JP2015195774A - Methods for detecting aspergillus ochraceus and aspergillus westerdijkiae - Google Patents

Abstract

PROBLEM TO BE SOLVED: To provide rapid and accurate methods for detecting Aspergillus ochraceus and Aspergillus westerdijkiae at the respective species levels.SOLUTION: There are provided two kinds of oligonucleotides with deletion, substitution, insertion or addition of one or several bases in specified base sequences and usable for detection of Aspergillus ochraceus, and two kinds of oligonucleotides with deletion, substitution, insertion or addition of one or several bases in specified base sequences and usable for detection of Aspergillus westerdijkiae. Also provided are a method for detecting Aspergillus ochraceus and Aspergillus westerdijkiae at the respective species levels comprising amplifying a part of a nucleic acid having a base sequence of at least one β-tubulin gene, and confirming the presence or absence of the amplified products.

Description

The present invention relates to a method for detecting Aspergillus ochraceus and Aspergillus westerdijkiae .

A mold secondary metabolite that is toxic to animals and humans is called a fungal toxin. In addition, when mold grows on foods and feeds to produce toxins, and when the foods and feeds are consumed, the toxins enter the body and cause damage, the toxins are called mycotoxins.
Ochratoxin A is a kind of mycotoxin. It is known that when ochratoxin A enters the living body of animals or humans, it exhibits strong toxicity to the liver and kidney. Therefore, elucidation of the actual state of contamination by ochratoxin A in agricultural products is one of the important issues in food hygiene.

Examples of fungi that produce ochratoxin A and have been reported as causative bacteria in food and beverage accidents include many species belonging to the genus Aspergillus . For example, fungi are detected at a rate of 30 to 50% from raw coffee beans. And it is known that the fungi to be detected include fungal species that produce ochratoxin A. Among these, Aspergillus ochraceus and Aspergillus westaziciae are known as bacterial species belonging to the genus Aspergillus that are detected from raw coffee beans and reported as a causative agent of food and beverage accidents caused by ochratoxin A.
Therefore, from the viewpoint of food hygiene, the rapid and accurate detection of Aspergillus ochraceus and Aspergillus westagekiae is extremely important.

The detection method of Aspergillus ochraceus and Aspergillus westaziciae and the discrimination method from other species are mainly morphological species classification using culture. Since this method requires culturing until morphological characteristics can be confirmed, it requires a long period of at least 14 days. In addition, since morphological identification requires extremely high expertise, it is impossible to deny the risk that identification results differ depending on the judge. In addition, there are cases where damaged cells due to heating or drugs lose their morphogenic ability, and these cells do not form a characteristic shape even after long-term culture, so the accuracy of detection and identification results There was a problem.
As described above, morphological identification methods that require a long period of time for detection of Aspergillus ochraceus and Aspergillus westaziciae, and that have a problem in the accuracy of discrimination results from other species include hygiene management of food and drink, raw materials It is difficult to say that it is always satisfactory from the viewpoints of ensuring freshness and restrictions on distribution. Therefore, it has been demanded to establish a detection method that solves the problems of the conventional quickness and accuracy.

  In response to such a demand, a method for detecting Aspergillus ochraceus and Aspergillus westagechiae quickly and accurately by using a genetic engineering technique has been proposed. For example, Non-Patent Documents 1 to 5 describe a method for detecting Aspergillus ochraceus by amplifying a specific site in the internal transcription spacer region in the genomic DNA of Aspergillus ochraceus. Non-patent documents 1 and 6 describe a method for detecting Aspergillus westaziciae by amplifying a specific site of the β-tubulin gene or the internal transcription spacer region in the genomic DNA of Aspergillus westaziciae. .

Jessica Gil-Serna et al., International Journal of Food Microbiology (2009), vol. 136, p. 83-87 Daniele Sartori et al., Research in Microbiology (2006), vol. 157, p. 350-354 Jessica Gil-Serna et al., International Journal of Food Microbiology (2009), vol. 131, p. 162-167 Belen Patinoa et al., International Journal of Food Microbiology (2005), vol. 104, p. 207-214 Holger Schmidt et al., System. Appl. Microbiol. (2003), vol. 26, p. 138-146 Luis Gustavo Morello et al., International Journal of Food Microbiology (2007), vol. 119, p. 270-276

The inventions described in Non-Patent Documents 1 to 6 are methods for detecting Aspergillus ochraceus and Aspergillus westagechiae by distinguishing Aspergillus ochraceus and Aspergillus westazikiae from other bacterial species belonging to the genus Aspergillus. However, Aspergillus melleus , Aspergillus affinis ( Aspergillus affinis ), etc. Aspergillus ochraceus and Aspergillus westazikiae are distinguished from closely related species, Aspergillus ochraceus and Aspergillus westazie The techniques described in Non-Patent Documents 1 to 6 have not yet been satisfactory.

  Furthermore, fungi belonging to the genus Aspergillus, including Aspergillus ochraceus and Aspergillus westaziciae, differ in the ability to produce ochratoxin A depending on the species. That is, the fungi belonging to the genus Aspergillus vary greatly in toxicity depending on the bacterial species. Therefore, it is necessary to quickly and accurately detect Aspergillus ochraceus and Aspergillus westagechiae at the species level in the food and beverage industry and the like.

  An object of the present invention is to provide a method for quickly and accurately detecting Aspergillus ochraceus and Aspergillus westagechiae, which are problematic in the food and beverage industry, at the species level. In addition, the present invention is a method for detecting Aspergillus ochraceus and Aspergillus westagechiae, which detects Aspergillus ochraceus and Aspergillus westagechiae in a taxonomic manner, distinguishing them from closely related species of Aspergillus ochraceus and Aspergillus westagechiae. The issue is to provide Another object of the present invention is to provide a method for detecting Aspergillus ochraceus and Aspergillus westagechiae that can detect Aspergillus ochraceus and Aspergillus westagechiae with high accuracy without producing false positive results. Furthermore, this invention makes it a subject to provide the oligonucleotide which can be applied to these methods, oligonucleotide pair, and a detection kit.

