JP2011000071A - Method for treating biomass raw material, method for producing sugar, method for producing ethanol and method for producing lactic acid - Google Patents

Abstract

PROBLEM TO BE SOLVED: To provide a method for producing a sugar, method for producing ethanol and method for producing lactic acid, capable of performing enzymatic saccharification efficiently and therefore capable of improving the production efficiency of the sugar, production efficiency of the ethanol and production efficiency of the lactic acid, and a method for treating a biomass raw material used for the method for producing a sugar, the method for producing ethanol and the method for producing lactic acid.SOLUTION: This method for treating the biomass raw material is characterized by comprising (a) a process of obtaining a modified biomass raw material by treating the biomass raw material with a treating agent containing ammonia, and (b) a process of enzymatically saccharifying the modified biomass raw material with Cellobiohydrolase II (Cel6A).

Description

  The present invention relates to a biomass raw material treatment method, a sugar production method, an ethanol production method, and a lactic acid production method.

  In recent years, bioethanol produced from plant resources has attracted attention as a substitute for fossil fuels as part of measures to combat global warming.

  Conventionally, sugars such as sugar cane and starches such as cereals were mainly used as raw materials for bioethanol, but these raw materials are often used as food and feed. Increasing the production volume of bioethanol using corn is likely to affect the supply of food and feed.

On the other hand, trees, grasses, wastes, etc. are biomass raw materials useful for energy use because they do not compete with food production.
Cellulosic biomass derived from plants contains cellulose, hemicellulose, and lignin as main components. The cellulose is a fibrous polysaccharide in which glucose is formed in a straight chain by β-1,4-glucoside bonding, and is a main component constituting a cell wall of a plant. The said hemicellulose is a polysaccharide which comprises the cell wall etc. of a plant with the said cellulose. The lignin is a polymer material polymerized using hydroxyphenylpropane as a basic unit. Among these, the cellulose is a natural polymer having the largest abundance on the earth.
Therefore, in recent years, attempts have been widely made to saccharify raw materials containing cellulose such as woody biomass and herbaceous biomass and use them as various fuels and chemical raw materials.

Production of ethanol from biomass raw material can be performed, for example, by decomposing the collected biomass raw material into sugar in the saccharification step and then converting it into ethanol using a microorganism such as yeast in the fermentation step.
In the saccharification step for extracting sugar from cellulosic biomass, it is necessary to solubilize cellulose and hemicellulose present in a macromolecule in the plant body and simultaneously decompose them into monosaccharides such as glucose. Conventionally, as a saccharification method, a strong acid such as concentrated sulfuric acid or concentrated hydrochloric acid has been often used, but it is desired to avoid the use of these strong acids from the viewpoint of reducing environmental burden.

Thus, in recent years, saccharification of biomass raw materials using enzymes has been widely studied as a means to replace saccharification with strong acids such as concentrated sulfuric acid and concentrated hydrochloric acid.
Enzymatic saccharification is a desirable means from the viewpoints of reducing environmental burden, selectivity of products, and mild reaction conditions, but the enzyme used for saccharification of cellulosic biomass has already been put to practical use. Compared with the amylase addition amount required for saccharification, since the addition amount of cellulase required for saccharifying cellulose is remarkably large, the increase in sugar conversion cost is a problem.

In addition, for this enzymatic saccharification, it is necessary to pretreat the biomass raw material in advance for the purpose of facilitating the action of the enzyme. Various methods are known as pretreatment methods for this biomass raw material. Among these, steaming treatment with dilute sulfuric acid, pressurized hot water, etc. are common (see Patent Documents 1 to 4). However, as described above, the use of sulfuric acid is not preferable. Further, when these pretreatments are performed on the biomass raw material and the obtained processed product is subjected to enzymatic saccharification, it is necessary to perform the pretreatment in multiple stages in order to obtain a desired degree of enzymatic saccharification efficiency, This is a problem in that the temperature must be higher than 200 ° C.
It is also known that chemical and biochemical reactivity can be improved by finely pulverizing biomass raw materials by physical means. However, if sufficient enzymatic saccharification efficiency is obtained by pulverization alone, This is a problem in that it requires a lot of energy and may lose economic rationality.
Furthermore, it is known that the chemical and biochemical reactivity of the biomass raw material is improved by pretreatment with ammonia or organic amine (see Patent Document 5). However, the enzyme saccharification efficiency is a problem in that it is not yet sufficient.

  Accordingly, the development of an enzyme saccharification technique that can further increase the enzyme saccharification efficiency and the development of a biomass raw material pretreatment technique suitable for the enzyme saccharification are still desired.

JP 2006-075007 A JP 2004-121055 A JP 2002-541355 A JP 2002-159954 A European Patent Publication No. 77287

  An object of the present invention is to solve the conventional problems and achieve the following objects. That is, the present invention can efficiently carry out enzymatic saccharification, and therefore can improve sugar production efficiency, ethanol production efficiency, and lactic acid production efficiency. It is an object of the present invention to provide a method, a method for producing lactic acid, and a method for treating a biomass raw material used in the method for producing sugar, the method for producing ethanol, and the method for producing lactic acid.

  In order to solve the above-mentioned problems, the present inventors have made extensive studies and as a result, obtained the following findings. That is, an enzyme is obtained by enzymatic saccharification of a modified biomass raw material obtained by treating a biomass raw material containing cellulose type I, which is natural type cellulose, with a treatment agent containing ammonia using cellobiohydrolase II (Cel6A). This is a finding that saccharification can be efficiently performed, and therefore, sugar production efficiency, ethanol production efficiency, and lactic acid production efficiency can be significantly improved.

In addition, the present inventors previously used enzymatic saccharification efficiently by using cellulose having a crystal density lower than that of natural cellulose (type _I cellulose) as an object of enzymatic saccharification. Patent application filed that it can be carried out, and that a biomass raw material containing cellulose type I can be treated with ammonia, particularly supercritical ammonia, to efficiently obtain cellulose for enzymatic saccharification containing cellulose III type _I (See JP 2008-161125 A).

  It is conventionally known that the enzymatic saccharification efficiency of a biomass raw material can be remarkably improved by treating the biomass raw material with a treatment agent containing ammonia and then performing enzymatic saccharification using cellobiohydrolase II (Cel6A). This is a new finding by the present inventors.

The present invention is based on the above findings by the present inventors, and means for solving the above problems are as follows. That is,
<1> (a) A step of obtaining a modified biomass material by treating the biomass material with a treatment agent containing ammonia, (b) enzymatic saccharification of the modified biomass material with cellobiohydrolase II (Cel6A) A process for treating a biomass raw material.
<2> The biomass raw material treatment method according to <1>, wherein the biomass raw material includes cellulose type I.
<3> The biomass raw material treatment method according to any one of <1> to <2>, wherein the biomass raw material is woody biomass.
<4> The method for treating a biomass raw material according to any one of <1> to <3>, wherein the step (a) includes treatment with a supercritical ammonia fluid.
<5> When the surface density at which the modified biomass material and cellobiohydrolase II (Cel6A) undergo a hydrolysis reaction is 0.9 or less, the hydrolysis rate per molecule of cellobiohydrolase II (Cel6A) is 1 minute. The method for treating a biomass raw material according to any one of <1> to <4>, wherein the treatment is performed 5 times or more.
<6> A method for producing sugar, characterized in that sugar is obtained by the method for treating a biomass raw material according to any one of <1> to <5>.
<7> A method for producing ethanol, wherein the sugar obtained by the method for producing sugar according to <6> is fermented to obtain ethanol.
<8> A method for producing lactic acid, wherein the saccharide obtained by the method for producing saccharide according to <6> is fermented to obtain lactic acid.

  According to the present invention, the conventional problems can be solved, the object can be achieved, and enzymatic saccharification can be efficiently performed. Therefore, sugar production efficiency, ethanol production efficiency, and lactic acid production Processing of sugar raw material, ethanol manufacturing method, lactic acid manufacturing method, and biomass raw material used in the sugar manufacturing method, ethanol manufacturing method, and lactic acid manufacturing method capable of improving production efficiency A method can be provided.

