klug 1994 Effects of Sieving, Storage, and Incubation Temperature on the Phospholipid Fatty Acid Profile of a Soil Microbial Community Applied and Environmental Microbiology 60; (7) 2421-2430
SP Mathur 1971 Characterization of Soil Humus through Enzymatic Degradation Soil Sceince 111; (3) 147-157
SR Kehrmeyer, BM Applegate, HC Pinkart, DB Hedrick, DC White and GS Sayler 1996 Combined lipid / DNA extraction method for environmental samples Journal of Microbiological Methods 25; 153-163
Sven Becker, Peter Boger, Ralfh Oehlmann, and Anneliese Ernst 2000 PCR Bias in Ecological Analysis: a Case Study for Quantitative Taq Nuclease Assays in Analyses of Microbial Communities Applied and Environmental Microbiology 66; (11) 4945-4953
Tillmann Lueders and Michael W. Friedrich 2003 Evaluation of PCR Amplification Bias by Terminal Restriciton Fragment Length Polymorphism Analysis of Small-Subunit rRNA and mcrA Genes by Using Defined Template Mixtures of Methanogenic Pure Cultures and Soil DNA Extracts Applied and Environmental Microbiology 69; (1) 320-326

Tolleson, TS and McKercher, RB 1983 The degradation of ¹⁴ C-labelede phosphatidyl choline in soil.Soil Biology Biochemistry 15; 145-148
Torsvik V, Daae FL, Goksoyr J Extraction, purification, and analysis of DNA from soil bacteria Nucleic Acids in Environment
Torsvik V, Sorheim R, Goksoyr J 1996 Total bacterial diversity in soil and sediment communities-a review Journal of Industrial Microbiology 17: 170-178
Tsai YL, Olson BH 1992 Rapid method for separation of bacterial-DNA from humic substances in sediments for polymerase chain-reaction Applied and Environmental Microbiology 58: (7) 2292-2295
Uchida Natsuyo, Hirata Shuntaro, late Inoue Katsuhiro 2000 Comparison of corrosive acid adsorption properties of allophane, ferrihydrite, fine coal, activated carbon Japan Soil Fertilizer Science Journal 71; (1) 1-7
V Farrelly, FA Rainey and E Stackebrandt 1995 Effect of genome size and rrn gene copy number on PCR amplification of 16S rRNA genes from a mixture of bacterial species Applied and Environmental Microbiology 61: (7) 2798-2801
Velegraki A, Kambouris M, Kostourou A, Chalevelakis G, Legakis NJ 1999 Rapid extraction of fungal DNA from clinical samples for PCR amplification Medical Mycology 37: (1) 69-73
Vigdis Lid Torsvik 1980 Isolation of Bacterial DNA from soil Soil Biology and Biochemistry 12: (1) 15-21
Watson RJ, Blackwell B 2000 Purification and characterization of a common soil component which inhibits the polymerase chain reaction Canadian Journal of Microbiology 46: (7) 633-642
White DC, Davis WM, Nickels JS, King JD and Bobbie RJ 1979 Determination of the sedimentary microbial biomass by extractible lipid phosphate Oecologia 40: 51-62
White, DC and Tucker, AN 1969 Phospholipid metabolism during bacterial growth.Journal of Lipid Research 19; 115-123
Yu-li Tsai and Betty H. Olson 1991 Rapid Method for Direct Extraction of DNA from Soil and Sediments Applied and Environmental Microbiology 57: (4) 1070-1074
Yu-li Tsai, MarieJ. Park and Betty H. Olson 1991 Rapid Method for Direct Extraction of mRNA from Seeded Soils Applied and Environmental Microbiology 57: (3) 765-768
Yun-Hwei Shen 1999 Sorption of Humic Acid to Soil: the Role of Soil Mineral Composition Chemosphere 38; (11) 2489-2499
Yutaka Oba 1996 40 years with volcanic ash soil Fertilizer science 18; 45-65
Zelles L. 1997 Phospholipid Fatty Acid Profiles in Selected Members of Soil Microbial Communities Chemosphere 35; (1,2) 275-294
Zelles L. 1999 Fatty acid patterns of phospholipids and lipopolysaccharides in the characterization of microbial communities in soil: a review Biology and Fertility of Soils 29; 111-129
Zhu H, Qu F, Zhu LH 1993 Isolation of genomic DNAs from plants, fungi and bacteria using benzyl-chloride Nucleic Acids Research 21: (22) 5279-5280
Hong Wang, Susanne E. Kohalmi and Adrian J. Cutler An Improved Method for Polymerase Chain Reaction Using Whole Yeast Cells 3232

  The present invention provides a method capable of recovering DNA from soil with high yield and high purity. The DNA obtained by the method of the present invention contains almost no contaminants, and the loss of DNA during extraction and purification can be minimized. Further, when implementing the present invention, no special technique is required, and it is simple and inexpensive. Therefore, the method of the present invention can be used to analyze the community structure of soil microorganisms and to search for new genes from environmental DNA such as soil microbial ecology, combinatorial biology, or combinatorial genetics. This is extremely useful.

