JP2010115122A - Method of detecting aspergillus fumigatus relative - Google Patents

Abstract

<P>PROBLEM TO BE SOLVED: To provide a method of specifically, simply and readily detecting an Aspergillus fumigatus relative. <P>SOLUTION: The method of detecting an Aspergillus fumigatus relative includes identifying the Aspergillus fumigatus relative by using a nucleic acid represented by partial nucleotide sequence of β-tubulin gene. <P>COPYRIGHT: (C)2010,JPO&INPIT

Description

The present invention relates to a method for detecting Aspergillus fumigatus- related bacteria.

The genus Aspergillus is a fungus widely found in nature, and more than 150 species are known. It is also found in food and its raw materials because it is present in soil and compost and also in air.
Among the fungi belonging to the genus Aspergillus, there are fungal species that are pathogenic to humans and animals. These pathogenic fungi invade the body by inhaling spores floating in the air mainly by respiration, infect the lungs, ear canal, nasal cavity, etc., and cause an infection called aspergillosis. Aspergillosis is a relatively pathogenic secondary pathogen (opportunistic pathogen), so it is relatively difficult for healthy people to infect, but it is infected when the resistance to infection is reduced due to disease, etc. A type of infectious disease. With the recent aging of the population, the number of transplant patients who use immunosuppressants and anticancer drugs, anticancer drug treated patients, etc. are increasing, and the number of cases of aspergillosis is also increasing is there. Furthermore, since the mortality due to these aspergillosis is also high, immediate improvement of the treatment method is desired.

As fungi belonging to the genus Aspergillus causing aspergillosis, Aspergillus fumigatus ( Aspergillus fumigatus ), Aspergillus flavus ( Aspergillus flavus ), Aspergillus niger ( Aspergillus nipni ) and the like have been conventionally known. Among them, there are many cases that develop due to Aspergillus fumigatus.

In recent years, with the advance of genetic phylogenetic analysis methods, new species of fungi that have not been identified by conventional morphological classification methods have been discovered. Aspergillus fumigatus also has similar morphological characteristics and was previously regarded as the same species as Aspergillus fumigatus, but there were several new species of fungi that were identified as different species from Aspergillus fumigatus as a result of genetic analysis etc. Has been discovered. These new species of Aspergillus spp. Are called Aspergillus fumigatus relatives because their genetic characteristics are similar to those of Aspergillus fumigatus, as well as their apparent characteristics.
Some of these Aspergillus fumigatus-related fungi have been reported to cause aspergillosis as well as Aspergillus fumigatus. In addition, some bacterial species are less sensitive to specific antifungal drugs. In general, antifungal drugs are used for the treatment of aspergillosis, and amphotericin B, voriconazole, caspofandin and the like are used. For example, among the related fungi that have been pointed out as pathogenic, Aspergillus lentulus ) Has drug resistance to amphotericin B, voriconazole, and caspofandin, and Aspergillus udagawae has been reported to have drug resistance to amphotericin B (see, for example, Non-Patent Document 1). ). Aspergillus fumigatus and its related bacteria are similar in morphological characteristics, and if such a drug-resistant bacterial species is misidentified as Aspergillus fumigatus and treated, it is impossible to select an appropriate antifungal drug and the therapeutic effect May be significantly inferior. Therefore, in order to increase the therapeutic effect of aspergillosis, it is very important to identify the type of fungus causing the disease and appropriately select an antifungal agent effective for the fungus type. For that purpose, it is required to appropriately and quickly identify the bacterial species of the causative bacterium causing aspergillosis.

  In addition, among Aspergillus fumigatus and its related bacteria, there are species that produce mold toxins (fumitoremorgins). As described above, since Aspergillus fungi are frequently detected from foods and their materials, there is a concern that mold poisons may be mixed into these foods.

  At present, the detection and identification methods of Aspergillus fumigatus and its related fungi are mainly based on the growth temperature and morphological classification of bacteria. This method requires a long period of at least 14 days since culture must be continued until morphological characteristics occur. In addition, since Aspergillus fumigatus and its related bacteria have similar morphological characteristics, it is very difficult to accurately identify the bacterial species only from the morphological characteristics. Therefore, from the viewpoint of treatment of aspergillosis and food hygiene measures, establishment of a rapid and accurate detection / identification method at the bacterial species level is required.

  As a rapid and reliable detection method of fungi, an amplification method (for example, a PCR method or a LAMP method) targeting a specific base sequence of a gene is known (for example, see Patent Documents 1 to 4). However, the gene region specific to Aspergillus fumigatus and its related bacteria has not been elucidated. Therefore, there is a problem that it is difficult to specifically and rapidly detect Aspergillus fumigatus and its related bacteria.

ukaryotic Cell, 5 (10): 1705-1712, 2006 Balajee SA et al. Molecular Studies Reveal Frequent Misidentification of Aspergillus fumigatus by Morphotyping. Japanese National Patent Publication No. 11-505728 JP 2006-61152 A JP 2006-304763 A JP 2007-174903 A

An object of the present invention is to provide a method capable of specifically, simply and rapidly detecting Aspergillus fumigatus- related bacteria having pathogenicity to humans and animals. The present invention also provides a DNA represented by a base sequence specific to Aspergillus fumigatus-related bacteria for use in this detection method, an oligonucleotide capable of hybridizing to the nucleic acid represented by the base sequence, and the oligonucleotide It is an object of the present invention to provide a primer set and a detection kit using the.

In view of the above-mentioned problems, the present inventors have conducted intensive studies on a method for specifically identifying a species that is pathogenic to humans and animals among Aspergillus fumigatus- related bacteria. As a result, there is a region in the β-tubulin gene sequence of Aspergillus fumigatus-related bacteria that has a specific base sequence that can be clearly distinguished from that of other fungi (hereinafter also referred to as “variable region”). I found something to do. Furthermore, it has been found that by targeting this variable region, the pathogenic Aspergillus fumigatus-related bacteria can be specifically and rapidly detected. The present invention has been completed based on these findings.

The present invention relates to the following (a) or (b) Aspergillus fumigatus (Aspergillus fumigatus) analogues which is characterized in that the identification of Aspergillus fumigatus (Aspergillus fumigatus) analogous bacteria using a nucleic acid represented by the nucleotide sequence set forth in The present invention relates to a method for detecting bacteria.
(A) Partial base sequence of β-tubulin gene described in SEQ ID NO: 1 or 2 or its complementary sequence (b) One or several bases are deleted or replaced in the base sequence described in SEQ ID NO: 1 or 2 Or the added base sequence or its complementary sequence

The present invention also relates to a DNA represented by the base sequence described in (a) or (b) above for use in detecting Aspergillus fumigatus- related bacteria.

The present invention also provides a nucleic acid probe capable of hybridizing to the nucleic acid represented by the base sequence described in the above (a) or (b) and specifically detecting an Aspergillus fumigatus- related bacterium. The present invention relates to an oligonucleotide for detecting Aspergillus fumigatus-related bacteria that can function as a nucleic acid primer.

The present invention, (c) and (d) of Aspergillus lentus (Aspergillus lentulus) consisting of oligonucleotides and / or Aspergillus Fumishinematasu (Aspergillus fumisynnematus) oligonucleotide pair for detecting the following, the following (e) and (f) Aspergillus Udagawae consisting oligonucleotides (Aspergillus udagawae) oligonucleotide pair for detecting, and to Aspergillus fumigatus (Aspergillus fumigatus) analogous bacteria detection kit containing these oligonucleotide pairs.
(C) the oligonucleotide represented by the base sequence set forth in SEQ ID NO: 3 or the oligonucleotide represented by the base sequence having 70% or more homology to the base sequence and usable as a detection oligonucleotide (D) the oligonucleotide represented by the base sequence set forth in SEQ ID NO: 4 or the oligonucleotide represented by the base sequence having 70% or more homology to the base sequence and usable as a detection oligonucleotide (E) the oligonucleotide represented by the nucleotide sequence set forth in SEQ ID NO: 5 or the oligonucleotide represented by the nucleotide sequence having 70% or more homology with the nucleotide sequence and usable as a detection oligonucleotide (F) Oligonucleotide represented by the nucleotide sequence set forth in SEQ ID NO: 6, or 70% or more based on the nucleotide sequence An oligonucleotide represented by the nucleotide sequence which can be used as a and the detector oligonucleotide homology

Further, the present invention is a primer or below (g) ~ Aspergillus lentus (Aspergillus lentulus) consisting of primer (l) and / or Aspergillus Fumishinematasu (Aspergillus fumisynnematus) detection primer set of the following (g) ~ (j), Aspergillus udagawae detection primer set comprising the following primers (m) to (p) or the following primers (m) to (r), a primer set thereof, a DNA polymerase, dATP, dCTP , An Aspergillus fumigatus- related fungus detection kit comprising dNTP including dGTP and dTTP.
(G) a primer composed of an oligonucleotide represented by the base sequence described in SEQ ID NO: 7 (h) a primer composed of an oligonucleotide represented by the base sequence described in SEQ ID NO: 8 (i) a base described in SEQ ID NO: 9 Primer consisting of oligonucleotide represented by sequence (j) Primer consisting of oligonucleotide represented by base sequence described in SEQ ID NO: 10 (k) Primer consisting of oligonucleotide represented by base sequence described in SEQ ID NO: 11 (L) a primer composed of an oligonucleotide represented by the base sequence described in SEQ ID NO: 12 (m) a primer composed of an oligonucleotide represented by the base sequence described in SEQ ID NO: 13 (n) a base described in SEQ ID NO: 14 Primer comprising the oligonucleotide represented by the sequence (o) Base sequence described in SEQ ID NO: 15 Primer consisting of oligonucleotide represented by (p) Primer consisting of oligonucleotide represented by the base sequence set forth in SEQ ID NO: 16 (q) Primer consisting of oligonucleotide represented by the base sequence set forth in SEQ ID NO: 17 ( r) Primer comprising an oligonucleotide represented by the nucleotide sequence set forth in SEQ ID NO: 18

Furthermore, the present invention selects F3, F2 and F1 as base sequence regions in order from the 5 ′ side of the target region sequence selected from the base sequence of the β-tubulin gene of Aspergillus fumigatus- related bacteria. ,
In order from the 3 ′ side of the target region, B3c, B2c and B1c are selected as base sequence regions,
The complementary base sequences of F3, F2 and F1 are F3c, F2c and F1c, respectively.
When the base sequences complementary to B3c, B2c and B1c are B3, B2 and B1, respectively,
Aspergillus fumigatus ( Aspergillus fumigatus ) -related oligonucleotides represented by a base sequence corresponding to any of the following (a) to (f), oligonucleotides for detection thereof, DNA polymerase, dATP, dCTP , An Aspergillus fumigatus- related fungus detection kit comprising dNTP including dGTP and dTTP.
(A) a base sequence having the B2 region on the 3 ′ side and a B1c region on the 5 ′ side (b) a base sequence having the B3 region (c) having the F2 region on the 3 ′ side; A base sequence having an F1c region on the 5 ′ side (d) a base sequence having the F3 region (e) a base sequence having a sequence complementary to a portion between the B1 region and the B2 region (f) the F1 region A base sequence having a sequence complementary to a portion between the F2 regions

ADVANTAGE OF THE INVENTION According to this invention, the method which can detect the Aspergillus fumigatus ( Aspergillus fumigatus ) related bacteria which has pathogenicity with respect to a human or an animal specifically, simply and rapidly can be provided. Further, according to the present invention, it hybridizes to a DNA represented by a base sequence of a β-tubulin gene specific for Aspergillus fumigatus-related bacteria for use in this detection method, and to a nucleic acid represented by the base sequence. An oligonucleotide to be obtained, and a primer set and a detection kit using the oligonucleotide can be provided.