Figure 1 is a diagram showing a PcCel6A, the time course of cellobiose concentration in the reaction solution with a cellulose III _I. FIG. 2 is a graph showing the change over time of the cellobiose concentration in the reaction solution of TrCel7A and cellulose III _I. 3, PcCel6A- hydrolysis of cellulose III _I, TrCel7A- hydrolysis of cellulose III _I, PcCel6A- hydrolysis of cellulose I _alpha, and TrCel7A- in the hydrolysis of cellulose I _alpha, cellobiose each reaction solution generated It is the figure which showed the relationship between quantity and reaction surface density. FIG. 4 shows the results of hydrolysis of PcCel6A-cellulose III _I , hydrolysis of TrCel7A-cellulose III _I , hydrolysis of PcCel6A-cellulose I _α , and hydrolysis of TrCel7A-cellulose I _α per molecule of each adsorbing enzyme. It is the figure which showed the relationship between a hydrolysis rate and the reaction surface density. 5, PcCel6A- hydrolysis reaction of cellulose III _I, TrCel7A- hydrolysis reaction of cellulose III _I, PcCel6A- hydrolysis reaction of cellulose I _alpha, a TrCel7A- cellulose I _alpha in the hydrolysis reaction, in the hydrolysis reaction It is the figure which showed the amount of PcCel6A or TrCel7A which adsorb | sucked to each cellulose. 6, TrCel7A- hydrolysis reaction of cellulose I _α, PcCel6A- hydrolysis reaction of cellulose III _I, TrCel7A- hydrolysis reaction of cellulose III _I, and PcCel6A + PcCel45A- in the hydrolysis reaction of cellulose III _I, each of the reaction solution It is the figure which showed the time-dependent change of the cellobiose density | concentration in it. 7, TrCel7A- hydrolysis reaction of cellulose I _α, PcCel6A- hydrolysis reaction of cellulose I _α, PcCel45A- hydrolysis reaction of cellulose I _α, PcCel6A + PcCel45A- cellulose I _alpha hydrolysis reaction, the TrCel7A- cellulose III _I It is the figure which showed the cellobiose formation rate in the hydrolysis reaction, the hydrolysis reaction of PcCel6A-cellulose III _I , the hydrolysis reaction of PcCel45A-cellulose III _I , and the hydrolysis reaction of PcCel6A + PcCel45A-cellulose III _I.

(Biomass raw material processing method)
The method for treating a biomass material according to the present invention includes (a) a step of obtaining a modified biomass material by treating the biomass material with a treatment agent containing ammonia, and (b) treating the modified biomass material with cellobiohydrolase II. A step of enzymatic saccharification with (Cel6A), and if necessary, further processing.

<Process (a)>
The step (a) is a step of obtaining a modified biomass material by treating the biomass material with a treatment agent containing ammonia.

-Biomass raw material-
There is no restriction | limiting in particular as said biomass raw material, Although it can select suitably according to the objective, The biomass raw material containing a cellulose I type is preferable.
There is no restriction | limiting in particular as a biomass raw material containing the said cellulose I type, According to the objective, it can select suitably. For example, “waste biomass” obtained as a residue from production activities such as agriculture and forestry, or “resource crop biomass” obtained by intentional cultivation for the purpose of obtaining energy, etc. can be used. .
There is no restriction | limiting in particular as said "waste-type biomass", According to the objective, it can select suitably, For example, a waste building material, thinning material, rice straw, straw, rice husk, sugarcane bagasse etc. are mentioned.
The “resource crop-based biomass” is not particularly limited and can be appropriately selected depending on the purpose. For example, sugar or starch-based crops grown as food such as sugar cane and corn, and cellulose Eucalyptus, poplar, acacia, willow, cedar, switchgrass, napiergrass, Elianthus, Miscanthus, Susuki, etc., cultivated for the purpose of the use of fruits.

  The biomass material containing cellulose type I is also classified into “woody biomass” using wood as a raw material, “herbaceous biomass” using grass as a raw material, and the like. In the present invention, both woody biomass and herbaceous biomass can be used, but biomass having a high cellulose content is preferably used from the viewpoint that the effects of the present invention can be obtained more remarkably.

The biomass raw material containing cellulose type I may be cellulose type I itself obtained by purification from various types of biomass as described above.
Moreover, the biomass raw material containing the said cellulose I type may be used individually by 1 type, and may use 2 or more types together. Cellulose I type, which is a natural type cellulose, is classified into cellulose I _α type and cellulose I _β type, and any of these may be used as the cellulose I type contained in the biomass raw material. Both of these may be used.

  The state of the biomass raw material is not particularly limited and may be appropriately selected according to the purpose. The collected material may be used as it is, and after being made to be a certain size or less by cutting, pulverizing, or the like. May be used.

-Treatment agent containing ammonia-
The treatment agent containing ammonia is not particularly limited as long as it contains at least ammonia, and can be appropriately selected according to the purpose, and further contains other compounds as necessary.

There is no restriction | limiting in particular as a method of processing the biomass raw material containing the said cellulose I type with the processing agent containing ammonia, According to the objective, it can select suitably.
By treating with the treatment agent containing ammonia, at least a part of cellulose type I in the biomass raw material is transformed into cellulose III type _I having higher enzymatic saccharification efficiency.
The ammonia is not particularly limited and can be appropriately selected in consideration of the target saccharification rate, energy consumption, and the like, for example, liquid phase, gas phase, subcritical state. The supercritical state is preferable, but the supercritical state is preferable from the viewpoint of improving the transformation efficiency.

-Treatment with supercritical ammonia fluid-
There is no restriction | limiting in particular as a method of processing using the said supercritical ammonia fluid, According to the objective, it can select suitably, For example, reactors, such as a biomass raw material containing the said cellulose I type, and ammonia, such as an autoclave It can introduce | transduce in and can carry out by heating and pressurizing the inside of the said reactor, and making ammonia a supercritical state.

In the treatment, as the biomass raw material containing the cellulose type I, the collected material may be used as it is, but using it after reducing it to some extent can reduce the energy required for the treatment. desirable.
There is no restriction | limiting in particular as a size of the said biomass raw material, Although it can select suitably according to the objective, For example, 5 mm diameter or less is preferable, 1 mm diameter or less is more preferable, 0.1 mm diameter or less is still more preferable. If the size exceeds 5 mm, the treatment may be insufficient. On the other hand, when the size is within the further preferable range, it is advantageous in that the treatment time can be shortened and the volume of ammonia to be used can be reduced.

There is no restriction | limiting in particular as the usage-amount of the said ammonia at the time of processing with the processing agent containing the said ammonia, Although it can select suitably according to the objective, With respect to 1 g of biomass raw materials containing the said cellulose I type 10 mg to 300 g is preferable, 100 mg to 150 g is more preferable, and 1 g to 50 g is still more preferable.
If the amount of ammonia used is less than 10 mg with respect to 1 g of biomass raw material containing cellulose type I, the treatment may be insufficient, and if it exceeds 300 g, the efficiency of the treatment may deteriorate. On the other hand, when the amount used is in the further preferable range, it is advantageous in that the treatment time can be shortened and the amount of the treatment agent to be used can be reduced.
The treatment temperature and the treatment pressure are not particularly limited and may be appropriately selected depending on the purpose within a range where ammonia is in a supercritical state, but preferably 0 MPa to 12.5 MPa.
There is no restriction | limiting in particular as processing temperature which processes with the said processing agent containing ammonia, Although it can select suitably according to the objective, -35 to 140 degreeC is preferable.

There is no restriction | limiting in particular as time to process with the processing agent containing the said ammonia, According to the quantity of the biomass raw material containing the said cellulose I type to be used, the said processing pressure, the said processing temperature, etc., from the cellulose I type of a desired grade. Although it can select suitably in the range in which transformation to cellulose III type _I advances, 5 minutes-10 hours are preferred, 10 minutes-5 hours are more preferred, and 30 minutes-2 hours are still more preferred.
The processing time, sometimes transformation is less than 5 minutes from the desired degree of cellulose I type cellulose to III type _I does not proceed, from more cellulose I type more than 10 hours to cellulose III _I Type Transformation does not proceed and may be inefficient as a whole. On the other hand, when the treatment time is within the more preferable range, it is advantageous in that the transformation from cellulose type I to cellulose III type _I can be efficiently advanced.

-Other compounds-
The other compound in the treatment agent containing ammonia is not particularly limited and may be appropriately selected depending on the intended purpose. For example, carbon dioxide, nitrogen, ethylene, methane, ethane, propane, butane, pentane, hexane , Toluene, benzene, phenol, dioxane, xylene, acetone, chloroform, carbon tetrachloride, ethanol, methanol, propanol, butanol and the like.
In addition, it is preferable not to use water as said other compound. With the water, cellulose III type _I obtained was, in some cases back to cellulose I type.
There is no restriction | limiting in particular also as content of the said other compound, According to the objective, it can select suitably.