  As described above, no method has been reported that distinguishes Aspergillus ochraceus and Aspergillus westagekiae from related species of Aspergillus ochraceus and Aspergillus westazikiae, and detects them at the species level of Aspergillus ochraceus and Aspergillus westagechiae. This is because the gene databases of Aspergillus ochraceus and Aspergillus westaziciae are currently fragile. Furthermore, since the gene regions conserved at the species level of Aspergillus ochraceus and Aspergillus westaziciae have not been analyzed correctly, respectively, it is possible to detect Aspergillus ochraceus and Aspergillus westaziciae quickly and accurately at the species level. This may be due to the difficulty in designing highly sensitive oligonucleotides.

  In view of such problems, the present inventors have conducted intensive studies in order to search for new DNA regions capable of detecting Aspergillus ochraceus and Aspergillus westagechiae each quickly and accurately at the species level. Specifically, the present inventors conducted extensive studies using a molecular phylogenetic technique based on the base sequence of the β-tubulin gene of Aspergillus ochraceus and Aspergillus westagechiae. As a result, the β-tubulin genes of Aspergillus ochraceus and Aspergillus westaziciae each have a specific base sequence that can be clearly distinguished from those of other fungi (hereinafter referred to as “variable sites”). I found out). Furthermore, it has been found that by targeting these variable sites, each of Aspergillus ochraceus and Aspergillus westaziciae can be detected quickly and accurately at the species level. Furthermore, it has been found that by targeting these variable sites, Aspergillus ochraceus and Aspergillus westagechiae can be detected separately from the bacterial species that are closely related to Aspergillus ochraceus and Aspergillus westaziciae. The present invention has been completed based on these findings.

The present invention provides at least one oligonucleotide pair selected from the group consisting of the following oligonucleotide pair consisting of oligonucleotides (a) and (b) and the following oligonucleotide pair consisting of oligonucleotides (c) and (d): The present invention relates to a detection method for Aspergillus ochraceus and Aspergillus westagechiae, which detects Aspergillus ochraceus and Aspergillus westagechiae at the species level, respectively.
(A) an oligonucleotide represented by the nucleotide sequence set forth in SEQ ID NO: 1, or one or several bases deleted, substituted, inserted or added in the nucleotide sequence set forth in SEQ ID NO: 1 and Aspergillus ocraceus Oligonucleotides that can be used to detect
(B) an oligonucleotide represented by the nucleotide sequence set forth in SEQ ID NO: 2, or one or several bases deleted, substituted, inserted or added in the nucleotide sequence set forth in SEQ ID NO: 2 and Aspergillus ocraceus Oligonucleotides that can be used to detect
(C) an oligonucleotide represented by the nucleotide sequence set forth in SEQ ID NO: 3, or one or several bases deleted, substituted, inserted or added in the nucleotide sequence set forth in SEQ ID NO: 3, and Aspergillus westaziciae Oligonucleotides that can be used to detect
(D) an oligonucleotide represented by the nucleotide sequence set forth in SEQ ID NO: 4, or one or several bases deleted, substituted, inserted or added in the nucleotide sequence set forth in SEQ ID NO: 4 and Aspergillus westaziciae Oligonucleotides that can be used to detect

The present invention also provides an oligonucleotide selected from the group consisting of the oligonucleotides (a) to (d), an oligonucleotide pair consisting of the oligonucleotides (a) and (b), or the oligonucleotides (c) and ( to the oligonucleotide pair consisting of d).
The present invention also relates to a detection kit for Aspergillus ochraceus and Aspergillus westagechiae comprising the oligonucleotide or oligonucleotide pair.

  The detection method of the present invention can quickly and accurately detect each of the above-mentioned Aspergillus ochraceus and Aspergillus westagechiae, which are one type of bacteria that cause contamination of food and drink, at the species level. In addition, the detection method of the present invention can detect Aspergillus ochraceus and Aspergillus westagechiae by distinguishing it from bacterial species regarded as closely related to Aspergillus ochraceus and Aspergillus westagechiae. In addition, the detection method of the present invention can detect Aspergillus ochraceus and Aspergillus westagechiae with high accuracy without producing a false positive result. Furthermore, the oligonucleotide, oligonucleotide pair and detection kit of the present invention can be suitably applied to these methods.

It is a figure which shows the molecular phylogenetic tree of Aspergillus fungi created based on the base sequence of the β-tubulin gene of Aspergillus fungi. FIG. 2 is an electrophoretogram of a polymerase chain reaction (hereinafter also simply referred to as “PCR”) product amplified using the oligonucleotides (a) and (b) in Example 1. FIG. 3 is an electrophoretogram of PCR products amplified using the oligonucleotides (a) and (b) in Example 1. FIG. 3 is an electrophoretogram of PCR products amplified using the oligonucleotides (a) and (b) in Example 1. FIG. 3 is an electrophoretogram of PCR products amplified using the oligonucleotides (a) and (b) in Example 1. FIG. 3 is an electrophoretogram of PCR products amplified using the oligonucleotides (c) and (d) in Example 2. FIG. 3 is an electrophoretogram of PCR products amplified using the oligonucleotides (c) and (d) in Example 2. FIG. 3 is an electrophoretogram of PCR products amplified using the oligonucleotides (c) and (d) in Example 2. FIG. 3 is an electrophoretogram of PCR products amplified using the oligonucleotides (c) and (d) in Example 2.

  The detection method of the present invention comprises a specific partial nucleotide sequence of the β-tubulin gene of Aspergillus ocraceus and Aspergillus westagechiae, that is, a specific nucleotide sequence site for each of Aspergillus ochraceus and Aspergillus westagechiae (variable). The detection of Aspergillus ochraceus and Aspergillus westaechiae using oligonucleotide pairs that can hybridize under stringent conditions at the site), and the method of detecting each of Aspergillus ochraceus and Aspergillus westagechiae quickly and accurately at the species level. is there. Here, the “variable site” is a site where base mutations tend to accumulate in the base sequence of the β-tubulin gene, and the base sequence of this site is greatly different from other bacterial species.