Hereinafter, the present invention will be described in detail.
The present invention is represented by a specific partial nucleotide sequence of the β-tubulin gene of Aspergillus fumigatus-related bacteria, that is, a species-specific region (variable region) in the β-tubulin gene sequence of Aspergillus fumigatus-related bacteria. This is a method for specifically identifying and detecting Aspergillus fumigatus- related bacteria by identifying aspergillus fumigatus- related bacteria using nucleic acids.
Aspergillus fumigatus is a fungus belonging to Aspergillus (Aspergillus) genus fungi imperfecti, causing aspergillosis has pathogenicity to humans and animals.
In the present invention, “Aspergillus fumigatus-related fungi” refers to a group of fungi belonging to the genus Aspergillus and particularly having a morphological characteristic and a genetic characteristic similar to those of Aspergillus fumigatus. Specifically, Aspergillus lentus (Aspergillus lentulus), Aspergillus Fumishinematasu (Aspergillus fumisynnematus), Aspergillus Udagawae (Aspergillus udagawae), Aspergillus fumigatus apt Affi varnish (Aspergillus fumigatiaffinis), Aspergillus Nobofumigatasu (Aspergillus novofumigatus), Aspergillus kink di New chest (Aspergillus viridinutans ), Aspergillus Burebipusu (Aspergillus brevipes), Aspergillus Deyurikarisu (Aspergillus duricaulis), Aspergillus Yu Lateralis (Aspergillus unilateralis) and the like are known. Among these analogous bacteria, Aspergillus lentus (Aspergillus lentulus), Aspergillus Fumishinematasu (Aspergillus fumisynnematus) and Aspergillus Udagawae (Aspergillus udagawae) is relatively high frequently isolated from the aspergillosis patients, it has been reported to have a pathogenicity. In addition, these species are clinically problematic because of low sensitivity to antifungal agents such as ampotericin B. In addition, Aspergillus fumigatus and Aspergillus vulgaris are known to produce anti-neurogenic mold venom.

  “Β-tubulin” is a protein constituting a microtubule, and “β-tubulin gene” is a gene encoding β-tubulin. In the present invention, the “variable region of the β-tubulin gene” refers to a specific region in the β-tubulin gene that is likely to accumulate base mutations. In the detection method of the present invention, “the identification is performed using a nucleic acid represented by a partial base sequence of a β-tubulin gene” means that a nucleic acid represented by the whole or a part of the partial base sequence is used. To identify.

The detection method of the present invention is characterized by using a nucleic acid represented by a base sequence of a specific (variable) region in the β-tubulin gene of Aspergillus fumigatus-related bacteria.
The inventors identified the base sequences of various β-tubulin genes from fungi belonging to the genus Aspergillus, and analyzed the genetic distance within the genus Aspergillus. Furthermore, homology analysis of various determined β-tubulin sequences was performed. As a result, it was clarified that Aspergillus fumigatus-related bacteria are classified into five groups. Among these 5 groups, the Aspergillus lentus group (including Aspergillus lentus and Aspergillus fumicinetus) and the Aspergillus urchinae group, which are particularly important in the field of medical fungi, and the variable region having a base sequence unique to the fungi belonging to the group I found. In this variable region, Aspergillus fumigatus and its related bacteria have a unique base sequence depending on the bacterial species, so that Aspergillus fumigatus and its related bacteria can be identified and identified at the bacterial species level. The present invention targets the variable region and oligonucleotides derived from the variable region.

  The nucleic acid represented by the partial base sequence (base sequence of the variable region) of the β-tubulin gene of Aspergillus fumigatus-related bacteria used in the detection method of the present invention is the base sequence described in SEQ ID NO: 1 or SEQ ID NO: 2 or its complement It is a nucleic acid represented by a sequence.

The base sequence described in SEQ ID NO: 1 and its complementary sequence are the base sequence of the variable region of the β-tubulin gene isolated and identified from Aspergillus lentulus . Since this sequence is specific to the Aspergillus lentus group, that is, Aspergillus fumicinetus, a species that is systematically very close to Aspergillus lentus and Aspergillus lentus , the subject has this base sequence. It is possible to specifically identify and identify only Aspergillus lentus and Aspergillus fumigatus from among Aspergillus fumigatus and its related bacteria. In addition, even when using a nucleic acid represented by a base sequence in which one or several bases are deleted, substituted or added in the base sequence shown in SEQ ID NO: 1 or its complementary sequence, only Aspergillus lentus and Aspergillus fumicinetus are used. Can be specifically identified and identified.
The base sequence described in SEQ ID NO: 2 and its complementary sequence are the base sequence of the variable region of the β-tubulin gene isolated and identified from Aspergillus udagawae . Since this sequence is specific to Aspergillus subtilis, only Aspergillus subtilis is specifically identified from Aspergillus fumigatus and its related bacteria by confirming whether or not the subject has this base sequence.・ It can be identified. In addition, even when using a nucleic acid represented by a base sequence that is deleted, substituted, or added to one or several bases in the base sequence shown in SEQ ID NO: 2 or a complementary sequence thereof, only Aspergillus subtilis is similarly specific. Can be identified and identified.
(Hereinafter, the base sequence shown in SEQ ID NO: 1 or 2 or its complementary sequence, the base sequence shown in SEQ ID NO: 1 or 2, or a base sequence obtained by deleting, replacing or adding one or several bases, or a complementary sequence thereof) Are collectively referred to as “the base sequence of the variable region of the β-tubulin gene of the present invention”.)

  The method for identifying Aspergillus fumigatus-related bacteria using the nucleic acid represented by the nucleotide sequence of the variable region of the β-tubulin gene of the present invention is not particularly limited. Sequencing method, hybridization method, PCR method, LAMP It can be performed by a commonly used genetic engineering technique such as a method.

In the detection method of the present invention, in order to identify Aspergillus fumigatus-related bacteria using the nucleic acid represented by the nucleotide sequence of the variable region of the β-tubulin gene of the present invention, the β-tubulin gene of the subject is identified. It is preferable to determine the base sequence and confirm whether the base sequence of the nucleic acid described in (a) or (b) is included in the base sequence of the gene. That is, the detection method of the present invention analyzes and determines the base sequence of the β-tubulin gene of the subject, and compares the determined base sequence with the base sequence of the variable region of the β-tubulin gene of the present invention. Based on the agreement or difference, fungi belonging to the genus Geosmithia are identified.
The method for analyzing and determining the base sequence is not particularly limited, and a commonly used RNA or DNA sequencing method can be used.
Specific examples include electrophoresis such as Maxam-Gilbert method and Sanger method, mass spectrometry, hybridization method and the like. Examples of the Sanger method include a method of labeling a primer or a terminator by a radiation labeling method, a fluorescence labeling method, or the like.

In the present invention, in order to identify Aspergillus fumigatus- related bacteria using the nucleic acid represented by the nucleotide sequence of the variable region of the β-tubulin gene of the present invention, the β-tube of the present invention is identified. Use a detection oligonucleotide that can hybridize to the nucleic acid represented by the nucleotide sequence of the variable region of the phosphorus gene and that can function as a nucleic acid probe or nucleic acid primer for specifically detecting Aspergillus fumigatus-related bacteria Can do.
The detection oligonucleotide of the present invention may be any oligonucleotide that can be used for detection of Aspergillus fumigatus-related bacteria. That is, any oligonucleotide that can be used as a nucleic acid primer or nucleic acid probe for detecting Aspergillus fumigatus-related bacteria or an oligonucleotide that can hybridize to the β-tubulin gene of Aspergillus fumigatus-related bacteria under stringent conditions may be used. Here, “stringent conditions” include, for example, the method described in Molecular Cloning-A LABORATORY MANUAL THIRD EDITION [Joseph Sambrook, David W. Russell., Cold Spring Harbor Laboratory Press], for example, 6 × SSC (1 × SSC composition: 0.15 M sodium chloride, 0.015 M sodium citrate, pH 7.0), 0.5% SDS, 5 × Denhart and 100 mg / mL herring sperm DNA together with the probe at 65 ° C. Examples include conditions of constant temperature for 8 to 16 hours for hybridization.

  The number of bases of the detection oligonucleotide of the present invention is not particularly limited, but is preferably 13 to 30 bases, more preferably 18 to 23 bases. Further, the Tm value at the time of hybridization is preferably in the range of 55 ° C to 65 ° C, and more preferably in the range of 59 ° C to 62 ° C. The GC content is preferably 30% to 80%, more preferably 45% to 65%, and most preferably around 55%.

  The detection oligonucleotide of the present invention is more preferably an oligonucleotide represented by the base sequence described in any of SEQ ID NOs: 3 to 18 or a complementary sequence thereof. The detection oligonucleotide of the present invention is an oligonucleotide represented by a base sequence having 70% or more homology to the base sequence described in any of SEQ ID NOs: 3 to 18 or a complementary sequence thereof. The homology is more preferably 80% or more, the homology is more preferably 90% or more, and the homology is particularly preferably 95% or more. In addition, the detection oligonucleotide that can be used in the present invention is 1 or several, preferably 1 to 5, more preferably 1 in the base sequence described in any of SEQ ID NOs: 3 to 18 or its complementary sequence. To 4, more preferably 1 to 3, even more preferably 1 to 2, particularly preferably 1 nucleotide deletion, insertion or substitution mutations or oligonucleotides represented by a modified base sequence Are also included. In addition, an appropriate base sequence may be added to the base sequence described in any one of SEQ ID NOs: 3 to 18 or a complementary sequence thereof. The base sequence homology is calculated by the Lipman-Pearson method (Science, 227, 1435, 1985) or the like. Specifically, using a homology analysis (Search homology) program of genetic information processing software Genetyx-Win (manufactured by software development), the calculation is performed by performing an analysis with the parameter unit size to compare (ktup) as 2. Can do.