-Modified biomass feedstock-
The modified biomass raw material can be obtained by processing with the processing agent containing ammonia.
The “modified biomass raw material” in the present application means a biomass raw material containing cellulose type I treated with a treatment agent containing ammonia. At least a part of cellulose type I contained in the biomass raw material is cellulose III. It is preferably one transformed into type _I. The cellulose III type _I is cellulose having a lower crystal density than the cellulose type I. Cellulose III type _I is advantageous in that the enzyme easily acts because of its low crystal density.
Moreover, since the modified biomass raw material has been modified into a state in which the hemicellulose contained in the biomass raw material is modified by the treatment, and the enzyme is more likely to act, the enzymatic saccharification efficiency can be improved. .

The ratio of the cellulose III type _I in the modified biomass raw material is not particularly limited and can be appropriately selected according to the purpose. However, the more the cellulose III type _I , the better the enzymatic saccharification efficiency. This is preferable.
In addition to the cellulose III type _I , the modified biomass material includes, for example, cellulose type I (cellulose I _α type, cellulose I _β type) and other components such as hemicellulose and lignin. May be. However, from the viewpoint of improving the efficiency of enzymatic saccharification, it is preferable that hemicellulose and lignin are not contained or the content thereof is small.

In the modified biomass raw material, as a method for confirming that at least a part of the cellulose _I type is converted to the cellulose III _I type, there is no particular limitation, and can be appropriately selected according to the purpose, For example, it can be confirmed by X-ray diffraction, FT-IR, solid NMR or the like.

  In the modified biomass raw material, cellulose may have other compounds between its molecular structures. For example, as described above, the modified biomass raw material can be obtained by treating a biomass raw material containing cellulose type I, which is a natural type cellulose, with a treatment agent containing ammonia. And a complex of ammonia (hereinafter sometimes referred to as “cellulose / ammonia complex”). However, the cellulose-ammonia complex is difficult to adjust pH during enzymatic saccharification, and has the property of returning to cellulose type I by the action of water. It is preferable to use a modified biomass raw material in which ammonia is removed from the cellulose / ammonia complex.

Therefore, it is preferable to provide a removal step for removing ammonia from the cellulose / ammonia complex after the treatment with ammonia.
The method for removing ammonia is not particularly limited and can be appropriately selected depending on the purpose. For example, after the treatment with ammonia, the obtained modified biomass raw material containing the cellulose-ammonia complex is treated with methanol. , Methods of washing with ethanol, acetone, etc., methods of drying under reduced pressure, methods of drying at a temperature equal to or higher than the boiling point of the treating agent, and the like. Among these, a method of drying at normal temperature or reduced pressure at a temperature equal to or higher than the boiling point of ammonia (for example, normal temperature to 50 ° C.) is preferable in terms of safety without using an organic solvent.

<Step (b)>
The step (b) is a step of enzymatic saccharification of the modified biomass material with cellobiohydrolase II (Cel6A).

-Cellobiohydrolase II (Cel6A)-
The enzymatic saccharification is performed by cellulase. Cellulase is a general term for enzymes that hydrolyze cellulose. Broadly speaking, exo-type cellobiohydrolase that liberates cellobiose from the end of cellulose, crystalline cellulose cannot be decomposed, but amorphous cellulose (amorphous cellulose) chains. There are three types of endo-type endoglucanase that cleaves randomly, and exo-type β-glucosidase that produces glucose from the ends of cellobiose and short chains (cello-oligosaccharides), and there are various types of enzymes.
The cellobiohydrolase II (Cel6A) is a kind of the exo-type cellobiohydrolase and is an enzyme that hydrolyzes the glycosidic bond of β-1,4-glucan constituting cellulose.

The origin of the cellobiohydrolase II (Cel6A) is not particularly limited and may be appropriately selected depending on the intended purpose. Examples thereof include bacteria, ascomycetes and basidiomycetes.
The bacterium is not particularly limited as long as it can produce the cellobiohydrolase II (Cel6A), and can be appropriately selected according to the purpose. Examples thereof include Cellulomonas fimi and Thermobifida fusca. Can be mentioned.
The child ascomycete, if the cellobiohydrolase II (Cel6A) producing, not particularly limited and may be appropriately selected depending on the intended purpose, e.g., Trichoderma reesei (Trichoderma reesei), Trichoderma viride (T. viride) Humicola insolens , Humicola glycea ( H. grisea ), Ketomium thermophilum (Chaetmium thermophilum ), Talaromyces emersonii ( Talaromyces emersonis, etc.)
The basidiomycete is not particularly limited as long as it can produce the cellobiohydrolase II (Cel6A), and can be appropriately selected according to the purpose. However, a basidiomycete belonging to the basidiomycete Aratake mushroom is preferred. More preferably, the basidiomycetes belonging to the genus Agarica are more preferably a basidiomycete belonging to the order Basidiomycetes Agarica haratake. More particularly, the basidiomycetes belonging to the order Amanita mushroom are preferred, and Phanerochate chrysosporium is particularly preferred.

  The method for obtaining the cellobiohydrolase II (Cel6A) is not particularly limited and may be appropriately selected depending on the intended purpose. The cellobiohydrolase obtained by culturing the basidiomycete and obtaining it from a database such as NCBI. A method of obtaining a recombinant protein of cellobiohydrolase II (Cel6A) by cloning using the gene sequence of II (Cel6A) is preferred. Commercial products can also be used.

The method for culturing the basidiomycete is not particularly limited and may be appropriately selected depending on the intended purpose. Examples thereof include a solid culture method using an agar medium and a liquid culture method using a liquid medium. Among these, the liquid culture method is preferable in that a large amount of cellobiohydrolase II (Cel6A) can be produced.
The liquid medium is not particularly limited and may be appropriately selected depending on the intended purpose. For example, Kremer and Wood medium containing cellulose (Kremer, S. M., and P. M. Wood., 1992, ... Evidence that cellobiose oxidase from Phanerochaete chrysosporium is primarily an Fe (III) reductase Kinetic comparison with neutrophil NADPH oxidase and yeast flavocytochrome b 2, Eur J. Biochem, 205:.. 133-138) , and the like.

  There is no restriction | limiting in particular as temperature of the said culture | cultivation, Although it can select suitably according to the objective, 20 to 45 degreeC is preferable, 30 to 40 degreeC is more preferable, and 37 degreeC is still more preferable. If the culture temperature is less than 20 ° C, the growth of basidiomycetes may be slow, and if it exceeds 45 ° C, the basidiomycetes may not grow. On the other hand, when the culture temperature is within the further preferable range, it is advantageous in that cellobiohydrolase II (Cel6A) can be efficiently produced.

  There is no restriction | limiting in particular as the number of days of the said culture | cultivation, Although it can select suitably according to the objective, 1 to 30 days are preferable, 2 to 14 days are more preferable, and 3 to 7 days are still more preferable. When the number of days of the culture is less than one day, the number of basidiomycetes is small and the production amount of cellobiohydrolase II (Cel6A) may be small. When the number of days exceeds 30 days, the number of basidiomycetes that become dead bacteria increases. Alternatively, the produced cellobiohydrolase II (Cel6A) may be decomposed. On the other hand, when the number of days of the culture is within the further preferable range, it is advantageous in that cellobiohydrolase II (Cel6A) can be efficiently produced.

--Enzymatic saccharification--
There is no restriction | limiting in particular as the usage-amount of the said cellobiohydrolase II (Cel6A) in the case of the said enzyme saccharification, Although it can select suitably according to the objective, For example, 1 mg-with respect to 1g of modified biomass raw materials. 1,000 mg is preferable, 2 mg to 500 mg is more preferable, and 5 mg to 200 mg is still more preferable. If the amount of the enzyme used is less than 1 mg with respect to 1 g of the enzyme saccharification raw material, enzyme saccharification may be insufficient, and if it exceeds 1,000 mg, the amount of enzyme used increases and the efficiency deteriorates. On the other hand, when the amount of the enzyme used is within the more preferable range, it is advantageous in that the amount of sugar obtained is larger than the amount of enzyme added.

  There is no restriction | limiting in particular as temperature in the case of the said enzyme saccharification, Although it can select suitably according to the objective, For example, 10 to 70 degreeC is preferable, 20 to 60 degreeC is more preferable, 30 to 50 degreeC. More preferred is ° C. If the temperature is less than 10 ° C, enzyme saccharification may not proceed sufficiently, and if it exceeds 70 ° C, the enzyme may be deactivated. On the other hand, it is advantageous that the amount of sugar obtained relative to the amount of enzyme added is large when the temperature is within the further preferable range.