In the present invention, “Aspergillus ochraceus” is one of incomplete fungi classified into the genus Aspergillus. The optimal temperature for growth of Aspergillus ochraceus is 25 to 30 ° C., and when grown on the medium, a light yellow colony is formed. In addition, the heat resistance of ascospores formed by Aspergillus ochraceus is low.
In the present invention, “Aspergillus westaziciae” is one of incomplete fungi classified into the genus Aspergillus. The optimum temperature for growth of Aspergillus westaziciae is 25 to 30 ° C., and when grown on a medium, a light yellow colony is formed. In addition, the heat resistance of ascospores formed by Aspergillus westaziciae is low.
In addition, Aspergillus ochraceus and Aspergillus westaziciae are known as harmful bacteria to foods and drinks such as beans, particularly raw coffee beans.

  In the present specification, “β-tubulin” is a protein constituting a microtubule. The “β-tubulin gene” is a gene encoding β-tubulin.

The term “species” as used herein refers to a group of bacterial species classified based on a molecular phylogenetic tree using the molecular phylogenetic method for the base sequence of the β-tubulin gene of Aspergillus ochraceus and Aspergillus westaziciae. means.
There is no restriction | limiting in particular as the preparation method of the said molecular phylogenetic tree, It can create by a normal method. For example, using neighbor-joining method, maximum parsimony, maximum likelihood estimation, Bayesian method, unweighted pair group method with Arithmetic mean can do. In the present invention, it is preferable to create a molecular phylogenetic tree using the neighborhood joining method.

  In this specification, “stringent conditions” include, for example, Molecular Cloning-A LABORATORY MANUAL THIRD EDITION [Joseph Sambrook, David W., et al. Russell., Cold Spring Harbor Laboratory Press], for example, 6 × SSC (composition of 1 × SSC: 0.15 M sodium chloride, 0.015 M sodium citrate, pH 7.0), 0.5% Examples include conditions in which a solution containing SDS, 5 × Denhart and 100 mg / mL herring sperm DNA is incubated with a probe at 65 ° C. for 8 to 16 hours and hybridized.

The detection method of the present invention is characterized by using an oligonucleotide pair represented by a nucleic acid corresponding to each variable site in the base sequence of the β-tubulin gene of Aspergillus ochraceus and Aspergillus westagechiae.
The present inventors determined the base sequences of the β-tubulin genes of Aspergillus ochraceus and Aspergillus westagechiae, respectively, and analyzed the genetic distance between the species and the homology of the base sequences. That is, the base sequence of each β-tubulin gene of Aspergillus ochraceus and Aspergillus westagechiae was determined by sequencing, and the matching base region was examined by alignment analysis. As a result, in the base sequence of the β-tubulin gene, a variable site having high conservability within the same species but having low base sequence conservation between different species and having a unique base sequence depending on the species was found. In this variable site, Aspergillus ochraceus and Aspergillus westaziciae have species-specific base sequences. Therefore, this region is useful as a genetic index for detecting Aspergillus ochraceus and Aspergillus westagechiae at the species level quickly and accurately.

The detection method of the present invention comprises at least one oligonucleotide selected from the group consisting of an oligonucleotide pair consisting of the following oligonucleotides (a) and (b) and an oligonucleotide pair consisting of the following oligonucleotides (c) and (d): Use nucleotide pairs.

(A) an oligonucleotide represented by the nucleotide sequence set forth in SEQ ID NO: 1, or one or several bases deleted, substituted, inserted or added in the nucleotide sequence set forth in SEQ ID NO: 1 and Aspergillus ocraceus Oligonucleotides that can be used to detect
(B) an oligonucleotide represented by the nucleotide sequence set forth in SEQ ID NO: 2, or one or several bases deleted, substituted, inserted or added in the nucleotide sequence set forth in SEQ ID NO: 2 and Aspergillus ocraceus Oligonucleotides that can be used to detect
(C) an oligonucleotide represented by the nucleotide sequence set forth in SEQ ID NO: 3, or one or several bases deleted, substituted, inserted or added in the nucleotide sequence set forth in SEQ ID NO: 3, and Aspergillus westaziciae Oligonucleotides that can be used to detect
(D) an oligonucleotide represented by the nucleotide sequence set forth in SEQ ID NO: 4, or one or several bases deleted, substituted, inserted or added in the nucleotide sequence set forth in SEQ ID NO: 4 and Aspergillus westaziciae Oligonucleotides that can be used to detect

By detecting and identifying Aspergillus ochraceus at the species level using the oligonucleotide pair consisting of the oligonucleotides (a) and (b), specific detection of Aspergillus ochraceus becomes possible. In addition, by using the oligonucleotide pair consisting of the oligonucleotides (a) and (b), it is possible to detect Aspergillus ochraceus, distinguishing it from the bacterial species regarded as closely related to Aspergillus ochraceus. Furthermore, by using the oligonucleotide pair consisting of the oligonucleotides (a) and (b), it is possible to detect Aspergillus ochraceus without producing a false positive result.
Further, by detecting and identifying Aspergillus westagechiae at the species level using the oligonucleotide pair consisting of the oligonucleotides (c) and (d), specific detection of Aspergillus westagechiae can be performed. In addition, by using the oligonucleotide pair consisting of the oligonucleotides (c) and (d), it is possible to detect Aspergillus westagechiae by distinguishing it from the bacterial species considered to be closely related to Aspergillus westagechiae. Furthermore, by using the oligonucleotide pair consisting of the oligonucleotides (c) and (d), it is possible to detect Aspergillus westaziciae without producing a false positive result.

