JP2008092835A - Method for extracting nucleic acid - Google Patents

Abstract

<P>PROBLEM TO BE SOLVED: To provide a method for extracting a nucleic acid, wherein the extraction process is carried out without taking care of kinds of test samples and without using reagents that require careful handling, and the obtained nucleic acid sample does not require any enzymatic treatment thereafter, and it can be supplied to PCR nucleic acid amplification test as it is to give no adverse effect. <P>SOLUTION: The method for extracting a nucleic acid of the invention comprises a process of bringing test samples into contact with sodium N-lauroyl sarcosinate (LSS) and the concentration of LSS is preferably 0.1 to 0.2 mass% upon extraction of a nucleic acid. <P>COPYRIGHT: (C)2008,JPO&INPIT

Description

  The present invention relates to a nucleic acid extraction method, and more particularly to a method capable of easily extracting nucleic acid and free DNA in high yield.

Cryptosporidium is widely distributed throughout the world and is a protozoan that parasitizes the digestive tract of various animals.
Cryptosporidium is currently the most prominent protozoan in clinical and public health aspects because oocysts of this protozoa often cause mass diarrhea through water supply due to its strong chlorine tolerance .
The detection of Cryptosporidium is usually performed by visual observation under a microscope. However, this method requires a lot of labor for detection because of complicated operation, rapidity, and low detection rate.
Therefore, in recent years, genetic techniques have also been used for the study of Cryptosporidium, and it has become relatively easy to identify and type species.

Conventionally, for example, Cryptosporidium DNA is extracted by physical treatment such as freeze-thawing or chemical treatment using a surfactant or an enzyme. Methods for extracting nucleic acids from various samples include, for example, Many processes such as cell walls and membranes are destroyed physically or by treatment with surfactants, then removed using organic solvents such as water-saturated phenol and chloroform, proteins are denatured, and nucleic acids are separated. Needed.
Reagents used at this time include those requiring careful handling such as strongly alkaline sodium hydroxide solution and highly corrosive phenol solution.

Conventionally, the reagent used for extracting the nucleic acid remains in the extracted nucleic acid sample, and such a remaining reagent, for example, SDS may become an inhibitor during PCR analysis for amplifying the nucleic acid, The analysis accuracy was inferior, and it was difficult to amplify the extracted nucleic acid reagent as it was for PCR analysis.
Therefore, further purification steps are required to process these reagents contained in the extracted nucleic acid sample.

  On the other hand, at present, in nucleic acid extraction, automation such as speeding up and gene extraction is being attempted, and if the number of steps increases, purification steps such as centrifugation and suction filtration become complicated, saving labor of automatic gene equipment, It was a barrier to miniaturization.

  In order to solve this problem, Japanese Patent Application Laid-Open No. 5-236963 discloses a method for purifying DNA from a mixture of microbial cells and phages, specifically, DNA concentration using phenol and ethanol. In place of the process, a method of removing impurities and concentrating DNA by providing a process of passing a sample through an ultrafiltration membrane has been proposed.

However, in the above method, although the use of a phenol solution, which is a reagent that requires careful handling, can be avoided, a strong alkaline sodium hydroxide solution is necessary for purification, and therefore, all reagents are easy to handle. It is difficult to substitute with things.
Moreover, although this method is an effective method for making the mixture of microbial cells and phages symmetrical, it has been difficult to provide a method for efficiently extracting nucleic acids from any arbitrary organism.
Furthermore, the reagent remaining in the nucleic acid sample extracted using the conventional extraction method may hinder the later analysis, and there is a problem that a further purification process is required and the analysis accuracy is lowered.

  Japanese Patent Application Laid-Open No. 2006-61041 proposes a nucleic acid extraction method having a step of bringing glycocholic acid into contact with a test sample. Specifically, glycolic acid / deoxychol from Cryptosporidium oocysts is proposed. In this method, acid treatment and subsequent protease treatment are combined to extract DNA from oocysts without going through a DNA purification step.