  There is no restriction | limiting in particular as pH in the case of the said enzyme saccharification, Although it can select suitably according to the objective, For example, 2-8 are preferable, 3-7 are more preferable, and 4-6 are still more preferable. If the pH is less than 2 or exceeds 8, the enzyme may be deactivated. On the other hand, when the pH is within the more preferable range, it is advantageous in that a large amount of sugar is obtained relative to the amount of enzyme added.

  In addition, there is no restriction | limiting in particular as a hydrolysis rate of the said enzyme, Although it can select suitably according to the objective, The said modified biomass raw material and the said cellobiohydrolase II (Cel6A) perform a hydrolysis reaction. When the surface density is 0.9 or less, the hydrolysis rate per cellobiohydrolase II (Cel6A) molecule is preferably 5 times or more per minute.

<Other processes>
There is no restriction | limiting in particular as said other process, According to the objective, it can select suitably, For example, the process of cutting and grind | pulverizing the said biomass raw material, the process of grind | pulverizing the said modified biomass raw material, etc. are mentioned.

-Cutting and crushing biomass raw materials-
In the treatment with the treatment agent containing ammonia, it is preferable that the biomass raw material containing cellulose type I is preliminarily cut and pulverized in that the treatment with the treatment agent containing ammonia proceeds efficiently. Further, it is also preferable in that a finer powdery reformed biomass material excellent in enzymatic saccharification efficiency can be efficiently obtained when pulverizing the modified biomass material described later.
There is no restriction | limiting in particular as an apparatus used for the said cutting and grinding | pulverization, According to the objective, it can select suitably, For example, a Willet mill, a cutter mill, a hammer mill, a pin mill etc. are mentioned.

-Process of crushing modified biomass raw material-
In the step (b), it is preferable that the modified biomass raw material is pulverized in advance because the enzyme saccharification efficiency can be further improved.
The method for pulverizing the modified biomass raw material is not particularly limited and may be appropriately selected depending on the intended purpose. For example, a pulverizer such as a flat mill, a planetary ball mill, a vibration ball mill, a bead mill, a jet mill or the like may be used. Can be used. Among these, a flat mill is preferable as the pulverizer because a fine powdery raw material for enzymatic saccharification excellent in enzymatic saccharification efficiency can be obtained with relatively low energy.
The conditions for the pulverization are not particularly limited, and can be appropriately selected depending on the type of pulverizer, the type of modified biomass raw material, the average particle size of the pulverized product to be obtained, and the like.

(Method for producing sugar)
The sugar production method of the present invention includes obtaining sugar by the above-described biomass raw material treatment method of the present invention (sugar acquisition step), and further includes other steps as necessary.

<Sugar acquisition process>
The sugar acquisition step is a step of obtaining sugar from the biomass raw material using the cellobiohydrolase II (Cel6A), and other cellulases can be used as necessary.

-Biomass raw material-
As the biomass raw material, it is preferable to use the modified biomass raw material described above, and it is more preferable that the modified biomass raw material is in a pulverized state because the enzyme saccharification efficiency can be improved.

-Cellobiohydrolase II (Cel6A)-
There is no restriction | limiting in particular about the usage-amount of the said cellobiohydrolase II (Cel6A), reaction temperature, pH, reaction time, etc. in the said sugar acquisition process, According to the objective, it can select suitably.

-Other cellulases-
There is no restriction | limiting in particular as said other cellulase, According to the objective, it can select suitably, For example, Cel45A of Phanerochate chrysosporium ( Phanerochaete chrysosporium ) etc. are mentioned.
When the other cellulase is further used, the amount of cellulase used is not particularly limited, and may be appropriately selected according to the amount of the modified biomass raw material, the amount of the cellobiohydrolase II (Cel6A) added, and the like. However, the ratio of the cellobiohydrolase II (Cel6A) to the cellulase is preferably 100: 1 to 1: 100, more preferably 10: 1 to 1:10, and even more preferably 2: 1 to 1: 2. preferable.

  By the sugar acquisition step, for example, a sugar solution containing glucose which is a sugar derived from cellulose can be obtained. In addition, the sugar solution obtained by the sugar acquisition step preferably also contains a sugar derived from hemicellulose. The sugar derived from hemicellulose is not particularly limited and may be appropriately selected depending on the intended purpose. Examples thereof include pentose sugars such as xylose and arabinose and hexose sugars such as glucose, galactose and mannose. .

<Other processes>
There is no restriction | limiting in particular as said other process, According to the objective, it can select suitably, For example, the process etc. which adjust the said sugar liquid to pH suitable for the fermentation process mentioned later etc. are mentioned.

<Application>
The sugar solution may be used, for example, as it is in the method for producing ethanol of the present invention, which will be described later, or may be used for the method for producing ethanol, which will be described later, through other steps as described below.

(Ethanol production method)
The method for producing ethanol of the present invention includes a step (fermentation step) of fermenting the sugar obtained by the above-described method for producing sugar of the present invention to obtain ethanol, and further includes other steps as necessary. .

<Fermentation process (alcohol fermentation process)>
In the method for producing ethanol, the method for fermenting the sugar is not particularly limited and can be appropriately selected according to the purpose.However, an alcohol-fermenting microorganism such as yeast is added to the solution containing the sugar, A method of performing alcoholic fermentation is preferred.

-Yeast-
There is no restriction | limiting in particular as said yeast, According to the objective, it can select suitably, For example, Saccharomyces genus yeast etc. are mentioned. The yeast may be natural yeast or genetically modified yeast. Specific examples of the ethanol-fermenting microorganism include Saccharomyces cerevisiae , Kluyveromyces fragilis , Kluyveromyces lactis ( K. lactis ), Kluyveris an . , Pichia Sutipitisu (Pichia stipitis), Pichia pastoris (P. pastoris), Pachisoren Tan'nofirusu (Pachysolen tannophilus), Candida Gurabirata (Candida glabrata) yeast or of genes recombinants such as, Zaimomonazu mobilis (Zymomonas mobilis), Saimobakuta Palme (Zymobacter palmae), Clostridium thermocellum (Clostridium thermocellum), can be used bacteria or of these genes recombinant such as Clostridium Rujungudari (C.ljungdahlii).

  The amount of yeast used, the fermentation temperature, pH, fermentation time, etc. in the fermentation are not particularly limited, and are appropriately selected according to, for example, the amount of sugar to be used for alcohol fermentation, the type of yeast to be used, and the like. be able to.

<Other processes>
There is no restriction | limiting in particular as said other process, According to the objective, it can select suitably, For example, the process etc. which isolate | separate and refine | purify the ethanol obtained by the said fermentation process are mentioned. The method for separation and purification is not particularly limited and may be appropriately selected depending on the intended purpose. Examples thereof include distillation.

<Application>
Ethanol obtained by the ethanol production method can be suitably used as, for example, fuel ethanol, industrial ethanol, and the like. Since the ethanol can be obtained from the biomass raw material, it can be reproduced as long as the biomass raw material can be produced, and the plant absorbs carbon dioxide in the atmosphere during cultivation. Even if carbon dioxide is generated by burning, it does not increase the carbon dioxide concentration in the atmosphere. Therefore, it can be said that ethanol is a desirable energy source for preventing global warming. In recent years, such ethanol is particularly expected to be mixed with gasoline and used as an environmentally friendly automobile fuel.

  Alcohol other than ethanol is produced by fermenting the sugar obtained by the sugar production method of the present invention with a microorganism that produces the desired alcohol, instead of the yeast that produces ethanol. You can also. For example, butanol can be produced by fermentation using acetone / butanol bacteria.

(Production method of lactic acid)
The method for producing lactic acid of the present invention includes a step (fermentation step) of fermenting the saccharide obtained by the above-described method for producing saccharide of the present invention to obtain lactic acid, and further includes other steps as necessary. .

<Fermentation process (lactic acid fermentation process)>
In the method for producing lactic acid, the method for fermenting the sugar is not particularly limited and may be appropriately selected depending on the purpose. However, a lactic acid-fermenting microorganism such as lactic acid bacteria is added to the solution containing the sugar, A method of performing lactic acid fermentation is preferred.

-Lactic acid bacteria-
The lactic acid bacterium is not particularly limited and may be appropriately selected depending on the intended purpose. For example, Lactobacillus manihotivorans , Lactobacillus plantarum ( Lactobacillus plantarum ), Streptococcus thermophilus s . And Lactobacillus bulgaricus . The lactic acid bacterium may be a natural lactic acid bacterium or a genetically modified lactic acid bacterium.

  In the fermentation, the amount of lactic acid bacteria used, fermentation temperature, pH, fermentation time, etc. are not particularly limited, and are appropriately selected according to, for example, the amount of saccharide used for lactic acid fermentation, the type of lactic acid bacteria used, etc. can do.