The variable sites in the base sequence of the Aspergillus ochraceus β-tubulin gene will be described based on the base sequence set forth in SEQ ID NO: 5. The base sequence described in SEQ ID NO: 5 represents a partial base sequence of the β-tubulin gene of Aspergillus ochraceus CBS 547.65 strain.
The oligonucleotide (a) (also referred to as “Aoch_F2” in the present specification) and the oligonucleotide (b) (also referred to as “Aoch_R1” in the present specification) are each of the nucleotide sequence set forth in SEQ ID NO: 5. It is an oligonucleotide that can hybridize under stringent conditions to the region from position 41 to position 62 and the region from position 347 to position 366. The present inventors have found that these regions are variable regions with low conserved base sequences between species, and that the base sequences of these regions are the base sequences inherent in Aspergillus ochraceus.
Therefore, Aspergillus ocraceus can be detected quickly and accurately at the species level using the oligonucleotides (a) and (b). Specifically, it is possible to use as primers specific to Aspergillus ochraceus if it is designed so that 5 or more bases at the 3 ′ end of the primer in the direction of DNA extension by polymerase hybridize to this region. Detection by the PCR method using these primers becomes possible. In addition, since the probe designed to hybridize to this region for 10 bases or more specifically hybridizes with the base sequence of the β-tubulin gene of Aspergillus ochraceus, the presence or absence of hybridization is confirmed by confirming the presence or absence of hybridization. Ocraceus can be detected.

In the present invention, the base sequence of the Aspergillus ochraceus β-tubulin gene is preferably the following base sequence (e) or (f). Furthermore, it is preferable to confirm the presence of the nucleic acid (preferably the variable site) represented by the following base sequence (e) or (f) using the oligonucleotides (a) and (b).
(E) The base sequence of the β-tubulin gene described in SEQ ID NO: 5 or its complementary sequence.
(F) 1 or several (preferably 1 to 25, more preferably 1 to 20, more preferably 1 to 15, particularly preferably 1 to 10, most preferably 1) in the nucleotide sequence set forth in SEQ ID NO: 5 Is a base sequence having 1 to 5 bases deleted, substituted, inserted, or added and can be used for detection of Aspergillus ocraceus, 70% or more (preferably 80%) with respect to the base sequence described in SEQ ID NO: 5 % Or more, more preferably 85% or more, still more preferably 90% or more, still more preferably 95% or more, particularly preferably 97% or more) and a nucleotide sequence that can be used for detection of Aspergillus ocraceus, or These complementary sequences.

The variable sites in the base sequence of the β-tubulin gene of Aspergillus westaziciae will be described based on the base sequence set forth in SEQ ID NO: 6. The base sequence described in SEQ ID NO: 6 shows the partial base sequence of the β-tubulin gene of Aspergillus westaziciae CBS112803 strain.
The oligonucleotide (c) (also referred to as “Awes_F1” in the present specification) and the oligonucleotide (d) (also referred to as “Awes_R2” in the present specification) are each of the nucleotide sequence set forth in SEQ ID NO: 6. It is an oligonucleotide that can hybridize under stringent conditions to the region from position 23 to position 42 and the region from position 334 to position 354. The present inventors have found that these regions are variable regions with low conserved base sequences between species, and that the base sequences of these regions are base sequences inherent in Aspergillus westagechiae.
Therefore, using the oligonucleotides (c) and (d), Aspergillus westagechiae can be detected quickly and accurately at the species level. Specifically, if this region is designed so that 5 bases or more of the 3 ′ end of the primer, which is the direction of DNA extension by polymerase, hybridize, it can be used as a primer specific to Aspergillus westagechiae. Detection by the PCR method using these primers becomes possible. In addition, the probe designed to hybridize in this region with 10 or more bases specifically hybridizes with the base sequence of the β-tubulin gene of Aspergillus westaziciae. It becomes possible to detect Westa Dichiae.

In the present invention, the base sequence of the β-tubulin gene of Aspergillus westaziciae is preferably the following base sequence (g) or (h). Furthermore, it is preferable to confirm the presence of the nucleic acid (preferably the variable site) represented by the following base sequence (g) or (h) using the oligonucleotides (c) and (d).
(G) The base sequence of the β-tubulin gene described in SEQ ID NO: 6 or its complementary sequence.
(H) 1 or several (preferably 1 to 25, more preferably 1 to 20, more preferably 1 to 15, particularly preferably 1 to 10, most preferably in the base sequence shown in SEQ ID NO: 6 Is 1 to 5 bases deleted, substituted, inserted or added, and can be used for detection of Aspergillus westagechiae, 70% or more (preferably 80% to the base sequence described in SEQ ID NO: 6) % Or more, more preferably 85% or more, still more preferably 90% or more, still more preferably 95% or more, particularly preferably 97% or more) and a nucleotide sequence that can be used for the detection of Aspergillus westagechiae These complementary sequences.

The oligonucleotides (a) and (b) used in the detection method of the present invention are preferably oligonucleotides represented by the nucleotide sequence set forth in SEQ ID NO: 1 or 2. Moreover, if the oligonucleotides (a) and (b) used in the detection method of the present invention can be used for detection at the species level of Aspergillus ochraceus, 70% or more of the nucleotide sequence described in SEQ ID NO: 1 or 2 It may be an oligonucleotide represented by a base sequence having homology or its complementary sequence, preferably having a homology of 80% or more, more preferably 85% or more, and homology Is more preferably 90% or more, and particularly preferably homology is 95% or more. In addition, in the oligonucleotides (a) and (b) that can be used in the present invention, one or several, preferably 1 to 5, more preferably 1 to 4 nucleotide sequences of SEQ ID NO: 1 or 2 are used. , More preferably 1 to 3, even more preferably 1 or 2, particularly preferably 1 base deletion, substitution or insertion and can be used for detection at the species level of Aspergillus ochraceus Oligonucleotides are also included. An appropriate base sequence may be added to the base sequence described in SEQ ID NO: 1 or 2.
In addition, the oligonucleotides (c) and (d) used in the detection method of the present invention are preferably oligonucleotides represented by the nucleotide sequence set forth in SEQ ID NO: 3 or 4. Moreover, if the oligonucleotides (c) and (d) used in the detection method of the present invention can be used for detection at the species level of Aspergillus westagechiae, 70% or more of the nucleotide sequence described in SEQ ID NO: 3 or 4 It may be an oligonucleotide represented by a base sequence having homology or its complementary sequence, preferably having a homology of 80% or more, more preferably 85% or more, and homology Is more preferably 90% or more, and particularly preferably homology is 95% or more. In addition, in the oligonucleotides (c) and (d) that can be used in the present invention, one or several, preferably 1 to 5, more preferably 1 to 4 in the base sequence described in SEQ ID NO: 3 or 4 are used. , More preferably 1 to 3, more preferably 1 or 2, particularly preferably 1 base deletion, substitution or insertion, and can be used for detection at the species level of Aspergillus westagechiae Oligonucleotides are also included. An appropriate base sequence may be added to the base sequence described in SEQ ID NO: 3 or 4.
In the present invention, the homology of the base sequence is calculated by the Lipman-Pearson method (Science, 1985, 227, p. 1435) or the like. Specifically, using the homology analysis (Search homology) program of genetic information processing software Genetyx-Win (software development), the parameter Unit size to compare (ktup) is set to 2 and the calculation is performed. Can do.