However, according to such a DNA extraction method, even if the number of steps can be slightly reduced, the enzyme used for extracting the nucleic acid remains in the extracted nucleic acid sample, and the remaining enzyme amplifies the nucleic acid. It may become an inhibitor during PCR analysis, the analysis accuracy is poor, and it is difficult to amplify the extracted nucleic acid reagent as it is for PCR analysis.
Therefore, there is a problem that it is difficult to eliminate the steps of enzyme treatment and deactivation treatment.
JP-A-5-236963 JP 2006-61041 A

  In view of the above problems, an object of the present invention is to obtain a nucleic acid that can be easily extracted without using a reagent having a careful handling regardless of the type of a test sample. It is an object of the present invention to provide a novel nucleic acid extraction method that does not adversely affect a nucleic acid sample even if it is subjected to PCR nucleic acid amplification without requiring subsequent enzyme treatment.

  The present invention has been achieved by using a specific reagent for nucleic acid extraction, and a conventionally known anionic surfactant used for extracting a nucleic acid, such as SDS, is a subsequent enzyme such as PCR. In order to strongly inhibit the reaction, it is necessary to remove these conventional anionic surfactants after cell destruction reaction for removing nucleic acid and before imposing on the reaction such as PCR. Thus, the present inventors have found that a sample after cell disruption can be used without substantially inhibiting the nucleic acid amplification reaction.

That is, the nucleic acid extraction method of the present invention is characterized by performing a treatment of bringing sodium N-lauroyl sarcosinate (LSS) into contact with a test sample.
Preferably, the nucleic acid extraction method according to claim 2 is the nucleic acid extraction method according to claim 1, wherein the concentration of the sodium N-lauroyl sarcosinate (LSS) is 0.1 to 0.2% by mass. Features.
More preferably, the nucleic acid extraction method according to claim 3 is characterized in that in the nucleic acid extraction method according to claim 1 or 2, the test sample is an animal-derived sample.
Further preferably, the nucleic acid extraction method according to claim 4 is the nucleic acid extraction method according to claim 3, wherein the nucleic acid extraction method is a sample containing a microorganism.
In the present specification, “nucleic acid” is used as a concept including DNA, RNA, and derivatives thereof.
Moreover, in this specification, "final concentration" shows the sodium N-lauroyl sarcosinate (LSS) density | concentration in the reaction tube at the time of PCR.

The nucleic acid extraction method of the present invention uses a specific anionic surfactant, so that it can be easily and reliably extracted regardless of the type of test sample, regardless of the type of test sample. Can be easily extracted using a specific anionic surfactant that can be easily extracted.
Furthermore, since the nucleic acid extraction method of the present invention does not adversely affect the obtained nucleic acid sample for subsequent PCR nucleic acid amplification, a purification step and an enzyme treatment step for use in the PCR reaction are unnecessary. Therefore, the nucleic acid extraction process can be performed in a short time, and labor saving and downsizing of the automatic genetic test equipment can be realized.

That is, the above-described effect can be obtained by using the nucleic acid extraction method having the step of contacting sodium N-lauroyl sarcosinate (LSS) with a test sample according to claim 1.
Moreover, the said effect is obtained by using the nucleic acid extraction method whose concentration of the said sodium N-lauroyl sarcosinate (LSS) at the time of making it contact with a test sample of Claim 2 is 0.1-0.2 mass%. In addition, it is possible to extract the nucleic acid without failing to inhibit the enzyme reaction after the extraction without fail, and to obtain the effect that the efficiency of the nucleic acid extraction is maximized.

In addition to the above-described effects, for example, in the medical field such as diagnosis of animal diseases, by using the nucleic acid extraction method using an animal-derived sample as a test sample regardless of the type of test sample according to claim 3 Can be used.
Conventionally, there are cases in which extraction is difficult due to a structure or the like peculiar to microorganisms. By using the nucleic acid extraction method for a sample containing microorganisms according to claim 4, a sample containing the microorganisms can be obtained. Can also effectively exhibit the above-described effects.

  Moreover, the nucleic acid extraction method of the present invention can reliably extract a nucleic acid without inhibiting the enzymatic reaction after the extraction, and can perform the treatment in a short time without using a reagent having careful handling. It can greatly help automate the DNA extraction reaction and save labor.