The oligonucleotide for detection of the present invention can be used as a nucleic acid primer and a nucleic acid probe. The nucleic acid probe can be prepared by labeling the oligonucleotide with a label. The label is not particularly limited, and usual labels such as radioactive substances, enzymes, fluorescent substances, luminescent substances, antigens, haptens, enzyme substrates, insoluble carriers and the like can be used. The labeling method may be end labeling, labeling in the middle of the sequence, or labeling on a sugar, phosphate group, or base moiety. As a means for detecting such a label, for example, when the nucleic acid probe is labeled with a radioisotope, it is labeled with a chemiluminescent substance such as autoradiography, and when it is labeled with a fluorescent substance, such as a fluorescence microscope. In some cases, analysis using a photosensitive film, digital analysis using a CCD camera, and the like can be given.
The oligonucleotide can also be used as a capture probe by binding to a solid support. In this case, a sandwich assay can be performed with a combination of a capture probe and a labeled nucleic acid probe, or the target nucleic acid can be labeled and captured.

  In order to detect Aspergillus fumigatus-related bacteria in a sample, the detection oligonucleotide of the present invention is labeled to form a nucleic acid probe, the obtained nucleic acid probe is hybridized with DNA or RNA, and the label of the hybridized probe is detected. May be detected by an appropriate detection method. Since the above-mentioned nucleic acid probe specifically hybridizes with a part of the variable region of the β-tubulin gene of Aspergillus fumigatus related bacteria, Aspergillus fumigatus related bacteria in a subject can be detected quickly and easily. As a method for measuring the label of the nucleic acid probe hybridized with DNA or RNA, a usual method (FISH method, dot blot method, Southern blot method, Northern blot method, etc.) can be used.

  In the detection method of the present invention, in order to identify Aspergillus fumigatus-related bacteria using the nucleic acid represented by the base sequence of the variable region of the β-tubulin gene of the present invention, all or part of the base sequence is used. It is preferable to amplify the DNA fragment in the region and confirm the presence or absence of the amplification product. There are no particular limitations on the method for amplifying the DNA fragment containing the region, PCR (Polymerase Chain Reaction) method, LCR (Ligase Chain Reaction) method, SDA (Strand Displacement Amplification) method, NASBA (Nucleic Acid Sequence-based Amplification) method Ordinary methods such as RCA (Rolling-circle amplification) method and LAMP (Loop mediated isothermal amplification) method can be used. However, in the present invention, it is preferable to use the PCR method or the LAMP method from the viewpoint of rapidity and simplicity.

  In the present invention, the case of detecting Aspergillus fumigatus-related bacteria using the PCR method will be described.

When detecting Aspergillus lentus (Aspergillus lentulus) and / or Aspergillus Fumishinematasu a (Aspergillus fumisynnematus), describes oligonucleotides of the following (c) or (d) a is preferably used as a nucleic acid primer, SEQ ID NO: 3 and SEQ ID NO: 4 It is more preferable to use an oligonucleotide having the following nucleotide sequence.
(C) the oligonucleotide represented by the nucleotide sequence set forth in SEQ ID NO: 3 or the oligonucleotide represented by the nucleotide sequence having 70% or more homology with the nucleotide sequence and usable as a nucleic acid primer (d ) The oligonucleotide represented by the nucleotide sequence set forth in SEQ ID NO: 4 or the oligonucleotide represented by the nucleotide sequence having 70% or more homology with the nucleotide sequence and usable as a nucleic acid primer The Aspergillus lentus and Aspergillus fumicinetus detection oligonucleotide pairs are oligonucleotide pairs comprising the oligonucleotide (c) and the oligonucleotide (d).

The oligonucleotides represented by the base sequences described in SEQ ID NO: 3 and SEQ ID NO: 4 are oligonucleotides that are present in the β-tubulin gene region and have the same base sequence as the base sequence of a part of the variable region or its complementary sequence. is there. These oligonucleotides can specifically hybridize to portions of Aspergillus lentus and Aspergillus fumicinetus DNA.
The oligonucleotides represented by (c) and (d) correspond to the regions from position 97 to position 118 and position 361 to position 383, respectively, of the base sequence set forth in SEQ ID NO: 1. Therefore, Aspergillus lentus and Aspergillus fumicinetus can be specifically detected by hybridizing the oligonucleotide to the β-tubulin gene of Aspergillus lentus and Aspergillus fumicinetus.

In the present invention, when detecting Aspergillus udagawae using the PCR method, the following oligonucleotide (e) or (f) is preferably used as a nucleic acid primer, described in SEQ ID NO: 5 and SEQ ID NO: 6 It is more preferable to use an oligonucleotide pair represented by the nucleotide sequence of
(E) the oligonucleotide represented by the nucleotide sequence set forth in SEQ ID NO: 5, or the oligonucleotide represented by the nucleotide sequence having 70% or more homology with the nucleotide sequence and usable as a nucleic acid primer (f ) The oligonucleotide represented by the base sequence set forth in SEQ ID NO: 6, or the oligonucleotide represented by the base sequence that has 70% or more homology with the base sequence and can be used as a nucleic acid primer The Aspergillus Udagawae detection oligonucleotide pair is an oligonucleotide pair comprising the oligonucleotide (e) and the oligonucleotide (f).

The oligonucleotides represented by the base sequences described in SEQ ID NO: 5 and SEQ ID NO: 6 are oligonucleotides that exist in the β-tubulin gene region and have the same base sequence as the base sequence of a part of the variable region or its complementary sequence. is there. These oligonucleotides can specifically hybridize to a portion of Aspergillus subtilis DNA.
The oligonucleotides represented by (e) and (f) correspond to regions from the 93rd position to the 114th position and from the 338th position to the 357th position, respectively, in the base sequence set forth in SEQ ID NO: 2. Therefore, by hybridizing the oligonucleotide to the β-tubulin gene of Aspergillus udderfly, Aspergillus udderfly can be specifically detected.

  The PCR reaction conditions in the present invention are not particularly limited as long as the target DNA fragment can be amplified to a detectable level. As a preferable example of PCR reaction conditions, for example, an annealing reaction in which a heat denaturation reaction for converting a double-stranded DNA into a single strand is performed at 95 to 98 ° C. for 10 to 60 seconds, and a primer pair is hybridized to the single-stranded DNA. Is performed at about 59 ° C. for about 60 seconds, an extension reaction for allowing DNA polymerase to act is performed at about 72 ° C. for about 60 seconds, and these are defined as one cycle for about 30 to 35 cycles.

In the present invention, gene fragments amplified by the PCR method can be confirmed by ordinary methods. For example, a method of incorporating nucleotides labeled with radioactive substances during amplification reaction, a method of confirming the presence or absence of a band corresponding to the size of the amplified gene by electrophoresis on the PCR reaction product, and decoding the base sequence of the PCR reaction product And a method of allowing a fluorescent substance to enter between the amplified DNA double strands to emit light, but the present invention is not limited to these methods. In the present invention, a method of performing electrophoresis after gene amplification treatment and confirming the presence or absence of a band corresponding to the size of the amplified gene is preferable.
When the specimen contains fungi belonging to Aspergillus fumigatus ( Aspergillus fumigatus ), the PCR reaction is performed using the oligonucleotide pair of the present invention as a primer set, and the obtained PCR reaction product is subjected to electrophoresis. Amplification of a DNA fragment of about 250 bp specific to the fungus of the present invention is observed. By performing this operation, it can be confirmed whether or not the specimen contains fungi belonging to Aspergillus fumigatus- related bacteria.

Next, in the present invention, a case where Aspergillus fumigatus-related bacteria are detected using the LAMP method will be described.
In the present invention, when a DNA fragment containing a target region is amplified by the LAMP method, periodic temperature change control is not required, and therefore, isothermal complementary strand synthesis reaction is possible. For this reason, the specific fungi contained in the specimen can be detected easily and rapidly.

  The LAMP method is a loop-mediated isothermal amplification method (International Publication No. 00/28082 pamphlet) that does not require periodic temperature change control, which is indispensable for the PCR method, and includes a 3 ′ side of a primer on a template nucleotide. Annealing is used as a starting point for complementary strand synthesis, and by combining the primer to be annealed with the loop formed at this time, an isothermal complementary strand synthesis reaction is made possible. In this LAMP method, at least four primers that recognize six base sequence regions of a nucleic acid to be a template are required. Since these primers are designed so that the 3 ′ side always anneals to the nucleotide as a template, the check mechanism by complementary binding of the base sequence functions repeatedly, and a highly sensitive and highly specific nucleic acid An amplification reaction is possible.

The six base sequence regions recognized by the primers used in the LAMP method are called F3, F2, F1 in order from the 5 ′ side of the template nucleotide, and are called B3c, B2c, B1c in order from the 3 ′ side, and F1 , F2 and F3 complementary base sequences are called F1c, F2c and F3c, respectively, and B1c, B2c and B3c complementary base sequences are called B1, B2 and B3, respectively.
The six base sequence regions can be selected as follows, but the present invention is not limited to this.
Align the base sequence of the target bacterial gene and design multiple primers using software such as Primer Explorer V4 (Eiken Chemical website). They synthesized them, actually performed a LAMP reaction, and employed a primer that can specifically detect Aspergillus fumigatus-related bacteria.
In detail,
1. Use an alignment software such as Clustal X to create an alignment file of the base sequence information of the target region of the target bacterial species.
2. Design primers using Primer Explorer V4 (Eiken Chemical website) based on the information in the alignment file.
3. From among the designed primer set candidates, select a primer set that is more stable (difficult to take a dimer structure) and contains many mutations (species-specific mutations) at the end in the extension direction. In particular, when many mutations are included in the extension direction of the inner primer, the possibility of distinguishing from closely related species increases. When primer set candidates are not possible, design the Tm value and the number of bases of the primer so that they have a wide range.
4). Test using the primer set actually selected to confirm its effectiveness. After the effectiveness is confirmed, a loop primer is designed to shorten the reaction time.