  The binding mode of the oligonucleotide may be not only a phosphodiester bond existing in a natural nucleic acid but also a phosphoramidate bond, a phosphorothioate bond, or the like.

  The oligonucleotide can be prepared by a usual synthesis method such as chemical synthesis using, for example, an automatic DNA synthesizer. It is also possible to cut out directly from Aspergillus ochraceus or Aspergillus westaziciae using restriction enzymes or the like, or to clone and isolate and purify the gene, and then cut out using restriction enzymes or the like. It is preferable to prepare by chemical synthesis because it is easy to operate and can obtain a certain quality of oligonucleotide in a large amount and at low cost.

  The presence of the nucleic acid represented by the partial base sequence of the β-tubulin gene of Aspergillus ocraceus or Aspergillus westagechiae using the at least one oligonucleotide pair, and each of Aspergillus ochraceus and Aspergillus westaziciae at the species level The detection method is not particularly limited, and can be performed by a commonly used genetic engineering technique such as a sequencing method, a hybridization method, a PCR method, a real-time PCR method, or a loop mediated isothermal amplification (LAMP) method.

  The oligonucleotide for detection of the present invention can be used as a nucleic acid probe and / or a nucleic acid primer.

The nucleic acid probe can be prepared by labeling the oligonucleotide with a label. The label is not particularly limited, and usual labels such as radioactive substances, enzymes, fluorescent substances, luminescent substances, antigens, haptens, enzyme substrates, insoluble carriers and the like can be used. The labeling method may be end labeling, labeling in the middle of the sequence, or labeling on a sugar, phosphate group, or base moiety. As a means for detecting such a label, for example, when the nucleic acid probe is labeled with a radioisotope, it is labeled with a chemiluminescent substance such as autoradiography, and when it is labeled with a fluorescent substance, such as a fluorescence microscope. In some cases, analysis using a photosensitive film, digital analysis using a CCD camera, and the like can be given. The oligonucleotide labeled in this way is hybridized with the nucleic acid extracted from the test object by a conventional method under stringent conditions, and then the label of the hybridized detection oligonucleotide is measured. Aspergillus ochraceus and Aspergillus westaziciae can be detected at the species level. As a method for measuring the label of the nucleic acid probe hybridized with the nucleic acid, a usual method (FISH method, dot blot method, Southern blot method, Northern blot method, etc.) can be used.
The oligonucleotide can also be used as a capture probe by binding to a solid support. In this case, a sandwich assay can be performed with a combination of a capture probe and a labeled nucleic acid probe, or a target nucleic acid can be captured using the label as an indication.

In the detection method of the present invention, in order to detect Aspergillus ochraceus at the species level, it is preferable to perform hybridization using the oligonucleotide pair consisting of the oligonucleotides (a) and (b) as a nucleic acid probe.
In the detection method of the present invention, it is preferable to perform hybridization using the oligonucleotide pair consisting of the oligonucleotides (c) and (d) as a nucleic acid probe in order to detect Aspergillus westagechiae at the species level.

In order to detect Aspergillus ochraceus in a specimen at the species level, the oligonucleotide pair consisting of the oligonucleotides (a) and (b) is labeled to form a nucleic acid probe, and the obtained nucleic acid probe is hybridized with DNA or RNA. What is necessary is just to detect the label | marker of the probe which made it soy and hybridize by a suitable detection method. In addition, in order to detect Aspergillus westaziciae in a specimen at the species level, the oligonucleotide pair consisting of the oligonucleotides (c) and (d) is labeled to form a nucleic acid probe, and the obtained nucleic acid probe is used as DNA or RNA And the label of the hybridized probe may be detected by an appropriate detection method.
The nucleic acid probe specifically hybridizes with a variable site in the base sequence of the β-tubulin gene of Aspergillus ochraceus or Aspergillus westagechiae. Therefore, each of Aspergillus ocraceus and Aspergillus westagechiae in the specimen can be detected quickly and accurately at the species level.
As a method for measuring the label of the nucleic acid probe hybridized with DNA or RNA, a usual method (FISH method, dot blot method, Southern blot method, Northern blot method, etc.) can be used.

In the detection method of the present invention, in order to detect Aspergillus ochraceus and Aspergillus westagechiae, at least one β- selected from the group consisting of Aspergillus ochraceus and Aspergillus westagechiae using the at least one oligonucleotide pair. It is preferable to amplify a part of the nucleic acid represented by the base sequence of the tubulin gene and confirm the presence or absence of the amplified product. The method for amplifying a DNA fragment is not particularly limited. The PCR method, real-time PCR method, LCR (Ligase Chain Reaction) method, SDA (Strand Displacement Amplification) method, NASBA (Nucleic Acid Sequence-based Amplification) method, RCA (Rolling-) Ordinary methods such as circle amplification method and LAMP method can be used. In the present invention, the PCR method is preferably used.
In the present invention, the case of detecting each of Aspergillus ochraceus and Aspergillus westagechiae by carrying out an amplification reaction by PCR will be described in detail. However, the present invention is not limited to these.