<Other processes>
There is no restriction | limiting in particular as said other process, According to the objective, it can select suitably, For example, the process etc. which isolate | separate and refine | purify the lactic acid obtained by the said fermentation process are mentioned. The separation / purification method is not particularly limited and may be appropriately selected depending on the intended purpose.

<Application>
The lactic acid obtained by the lactic acid production method can be suitably used for producing polylactic acid by chemical polymerization, for example. Currently, it is desirable to be able to produce lactic acid, which is often produced from starch such as corn, from biomass raw materials containing cellulose that cannot be used for food. According to the method for producing lactic acid, It is possible to efficiently produce polylactic acid from a biomass raw material containing

  The saccharide obtained by the method for producing saccharides of the present invention is fermented by using microorganisms that produce the desired organic acid in place of the lactic acid bacteria, so that organic acids other than lactic acid, such as citric acid and succinic acid, can be obtained. Acid, malic acid, oxalic acid and the like can also be produced.

  EXAMPLES The present invention will be specifically described below with reference to examples and comparative examples of the present invention, but the present invention is not limited to these examples.

(Examples 1-6)
<Processing of biomass raw material with Cel6A>
-Step (a)-
A modified biomass material was obtained by treating the biomass material with a treatment agent containing ammonia by a method described later.

--- Biomass raw material--
Green algae cell wall (cellulose I _α type / I _β type = 7: 3) was used as a biomass raw material.
The cellulose is purified by soaking at room temperature overnight in a 5.0% by weight potassium hydroxide aqueous solution and at 80 ° C. in a 0.3% by weight NaClO ₂ aqueous solution buffered with a pH 4.9 acetate buffer. The operation for 3 hours was repeated 3 times. After purification, it was washed with water, freeze-dried and stored (hereinafter sometimes referred to as “cellulose I _α ”).
The cellulose I _alpha is used for preparing the modified biomass material containing cellulose III _I described below.

--Supercritical ammonia fluid treatment (preparation of modified biomass feedstock containing cellulose III _I )-
The cellulose I _alpha, by the following operation, subjected to treatment with ammonia in the supercritical state.
In a 30 mL portable reactor, 200 mg of Shiogusa was placed and cooled to −13 ° C. in a methanol bath with dry ice. Ammonia gas was introduced into this reactor at a constant pressure of 0.5 MPa for 30 minutes, and the sample was completely immersed in liquid ammonia. The reactor lid was closed and left at room temperature for about 15 minutes. Subsequently, it processed in the 140 degreeC oil bath for 1 hour. At this time, the pressure in the reactor rose slowly, reached 13 MPa after 20 minutes, and then remained constant (critical temperature of ammonia Tc = 405.6 K, critical pressure Pc = 11.88 MPa). After the treatment, the reactor was removed from the oil bath, and ammonia gas was immediately leaked in the draft. The treated cellulose was washed with methanol and dried to obtain a modified biomass raw material containing cellulose III type _I (hereinafter sometimes referred to as “cellulose III _I ”).

-Step (b)-
Using cellobiohydrolase II (Cel6A) produced by the method described later, the modified biomass raw material (cellulose III _I ) was enzymatically saccharified (sugar acquisition step) to obtain sugar.

--- Production of recombinant Cel6A--
Phanerocate chrysosporium Cel6A recombinant protein (hereinafter sometimes referred to as “PcCel6A”) was produced by the following method.

--- Cloning of Cel6A gene ---
Phanerocatete chrysosporium K-3 strain, Kremer and Wood medium (Kremer, SM, and PM Wood, 19%, containing 2% by weight cellulose (CF11; manufactured by Whatman)) ... Evidence that cellobiose oxidase from Phanerochaete chrysosporium is primarily an Fe (III) reductase Kinetic comparison with neutrophil NADPH oxidase and yeast flavocytochrome b 2, Eur J. Biochem, 205:.. 133-138 in), Habu, N. , K .; Igarashi, M .; Samejima, B .; Pettersson, and K.C. E. Eriksson. , 1997, Enhanced production of cellobiose dehydrogenase in culture of Phanerochaete chrysospodium supplemented bobine calf. , Biotechnol. Appl. Biochem. , 26:98, and cultured for 3 days.

The culture solution after the culture was filtered, and the mycelium was separated using glass fiber filter paper (ADVANTEC (registered trademark) GA-100; manufactured by Toyo Filter Paper Co., Ltd.). Next, the separated mycelium was frozen with liquid nitrogen, and about 200 mg of total RNA was extracted using ISOGEN (manufactured by Nippon Gene Co., Ltd.) based on the manufacturer's manual.
From 1 μg of the extracted total RNA, mRNA was purified using Oligotex (TM) -dT30 <Super> (manufactured by Takara Bio Inc.).
Next, first-strand cDNA is synthesized from the mRNA using reverse transcriptase (ReverTraace; manufactured by Toyobo Co., Ltd.) and 3′RACE adapter primer (manufactured by Invitrogen) based on the manufacturer's manual. did.

The following primers were designed based on the Cel6A gene (AAB32942) (SEQ ID NO: 1) derived from Phanerocatete chrysosporium on the NCBI database.
Primer:
PcCel6A-EcoRI-F: TTTGAATTCCAGGCGTCGGAGTGGGGACAG (SEQ ID NO: 2) (in the sequence, “GAATTCC” is a restriction enzyme EcoRI cleavage sequence)
PcCel6A-NotI-R: TTTGCGGCCCCCTACAGCGGCGGGTTGGCAGC (SEQ ID NO: 3) (in the sequence, “GCGGCCGC” is a restriction enzyme NotI cleavage sequence)

PCR is performed using the above primers and KOD-Plus (version 2; manufactured by Toyobo Co., Ltd.) as a polymerase, using the cDNA prepared as described above as a template (94 ° C., 2 minutes for 1 cycle, 98 ° C., 10 ° C. And 68 ° C. for 1 second and 30 seconds for 25 cycles and 4 ° C.), a gene encoding the mature protein of PcCel6A (from the 21st amino acid) was obtained.
The PCR product obtained above was obtained from Zero Blunt (registered trademark) TOPO (registered trademark) PCR cloning kit (manufactured by Invitrogen), E. coli E. coli. It was cloned using E. coli JM109 strain (manufactured by Takara Bio Inc.).

--- Preparation of recombinant vector (expression vector) ---
The TOPO vector containing the PcCel6A gene prepared by miniprep and the yeast expression vector pPICZαA (manufactured by Invitrogen) were cleaved with restriction enzymes EcoRI and NotI (manufactured by Takara Bio Inc.), and the resulting fragment was After separation by agarose electrophoresis, the fragment was obtained by gel extraction.
20 ng each of pPICZαA and PcCel6A gene treated with restriction enzymes were ligated with DNA Ligation Kit <Mighty Mix> (manufactured by TAKARA BIO INC.). It was cloned using E. coli JM109 strain (manufactured by Takara Bio Inc.). In order to excise the Ste13 signal cleavage site from the yeast expression vector pPICZαA containing the PcCel6A gene prepared by miniprep (hereinafter sometimes referred to as “pPICZαA / PcCel6A”), the following primers were designed, PCR was performed using pPICZαA / PcCel6A as a template (94 ° C., 2 minutes for 1 cycle, 98 ° C., 10 seconds / 68 ° C., 1 minute 30 seconds for 15 cycles, 4 ° C.).
Primer:
PcCel6A-Kex2-F: GAAGGGGTATCTTCTCGAGAAAAGACAGGCGTCGGAGGTGGGACAG (SEQ ID NO: 4)
PcCel6A-Kex2-R: CTGTCCCCACTCCGACGCCTGTCTTTTCTCGAGAGATACCCCTC (SEQ ID NO: 5)

  The gene fragment amplified by PCR using the primer was treated with the restriction enzyme DpnI, and E. coli E. coli was treated. It was cloned using E. coli JM109 strain (manufactured by Takara Bio Inc.).

--- Production of transformant ---
The pPICZαA / PcCel6A-Ste (−) obtained by excising the Ste13 signal cleavage site obtained by the miniprep was linearized with a restriction enzyme BstXI (manufactured by Takara Bio Inc.), and yeast ( Pichia pastoris ) was electroporated. KM-71H) strain. Selection of transformants was performed using antibiotic (Zeocin) resistance as an index.