  In designing a primer used in the LAMP method, first, the above six base sequence regions are determined from the base sequence of the target region, and then inner primers F and B and outer primers F and B described later are designed.

The “inner primer” used in the LAMP method is a nucleic acid that recognizes a specific nucleotide sequence region on the target base sequence and has a base sequence that gives a synthesis origin on the 3 ′ side, and at the same time starts from this primer. An oligonucleotide having a base sequence complementary to an arbitrary region of a synthesis reaction product on the 5 ′ side. Among these, a primer including a base sequence having the F2 region on the 3 ′ side and the F1c region on the 5 ′ side is referred to as an inner primer F (hereinafter FIP), and has the B2 region on the 3 ′ side. A primer including a base sequence having the B1c region on the 5 ′ side is referred to as an inner primer B (hereinafter referred to as BIP). This inner primer may have an arbitrary base sequence having any length of 0 to 50 bases between the F2 region and the F1c region, or between the B2 region and the B1c region.
On the other hand, the “outer primer” recognizes “a specific nucleotide sequence region existing on the 5 ′ end side of a“ specific nucleotide sequence region ”(for example, the F2 region or B2 region)” on the target base sequence; Examples include oligonucleotides having a base sequence that gives a starting point for synthesis, and primers including a base sequence selected from the F3 region and primers including a base sequence selected from the B3 region. Here, a primer including a base sequence selected from the F3 region is referred to as an outer primer F (hereinafter referred to as F3 primer), and a primer including a base sequence selected from the B3 region is referred to as an outer primer B (hereinafter referred to as B3 primer).
Here, F in each primer is a primer display meaning that it binds complementarily to the antisense strand of the target base sequence and provides a starting point of synthesis, and B in each primer is the sense of the target base sequence. A primer representation that means to bind complementarily to the strand and provide a starting point for synthesis.

In the amplification of nucleic acid in the LAMP method, in addition to the inner primer and the outer primer, a loop primer (hereinafter, LF, LB) can be preferably used. The loop primer is a primer containing a base sequence complementary to the sequence in the loop on the 3 ′ side when complementary sequences generated on the same strand of the amplification product by the LAMP method anneal to each other to form a loop ( One for each of the two strands). That is, it is a primer having a base sequence complementary to the base sequence of the single-stranded part of the loop structure on the 5 ′ side of the dumbbell structure. When this primer is used, the starting point of nucleic acid synthesis is increased, so that the reaction time can be shortened and the detection sensitivity can be increased (WO 02/24902 pamphlet).
The base sequence of the loop primer may be selected from the base sequence of the target region or its complementary strand as long as it is complementary to the base sequence of the single-stranded portion of the 5 ′ loop structure of the dumbbell structure. It may be a base sequence. Further, the loop primer may be one type or two types.

  If a DNA fragment containing a target region is amplified using at least four or more of the above-mentioned primers, the DNA fragment can be amplified to an amount that can be detected specifically and efficiently. For this reason, specific fungi can be detected by confirming the presence or absence of an amplification product.

  The primer that can be used in the LAMP method is preferably 15 bases or more, and more preferably 20 bases or more. Each primer may be an oligonucleotide having a single base sequence or a mixture of oligonucleotides having a plurality of base sequences.

  The outer primer that can be used in the LAMP method can also be used in the PCR method to amplify a DNA fragment containing the target region. In the PCR method, a target DNA fragment can be amplified by PCR using the above primers and a β-tubulin gene in a sample as a template with a heat-resistant DNA polymerase.

A primer set that is preferably used when Aspergillus fumigatus-related bacteria are detected by the LAMP method will be described.
To detect Aspergillus lentus (Aspergillus lentulus) and Aspergillus Fumishinematasu a (Aspergillus fumisynnematus) specifically, it is more preferable to use a primer set consisting of the following primers (g) ~ (j).

Primer set for detecting Aspergillus lentus and Aspergillus fumicinetus (g) Primer consisting of an oligonucleotide represented by the base sequence shown in SEQ ID NO: 7 (h) Primer consisting of an oligonucleotide represented by the base sequence shown in SEQ ID NO: 8 ( i) Primer comprising an oligonucleotide represented by the base sequence set forth in SEQ ID NO: 9 (j) Primer comprising an oligonucleotide represented by the base sequence set forth in SEQ ID NO: 10

In order to detect Aspergillus lentus and Aspergillus fumicinetus, it is preferable to use a loop primer in addition to the above primers. As the loop primer, the following primer (k) and / or (l) is preferably used.

Loop primer for detecting Aspergillus lentus and Aspergillus fumicinetus (k) Primer consisting of an oligonucleotide represented by the base sequence shown in SEQ ID NO: 11 (1) Primer consisting of an oligonucleotide represented by the base sequence shown in SEQ ID NO: 12

FIG. 1 shows the positional relationship of the base sequences recognized by the primers in the base sequence of the Aspergillus lentus β-tubulin gene.

  The primer set for detecting Aspergillus lentus and Aspergillus fumicinetus of the present invention is a primer set used for detection by the LAMP method, comprising a primer comprising an oligonucleotide represented by the nucleotide sequence set forth in SEQ ID NO: 7, and SEQ ID NO: 8 A primer comprising the oligonucleotide represented by the base sequence described in SEQ ID NO: 9, a primer comprising the oligonucleotide represented by the base sequence represented by SEQ ID NO: 9, and an oligonucleotide represented by the base sequence represented by SEQ ID NO: 10. The primer set preferably further comprises a primer comprising an oligonucleotide represented by the nucleotide sequence set forth in SEQ ID NO: 11 and / or SEQ ID NO: 12. By using this primer set, a DNA fragment containing the target region of the β-tubulin gene of Aspergillus lentus and Aspergillus fumicinetus can be specifically, rapidly and highly sensitively amplified by the LAMP method. Therefore, when amplification of the DNA fragment is confirmed, it can be determined that Aspergillus lentus and Aspergillus fumicinetus are present in the sample.

In order to specifically detect Aspergillus udagawae , it is more preferable to use a primer set comprising the following primers (m) to (p).

Aspergillus Udagawa fly detection primer set (m) Primer consisting of an oligonucleotide represented by the base sequence set forth in SEQ ID NO: 13 (n) Primer consisting of an oligonucleotide represented by the base sequence set forth in SEQ ID NO: 14 (o) sequence Primer consisting of an oligonucleotide represented by the base sequence described in No. 15 (p) Primer consisting of an oligonucleotide represented by the base sequence described in SEQ ID No. 16

In order to detect Aspergillus subtilis, it is preferable to use a loop primer in addition to the above primers. As the loop primer, the following primer (q) and / or (r) is preferably used.

Loop primer for detecting Aspergillus vulvae (q) Primer consisting of an oligonucleotide represented by the base sequence set forth in SEQ ID NO: 17 (r) Primer consisting of an oligonucleotide represented by the base sequence set forth in SEQ ID NO: 18

FIG. 2 shows the positional relationship of the base sequence recognized by the primer in the base sequence of the β-tubulin gene of Aspergillus udagawa.

  The primer set for detecting Aspergillus udder fly according to the present invention is a primer set used for detection by the LAMP method, comprising a primer consisting of an oligonucleotide represented by the base sequence described in SEQ ID NO: 13, and a sequence described in SEQ ID NO: 14. A primer composed of an oligonucleotide represented by the base sequence, a primer composed of the oligonucleotide represented by the base sequence described in SEQ ID NO: 15, and a primer composed of the oligonucleotide represented by the base sequence described in SEQ ID NO: 16 The primer set preferably further comprises a primer comprising an oligonucleotide represented by the nucleotide sequence set forth in SEQ ID NO: 17 and / or SEQ ID NO: 18. By using this primer set, a DNA fragment containing the target region of the β-tubulin gene of Aspergillus udder can be specifically, rapidly and highly sensitively amplified by the LAMP method. For this reason, when amplification of the DNA fragment is confirmed, it can be determined that Aspergillus sudawae is present in the sample.

Further, the oligonucleotide for detecting Aspergillus fumigatus related bacteria of the present invention selects F3, F2 and F1 as the base sequence region from the 5 ′ side of the target region selected from the base sequence of the β-tubulin gene, From the 3 'side of the region, B3c, B2c and B1c are selected as base sequence regions, and the complementary base sequences of B3c, B2c and B1c are B3, B2 and B1, respectively, and complementary to the F3, F2 and F1. When the simple base sequences are F3c, F2c and F1c, respectively, an oligonucleotide having a base sequence corresponding to any of the following (a) to (f) is preferable.
(A) a base sequence having the B2 region on the 3 ′ side and a B1c region on the 5 ′ side (b) a base sequence having the B3 region (c) having the F2 region on the 3 ′ side; A base sequence having an F1c region on the 5 ′ side (d) a base sequence having the F3 region (e) a base sequence having a sequence complementary to a portion between the B1 region and the B2 region (f) the F1 region Base sequence having a sequence complementary to the portion between the F2 regions The oligonucleotide of the present invention can be used not only as a primer used in the LAMP method but also as a primer for PCR method, a probe for nucleic acid detection, etc. it can.

  The enzyme used when a DNA fragment including the target region is amplified by the LAMP method is not particularly limited as long as it is a commonly used enzyme, but a template-dependent nucleic acid synthase having strand displacement activity is preferable. Examples of such an enzyme include Bst DNA polymerase (large fragment), Bca (exo-) DNA polymerase, Klenow fragment of E. coli DNA polymerase I, and preferably Bst DNA polymerase (large fragment). Enzymes that can be used in the present invention may be purified from viruses, bacteria, or the like, or may be prepared by gene recombination techniques. These enzymes may be modified by fragmentation or amino acid substitution.

  The temperature at which the DNA fragment containing the target region is amplified by the LAMP method is not particularly limited, but is preferably 60 to 65 ° C.

Amplification of the DNA fragment containing the target region can be confirmed by a usual method. When a DNA fragment containing the target region is amplified by the LAMP method, for example, hybridization is performed using a labeled oligonucleotide that specifically recognizes the amplified base sequence as a probe, or a fluorescent intercalator method ( JP-A-2001-242169), or the reaction solution after completion of the reaction can be directly electrophoresed on an agarose gel and detected as a band. In agarose gel electrophoresis, a large number of bands with different base lengths are detected in a ladder shape from the LAMP amplification product.
In the LAMP method, a large amount of substrate is consumed by nucleic acid synthesis, and pyrophosphate ions as a by-product react with the coexisting magnesium ions to calculate magnesium pyrophosphate. When magnesium pyrophosphate is calculated, the reaction solution becomes cloudy to the extent that it can be confirmed with the naked eye. Using this white turbidity as an index, a nucleic acid amplification reaction can be detected using a measuring instrument that can optically observe the increase in turbidity after the reaction or during the reaction. For example, a nucleic acid amplification reaction can be detected by confirming a change in absorbance at 400 nm using a spectrophotometer (International Publication No. 01/83817).