In the present invention, the oligonucleotides (a) and (b) (preferably, the oligonucleotide represented by the nucleotide sequence set forth in SEQ ID NO: 1 and the oligonucleotide represented by the nucleotide sequence set forth in SEQ ID NO: 2) are used. One of the nucleic acids represented by the base sequence of the β-tubulin gene of Aspergillus ochraceus (preferably one of the base sequences (e) and (f)) by performing PCR using the oligonucleotide pair as a nucleic acid primer. It is preferable to amplify the portion, confirm the presence or absence of the amplification product, and detect Aspergillus ochraceus at the species level. Here, the “Aspergillus ochraceus” in the present invention has the β-tubulin gene base sequence shown in SEQ ID NO: 5 regardless of the taxonomic classification and the presence or absence of the ability to produce ochratoxin A, Homology with the nucleotide sequence set forth in SEQ ID NO: 5 is 70% or more, preferably 80% or more, more preferably 85% or more, more preferably 90% or more, still more preferably 95% or more, and particularly preferably 97% or more. Or 1 or several, preferably 1 to 25, more preferably 1 to 20, more preferably 1 to 15 and particularly preferably 1 to 10 in the nucleotide sequence of SEQ ID NO: 5. And most preferably 1 to 5 base sequences having a deleted, substituted, inserted or added base sequence as a β-tubulin gene.
The oligonucleotides (a) and (b) can amplify the nucleic acid represented by the base sequence (e) or (f) or a part thereof by PCR, and detect Aspergillus ochraceus quickly and accurately at the species level. Can function as a nucleic acid primer for Therefore, the oligonucleotide pair consisting of the oligonucleotides (a) and (b) can be used as an Aspergillus ochraceus detection oligonucleotide pair.

In the present invention, it comprises the oligonucleotides (c) and (d) (preferably, the oligonucleotide represented by the nucleotide sequence set forth in SEQ ID NO: 3 and the oligonucleotide represented by the nucleotide sequence set forth in SEQ ID NO: 4). One of the nucleic acids represented by the base sequence of the β-tubulin gene of Aspergillus westadichiae (preferably one of the base sequences (g) and (h)) by performing PCR using the oligonucleotide pair as a nucleic acid primer. It is preferable to amplify the portion, confirm the presence or absence of the amplified product, and detect Aspergillus westagechiae at the species level. Here, “Aspergillus westaziciae” in the present invention includes the one having the base sequence of the β-tubulin gene described in SEQ ID NO: 6, regardless of the taxonomic classification and the ability to produce ochratoxin A, The homology with the base sequence described in SEQ ID NO: 6 is 70% or more, preferably 80% or more, more preferably 85% or more, more preferably 90% or more, still more preferably 95% or more, particularly preferably 97% or more. Or 1 or several, preferably 1 to 25, more preferably 1 to 20, more preferably 1 to 15 and particularly preferably 1 to 10 in the nucleotide sequence of SEQ ID NO: 6. And most preferably 1 to 5 base sequences in which the base sequence has been deleted, substituted, inserted or added as a β-tubulin gene. The
The oligonucleotides (c) and (d) can amplify the nucleic acid represented by the base sequence (g) or (h) or a part thereof by PCR, and rapidly and accurately detect Aspergillus westagechiae at the species level. Can function as a nucleic acid primer for Therefore, the oligonucleotide pair consisting of the oligonucleotides (c) and (d) can be used as an oligonucleotide pair for detecting Aspergillus westagechiae.

The PCR conditions are not particularly limited as long as the target DNA fragment can be amplified to a detectable level.
For example, when PCR is performed using the oligonucleotide pair consisting of the oligonucleotides (a) and (b) as a nucleic acid primer, a preferable PCR condition is a heat denaturation reaction in which a double-stranded DNA is made into a single strand at 95 ° C. It is performed at 98 ° C. or less for 5 seconds or more and 60 seconds or less. An annealing reaction for hybridizing the primer pair to single-stranded DNA is 50 ° C. or higher (preferably 52 ° C. or higher, more preferably 53 ° C. or higher, more preferably 55 ° C. or higher) 65 ° C. or lower (preferably 63 ° C. or lower, More preferably, it is 60 ° C. or less, more preferably 59 ° C. or less) for 5 seconds or more (preferably 10 seconds or more) and 120 seconds or less (preferably 60 seconds or less). Further, an extension reaction for allowing DNA polymerase to act is performed at about 72 ° C. for 10 seconds to 60 seconds. And what made these heat denaturation reaction, annealing reaction, and extension reaction 1 cycle is performed 30 cycles or more and 35 cycles or less.
When PCR is performed using the oligonucleotide pair consisting of the oligonucleotides (c) and (d) as a nucleic acid primer, a preferable PCR condition is a heat denaturation reaction in which a double-stranded DNA is made into a single strand at 95 ° C. It is performed at 98 ° C. or less for 5 seconds or more and 60 seconds or less. An annealing reaction for hybridizing the primer pair to single-stranded DNA is 50 ° C. or higher (preferably 52 ° C. or higher, more preferably 53 ° C. or higher, more preferably 55 ° C. or higher) 65 ° C. or lower (preferably 63 ° C. or lower, More preferably, it is 60 ° C. or less, more preferably 59 ° C. or less) for 5 seconds or more (preferably 10 seconds or more) and 120 seconds or less (preferably 60 seconds or less). Further, an extension reaction for allowing DNA polymerase to act is performed at about 72 ° C. for 10 seconds to 60 seconds. And what made these heat denaturation reaction, annealing reaction, and extension reaction 1 cycle is performed 30 cycles or more and 35 cycles or less.