--- Cultivation of transformed yeast ---
The above transformant was reciprocally shaken in a YPG medium (1% by weight yeast extract, 2% by weight polypeptone, 1% by weight glycerol) containing 25 μg / mL Zeocin at 30 ° C. and 300 rpm. After culturing for 24 hours, the flask was inoculated into an Erlenmeyer flask containing 200 mL of YPG medium, and further cultured for 24 hours in a rotary shaker (30 ° C., 150 rpm). After the cells are collected by centrifugation (3,000 g, 10 minutes), the cells are transferred to 50 mL of YPM medium (1% by weight yeast extract, 2% by weight polypeptone, 1% by weight methanol), and every 24 hours. While adding methanol to a final concentration of 1% by mass, the cells were further cultured for 96 hours in a rotary shaker (26.5 ° C., 150 rpm). The culture supernatant obtained by centrifugation (3,000 g, 10 minutes) was used as a crude enzyme solution.

--- Production and purification of PcCel6A ---
Ammonium sulfate was added to the crude enzyme solution obtained as described above so as to be 70% by mass saturation, and the precipitate was recovered by centrifugation (15,000 g, 30 minutes). The precipitate was dissolved in 20 mM sodium acetate buffer (pH 5.0) containing 1M ammonium sulfate.
The solution was fractionated using a Phenyl-Toyopearl 650S column (26 mm × 120 mm, manufactured by Tosoh Corporation) equilibrated with 20 mM sodium acetate buffer (pH 5.0) containing 1 M ammonium sulfate. The obtained PcCel6A was eluted in 20 mM sodium acetate buffer (pH 5.0) with a reverse gradient of 300 mL.
Thereafter, the fractions containing PcCel6A were collected and equilibrated with 20 mM Tris-HCl buffer (pH 8.0). Subsequently, the solution containing the equilibrated PcCel6A was added to a SuperQ-Toyopearl 650S column (9 mm × 120 mm, manufactured by Tosoh Corporation) equilibrated with 20 mM Tris-HCl buffer (pH 8.0). PcCel6A was eluted from the column with a linear gradient of 100 mL of 0M to 0.5M sodium chloride.
The obtained PcCel6A gave a single band by SDS-PAGE (12% by mass polyacrylamide gel). In addition, the amino acid sequence at the N-terminal of the obtained PcCel6A was confirmed by a protein sequencer (Model 491 cLc; manufactured by Applied Biosystems).
As a result, the N-terminal amino acid sequence of PcCel6A obtained in the transformed yeast was QASEWGQCGIG (SEQ ID NO: 6), and was confirmed to be the same as Cel6A derived from the basidiomycete Phanerochate chrysosporium ( Phanerochaete chrysosporium ). .
The purified PcCel6A was buffer-exchanged with 50 mM acetate buffer (pH 5.0) and used for the following sugar acquisition step.

-Sugar acquisition process and sugar determination-
The cellulose III _I was added to 250 μL of 50 mM sodium acetate solution (pH 5.0) so that the final concentration was 0.1% by mass. Next, the PcCel6A was added according to the following Table 1, and reacted at 30 ° C. for a maximum of 360 minutes.
After completion of the reaction, the supernatant obtained after centrifuging the reaction solution for 5 minutes (× 15,000 g) to stop the reaction was linearized with acetonitrile / H ₂ O (60 / 40-50 / 50, volume / volume). With a gradient, separation was performed with Shodex (registered trademark) Asahipak NH2P-50 (manufactured by Showa Denko KK). The amount of the separated sugar was quantified using a cellooligosaccharide (manufactured by Seikagaku Corporation) having a polymerization degree (DP) = 2 to 7 as a standard. The HPLC apparatus used was LC-2000 (manufactured by JASCO Corporation) using a Corona (registered trademark) Charged Aerosol Detector (registered trademark) (manufactured by ESA Biosciences).

FIG. 1 shows the change over time of the cellobiose concentration (μM) in the reaction solution of PcCel6A and the supercritical ammonia-treated Shiogusa-derived cellulose (cellulose III _I ).
In FIG. 1, “■” indicates a case where PcCel6A is 0.25 μM (Example 1),
“●” indicates the case where PcCel6A is 0.5 μM (Example 2),
“▲” indicates the case where PcCel6A is 1.0 μM (Example 3),
“□” indicates the case where PcCel6A is 2.0 μM (Example 4),
“◯” indicates the case where PcCel6A is 4.0 μM (Example 5),
“Δ” indicates the case where PcCel6A is 8.0 μM (Example 6).

(Comparative Examples 1-6)
<Processing of biomass raw material with Cel7A>
The modified biomass raw material (cellulose III _I ) obtained in the step (a) was enzymatically saccharified using cellobiohydrolase I (Cel7A) purified by the following method, and the resulting sugar was quantified.

-Purification of Cel7A-
The Trichoderma reesei Cel7A (hereinafter sometimes referred to as “TrCel7A”) was purified by column chromatography from a cellulase preparation (Celcrust, manufactured by Novozyme).
That is, the cellulase preparation was equilibrated with 20 mM Tris-HCl buffer (pH 8.0). Subsequently, the equilibrated solution containing TrCel7A was added to a SuperQ-Toyopearl 650S column (9 mm × 120 mm, manufactured by Tosoh Corporation) equilibrated with 20 mM Tris-HCl buffer (pH 8.0). TrCel7A eluted from the column with a linear gradient of 100 mL of 0M to 0.5M sodium chloride.
Thereafter, the fraction containing TrCel7A was collected and equilibrated against 20 mM sodium acetate buffer (pH 5.0) containing 1 M ammonium sulfate. Next, the solution was fractionated using a Phenyl-Toyopearl 650S column (26 mm × 120 mm, manufactured by Tosoh Corporation) equilibrated with 20 mM sodium acetate buffer (pH 5.0) containing 1 M ammonium sulfate. The obtained TrCel7A was eluted with a reverse gradient of 300 mL into 20 mM sodium acetate buffer (pH 5.0).
The purified TrCel7A was suspended in 50 mM acetate buffer (pH 5.0) and used in the following sugar acquisition step.

-Production of sugar and determination of sugar-
The cellulose III _I was added to 250 μL of 50 mM sodium acetate solution (pH 5.0) so that the final concentration was 0.1% by mass. Next, the TrCel7A was added according to the following Table 2 and reacted at 30 ° C. for a maximum of 360 minutes.
After completion of the reaction, the supernatant obtained after centrifuging the reaction solution for 5 minutes (× 15,000 g) to stop the reaction was quantified in the same manner as in Examples 1-6.

FIG. 2 shows the change over time of the cellobiose concentration (μM) in the reaction solution of TrCel7A and the supercritical ammonia-treated Shiogusa-derived cellulose (cellulose III _I ).
In FIG. 2, “■” indicates the case where TrCel7A is 0.25 μM (Comparative Example 1).
“●” indicates the case where TrCel7A is 0.5 μM (Comparative Example 2),
“▲” indicates that TrCel7A is 1.0 μM (Comparative Example 3).
“□” indicates the case where TrCel7A is 2.0 μM (Comparative Example 4).
“◯” indicates the case where TrCel7A is 4.0 μM (Comparative Example 5).
“Δ” indicates that TrCel7A is 8.0 μM (Comparative Example 6).

From FIG. 1 (Examples 1 to 6) and FIG. 2 (Comparative Examples 1 to 6), when cellulose III _I was hydrolyzed using PcCel6A (Examples 1 to 6), it was also hydrolyzed using TrCel7A. In cases (Comparative Examples 1 to 6), the amount of the hydrolyzate (cellobiose) increased depending on the enzyme concentration. However, the amount of cellobiose produced was significantly higher in the case of hydrolysis using PcCel6A than in the case of hydrolysis using TrCel7A. In addition, when the hydrolysis was performed using PcCel6A, the reaction rate was also faster than when the hydrolysis was performed using TrCel7A.

(Example 3, and Comparative Examples 3, 7-8)
<Saccharification of cellulose I _α and cellulose III _I with PcCel6A and TrCel7A>
-Examination of cellobiose production rate and hydrolysis rate per molecule of adsorbed enzyme-
In order to compare the saccharification efficiency of cellulose between PcCel6A and TrCel7A, saccharification of cellulose III _I was performed in the same manner as in Example 3 and Comparative Example 3.
Further, in order to examine the saccharification efficiency of cellulose I _alpha by PcCel6A and TrCel7A, except for changing the cellulose III _I to cellulose I _alpha, was performed saccharification of cellulose I _alpha in the same manner as in Example 3 and Comparative Example 3 .
That is, cellulose I _α or cellulose III _I was added to 250 μL of 50 mM sodium acetate solution (pH 5.0) so that the final concentration was 0.1% by mass according to Table 3 below. Next, 1.0 μM of PcCel6A prepared in Examples 1 to 6 or 1.0 μM of TrCel7A prepared in Comparative Examples 1 to 6 was added according to Table 3 below, and reacted at 30 ° C. for a maximum of 360 minutes.
After completion of the reaction, the reaction solution was centrifuged for 5 minutes (× 15,000 g) to stop the reaction, and the supernatant obtained was quantified in the same manner as in Examples 1 to 6, and the amount of cellobiose produced (FIG. 3). And the hydrolysis rate (FIG. 4) per molecule of the enzyme adsorbed on the substrate (cellulose I _α or cellulose III _I ).