The present invention will be illustrated by the following preferred embodiments, but is not limited thereto.
The nucleic acid extraction method of the present invention includes a step of bringing sodium N-lauroyl sarcosinate (LSS) into contact with a test sample.
By using sodium N-lauroyl sarcosinate (LSS) as a reagent in contact with a test sample, it can be applied to any type of cells such as bacteria and animal cells, has no PCR inhibition characteristics, A nucleic acid extracted by contacting with a test sample, or a free nucleic acid-containing solution can be used for PCR amplification.

  This process can be repeated a plurality of times until the cell membrane of the test sample is sufficiently destroyed. Especially in the preparation of a small amount of sample such as the preparation of a sample for PCR, it depends on the type and amount of the test sample. Although the time imposed on the process differs, for example, a contact time of about 5 to 30 minutes at 90 ° C. can sufficiently destroy cell membranes derived from animals.

Particularly preferably, the concentration of sodium N-lauroyl sarcosinate (LSS) is sufficient if the amount and quality necessary for subjecting the obtained nucleic acid to various analyzes can be extracted after carrying out the nucleic acid extraction method of the present invention. The extraction power is higher as the treatment concentration of sodium N-lauroyl sarcosinate (LSS) during nucleic acid extraction is higher.
When the nucleic acid extract is subjected to PCR amplification, it is preferable that the final concentration of sodium N-lauroyl sarcosinate (LSS) is preferably 0.01 to 0.02% by mass without exhibiting amplification inhibition. Usually, during PCR, the nucleic acid extraction-treated solution is diluted 10-fold, so that the concentration of sodium N-lauroyl sarcosinate (LSS) during the nucleic acid extraction treatment is preferably 0.01 to It is desirable to bring the sample into contact with the test sample at a concentration of 1% by mass, more preferably 0.1 to 0.2% by mass, in order to ensure nucleic acid extraction, and to further improve nucleic acid extraction efficiency and extraction. The time required is shortened, and the detection sensitivity is improved and rapid detection is achieved.

  The concentration of the sodium N-lauroyl sarcosinate (LSS) during nucleic acid extraction is adjusted by diluting the sodium N-lauroyl sarcosinate (LSS) with water, for example, with 0.01 to 1% by mass, more preferably It is sufficient to prepare a 0.1 to 0.2% by mass solution, and it is possible to extract nucleic acids by introducing oocysts into the solution and performing a contact treatment at 90 ° C. for 5 minutes, for example.

In the nucleic acid extraction method of the present invention, the sodium N-lauroyl sarcosinate (LSS) reagent is prepared by adding sodium N-lauroyl sarcosinate (LSS) so that the concentration at the time of use is an amount selected from the concentration range as described above. It may be in a solution state such as an aqueous solution to be contained, or may be in a freeze-dried state or a dry state containing sodium N-lauroyl sarcosinate (LSS) so as to be an amount selected from the concentration range. Is not particularly limited.
Moreover, when the reagent form is a freeze-dried state or a dry state, it may be combined with a solution for dissolving it as necessary.

The test sample is not particularly limited, and organisms such as animals (including humans), plants, microorganisms (including protozoa and protozoa) can be targeted.
In particular, nucleic acids from animal-derived test samples include blood free DNA from blood components such as serum and plasma, DNA such as viral DNA, RNA such as blood free messenger RNA and viral RNA.
The method of the present invention is useful for DNA extraction, and is derived from cells damaged or killed in various diseased areas such as cancer, and so-called blood free DNA (plasma) floating in serum or plasma. It is useful for the extraction of DNA or circular DNA.

  In general, since the cell membrane is composed of phospholipids and proteins, it is believed that sodium N-lauroyl sarcosinate (LSS) penetrates into the lipid bilayer of the phospholipid of this cell membrane and thus breaks the cell membrane, thus The method of the present invention can be applied to test samples derived from all living organisms regardless of whether they are plants or microorganisms.

Moreover, when extracting a nucleic acid from the organism which has a cell wall, such as a plant cell, yeast, a mold friend, and Gram-positive bacteria, a test sample and sodium N-lauroyl sarcosinate (LSS) are made to contact as needed. It is also possible to provide a pretreatment step for decomposing these cell walls before.
For example, they can be supplied as a stock or concentrated solution of a liquid (solution) dissolved and sealed together with a reagent such as a buffer solution required for each step.