In the present invention, confirmation of gene fragments can be performed by a usual method. Examples include a method for confirming the presence or absence of a band corresponding to the size of the amplified gene by electrophoresis on the amplified product, a method for measuring the amount of amplified product over time, and a method for decoding the base sequence of the amplified product. The present invention is not limited to these methods. In the present invention, a method of performing electrophoresis after gene amplification treatment and confirming the presence or absence of a band corresponding to the size of the amplified gene is preferable. In the present invention, the amplification product can be detected by a usual method. For example, a method of incorporating nucleotides labeled with a radioactive substance during an amplification reaction, a method of using a primer labeled with a fluorescent substance, or the like, and fluorescence intensity is increased by binding to DNA such as ethidium bromide between two amplified DNA strands. Although the method etc. which put in the fluorescent substance which becomes strong are mentioned, this invention is not limited to these methods. In the present invention, a method in which a fluorescent substance whose fluorescence intensity is increased by binding to DNA between the amplified DNA double strands is preferable.
When the sample contains a fungus to be detected, PCR is performed using the oligonucleotide pair of the present invention as a primer set, and the obtained PCR product is electrophoresed to confirm a DNA fragment with a specific size. Specifically, when Aspergillus ocraceus is included in the specimen, electrophoresis of a PCR product obtained using the oligonucleotide pair consisting of the oligonucleotides (a) and (b) as a nucleic acid primer yields about 330 bp. DNA fragments are confirmed at the size of When the sample contains Aspergillus westaziciae, the PCR product obtained using the oligonucleotide pair consisting of the oligonucleotides (c) and (d) as a nucleic acid primer is subjected to electrophoresis at a size of about 340 bp. A DNA fragment is identified. By performing such an operation, it is possible to confirm whether or not the detection target fungus is contained in the specimen. In addition, the generation of a DNA fragment having a size of about 330 bp or about 340 bp means that Aspergillus ochraceus or Aspergillus westagechiae is present in the specimen. Therefore, by confirming the generation of such a DNA fragment, it is possible to detect Aspergillus ochraceus and Aspergillus westagechiae without determining the base sequence of the DNA fragment.

In the present invention, a partial base sequence of a β-tubulin gene in a sample is determined using the at least one oligonucleotide pair, and the partial base sequence is any one of the base sequences (e) to (h). By confirming whether or not it is contained, the presence of the nucleic acid represented by any one of the base sequences (e) to (h) can be confirmed, and each of Aspergillus ochraceus and Aspergillus westagechiae can be detected at the species level. it can. That is, the partial base sequence of the β-tubulin gene in the sample is analyzed and determined using the at least one oligonucleotide pair, and the determined base sequence and any of the base sequences (e) to (h) are determined. In comparison, the presence of the nucleic acid represented by any one of the base sequences (e) to (h) is confirmed based on the match or difference, and each species level of Aspergillus ochraceus and Aspergillus westaziciae can be detected. it can. For example, PCR is performed using the oligonucleotide pair consisting of the oligonucleotides (a) and (b) as a primer, and a part of the nucleic acid represented by any one of the base sequences (e) and (f) is amplified. The presence or absence of an amplification product is confirmed, and the base sequence of the obtained amplification product is compared with one of the base sequences (e) and (f), and is represented by one of the base sequences (e) and (f). Confirm the presence of the nucleic acid. If the base sequence of the amplification product is contained as part of the nucleic acid represented by the base sequences (e) and (f), the microorganism contained in the specimen can be identified as Aspergillus ochraceus. Further, PCR is performed using the oligonucleotide pair consisting of the oligonucleotides (c) and (d) as a primer to amplify a part of the nucleic acid represented by any of the base sequences (g) and (h) The presence or absence of the amplification product is confirmed, and the base sequence of the amplification product obtained is compared with any of the base sequences (g) and (h), and is represented by either the base sequence (g) or (h). Confirm the presence of the nucleic acid. If the base sequence of the amplification product is contained as part of the nucleic acid represented by the base sequences (g) and (h), the microorganism contained in the sample can be identified as Aspergillus westagechiae. In this way, each of Aspergillus ochraceus and Aspergillus westaziciae can also be detected quickly and accurately at the species level.
The method for analyzing and determining the base sequence is not particularly limited, and a commonly used technique of RNA or DNA sequencing can be used.
Specific examples include electrophoresis such as Maxam-Gilbert method and Sanger method, mass spectrometry, hybridization method and the like. Examples of the Sanger method include a method of labeling a primer or a terminator by a radiation labeling method, a fluorescence labeling method, or the like.

  In the present invention, the primer used in the amplification reaction can be chemically synthesized based on the designed sequence or purchased from a reagent manufacturer. Specifically, it can be synthesized using an oligonucleotide synthesizer or the like. Moreover, what was refine | purified using the adsorption column, the high performance liquid chromatography, and the electrophoresis method after a synthesis | combination can also be used. In addition, an oligonucleotide having a base sequence in which one to several bases are substituted, deleted, inserted or added can be synthesized using a conventional method.

The specimen used in the present invention can be appropriately determined, and the food and drink itself, the raw material of the food and drink, the isolated microbial cell, the cultured microbial cell, the food and drink, or the packaging container of the raw material can be used.
As a method for preparing genomic DNA from a specimen, DNA having a sufficient degree of purification and quantity can be obtained even in an unpurified state for detecting Aspergillus ochraceus and Aspergillus westagechiae. In addition, the sample may be subjected to pretreatment such as separation, extraction, concentration, and purification. For example, it can be used after treatment with phenol and chloroform, or purification using a commercially available extraction kit to increase the purity of the nucleic acid. In addition, DNA obtained by reverse transcription of RNA in a specimen can also be used.

  The Aspergillus ochraceus and Aspergillus westagechiae detection kit of the present invention contains the oligonucleotide and / or oligonucleotide pair of the present invention as a nucleic acid probe or a nucleic acid primer. In addition to the nucleic acid probe and the nucleic acid primer, the kit of the present invention includes a label detection substance, a buffer solution, a nucleic acid synthase (DNA polymerase, RNA polymerase, reverse transcriptase, etc.), an enzyme substrate (dNTP, rNTP, etc.) depending on the purpose. ) And other substances commonly used for detecting fungi. The kit of the present invention may contain a positive control (positive control) for confirming that detection is possible with the oligonucleotide or oligonucleotide pair of the present invention. Examples of the positive control include genomic DNA containing a region amplified by the method of the present invention.

  In relation to the above-described embodiments, the present invention further discloses the following detection method for Aspergillus ochraceus and Aspergillus westagechiae, oligonucleotide or oligonucleotide pair, Aspergillus ochraceus and Aspergillus westagechiae detection kit, use and method.