3, PcCel6A cellulose III _I hydrolysis reaction (hereinafter sometimes referred to as "PcCel6A- cellulose III _I") (Example 3), and TrCel7A cellulose III _I (hereinafter "TrCel7A- cellulose III _I" Hydrolysis reaction (Comparative Example 3), PcCel6A and cellulose I _α (hereinafter sometimes referred to as “PcCel6A-cellulose I _α ”), and TrCel7A Amount of cellobiose (μM / min) in each reaction solution in the hydrolysis reaction of cellulose and cellulose I _α (hereinafter sometimes referred to as “TrCel7A-cellulose I _α ”) (Comparative Example 8), reaction surface The relationship with density (ρ) is shown.
In FIG. 3, “●” indicates the hydrolysis reaction of PcCel6A-cellulose III _I (Example 3).
“◯” indicates the hydrolysis reaction of TrCel7A-cellulose III _I (Comparative Example 3).
“■” indicates the hydrolysis reaction of PcCel6A-cellulose I _α (Comparative Example 7).
"□" is TrCel7A- shows the hydrolysis of cellulose I _alpha (Comparative Example 8).

4, PcCel6A- hydrolysis reaction of cellulose III _I (Example 3), TrCel7A- hydrolysis reaction of cellulose III _I (Comparative Example 3), PcCel6A- hydrolysis reaction of cellulose I _alpha (Comparative Example 7), and TrCel7A- in the hydrolysis reaction of cellulose I _alpha (Comparative example 8), and hydrolysis rate per each suction enzyme molecule ^{(min -1),} showing the relationship between the reaction surface density ([rho).
In FIG. 4, “●” indicates the hydrolysis reaction of PcCel6A-cellulose III _I (Example 3).
“◯” indicates the hydrolysis reaction of TrCel7A-cellulose III _I (Comparative Example 3).
“■” indicates the hydrolysis reaction of PcCel6A-cellulose I _α (Comparative Example 7).
"□" is TrCel7A- shows the hydrolysis of cellulose I _alpha (Comparative Example 8).

Than 3, the hydrolysis reaction of PcCel6A- cellulose I _alpha (Comparative Example 3) and TrCel7A- hydrolysis of cellulose I _alpha (Comparative Example 8), both producing little cellobiose was observed. Although the production of cellobiose was observed in the hydrolysis reaction of TrCel7A-cellulose III _I (Comparative Example 3), the production rate was slow. On the other hand, the production rate of cellobiose by the hydrolysis reaction of PcCel6A-cellulose III _I (Example 3) was significantly faster than those of Comparative Examples 3 and 7-8.

FIG. 4 shows that the substrate (cellulose I _α or cellulose III _I ) was not improved in order to confirm that the increase in the amount of cellobiose produced was simply due to the increase in the reaction surface density of cellulose III _I undergoing the hydrolysis reaction. It is the graph which calculated | required the hydrolysis rate per molecule | numerator of the adsorbed enzyme. FIG. 4 shows that when the reaction surface density of cellulose III _I is 0.4, the hydrolysis rate per molecule of TrCel7A was 2.5 times per minute (Comparative Example 3), whereas it was per PcCel6A molecule. The hydrolysis rate of was 11.5 times per minute (Example 3). From these results, it was confirmed that PcCel6A has a significantly high hydrolysis rate per enzyme molecule.

-Quantification of enzyme amount-
The hydrolysis reaction of the PcCel6A- cellulose III _I (Example 3), TrCel7A- hydrolysis reaction of cellulose III _I (Comparative Example 3), PcCel6A- hydrolysis reaction of cellulose I _alpha (Comparative Example 7), and TrCel7A- cellulose in the hydrolysis reaction of I _alpha (Comparative example 8), the amount of PcCel6A or TrCel7A adsorbed to the cellulose III _I or a cellulose I _alpha in each reaction was separated on a DEAE-5PW (Tosoh) was quantified. As the buffer, A: 20 mM Tris-HCl buffer (pH 8.0), B: 20 mM Tris-HCl buffer (pH 8.0) +0.5 M sodium chloride, A / B = 100/0 (volume / volume) A / B = 0/100 (volume / volume) was separated for 5 minutes over 5 minutes by a linear gradient of A / B = 100/0 to 40/60 (volume / volume) for 10 minutes. The HPLC apparatus for protein quantification used LC-2000 (manufactured by JASCO Corporation) using a visible ultraviolet detector (UV-2075).
FIG. 5 shows the relationship between the amount of free protein (μM) in the reaction solution and the amount of adsorbed enzyme (nmol / mg-cellulose).
In FIG. 5, “●” indicates the amount of PcCel6A after the hydrolysis reaction of PcCel6A-cellulose III _I (Example 3).
“◯” indicates the amount of TrCel7A after the hydrolysis reaction of TrCel7A-cellulose III _I (Comparative Example 3).
"■" indicates the case of PcCel6A- PcCel6A amount after hydrolysis of cellulose I _alpha (Comparative Example 7).
"□" indicates TrCel7A- TrCel7A amount after hydrolysis of cellulose I _alpha (Comparative Example 8).

From FIG. 5, PcCel6A- TrCel7A amount adsorbed by hydrolysis of PcCel6A amount and TrCel7A- cellulose I _alpha adsorbed by hydrolysis of cellulose I _alpha (Comparative Example 7) (Comparative Example 8) are comparable, the The amount of enzyme was small.
On the other hand, from FIG. 3, the hydrolysis reaction of PcCel6A- cellulose III _I (Example 3), despite was faster cellobiose production rate was adsorbed PcCel6A- hydrolysis reaction of cellulose III _I (Example 3) The amount of PcCel6A was significantly smaller than the amount of TrCel7A adsorbed by the hydrolysis reaction of TrCel7A-cellulose III _I (Comparative Example 3).
From these results, it is considered that when PcCel6A is reacted with cellulose III _I , the activity per molecule of the enzyme of the adsorbed PcCel6A is increased.

(Examples 3 and 7 and Comparative Examples 7 to 11)
<Synergistic effect of PcCel6A and PcCel45A>
As the enzyme, using a PcCel6A, the recombinant expressed in methylotrophic yeast (Pichia pastoris) Fanerokete chrysosporium (Phanerochaete chrysosporium) Cel45A, as the substrate cellulose III _I and cellulose of Examples 1 to 6 It investigated hydrolysis products when using any of I _alpha, was tested as follows synergy with PcCel6A and PcCel45A.

-Production of recombinant PcCel45A-
A recombinant protein of Phanerochate chrysosporium Cel45A (hereinafter sometimes referred to as “PcCel45A”) was produced by the following method.

--Cloning of PcCel45A gene--
The following primers (Pccel45A-F1, Pccel45A-F2) were designed based on the Cel45A gene (AB378504) derived from Phanerocatete chrysosporium on the NCBI database. Moreover, the following sequences were used for the reverse primer (manufactured by Invitrogen).
Primer:
Pccel45A-F1: ATGGCGAAGCTGTCGATGTTCTTGGGG (SEQ ID NO: 7)
Pccel45A-F2: CTGACCGTCTCCGAGAAGCGTG (SEQ ID NO: 8)
Reverse primer: Abbreviated Universal Amplification Primer (Invitrogen)

  Using the above primers, PCR was performed using cDNA prepared in the same manner as PcCel6A as a template (94 ° C, 2 minutes for 1 cycle, 98 ° C, 10 seconds / 68 ° C, 1 minute 30 seconds for 25 cycles, and finished at 4 ° C) ), The region encoding PcCel45A and the 3 ′ untranslated region were amplified by PCR.