  The detection oligonucleotide, nucleic acid primer and nucleic acid probe used in the present invention can be chemically synthesized based on the designed sequence or purchased from a reagent manufacturer. Specifically, it can be synthesized using an oligonucleotide synthesizer or the like. Moreover, what was refine | purified using the adsorption column, the high performance liquid chromatography, and the electrophoresis method after a synthesis | combination can also be used. An oligonucleotide having a base sequence in which one to several bases are substituted, deleted, inserted or added can also be synthesized using a known method.

  The binding mode of the detection oligonucleotide, nucleic acid primer, and nucleic acid probe may be not only a phosphodiester bond existing in a natural nucleic acid but also a phosphoramidate bond, a phosphorothioate bond, or the like.

There is no restriction | limiting in particular as a test substance used in this invention, Food-drinks itself, the raw material of food-drinks, an isolated microbial cell, a cultured microbial cell, etc. can be used.
The method for preparing DNA from a sample is not particularly limited as long as a sufficient degree of purity and amount of DNA can be obtained for detection of Aspergillus fumigatus-related bacteria, and can be used in an unpurified state. It can also be used after pretreatment such as extraction, concentration and purification. For example, it can be purified by extraction with phenol and chloroform, or purified using a commercially available extraction kit to increase the purity of the nucleic acid.

The detection oligonucleotide, nucleic acid probe or nucleic acid primer of the present invention may be prepackaged together with various reagents necessary for detecting Aspergillus fumigatus-related bacteria to form a kit for detecting Aspergillus fumigatus-related bacteria. it can.
For example, the kit of the present invention includes the primer set (g) to (j) and / or the primer set (m) to (p) that can be used in the LAMP method, a DNA polymerase, dATP, and dCTP. , DGTP and dNTP including dTTP. Preferably, the primer sets (g) to (l) and / or the primer sets (m) to (r) above, four types of dNTPs (dATP, dCTP, dGTP and dTTP), which serve as substrates for nucleic acid synthesis, and chains DNA polymerases such as template-dependent nucleic acid synthases with substitution activity, buffers that give suitable conditions for enzyme reactions, salts as cofactors (magnesium salts or manganese salts, etc.), protective agents that stabilize enzymes and templates Furthermore, reagents necessary for detection of reaction products are contained as a kit as required. The kit of the present invention may contain a positive control (positive control) for confirming that the LAMP reaction proceeds normally with the primer of the present invention. Examples of the positive control include DNA containing a region amplified by the method of the present invention.

  The detection kit of the present invention contains the oligonucleotide pairs (c) and (d) and / or the oligonucleotide pairs (e) and (f) as nucleic acid primers. This kit can be preferably used in a method for detecting Aspergillus fumigatus-related bacteria by PCR. In addition to the nucleic acid primer, the kit of the present invention may be a label detection substance, a buffer, a nucleic acid synthase (DNA polymerase, RNA polymerase, reverse transcriptase, etc.), an enzyme substrate (dNTP, rNTP, etc.), etc. Contains substances commonly used for fungal detection.

  According to the method of the present invention, the process from the specimen preparation process to the fungus detection process can be performed in a short time of about 60 to 120 minutes.

  EXAMPLES Hereinafter, although this invention is demonstrated further in detail based on an Example, this invention is not limited to this.

Example 1 Analysis of base sequence specific to Aspergillus fumigatus-related bacteria The base sequence of the β-tubulin gene of each fungus belonging to the genus Aspergillus was determined by the following method. DNA was extracted from Aspergillus fumigatus-related cells cultured in a dark place on a potato dextrose agar slope medium at 25 ° C. for 7 days using Gentorukun TM (manufactured by Takara Bio Inc.). PCR amplification of the target site was performed using PuRe Taq ™ Ready-To-Go PCR Beads (manufactured by GE Health Care UK LTD) as primers, Bt2a (5′-GGTAACCAAATCGGTGCTGCTTTC-3 ′, SEQ ID NO: 19), Bt2b ( 5′-ACCCTCAGTGTAGTGACCCTTGGC-3 ′, SEQ ID NO: 20) (Glass and Donaldson, Appl Environ Microbiol 61: 1323-1330, 1995) was used. The amplification conditions were a denaturation temperature of 95 ° C., an annealing temperature of 59 ° C., an extension temperature of 72 ° C., and 35 cycles. The PCR product was purified using Auto Seg ™ G-50 (Amersham Pharmacia Biotech). PCR products were labeled using BigDye terminator Ver. 1.1 (trade name, manufactured by Applied Biosystems), and electrophoresed using ABI PRISM 3130 Genetic Analyzer (manufactured by Applied Biosystems). Software 'ATGC Ver. 4' (manufactured by Genetyx) was used to determine the base sequence from the fluorescence signal during electrophoresis.
Various fungi determined by sequencing methods (Aspergillus fumigatus (see Japanese Patent Application No. 2008-139999), Aspergillus lentus, Aspergillus Udagawae, Aspergillus niger (Accession number: AY585535), Hamigera Avellanera (see Japanese Patent Application No. 2008-139999), Bisokuramis nibea ( Based on the base sequence information of the β-tubulin gene in Japanese Patent Application No. 2008-139999)), alignment analysis was performed using DNA analysis software (trade name: DNAsis pro, manufactured by Hitachi Software), and Aspergillus lentus And a base sequence specific to Aspergillus fumicinetus (SEQ ID NO: 1) and a base sequence specific to Aspergillus vulgaris (SEQ ID NO: 2).

Example 2 Detection of Aspergillus lentus and Aspergillus fumicinetus by PCR (1) Preparation of primer 3 ′ terminal side of the base sequence region (SEQ ID NO: 1) specific to Aspergillus lentus and Aspergillus fumicinetus obtained in Example 1 From the region where the specificity of Aspergillus lentus group is particularly high, 1) the base sequence unique to the group is continuous around 10 bases, 2) the GC content is approximately 30% to 80%, and 3) self-annealing is possible. 4) The site | part which satisfy | fills four conditions that Tm value will be about 55-65 degreeC in general was examined. Based on the base sequence of this partial region, a set of primer pairs is designed, and the effectiveness of Aspergillus lentus group detection by PCR reaction using DNA extracted from various bacterial cells, ie, Aspergillus lentus and Aspergillus fumicinetus DNA An examination was made that an amplification reaction of about 300 bp was observed in the reaction using as a template, and no amplification product was observed in the reaction using the genomic DNA of other fungi as a template. As a result, the effectiveness of the designed primer pair was confirmed. The oligonucleotides represented by the base sequences described in SEQ ID NOs: 3 and 4 are this primer pair. The primers used were purchased from Sigma Aldrich Japan (combined desalted product, 0.02 μmol scale).

(2) Preparation of specimens Aspergillus lentus and Aspergillus fumicinetus, the strains listed in Table 1 were used. In order to show the primer specificity consisting of the oligonucleotides represented by the nucleotide sequences of SEQ ID NOs: 3 and 4 for the β-tubulin gene of Aspergillus lentus and Aspergillus fumicinetus, other Aspergillus fumigatus related bacteria shown in Table 1 and others The fungi were also used. These fungi were stored and used by Chiba University School of Medicine, Center for Fungal Medicine, and managed by IFM numbers.
Each cell was cultured under optimal conditions. As for the culture conditions, potato dextrose medium (trade name: Pearl Core potato dextrose agar medium, manufactured by Eiken Chemical Co., Ltd.) was used and cultured at 25 ° C. for 7 days.

(3) Preparation of genomic DNA Each bacterial cell was recovered from the agar medium using a platinum loop.
A genomic DNA solution was prepared from the collected cells using a genomic DNA preparation kit (PrepMan ultra (trade name) manufactured by Applied Biosystems). The concentration of the DNA solution was adjusted to 50 ng / μl.

(4) PCR reaction As a DNA template, 1 μl of the genomic DNA solution prepared above, 13 μl of Pre Mix Taq (trade name, manufactured by Takara Bio Inc.), and 10 μl of sterile distilled water were mixed and represented by the nucleotide sequence shown in SEQ ID NO: 3. Primers consisting of oligonucleotides (Al1F primer: GTGTTCAGCTTCGCTGCCATGA, 20 pmol / μl) 0.5 μl and oligonucleotides represented by the nucleotide sequence shown in SEQ ID NO: 4 (Al1R primer: GTCAGACCGTGGGATGTTGTCA, 20 pmol / μl) 5 μl was added to prepare a 25 μl PCR reaction solution.
The PCR reaction solution was subjected to gene amplification using an automatic gene amplification apparatus thermal cycler DICE (Takara Bio). PCR reaction conditions were 30 (1) heat denaturation reaction at 98 ° C. for 10 seconds, (ii) annealing reaction at 63 ° C. for 1 minute, and (iii) extension reaction at 72 ° C. for 1 minute as 30 cycles. Cycled.

(5) Confirmation of amplified gene fragment After PCR reaction, 10 μl is taken from the PCR reaction solution, electrophoresed on a 2% agarose gel, and after DNA staining with SYBR Safe DNA gel stain in 1 × TAE (Invitrogen) The presence or absence of the amplified DNA fragment was confirmed by detecting fluorescence under ultraviolet light. An electropherogram of the agarose gel is shown in FIG. The numbers in the figure indicate that the samples were reacted using DNA extracted from the samples with corresponding sample numbers shown in Table 1.
As a result, amplification of a gene fragment of about 250 bp was confirmed in the samples containing Aspergillus lentus and Aspergillus fumicinetus genomic DNA (sample numbers 1 to 6). On the other hand, amplification of the gene fragment was not confirmed in the sample not containing genomic DNA of Aspergillus lentus and Aspergillus fumicinetus. From the above results, Aspergillus lentus and Aspergillus fumicinetus can be specifically detected by using the oligonucleotide of the present invention.