Since the composition of the cell wall varies depending on the biological species, a cell wall degrading enzyme (for example, cellulase, zymolyase, lysozyme, etc.) corresponding to each composition is brought into contact with the test sample to lyse the cell wall.
However, the nucleic acid extraction method of the present invention can be applied without causing cell wall degrading enzymes to act on these organisms.

As a preferred application example of the nucleic acid extraction method of the present invention, explanation will be given using Cryptosporidium, which is one of the microorganisms as a test sample.
Here, Cryptosporidium to be detected refers to a microorganism belonging to the genus Cryptosporidium, and specifically Cryptosporidium parvum species (hereinafter abbreviated as C. parvum), Cryptosporidium. muris species (hereinafter abbreviated as C. muris), Cryptospodium baileyi species (hereinafter abbreviated as C. baileyi), Cryptosporidium serpentis species (hereinafter abbreviated as C. serpentis species), Crytosporidium meridian species. C. meleagridis), Cryptospodium felis species (hereinafter C. fe) The method of the present invention is used for nucleic acid extraction for species-detection of these species.

  In addition, as a test sample, a sample suspected of being contaminated with Cryptosporidium existing in the environment or in a living body can be used. For example, raw water for tap water, river water, lake water, well water, ground water, sewage, waste water, pool water Water samples that exist in the environment such as park water, or environmental samples such as soil samples that exist in the environment such as ranch soil, agricultural land soil, lake soil, river soil, feces such as humans, livestock, pets, etc. Examples of such biological samples, food samples such as beverage foods, raw vegetables, and fruits can be exemplified, but are not limited thereto.

  The step of preparing the nucleic acid sample from the test sample is performed by recovering the oocysts of Cryptosporidium from the test sample and extracting the chromosomal DNA from the recovered oocysts. Recovery of oocysts from the test sample can be performed using any known method.

Chromosomal DNA can be extracted from oocysts by treatment with sodium N-lauroyl sarcosinate (LSS), and it is not necessary to carry out protease treatment, purification treatment, or the like as in the prior art.
As described above, the concentration of sodium N-lauroyl sarcosinate (LSS) used for nucleic acid extraction treatment is 0.01 to 1% by mass, preferably 0.1 to 0.2% by mass (LSS during PCR). It is preferable to adjust to a case where the treated sample is diluted 10 times.
The nucleic acid extraction treatment conditions with such sodium N-lauroyl sarcosinate (LSS) are preferably, for example, 5 to 30 minutes at 70 to 90 ° C, and particularly preferably 10 to 30 minutes at 90 ° C.

  In addition, since sodium N-lauroyl sarcosinate (LSS) is not a substance that inhibits the PCR reaction as much as the conventional reagent, the sample treated by the method of the present invention does not undergo the purification process of the extracted DNA. Thus, it can be used for the subsequent PCR amplification reaction, so that the processing time can be greatly shortened and the time required for the extraction process can be shortened.

  In addition, nucleic acid loss may usually occur in the process of DNA purification, and the recovery rate of DNA after purification is at most about 80%. However, when the nucleic acid extraction method of the present invention is used, Since loss of DNA can be minimized, almost 100% DNA extraction efficiency can be maintained, and improvement in detection efficiency can be achieved.

A nucleic acid sample extracted from oocysts is amplified to improve detection sensitivity.
Usually, amplification of DNA is generally performed by PCR, and any conventional known PCR method can be employed as a PCR method using the DNA obtained above as a template.
Further, when the nucleic acid extract is subjected to PCR amplification, the final concentration of sodium N-lauroyl sarcosinate (LSS) is preferably 0.01 to 0.02% by mass, thereby exhibiting PCR amplification inhibition. PCR amplification can be performed effectively.