SEQ ID NO: 1 synthetic DNA
Sequence number 2: Synthetic DNA
Sequence number 3: Synthetic DNA
Sequence number 4: Synthetic DNA

Claims (32)

DNA from an environmental sample, characterized in that the environmental sample is treated in the presence of a DNA extract containing up to 5% surfactant and 250-1500 mM phosphate buffer and / or 200-600 mM EDTA. How to extract. The method according to claim 1, wherein the surfactant is any one selected from the group consisting of SDS, Triton X-100 and sodium N-lauroyl sarcosine. The method according to claim 1, wherein the pH of the DNA extract is 7 or more. The method according to claim 1, wherein the environmental sample is at least one selected from the group consisting of soil, compost, aqueous sediment, activated sludge, and feces. The method according to claim 1, wherein the processing of the environmental sample is a bead-beating process and / or a heating process of the environmental sample. A method for extracting DNA from environmental samples,
(a) Beads-beating treatment and / or heat treatment of environmental sample in the presence of DNA extract containing 5% or less surfactant, 250-2000 mM phosphate buffer and / or 200-600 mM EDTA ,
(b) Centrifuge the extract after beads-beating treatment and / or heat treatment,
(c) Collect the supernatant after centrifugation,
(d) The method comprising the steps of repeating the steps (a) to (c) once to four times for the remaining environmental sample after collecting the supernatant. A method for extracting DNA from environmental samples,
(a) beads-beating and / or heat-treating an environmental sample in the presence of a DNA extract containing 5% or less surfactant and 200-600 mM EDTA;
(b) Centrifuge the extract after beads-beating treatment and / or heat treatment, collect the supernatant,
(c) The method comprising the step of mixing the collected supernatant with 600 to 1100 mM EDTA. A method for extracting DNA from environmental samples,
(a) beads-beating and / or heat-treating an environmental sample in the presence of a DNA extract containing 5% or less surfactant and 200-600 mM EDTA;
(b) Centrifuge the extract after beads-beating treatment and / or heat treatment,
(c) The said method including the process of heat-processing the mixture of the supernatant obtained and 600-1100 mM EDTA. A method for extracting DNA from environmental samples,
The method comprising a step of beads-beating and / or heat-treating an environmental sample in the presence of a DNA extract containing 5% or less of a surfactant and 250 to 2000 mM phosphate buffer. A method for extracting DNA from environmental samples,
Including bead-beating treatment and / or heat treatment of environmental sample in the presence of DNA extract containing 5% or less surfactant, 200-800 mM EDTA, and 250-2000 mM phosphate buffer Said method. 11. The method according to claim 10, wherein the concentration of EDTA is 400 mM and the concentration of the phosphate buffer is 750 mM. A DNA purification method comprising purifying DNA derived from an environmental sample under conditions of pH 7.0 or less in the presence of CTAB and a salt solution containing a pH buffer having an acidic pKa. 13. The method according to claim 12, wherein the salt is at least one selected from the group consisting of sodium chloride, sodium acetate, potassium acetate, ammonium acetate, sodium phosphate, potassium phosphate, and ammonium phosphate. 13. The method according to claim 12, wherein the concentration of CTAB is 1 to 3%. 13. The method according to claim 12, wherein the salt concentration is 0.7 to 2.1M. 13. The method according to claim 12, wherein the concentration of CTAB is 2-3% and the concentration of salt is 1.0M. The method according to any one of claims 12 to 16, wherein the DNA derived from the environmental sample is DNA extracted by the method according to any one of claims 1 to 11. A method for recovering DNA, comprising precipitating DNA purified by the method according to any one of claims 12 to 16 in the presence of polyethylene glycol under conditions of pH 7.0 or higher. 19. The method according to claim 18, wherein the concentration of polyethylene glycol is 5 to 7.5%. A method for recovering DNA, wherein the DNA extracted by the method according to any one of claims 1 to 5 is precipitated under conditions of pH 7.0 or higher in the presence of polyethylene glycol. A kit for extracting DNA from an environmental sample, comprising 5% or less of a surfactant and an alkaline buffer, and 200 to 1200 mM EDTA and / or 250 to 3000 mM phosphate buffer. The kit according to claim 21, further comprising beads for bead-beating. The kit according to claim 21, wherein the alkaline buffer is a Tris buffer. 22. The kit according to claim 21, wherein the pH of the DNA extract can be adjusted to 7.0 or higher. A kit for purifying DNA from an environmental sample containing a salt solution containing a pH buffer having an acidic pKa and CTAB, or a mixture of the salt solution and CTAB. 26. The kit according to claim 25, wherein the pH buffer solution having pKa on the acidic side is an acetate buffer solution, a phosphate buffer solution, a hydrochloric acid buffer solution or a sulfate buffer solution. 26. The kit according to claim 25, wherein the salt is at least one selected from the group consisting of sodium chloride, sodium acetate, potassium acetate, ammonium acetate, sodium phosphate, potassium phosphate and ammonium phosphate. 26. The kit according to claim 25, wherein the pH of the DNA-containing solution can be adjusted to less than 7.0. A kit for recovering DNA from an environmental sample containing an alkaline buffer and polyethylene glycol. 30. The kit according to claim 29, wherein the alkaline buffer is a Tris buffer. 30. The kit according to claim 29, wherein the pH of the DNA-containing solution can be adjusted to 7.0 or higher. The kit for DNA extraction according to any one of claims 21 to 24, the kit for DNA purification according to any one of claims 25 to 28, and the kit according to any one of claims 29 to 31. A kit set for acquiring DNA from environmental samples, including two sets of kits selected from the group consisting of DNA recovery kits.