Example 3 Detection of Aspergillus vulvae by PCR (1) Preparation of primer Aspergillus vulvae in the base sequence region (SEQ ID NO: 2) specific to the Aspergillus vulvae group obtained in Example 1 at the 3 ′ end side From the region where the group specificity is particularly high, 1) the base sequence unique to the group is continuous around 10 bases, 2) the GC content is approximately 30% to 80%, and 3) the possibility of self-annealing is low. 4) The site | part which satisfy | fills four conditions that Tm value will be about 55-65 degreeC in general was examined. Based on the base sequence of this partial region, a set of primer pairs is designed, and the effectiveness of Aspergillus udder fly group detection by PCR reaction using DNA extracted from various bacterial cells, ie, Aspergillus udder fly DNA as a template. In this reaction, about 250 bp DNA amplification reaction was observed, and it was examined that amplification products were not recognized in reactions using genomic DNA of other fungi as a template. As a result, the effectiveness of the designed primer pair was confirmed. This primer pair is an oligonucleotide represented by the nucleotide sequences set forth in SEQ ID NOs: 5 and 6. The primer pairs used were purchased from Sigma-Aldrich Japan Co., Ltd. (demineralized product, 0.02 μmol scale).

(2) Preparation of specimens Aspergillus Udagawae, the strains listed in Table 2 were used. In order to show the primer specificity consisting of the oligonucleotides represented by the nucleotide sequences of SEQ ID NOs: 5 and 6 for the β-tubulin gene of Aspergillus vulgaris, other Aspergillus fumigatus related fungi and other fungi shown in Table 2 used. These fungi were stored and used by Chiba University School of Medicine, Center for Fungal Medicine, and managed by IFM numbers.
Each cell was cultured under optimal conditions. As for the culture conditions, potato dextrose medium (trade name: Pearl Core potato dextrose agar medium, manufactured by Eiken Chemical Co., Ltd.) was used and cultured at 25 ° C. for 7 days.

(3) Preparation of genomic DNA Each bacterial cell was recovered from the agar medium using a platinum loop.
A genomic DNA solution was prepared from the collected cells using a genomic DNA preparation kit (PrepMan ultra (trade name) manufactured by Applied Biosystems). The concentration of the DNA solution was adjusted to 50 ng / μl.

(4) PCR reaction As a DNA template, 1 μl of the genomic DNA solution prepared above, 13 μl of Pre Mix Taq (trade name, manufactured by Takara Bio Inc.), and 10 μl of sterile distilled water were mixed and represented by the nucleotide sequence set forth in SEQ ID NO: 5. Primer (Asp1F primer: CTAGGGTTTCAGCGTCGCTTTG, 20 pmol / μl) 0.5 μl and a primer composed of the oligonucleotide represented by the nucleotide sequence set forth in SEQ ID NO: 6 (Asp1R primer: GTAGTGTAGAGTCGAGTTTC, 20 pmol / μl) 5 μl was added to prepare a 25 μl PCR reaction solution.
The PCR reaction solution was subjected to gene amplification using an automatic gene amplification apparatus thermal cycler DICE (Takara Bio). PCR reaction conditions were 30 (1) heat denaturation reaction at 98 ° C. for 10 seconds, (ii) annealing reaction at 63 ° C. for 1 minute, and (iii) extension reaction at 72 ° C. for 1 minute as 30 cycles. Cycled.

(5) Confirmation of amplified gene fragment After PCR reaction, 10 μl is taken from the PCR reaction solution, electrophoresed on a 2% agarose gel, and after DNA staining with SYBR Safe DNA gel stain in 1 × TAE (Invitrogen) The presence or absence of the amplified DNA fragment was confirmed by detecting fluorescence under ultraviolet light. The electropherogram of the agarose gel is shown in FIG. The numbers in the figure indicate samples that have been reacted using DNA extracted from the samples of the corresponding sample numbers listed in Table 2.
As a result, amplification of a gene fragment of about 250 bp was confirmed in the sample (sample numbers 1 to 4) containing genomic DNA of Aspergillus vulgaris. On the other hand, amplification of the gene fragment was not confirmed in the sample not containing the genomic DNA of Aspergillus vulgaris. From the above results, Aspergillus subtilis can be specifically detected by using the oligonucleotide of the present invention.

Example 4 Detection of Aspergillus lentus and Aspergillus fumicinetus by LAMP method (1) Primer design and synthesis Based on the base sequence region (SEQ ID NO: 1) specific for Aspergillus lentus and Aspergillus fumicinetus obtained in Example 1, Using the LAMP method primer design support software Primer Explorer V4, 4 sets of LAMP primer pairs were designed. Using DNA extracted from various cells, the effectiveness of Aspergillus lentus group detection by the LAMP method was examined for each of these four sets of primer pairs, and the effectiveness was confirmed with one of the primer pairs. The oligonucleotides represented by the base sequences described in SEQ ID NOs: 7 to 12 are primer pairs. The primers used were synthesized in E Genome order (Fujitsu System Solutions Co., Ltd., SEQ ID NO: 7, 8; 5 pmol scale, SEQ ID NO: 9, 10; 40 pmol scale, SEQ ID NO: 11, 12: 20 pmol scale; all column purified products). Requested and purchased.

(2) Preparation of specimens Aspergillus lentus and Aspergillus fumicinetus, the strains listed in Table 3 were used. In order to confirm the specificity of the primer consisting of the oligonucleotide represented by the nucleotide sequence of SEQ ID NOs: 7 to 12 to the β-tubulin gene of Aspergillus lentus and Aspergillus fumicinetus, other Aspergillus fumigatus related bacteria shown in Table 3 and Other fungi were also used. These fungi were stored and used by Chiba University School of Medicine, Center for Fungal Medicine, and managed by IFM numbers.
Each cell was cultured under optimal conditions. As for the culture conditions, potato dextrose medium (trade name: Pearl Core potato dextrose agar medium, manufactured by Eiken Chemical Co., Ltd.) was used and cultured at 25 ° C. for 7 days.

(3) Preparation of genomic DNA A genomic DNA solution was prepared from the cells using a genomic DNA preparation kit (trade name: PrepMan ultra, manufactured by Applied Bio). Specifically, several colonies were collected from each medium, the cells were suspended in 200 μl of the kit's attached reagent, the cells were dissolved by heat treatment at 100 ° C. for 10 minutes, and centrifuged at 14800 rpm for 5 minutes. Thereafter, the supernatant was collected. The concentration of the obtained genomic DNA solution was adjusted to 50 ng / μl. This genomic DNA solution was used as a template DNA for the following LAMP reaction.

(4) Preparation of reaction solution for LAMP reaction 2 × Reaction Mix (Tris-HCl (pH 8.8) 40 mM, KCl 20 mM, MgSO ₄ 16 mM, (NH ₄ ) ₂ SO ₄ 20 mM, 0.2% Tween 20, Betaine 6M, dNTPs 2.8 mM: Eiken Chemical Co., Ltd .; Loopamp DNA amplification reagent kit) 12.5 μl, primer composed of oligonucleotide represented by the base sequence described in SEQ ID NO: 7 (LAl3F3 primer: TTCCCACCTCAATGCTAGGA, 5 pmol / μl) 1 μl of a primer consisting of an oligonucleotide represented by the base sequence shown in SEQ ID NO: 8 (LAI3B3 primer: ACGCGTCCTCTTCTTCCTT, 5 pmol / μl) 1 μl of a primer consisting of an oligonucleotide represented by the base sequence shown in SEQ ID NO: 9 ( Al3FIP primer: CTCATGGCAGCGAAGCTGAACAGGAGACTGGGACCTGTCATC, 40 μmol / μl) 1 μl, a primer composed of an oligonucleotide represented by the base sequence described in SEQ ID NO: 10 (LAl3BIP primer: TGACGGCTCTGGCCAGTAAGGCCTTACGTGTTTCCGCC, 40 μmol / μl) 1 μl of a primer composed of an oligonucleotide (LAI3LF loop primer: CATGGAGGACAGCCTGCT, 20 pmol / μl), 1 μl of a primer composed of an oligonucleotide represented by the base sequence described in SEQ ID NO: 12 (LAI3LB loop primer: TCGACCTATATCCTCCCAATTGA, 20 pmol / μl) 1 μl of Bst DNA Polymerase (8 U / 25 μL, manufactured by Eiken Chemical Co., Ltd.) and 1 μl of the template DNA prepared above were mixed, and distilled water was added. In addition, a total volume of 25 μl of reaction solution was prepared.

(5) LAMP reaction The reaction solution prepared above was subjected to a DNA amplification reaction at 63 ± 2 ° C. for 60 minutes with a real-time turbidity measuring apparatus Loopamp RT-160C (manufactured by Eiken Chemical Co., Ltd.). At the same time, the turbidity of the reaction solution was measured (wavelength: 400 nm).

(6) Confirmation of DNA amplification The presence or absence of DNA amplification was determined based on whether the turbidity of the reaction solution had increased. The measurement results of the turbidity of the reaction solution are shown in FIG. 5 and FIG.
As a result, only in a system (sample numbers 1 to 4) using Aspergillus lentus and Aspergillus fumicinetus genomic DNA as a template (sample numbers 1 to 4), an increase in turbidity, that is, DNA synthesis / amplification reaction was observed from about 20 minutes after the start of the reaction.
On the other hand, systems using genomic DNA of other fungi, that is, other Aspergillus genus (Sample No. 5 Aspergillus brevipes, Sample No. 6 Aspergillus doricaris, Sample No. 7 Aspergillus fumigafinis, Sample No. 8 Aspergillus fumigatus, Sample No. 9 Aspergillus Novohumigatus, Sample No. 10 Aspergillus Udagawae, Sample No. 11 Aspergillus urinalellaris, Sample No. 12 Aspergillus viridenutans) and Neosartoria genus (Document No. 13 Neosartoria Fischeri, Sample No. 14 Neosartoria Spinosa, Sample No. 15 Neosartoria Grabra, Sample No. 16 Neosartoria Hiratsukae) Then, no increase in the turbidity of the reaction solution was observed for up to 100 minutes after the start of the reaction. From about 100 minutes after the start of the reaction, an increase in the turbidity of the reaction solution was also observed in a system using genomic DNA other than Aspergillus lentus and Aspergillus fumicinetus. This is probably because a small number of primers have reacted to the part other than the target because of the occurrence or when the reaction time is long.
From the above results, according to the method of the present invention, Aspergillus lentus and Aspergillus fumicinetus can be detected simply, rapidly and specifically.