The present invention is illustrated by the following examples, but is not limited thereto.
However, “%” indicates “mass%”.
<Example 1> Detection of Cryptosporidium (1) Preparation of DNA Standard Sample A DNA standard sample of Cryptosporidium was prepared as follows.
As a test sample, Cryptosporidium parvum oocysts (Waterborne (USA)) that had been suspended in a PBS buffer solution were used so that the number of Cryptosporidium oocysts was 10 ^7/8 ml.
However, the PBS buffer was diluted and used as x10 PBS Buffer (11.5 g Na ₂ HPO ₄ , 2 g KH ₂ PO ₄ , 80 g NaCl, 2 g KCl / 1 l).

In addition, 10 ⁵ pieces of Cryptosporidium oocysts stored in the PBS buffer solution from 10 ⁷ pieces / 8 ml are dispensed, and the operation of freezing (−80 ° C., 2 min) and thawing (90 ° C., 2 min) is repeated twice. Then, DNA purification was performed with DNeasy Tissue Kit (QIAGEN), and sterile purified water was added to prepare 50 DNA / μl purified DNA solution.
Of these, 100 Cryptosporidium oocysts were subjected to the following PCR amplification to obtain PCR amplification products, and the following (4) electrophoresis test was conducted. The results are shown in FIG.

(2) DNA Extraction with Surfactant From 10 ⁷ Cryptosporidium oocysts / 8 ml of buffer solution, 10 ³ Cryptosporidium oocysts were dispensed, and each surfactant having a concentration of 0.01 to 20% was added in 2 parts. 10 μI (nonionic surfactant: Triton X-100, Tween 20, Polyoxyethylene (23) Lauryl Ether, anionic surfactant: SDS, sodium N-lauroyl sarcosinate (LSS)), and sterilized purified water added thereto The total amount was 20 μl (50 pieces / μl), incubated at 90 ° C. for 15 minutes, and DNA was extracted to obtain a DNA sample.

(3) PCR amplification The DNA sample obtained by the above preparation is cooled to room temperature, 2 μl (corresponding to 100 Cryptosporidium oocysts) of the sample is taken and used as a template to perform PCR amplification to amplify DNA. Then, the following electrophoresis test (4) was conducted, and the results are shown in FIG.
PCR was performed using a primer set of primer cry44 and cry39, which amplifies the 318 bp region of the polythreonine gene of Cryptosporidium parvum, using Light Cycler 1.5 (Roche).

The reaction solution was LC Fast Start DNA master SYBER Green I (Roche) 2.0 μl, 25 mM magnesium chloride 2.4 μl, 6 μM primer (Forward: CTCTTAATCCAATCATATACAAC, Reverse: GAGTCTAATAATAACAC. 6 μl was prepared by adding 2 μl of the DNA sample obtained in (2) above (equivalent to 100 Cryptosporidium oocysts).
PCR reaction conditions were such that the reaction solution was denatured in a denaturation step (95 ° C., 10 minutes), and then the PCR step (denaturation 95 ° C. 0 seconds, annealing 58 ° C. 5 seconds, extension 72 ° C. 13 seconds in one cycle) 55 The PCR reaction was completed by carrying out a cycle reaction to obtain an amplification product.

(4) Test / Electrophoresis Test For each amplification product obtained by PCR, a DNA sample corresponding to 100 cells was loaded into each lane together with the same amount of Superladder-Low 100 bp Ladder marker (Genetics) as an index. And 1.5% agarose gel electrophoresis (electrophoresis apparatus; Mupid-exu) (ADVANCE 100V, 40 minutes), the result of visual confirmation of the amount of amplified DNA extracted by gel electrophoresis Is shown in FIG.
In FIG. 1, M represents a molecular weight marker of 100 bp ladder.

  In FIG. 1, SDS numbers 1 to 3 and LSS numbers 5 to 7 are those treated at the SDS treatment concentrations of 0.01%, 0.1%, and 1% in the above step (2) (PCR amplification). (Sometimes 1/10 concentration), and results obtained using LSS treatment concentrations of 0.01%, 0.1%, 1% (1/10 concentration during PCR amplification) Show.

From the results of FIG. 1, it can be seen that although SDS “1” is an SDS concentration without PCR inhibition, a thin band was detected because the DNA extraction ability was weak.
Also, since SDS “2” and “3” have PCR inhibition, PCR amplification is difficult even if DNA is extracted.
In addition, LSS “5” is an LSS concentration without PCR inhibition, but DNA is not sufficiently extracted, and LSS “7” has PCR inhibition. Therefore, even if DNA is extracted, PCR amplification does not occur. Have difficulty.
Furthermore, from the strong band of LSS “6” (FIG. 1), it can be seen that 0.1% LSS treatment does not inhibit PCR and DNA is reliably extracted.