The base sequence of the 5 ′ untranslated region was amplified using GeneRacer (trademark) Kit (manufactured by Invitrogen), SuperScript (registered trademark) III RT (manufactured by Invitrogen), and the following gene-specific primers. (94 ° C., 2 minutes for 1 cycle, 98 ° C., 10 seconds / 70 ° C., 30 seconds for 5 cycles, 98 ° C., 10 seconds / 68 ° C., 30 seconds for 5 cycles, 98 ° C., 10 seconds / 66 ° C., 30 seconds at 68 ° C, 30 seconds for 20 cycles, 4 ° C).
The obtained PCR product was cloned by the same method as that for PcCel6A.
Primer:
Pccel45A-5′-R1: CAGCCTTGCCGCAAGCAGGAGAGCCGC (SEQ ID NO: 9)
Pccel45A-5′-R2: CGCAAGCAGGGAGAGCCGCAGCCCGAAT (SEQ ID NO: 10)

--- Production of recombinant vector (expression vector)-
The following oligonucleotide primers were designed based on the base sequence of the mature PcCel45A.
Oligonucleotide primer Pccel45A-XhoI-F: TTTCTCGAGAAAAGACTGACCGTCTCCGAGAAGCGTG (SEQ ID NO: 11)
Pccel45A-NotI-R: TTTTGCGGGCCGCTCACGAAGGGGCAGTCCCCTTGTT (SEQ ID NO: 12)

PCR was performed using the TOPO vector containing the PcCel45A gene as a template, the above oligonucleotide primer and KOD-Plus as the polymerase (94 ° C, 2 minutes for 1 cycle, 98 ° C, 10 seconds, 68 ° C, 30 seconds). The DNA fragment to be inserted into the expression vector was amplified.
The amplified DNA fragment was inserted into the XhoI and NotI sites of the yeast expression vector pPICZα to obtain a recombinant vector (expression vector).

--- Production of transformant-
About 5 μg of the expression vector obtained above was linearized using Bpu1102I (manufactured by Takara Bio Inc.). Next, the linearized recombinant vector was introduced into yeast ( Pichia pastoris KM71H strain) by electroporation, and then transformants were selected. The electroporation and selection of transformants were performed based on the manual of EasySelect (trademark) Pichia expression kit (version G; manufactured by Invitrogen). Thereby, a transformant transformed with the expression vector was obtained.

--Culture of transformed yeast--
The above transformant was cultured in the same manner as in Examples 1 to 6, and the culture supernatant obtained by centrifugation (3,000 g, 10 minutes) was used as a crude enzyme solution.

-Production and purification of PcCel45A-
The crude enzyme solution obtained as described above was purified in the same manner as in Examples 1-6.
The N-terminal amino acid sequence of the obtained PcCel45A was confirmed by a protein sequencer.
As a result, the N-terminal amino acid sequence of PcCel45A obtained in transformed yeast is ATGGGYVQQAT (SEQ ID NO: 13), which is the same as the natural one obtained in the basidiomycete Phanerocatete chrysosporium ( Phanerochaete chrysosporium ). Was recognized.
PcCel45A was buffer-exchanged into 50 mM acetate buffer (pH 5.0), and used for the following synergistic effect tests.

-Synergistic effect test-
The cellulose I _α or the cellulose III _I was added to 250 μL of a 50 mM sodium acetate solution (pH 5.0) so that the final concentration was 0.1% by mass according to Table 4 below. Subsequently, any of PcCel6A prepared in Examples 1 to 6, TrCel7A prepared in Comparative Examples 1 to 6 and PcCel6A + PcCel45A was added, and the reaction was allowed to proceed at 30 ° C. for a maximum of 360 minutes. The final concentrations of PcCel6A and TrCel7A were 1.0 μM, and the total enzyme concentration of PcCel6A + Cel45A was 2.0 μM (prepared by adding 1.0 μM of Cel45A to 1.0 μM of PcCel6A).
After completion of the reaction, the reaction solution was centrifuged (x15,000 g) for 5 minutes to stop the reaction, and the supernatant obtained was analyzed in the same manner as in Examples 1-6.

6, TrCel7A- cellulose I hydrolysis of _alpha (Comparative Example 8), PcCel6A- cellulose III _I of the hydrolysis reaction (Example 3), TrCel7A- cellulose III _I of the hydrolysis reaction (Comparative Example 3), and in PcCel6A + PcCel45A and cellulose III _I (hereinafter sometimes referred to as "PcCel6A + PcCel45A- cellulose III _I") of the hydrolysis reaction (example 7) shows the time course of the cellobiose concentration in the reaction solution ([mu] M).
In FIG. 6, “■” indicates the hydrolysis reaction of TrCel7A-cellulose I _α (Comparative Example 8).
“▲” indicates the hydrolysis reaction of PcCel6A-cellulose III _I (Example 3),
“●” indicates the hydrolysis reaction of TrCel7A-cellulose III _I (Comparative Example 3).
“♦” indicates the hydrolysis reaction of PcCel6A + PcCel45A-cellulose III _I (Example 7).
Incidentally, the hydrolysis reaction (Comparative Example 7) of PcCel6A- cellulose I _α, PcCel45A- hydrolysis reaction (Comparative Example 9) of cellulose I _α, PcCel6A + PcCel45A- hydrolysis reaction of cellulose I _alpha (Comparative Example 10), and PcCel45A- The hydrolysis reaction of cellulose III _I (Comparative Example 11) is not shown in FIG. 6 because the cellobiose concentration (μM) in the reaction solution is low or no cellobiose is generated.

7, TrCel7A- hydrolysis reaction of cellulose I _alpha (Comparative Example 8), PcCel6A- hydrolysis reaction of cellulose I _alpha (Comparative Example 7), hydrolysis reaction of PcCel45A- cellulose I _alpha (Comparative Example 9), PcCel6A + PcCel45A -Hydrolysis reaction of cellulose I _α (Comparative Example 10), hydrolysis reaction of TrCel7A-cellulose III _I (Comparative Example 3), hydrolysis reaction of PcCel6A-cellulose III _I (Example 3), PcCel45A-cellulose III _I The cellobiose production rate (micromol / min) in each hydrolysis reaction of a hydrolysis reaction (Comparative Example 11) and a hydrolysis reaction of PcCel6A + PcCel45A-cellulose III _I (Example 7) is shown.

From FIG. 6, in the hydrolysis reaction of PcCel6A + PcCel45A-cellulose III _I (Example 7), more cellobiose was obtained compared to the hydrolysis reaction of PcCel6A-cellulose III _I (Example 3).
Further, from FIG. 7, no cellobiose formation was observed in the hydrolysis reaction of PcCel45A-cellulose III _I (Comparative Example 11), but the rate of cellobiose formation in the hydrolysis reaction of PcCel6A + PcCel45A-cellulose III _I (Example 7). Was significantly faster than the cellobiose production rate in the hydrolysis reaction of PcCel6A-cellulose III _I (Example 3). On the other hand, the production rate of the cellobiose in the hydrolysis reaction of PcCel6A + PcCel45A- cellulose I _alpha (Comparative Example 10) was slow.
From these results, it was confirmed that PcCel6A has a synergistic effect on the degradation of cellulose III _{I when} used in combination with other cellulases. PcCel45A is thought to enhance the activity of PcCel6A.

According to the biomass raw material treatment method, sugar production method, ethanol production method, and lactic acid production method of the present invention, the sugar production efficiency, ethanol production efficiency, and lactic acid production efficiency are significantly improved. Can do.
Therefore, the biomass raw material treatment method, sugar production method, ethanol production method, and lactic acid production method of the present invention have been attracting attention in recent years from biomass raw materials aimed at producing environmentally friendly fuels. It can be suitably used for the production of ethanol and for the production of environmentally friendly biodegradable plastics.

Claims (7)

(A) a step of obtaining a modified biomass raw material by treating the biomass raw material with a treatment agent containing ammonia;
(B) enzymatic saccharification of the modified biomass raw material with cellobiohydrolase II (Cel6A);
The processing method of the biomass raw material characterized by including.   The processing method of the biomass raw material of Claim 1 in which a biomass raw material contains a cellulose I type.   The processing method of the biomass raw material in any one of Claim 1 to 2 with which a process (a) includes processing with a supercritical ammonia fluid.   When the surface density at which the modified biomass material and cellobiohydrolase II (Cel6A) undergo a hydrolysis reaction is 0.9 or less, the hydrolysis rate per molecule of cellobiohydrolase II (Cel6A) is 5 times per minute. It is the above, The processing method of the biomass raw material in any one of Claim 1 to 3.   A method for producing sugar, characterized in that sugar is obtained by the method for treating a biomass raw material according to any one of claims 1 to 4.   A method for producing ethanol, wherein the sugar obtained by the method for producing sugar according to claim 5 is fermented to obtain ethanol.   A method for producing lactic acid, wherein the saccharide obtained by the method for producing saccharide according to claim 5 is fermented to obtain lactic acid.