Example 5 Detection of Aspergillus udder fly by LAMP method (1) Primer design and synthesis Based on the base sequence region (SEQ ID NO: 2) specific to Aspergillus udder fly group obtained in Example 1, LAMP method primer design Three sets of LAMP primers were designed using the support software Primer Explorer V4. Using the DNA extracted from various bacterial cells, the effectiveness of Aspergillus udawae group detection by the LAMP method was examined for each of these three sets of primer pairs, and the effectiveness was confirmed with one set of primer pairs. The oligonucleotides represented by the nucleotide sequences described in SEQ ID NOs: 13 to 18 are primer pairs. The primers used were synthesized in E Genome order (Fujitsu System Solutions Co., Ltd., SEQ ID NO: 13, 14; 5 pmol scale, SEQ ID NO: 15, 16; 40 pmol scale, SEQ ID NO: 17, 18: 20 pmol scale; all column purified products). Requested and purchased.

(2) Preparation of specimens Aspergillus Udagawae, the strains listed in Table 4 were used. In order to confirm the specificity of the primer consisting of the oligonucleotide represented by the nucleotide sequence of SEQ ID NOs: 13 to 18 against the β-tubulin gene of Aspergillus vulgaris, other Aspergillus fumigatus-related fungi and other fungi shown in Table 4 Also used. These fungi were stored and used by Chiba University School of Medicine, Center for Fungal Medicine, and managed by IFM numbers.
Each cell was cultured under optimal conditions. As for the culture conditions, potato dextrose medium (trade name: Pearl Core potato dextrose agar medium, manufactured by Eiken Chemical Co., Ltd.) was used and cultured at 25 ° C. for 7 days.

(3) Preparation of genomic DNA A genomic DNA solution was prepared from the cells using a genomic DNA preparation kit (trade name: PrepMan ultra, manufactured by Applied Bio). Specifically, several colonies were collected from each medium, the cells were suspended in 200 μl of the kit's attached reagent, the cells were dissolved by heat treatment at 100 ° C. for 10 minutes, and centrifuged at 14800 rpm for 5 minutes. Thereafter, the supernatant was collected. The concentration of the obtained genomic DNA solution was adjusted to 50 ng / μl. This genomic DNA solution was used as a template DNA for the following LAMP reaction.

(4) Preparation of reaction solution for LAMP reaction 2 × Reaction Mix (Tris-HCl (pH 8.8) 40 mM, KCl 20 mM, MgSO ₄ 16 mM, (NH ₄ ) ₂ SO ₄ 20 mM, 0.2% Tween 20, Betaine 6M, dNTPs 2.8 mM: Eiken Chemical Co., Ltd .; Loopamp DNA amplification reagent kit) 12.5 μl, a primer composed of an oligonucleotide represented by the base sequence described in SEQ ID NO: 13 (LAsp3F3 primer: AGGACCTGTCATCCTAGCA, 5 pmol / μl) 1 μl of primer (LAsp3B3 primer: ATCCTCATCAGACACGCGC, 5 pmol / μl) consisting of an oligonucleotide represented by the nucleotide sequence shown in SEQ ID NO: 14 1 μl, a primer consisting of the oligonucleotide represented by the nucleotide sequence shown in SEQ ID NO: 15 Immers (LAsp3FIP primer: TCACCAGAGATGGTCTGCCTGTTTTCCTCCATGGTTTCAGCG, 40 pmol / μl) 1 μl, a primer composed of an oligonucleotide represented by the base sequence described in SEQ ID NO: 16 (LAsp3BIP primer: CTTGACGGCTCTGGCCAGTATTCCTGCTTGCCTTTCGC, 40 pmol / μl sequence described in 17 μl, sequence number 17) Primer consisting of an oligonucleotide represented by (LAsp3LF loop primer: TTTGTTAGCTGATACCCATCAAAGC, 20 pmol / μl) 1 μl, primer consisting of an oligonucleotide represented by the base sequence described in SEQ ID NO: 18 (LAsp3LB loop primer: TCCTCCCAATTGAGAAAGCGGG, 20 pmol / μl) 1 μl, Bst DNA Polymerase (8 U / 25 μL, manufactured by Eiken Chemical Co., Ltd.) 1 μl, and template DNA 1 prepared above Mixing l, and reaction solution a total volume of 25μl by adding distilled water.

(5) LAMP reaction The reaction solution prepared above was subjected to a DNA amplification reaction at 63 ± 2 ° C. for 60 minutes with a real-time turbidity measuring apparatus Loopamp RT-160C (manufactured by Eiken Chemical Co., Ltd.). At the same time, the turbidity of the reaction solution was measured (wavelength: 400 nm).

(6) Confirmation of DNA amplification The presence or absence of DNA amplification was determined based on whether the turbidity of the reaction solution had increased. The measurement results of the turbidity of the reaction solution are shown in FIGS.
As a result, an increase in turbidity, that is, DNA synthesis / amplification reaction was observed from about 20 minutes after the start of the reaction only in a system (sample numbers 1 to 3) using the genomic DNA of Aspergillus subtilis as a template.
On the other hand, systems using genomic DNA of other fungi, that is, other Aspergillus genus (Sample No. 4 Aspergillus Brevipes, Sample No. 5 Aspergillus doricaris, Sample No. 6, Aspergillus fumigafinis, Sample No. 7 Aspergillus fumigatus, Sample No. 8 Aspergillus fumicinetus, Sample No. 9 Aspergillus lentus, Sample No. 10 Aspergillus Novofumigatus, Sample No. 11 Aspergillus sea urinalis, Neosartria genus (Document No. 13 Neosartoria Fischery, Sample No. 14 Neosartoria Spinosa, Sample No. 15 Neosartoria Grabra, Sample No. 16 Neosartoria Hiratscae ), No increase in turbidity of the reaction solution was observed until 70 minutes after the start of the reaction. In addition, from about 70 minutes after the start of the reaction, an increase in turbidity of the reaction solution was also observed in a system using genomic DNA other than Aspergillus udderfly, but this caused a non-specific reaction between the plumers over time. Or, if the reaction time is long, it is considered that a small number of primers have reacted to the part other than the target.
From the above results, according to the method of the present invention, it is possible to detect Aspergillus subtilis simply, rapidly and specifically.

The positional relationship of the base sequences recognized by the Aspergillus lentus and Aspergillus fumicinetus detection primers in the base sequence of the β-tubulin gene of Aspergillus lentus is shown. The positional relationship of the base sequence which the primer for an Aspergillus Udagawa fly recognizes in the base sequence of the β-tubulin gene of Aspergillus Udagawa is shown. FIG. 3 is an electrophoretogram of PCR products in Example 2. FIG. 4 is an electrophoretogram of PCR products in Example 3. It is a figure which shows the detection sensitivity of Aspergillus lentus and Aspergillus fumicinetus by the real-time turbidity method in Example 4. 1 shows the detection sensitivity of a sample using genomic DNA derived from Aspergillus lentulus A170 strain, 2 shows the detection sensitivity of a sample using genomic DNA derived from Aspergillus lentulus AS10 strain, 3 shows genomic DNA derived from Aspergillus fumisynnematus A234 strain 4 shows the detection sensitivity of a sample using genomic DNA derived from Aspergillus fumisynnematus A240 strain, and 8 shows the detection sensitivity of a sample using genomic DNA derived from Aspergillus fumigatus A215 strain. It is a figure which shows the detection sensitivity of Aspergillus lentus and Aspergillus fumicinetus by the real-time turbidity method in Example 4. 10 shows the detection sensitivity of the sample using genomic DNA derived from Aspergillus udagawae A221 strain, and 16 shows the detection sensitivity of the sample using genomic DNA derived from Neosartorya hiratsukae IFM47036 strain. In Example 5, it is a figure which shows the detection sensitivity of Aspergillus vulgaris by the real-time turbidity method. 1 shows the detection sensitivity of a sample using genomic DNA derived from Aspergillus udagawae A221 strain, 2 shows the detection sensitivity of a sample using genomic DNA derived from Aspergillus udagawae N73 strain, 3 shows genomic DNA derived from Aspergillus udagawae A19 strain The detection sensitivity of the sample using is shown. In Example 5, it is a figure which shows the detection sensitivity of Aspergillus vulgaris by the real-time turbidity method. 9 shows the detection sensitivity of the sample using genomic DNA derived from Aspergillus lentulus A170 strain, 11 shows the detection sensitivity of the sample using genomic DNA derived from Aspergillus unilateralis A131 strain, and 12 shows genomic DNA derived from Aspergillus viridinutans A132 strain 13 shows the detection sensitivity of a sample using genomic DNA derived from Neosartorya ficheri A213 strain, and 14 shows the detection sensitivity of a sample using genomic DNA derived from Neosartorya spinosa IFM46945 strain.

Claims (29)