Example 2 PCR Inhibition Experiment of Surfactant to Cryptosporidium Purified DNA (1) Addition of Surfactant DNA Standard Reagent (5 × 10 ² Prepared in (1) Preparation of DNA Standard Sample in Experimental Example 1 above) To 2 μl, add 2 to 10 μl of the same 0.01-20% surfactant as used in (2) of Example 1 above, and add sterilized purified water to this to add a total volume of 20 μl (50 pieces). / Μl) of which 2 μl (corresponding to 100 Cryptosporidium oocysts) was used as a DNA sample for PCR amplification.
Next, each sample was subjected to PCR amplification in the same manner as in Experimental Example 1, and the detection sensitivity of Cryptosporidium by the surfactant treatment was examined.

In PCR amplification with the addition of an anionic surfactant, the final concentration in SDS (because the DNA sample is diluted to 1/10 when the PCR reagent is prepared, “final concentration = 1/10 treatment concentration”) 0.01, PCR inhibition was observed with 0.1, 1%, sodium N-lauroyl sarcosinate (LSS) at final concentrations of 0.1, 1% (FIG. 2).
In PCR amplification with addition of nonionic surfactant, PCR inhibition was not observed, and zwitterionic and cationic surfactants were inhibited in the entire range (not shown).

  Final concentration of sodium N-lauroyl sarcosinate (LSS) (because the DNA sample is diluted to 1/10 when the PCR reagent is prepared, “final concentration = 1/10 treatment concentration”) 0.01, 0.02, 0 PCR was performed at 0.03% and 0.04% to confirm the PCR inhibitory concentration. As a result, it was confirmed that 0.02% was a limit concentration capable of PCR amplification, and that when 0.03% or more was contained, PCR inhibition was shown (FIG. 3).

(2) N-lauroyl sarcosine dispensed study of Cryptosporidium detection sensitivity by Shin sodium (LSS) 0.1% processing Cryptosporidium oocysts 10 ⁷ 10 ³ min from / 8 ml min, supplemented with 1% surfactant 2μl Then, sterilized purified water was added to make a total volume of 20 μl (50 / μl). These were subjected to a) treatment at 90 ° C. for 5 to 15 minutes and b) treatment at 60 to 90 ° C. for 5 to 10 minutes to extract DNA. Of these, 2 μl (equivalent to 100 Cryptosporidium oocysts) was used for PCR amplification.
PCR amplification by PCR of 100 Cryptosporidium oocysts was carried out in the same manner as described above to obtain a PCR amplification product, and the electrophoresis test was conducted. The results are shown in FIGS. 4 (a) and 4 (b).

From the results of Example 2 above, it was found that sodium N-lauroyl sarcosinate (LSS) treatment concentration could be stably detected at 0.1%. In addition to this, as a result of investigating treatment concentration and time conditions, At a treatment concentration of 0.1%, PCR amplification was confirmed by treatment at 90 ° C. for 5 minutes (FIG. 4a).
In addition, as a result of treatment for 5 and 10 minutes at 60, 70, 80, and 90 ° C., PCR amplification was confirmed at 90 ° C. for 10 minutes and 70 to 90 ° C. for 10 minutes (FIG. 4b). It was not detected by the ° C treatment.
M represents a molecular weight marker of 100 bp ladder, and QIAGEN used purified DNA obtained by the QIAGEN Tissue kit.

<Example 3> Comparison of sodium N-lauroyl sarcosinate (LSS) extraction method with commercially available kit, simple extraction method (extraction amplification in 1, 10, 100 Cryptosporidium oocysts)
A schematic process diagram of these extraction methods is shown in FIG.
・ Commercial kit (DNeasy Tissue Kit (QIAGEN))
The Cryptosporidium oocysts 10 ^7/8 ml of ^{10 2,} 10 3, dispensed 10 ^four minutes, subjected to DNA purification by a commercial kit DNeasy Tissue Kit (QIAGEN), 0.5 units / [mu] l respectively, 5 / Μl and 50 / μl.
Of these, 2 μl (equivalent to 1, 10, 100 Cryptosporidium oocysts) was used for PCR amplification as described above.
However, PCR amplification was performed in the same manner as the PCR method, the electrophoresis test was performed, and the results are shown in FIG.

-Triton X-100 simple extraction method (National Institute of Infectious Diseases simple extraction method)
Cryptospodium oocysts from 10 ^7/8 ml to 10, 10 ² , 10 ³ are dispensed, 10 μl of 20% Triton X-100 is added, TE buffer (10 mM Tris-Cl 2, 1 mM EDTA) is added, and a total volume of 20 μl (0.5 pieces) / Μl, 5 / μl, 50 / μl). These were treated at 90 ° C. for 15 minutes, allowed to stand at room temperature for 5 minutes, and then centrifuged at 3000 rpm for several seconds.
After centrifugation, the supernatant was recovered and used as a DNA extract. Of these, 2 μl (equivalent to 1, 10, 100 Cryptosporidium oocysts) was used for the PCR amplification.
However, PCR amplification was performed in the same manner as the PCR method described above to obtain a PCR amplification product, and the electrophoresis test was performed. The results are shown in FIG.

-Extraction method of sodium N-lauroyl sarcosinate (LSS) Cryptosporidium oocysts 10 ⁷ / 8ml to 10, 10 ² , 10 ³ aliquots, 1% sodium N-lauroyl sarcosinate (LSS) 2 μl was added, Sterile purified water was added to make a total volume of 20 μl (0.5 / μl, 5 / μl, 50 / μl).
These were treated at 90 ° C. for 15 minutes to perform DNA extraction. Of these, 2 μl (equivalent to 1, 10, 100 Cryptosporidium oocysts) was used for the PCR amplification.
However, PCR amplification was performed in the same manner as the PCR method described above to obtain a PCR amplification product, and the electrophoresis test was performed. The results are shown in FIG.

  However, in FIG. 6, M represents a molecular weight marker of 100 bp ladder, freeze-thaw + QIAGEN (the same method as prepared in (1) of Example 1 above), QIAGEN uses purified DNA obtained by the QIAGEN Tissue kit. did.

  FIG. 6 shows that compared with the results of freezing and thawing and DNA extraction / amplification using the QIAGEN kit, the N-lauroyl sarcosate (LSS) -treated DNA extraction method performed without freezing and thawing and Triton X-by the National Institute of Infectious Diseases Comparison between the simple extraction method using 100 and the DNA extraction method using the QIAGEN DNeasy Tissue Kit was carried out. In the N-lauroyl sarcosinate (LSS) extraction method and the QIAGEN DNeasy Tissue Kit DNA extraction method, 10 Cryptosporidium oocysts were used. In the Triton X-100 simple extraction method, PCR amplification was not confirmed even with 100 oocysts (as many as 10).

From the above examples, the highest DNA detection sensitivity with good reproducibility was N-lauroyl sarcosinate (LSS) 0.1% treatment, and the concentration of sodium N-lauroyl sarcosinate (LSS) during nucleic acid extraction was high. PCR inhibition is not observed if the concentration is 0.1 to 0.2% (concentration is diluted to 1/10 at the time of PCR), and there is no PCR inhibition if the final concentration of sodium N-lauroyl sarcosinate (LSS) is 0.02% or less. I understand that.
In addition, PCR amplification was confirmed at 90 ° C. for 5 minutes at a sodium N-lauroyl sarcosinate (LSS) nucleic acid extraction treatment concentration of 0.1%.

  Therefore, the N-lauroyl sodium sarcosinate (LSS) extraction method and the QIAGEN DNeasy Tissue Kit DNA extraction method confirmed amplification with 10 Cryptosporidium oocysts, and the Triton X-100 simple extraction method confirmed PCR amplification with 100 oocysts. You can see that it was not done.