A method for detecting an Aspergillus fumigatus ( Aspergillus fumigatus ) -related bacterium characterized by identifying an Aspergillus fumigatus ( Aspergillus fumigatus ) -related bacterium using a nucleic acid represented by the base sequence described in (a) or (b) below .
(A) Partial base sequence of β-tubulin gene described in SEQ ID NO: 1 or 2 or its complementary sequence (b) One or several bases are deleted or replaced in the base sequence described in SEQ ID NO: 1 or 2 Or the added base sequence or its complementary sequence   In order to perform identification, the base sequence of the β-tubulin gene of the test bacterium is determined, and whether the base sequence of the nucleic acid described in (a) or (b) is included in the base sequence of the gene The method for detecting an Aspergillus fumigatus-related bacterium according to claim 1, wherein: The region of the nucleic acid represented by the base sequence described in (a) or (b) above is subjected to gene amplification for identification, and the presence or absence of a gene amplification product is confirmed. A method for detecting an Aspergillus fumigatus related bacterium. The Aspergillus fumigatus-related bacterium is Aspergillus lentulus , Aspergillus fumicinetus ( Aspergillus fumyninematus ), or at least one species selected from the group of Aspergillus udagawae ( Aspergillus udagae ) ( Aspergillus udagae ) Method. The Aspergillus fumigatus-related bacterium is Aspergillus lentulus and / or Aspergillus fumicinetus ( Aspergillus fumignanematus ), which is represented by the base sequence described in the following (a-1) or (b-1) The detection method according to claim 3, wherein the region is subjected to gene amplification, and the presence or absence of a gene amplification product is confirmed.
(A-1) Partial base sequence of β-tubulin gene described in SEQ ID NO: 1 or its complementary sequence (b-1) One or several bases deleted or substituted in the base sequence described in SEQ ID NO: 1 Or the added base sequence or its complementary sequence The Aspergillus fumigatus related bacteria an Aspergillus Udagawae (Aspergillus udagawae), the following areas in the nucleic acid represented by the nucleotide sequence set forth in (a-2) or (b-2) gene amplification, gene amplification products The detection method according to claim 3, wherein the presence or absence is confirmed.
(A-2) Partial base sequence of the β-tubulin gene described in SEQ ID NO: 2 or its complementary sequence (b-2) One or several bases are deleted or replaced in the base sequence described in SEQ ID NO: 2 Or the added base sequence or its complementary sequence   The detection method according to any one of claims 3 to 6, wherein the gene amplification reaction is performed by a polymerase chain reaction (PCR) method. The following oligonucleotides (c) and (d) perform an amplification reaction using as a nucleic acid primer, Aspergillus lentus (Aspergillus lentulus) and / or Aspergillus Fumishinematasu (Aspergillus fumisynnematus) according to claim 7, wherein the detecting the Detection method.
(C) an oligonucleotide represented by the base sequence set forth in SEQ ID NO: 3 or an oligonucleotide represented by a base sequence having 70% or more homology to the base sequence and usable as a primer (d) Oligonucleotide represented by the nucleotide sequence set forth in SEQ ID NO: 4, or oligonucleotide represented by a nucleotide sequence having 70% or more homology with the nucleotide sequence and usable as a primer 8. The detection method according to claim 7, wherein an amplification reaction is performed using the following oligonucleotides (e) and (f) as nucleic acid primers to detect Aspergillus udagawae .
(E) the oligonucleotide represented by the base sequence set forth in SEQ ID NO: 5 or the oligonucleotide represented by the base sequence that has 70% or more homology to the base sequence and can be used as a primer (f) Oligonucleotide represented by the nucleotide sequence set forth in SEQ ID NO: 6, or oligonucleotide represented by a nucleotide sequence having 70% or more homology with the nucleotide sequence and usable as a primer   The detection method according to any one of claims 3 to 6, wherein the gene amplification reaction is carried out by a loop mediated isal amplification (LAMP) method. The oligonucleotide sets the following (g) ~ (j) carried out an amplification reaction using as a nucleic acid primer according to claim 10, wherein the detecting Aspergillus lentus (Aspergillus lentulus) and / or Aspergillus Fumishinematasu (Aspergillus fumisynnematus) Detection method.
(G) Oligonucleotide represented by the base sequence set forth in SEQ ID NO: 7 (h) Oligonucleotide represented by the base sequence set forth in SEQ ID NO: 8 (i) Oligonucleotide represented by the base sequence set forth in SEQ ID NO: 9 Nucleotide (j) Oligonucleotide represented by the nucleotide sequence set forth in SEQ ID NO: 10 The detection method according to claim 11, further comprising using the following oligonucleotides (k) and / or (l) as nucleic acid primers.
(K) an oligonucleotide represented by the base sequence set forth in SEQ ID NO: 11 (l) an oligonucleotide represented by the base sequence set forth in SEQ ID NO: 12 The detection method according to claim 10, wherein an amplification reaction is carried out using the following oligonucleotide sets (m) to (p) as nucleic acid primers to detect Aspergillus udagawae .
(M) an oligonucleotide represented by the base sequence set forth in SEQ ID NO: 13 (n) an oligonucleotide represented by the base sequence set forth in SEQ ID NO: 14 (o) an oligonucleotide represented by the base sequence set forth in SEQ ID NO: 15 Nucleotide (p) Oligonucleotide represented by the nucleotide sequence set forth in SEQ ID NO: 16 14. The detection method according to claim 13, further comprising using the following oligonucleotides (q) and / or (r) as nucleic acid primers.
(Q) an oligonucleotide represented by the base sequence set forth in SEQ ID NO: 17 (r) an oligonucleotide represented by the base sequence set forth in SEQ ID NO: 18 A DNA represented by the base sequence described in the following (a) or (b) for use in detecting an Aspergillus fumigatus- related bacterium.
(A) Partial base sequence of β-tubulin gene described in SEQ ID NO: 1 or 2 or its complementary sequence (b) One or several bases are deleted or replaced in the base sequence described in SEQ ID NO: 1 or 2 Or the added base sequence or its complementary sequence Aspergillus lentus for use in the detection of (Aspergillus lentulus) and / or Aspergillus Fumishinematasu (Aspergillus fumisynnematus), DNA represented by the nucleotide sequence set forth in the following (a-1) or (b-1).
(A-1) Partial base sequence of β-tubulin gene described in SEQ ID NO: 1 or its complementary sequence (b-1) One or several bases deleted or substituted in the base sequence described in SEQ ID NO: 1 Or the added base sequence or its complementary sequence A DNA represented by the base sequence described in the following (a-2) or (b-2) for use in detecting Aspergillus udagawae .
(A-2) Partial base sequence of the β-tubulin gene described in SEQ ID NO: 2 or its complementary sequence (b-2) One or several bases are deleted or replaced in the base sequence described in SEQ ID NO: 2 Or the added base sequence or its complementary sequence It can hybridize to a nucleic acid represented by the base sequence described in (a) or (b) below, and functions as a nucleic acid probe or nucleic acid primer for specifically detecting an Aspergillus fumigatus- related bacterium. Obtained oligonucleotide for detecting Aspergillus fumigatus-related bacteria.
(A) Partial base sequence of β-tubulin gene described in SEQ ID NO: 1 or 2 or its complementary sequence (b) One or several bases are deleted or replaced in the base sequence described in SEQ ID NO: 1 or 2 Or the added base sequence or its complementary sequence   The oligonucleotide for detection has 70% or more homology with the oligonucleotide represented by the base sequence shown in any of SEQ ID NOs: 3 to 18 or its complementary sequence, or the base sequence or its complementary sequence The oligonucleotide for detecting Aspergillus fumigatus-related bacteria according to claim 18, wherein the oligonucleotide is an oligonucleotide. Following (c) and (d) of Aspergillus lentus (Aspergillus lentulus) consisting of oligonucleotides and / or Aspergillus Fumishinematasu (Aspergillus fumisynnematus) detector oligonucleotide pair.
(C) the oligonucleotide represented by the base sequence set forth in SEQ ID NO: 3 or the oligonucleotide represented by the base sequence having 70% or more homology to the base sequence and usable as a detection oligonucleotide (D) the oligonucleotide represented by the base sequence set forth in SEQ ID NO: 4 or the oligonucleotide represented by the base sequence having 70% or more homology to the base sequence and usable as a detection oligonucleotide A pair of oligonucleotides for detection of Aspergillus udagawae comprising the following oligonucleotides (e) and (f):
(E) the oligonucleotide represented by the nucleotide sequence set forth in SEQ ID NO: 5 or the oligonucleotide represented by the nucleotide sequence having 70% or more homology with the nucleotide sequence and usable as a detection oligonucleotide (F) an oligonucleotide represented by the base sequence set forth in SEQ ID NO: 6 or an oligonucleotide represented by a base sequence having 70% or more homology to the base sequence and usable as a detection oligonucleotide   The oligonucleotide pair according to claim 20 or 21, wherein the oligonucleotide pair is a nucleic acid primer pair. A kit for detecting Aspergillus fumigatus- related bacteria containing the oligonucleotide pair according to claim 20 and / or the oligonucleotide pair according to claim 21 as a nucleic acid primer pair. Following (g) ~ consisting primer (j) Aspergillus lentus (Aspergillus lentulus) and / or Aspergillus Fumishinematasu (Aspergillus fumisynnematus) detection primer set.
(G) a primer composed of an oligonucleotide represented by the base sequence described in SEQ ID NO: 7 (h) a primer composed of an oligonucleotide represented by the base sequence described in SEQ ID NO: 8 (i) a base described in SEQ ID NO: 9 Primer comprising an oligonucleotide represented by the sequence (j) Primer comprising the oligonucleotide represented by the base sequence set forth in SEQ ID NO: 10 25. The primer set according to claim 24, further comprising the following primer (k) and / or (l): For detection of Aspergillus lentulus and / or Aspergillus fumicinetus ( Aspergillus fumicinetus ) according to claim 24 Primer set.
(K) Primer comprising an oligonucleotide represented by the base sequence set forth in SEQ ID NO: 11 (l) Primer comprising an oligonucleotide represented by the base sequence set forth in SEQ ID NO: 12 A primer set for detecting Aspergillus udagawae comprising the following primers (m) to (p):
(M) a primer composed of an oligonucleotide represented by the base sequence described in SEQ ID NO: 13 (n) a primer composed of an oligonucleotide represented by the base sequence described in SEQ ID NO: 14 (o) a base described in SEQ ID NO: 15 Primer comprising an oligonucleotide represented by the sequence (p) Primer comprising the oligonucleotide represented by the base sequence set forth in SEQ ID NO: 16 The primer set for detecting Aspergillus udagawae according to claim 26, wherein the primer set according to claim 26 further comprises the following primers (q) and / or (r):
(Q) Primer consisting of an oligonucleotide represented by the base sequence set forth in SEQ ID NO: 17 (r) Primer consisting of an oligonucleotide represented by the base sequence set forth in SEQ ID NO: 18 F3, F2 and F1 are selected as base sequence regions in order from the 5 ′ side of the sequence of the target region selected from the base sequence of the β-tubulin gene of Aspergillus fumigatus- related bacteria.
In order from the 3 ′ side of the target region, B3c, B2c and B1c are selected as base sequence regions,
The complementary base sequences of F3, F2 and F1 are F3c, F2c and F1c, respectively.
When the base sequences complementary to B3c, B2c and B1c are B3, B2 and B1, respectively,
An oligonucleotide for detecting Aspergillus fumigatus- related bacteria represented by a base sequence corresponding to any of the following (a) to (f):
(A) a base sequence having the B2 region on the 3 ′ side and a B1c region on the 5 ′ side (b) a base sequence having the B3 region (c) having the F2 region on the 3 ′ side; A base sequence having an F1c region on the 5 ′ side (d) a base sequence having the F3 region (e) a base sequence having a sequence complementary to a portion between the B1 region and the B2 region (f) the F1 region A base sequence having a sequence complementary to a portion between the F2 regions A primer set according to claim 24, 25, 26 or 27 or an oligonucleotide according to claim 28;
DNA polymerase;
dNTPs including dATP, dCTP, dGTP and dTTP;
Aspergillus fumigatus, including the (Aspergillus fumigatus) analogous bacteria detection kit.