<Example 4> Glycocholate nucleic acid extraction method and sodium N-lauroyl sarcosinate (LSS)
・ Glycocholate nucleic acid extraction method
Cryptosporidium oocysts 10 ^7/8 ml of 10 ³ dispensed, added 1% glycocholate (GC) 2 [mu] l, to make a total volume of 20 [mu] l (50 units / [mu] l) was added to sterile purified water. These were treated at 37 ° C. for 15 minutes, 30 minutes and 60 minutes, respectively, and DNA was extracted.
Of these, 100 Cryptosporidium oocysts were used for PCR amplification experiments. However, PCR amplification was performed in the same manner as the above PCR method.

-Sodium N-lauroyl sarcosinate (LSS) extraction method Cryptosporidium oocysts 10 ⁷ to 10 ³ were dispensed, 2% 1% sodium N-lauroyl sarcosinate (LSS) was added, and sterilized purified water was added. The total volume was 20 μl (50 / μl). These were treated at 90 ° C. for 15 minutes, 30 minutes and 60 minutes, respectively, and DNA extraction was performed.
Of these, 100 Cryptosporidium oocysts were used for PCR amplification experiments. However, PCR amplification was performed in the same manner as the above PCR method.

  As a result of the comparison between the glycocholic acid extraction method and the sodium N-lauroyl sarcosinate (LSS) extraction method, it was extracted and amplified with good reproducibility by treatment with sodium N-lauroyl sarcosinate (LSS). In the acid treatment, reproducibility was low and no detection tendency was observed (FIG. 7).

  The nucleic acid extraction method and kit of the present invention are used in genetic engineering, clinical diagnosis, forensic medicine, etc., analysis of genetic information, diagnosis / cause investigation of genetic diseases / viral diseases, etc. Can be used as a sample used for examination of environmental contamination and the like (e.g., Southern blotting method and PCR method), especially in early stages of various diseases such as cancer using free DNA in blood. Gene diagnosis such as diagnosis or monitoring of disease state DNA typing method and DNA fingerprinting method (for example, PCR-RELP method, PCR-SSOP method, PCR-LIPA method, PCR-SSCP method, PCR-SSP method, PCR-CFLP method, PCR -In RAPD method, PCR-RDA method, RNase protection method, DGGE method, TGGE method) Used to.

  In addition, if nucleic acid is extracted from a plant-derived test sample, it can be applied to the identification of varieties, brands, etc., and test samples containing microorganisms can be applied to examine environmental contamination by microorganisms, in the field of bioremediation. Can be applied to confirm the presence of pollutant assimilating bacteria in the soil to be purified.

Electrophoretic test results after PCR amplification of each DNA extraction solution obtained in Example 1 Electrophoretic test result diagram after PCR amplification of each DNA extraction solution obtained in Example 2 Electrophoretic test results after PCR amplification obtained by changing the final concentration of sodium N-lauroyl sarcosinate (LSS) in Example 2 FIG. 4a shows electrophoresis after PCR amplification obtained by changing the time of nucleic acid extraction treatment in Example 2 with sodium N-lauroyl sarcosinate (LSS) 0.1% (concentration during PCR is 1/10). FIG. 4 b is a diagram showing test results. FIG. 4 b shows the results obtained by changing the time and temperature of nucleic acid extraction treatment in Example 2 with sodium N-lauroyl sarcosinate (LSS) 0.1% (concentration during PCR is 1/10). Result of electrophoresis test results after PCR amplification The figure which shows typically the sodium N-lauroyl sarcosinate (LSS) extraction method in Example 3, QIAGEN method, and the TritonX-100 simple extraction method. Electrophoretic test result diagram after PCR amplification of each DNA extraction solution obtained in Example 3 Electrophoretic test result diagram after PCR amplification of each DNA extraction solution obtained in Example 4

Claims (4)

  A method for extracting nucleic acid, comprising performing a treatment of contacting sodium N-lauroyl sarcosinate (LSS) with a test sample.   The nucleic acid extraction method according to claim 1, wherein a concentration of the sodium N-lauroyl sarcosinate (LSS) is 0.1 to 0.2% by mass.   The nucleic acid extraction method according to claim 1 or 2, wherein the test sample is an animal-derived sample. The nucleic acid extraction method according to claim 3, wherein the sample is a sample containing a microorganism.

Images