<1> Using at least one oligonucleotide pair selected from the group consisting of an oligonucleotide pair consisting of the following oligonucleotides (a) and (b) and an oligonucleotide pair consisting of the following oligonucleotides (c) and (d) And detecting Aspergillus ochraceus and Aspergillus westagechiae at the species level, respectively.
(A) 1 or several, preferably 1 to 5, more preferably 1 to 4, more preferably 1 or more of the oligonucleotide represented by the nucleotide sequence of SEQ ID NO: 1 or the nucleotide sequence of SEQ ID NO: 1. Are oligonucleotides having 1 to 3, more preferably 1 or 2, particularly preferably 1 bases deleted, substituted, inserted or added, and can be used for detection of Aspergillus ochraceus, or SEQ ID NO: Detection of Aspergillus ochraceus having a homology with the nucleotide sequence of 1 of 70% or more, preferably 80% or more, more preferably 85% or more, still more preferably 90% or more, particularly preferably 95% or more Oligonucleotides that can be used for
(B) One or several, preferably 1 to 5, more preferably 1 to 4, more preferably 1 or more oligonucleotides represented by the nucleotide sequence of SEQ ID NO: 2 or the nucleotide sequence of SEQ ID NO: 2 Are oligonucleotides having 1 to 3, more preferably 1 or 2, particularly preferably 1 bases deleted, substituted, inserted or added, and can be used for detection of Aspergillus ochraceus, or SEQ ID NO: Detection of Aspergillus ochraceus having a homology with the base sequence described in 2 of 70% or more, preferably 80% or more, more preferably 85% or more, still more preferably 90% or more, particularly preferably 95% or more Oligonucleotides that can be used for
(C) One or several, preferably 1 to 5, more preferably 1 to 4, more preferably 1 to 5 oligonucleotides represented by the nucleotide sequence set forth in SEQ ID NO: 3 or the nucleotide sequence set forth in SEQ ID NO: 3. Are oligonucleotides having 1 to 3, more preferably 1 or 2, particularly preferably 1, bases deleted, substituted, inserted or added, and can be used for detection of Aspergillus westagechiae, or SEQ ID NO: Detection of Aspergillus westaziciae, wherein the homology with the base sequence described in 3 is 70% or higher, preferably 80% or higher, more preferably 85% or higher, still more preferably 90% or higher, particularly preferably 95% or higher. Oligonucleotides that can be used for
(D) One or several, preferably 1 to 5, more preferably 1 to 4, more preferably 1 to 5 oligonucleotides represented by the nucleotide sequence of SEQ ID NO: 4 or the nucleotide sequence of SEQ ID NO: 4 Are oligonucleotides having 1 to 3, more preferably 1 or 2, particularly preferably 1, bases deleted, substituted, inserted or added, and can be used for detection of Aspergillus westagechiae, or SEQ ID NO: Detection of Aspergillus westaziciae having a homology with the base sequence described in No. 4 of 70% or more, preferably 80% or more, more preferably 85% or more, still more preferably 90% or more, particularly preferably 95% or more. Oligonucleotides that can be used for

<2> The detection method according to <2>, wherein Aspergillus ocraceus is detected at a species level using an oligonucleotide pair consisting of the oligonucleotides (a) and (b).
<3> The detection method according to <2>, wherein Aspergillus westagechiae is detected at the species level using an oligonucleotide pair consisting of the oligonucleotides (c) and (d).
<4> For detection, a part of the nucleic acid represented by the base sequence of the β-tubulin gene of Aspergillus ochraceus and Aspergillus westagechiae is amplified using the at least one oligonucleotide pair, and the amplification product The detection method according to any one of <1> to <3> above, wherein the presence or absence of the Aspergillus ochraceus and Aspergillus westagechiae is detected at the species level.
<5> The detection method according to <4>, wherein a part of the nucleic acid represented by the base sequence of the β-tubulin gene is amplified by a polymerase chain reaction method.
<6> The detection method according to any one of <1> to <5>, wherein the base sequence of the β-tubulin gene of Aspergillus ochraceus is the following base sequence (e) or (f).
(E) The base sequence of the β-tubulin gene described in SEQ ID NO: 5 or its complementary sequence.
(F) 1 or several, preferably 1 to 25, more preferably 1 to 20, more preferably 1 to 15, particularly preferably 1 to 10, most preferably 1 in the base sequence shown in SEQ ID NO: 5. Is a base sequence in which 1 to 5 bases have been deleted, substituted, inserted or added and can be used for detection of Aspergillus ocraceus, 70% or more, preferably 80% of the base sequence set forth in SEQ ID NO: 5 % Or more, more preferably 85% or more, further preferably 90% or more, still more preferably 95% or more, particularly preferably 97% or more, and a nucleotide sequence that can be used for detection of Aspergillus ocraceus, or These complementary sequences.
<7> The detection method according to any one of <1> to <5>, wherein the base sequence of the β-tubulin gene of Aspergillus westagechiae is the following base sequence (g) or (h).
(G) The base sequence of the β-tubulin gene described in SEQ ID NO: 6 or its complementary sequence.
(H) 1 or several, preferably 1 to 25, more preferably 1 to 20, more preferably 1 to 15, particularly preferably 1 to 10, most preferably 1 in the base sequence shown in SEQ ID NO: 6 Is a base sequence in which 1 to 5 bases have been deleted, substituted, inserted or added and can be used for detection of Aspergillus westagechiae, 70% or more with respect to the base sequence set forth in SEQ ID NO: 6, preferably 80 % Or more, more preferably 85% or more, more preferably 90% or more, still more preferably 95% or more, particularly preferably 97% or more, and a nucleotide sequence that can be used for detection of Aspergillus westagechiae, or These complementary sequences.

<8> From an oligonucleotide selected from the group consisting of the oligonucleotides (a) to (d), an oligonucleotide pair consisting of the oligonucleotides (a) and (b), or the oligonucleotides (c) and (d) An oligonucleotide pair.

<9> The oligonucleotide or oligonucleotide pair according to <8>, wherein the oligonucleotide is a nucleic acid probe or a nucleic acid primer.
<10> A nucleic acid probe for detecting Aspergillus ochraceus, wherein the oligonucleotides (a) and (b) can hybridize to the nucleic acid represented by the base sequence (e) or (f), respectively. The oligonucleotide or oligonucleotide pair according to <8> or <9>, which can function as a nucleic acid primer.
<11> The oligonucleotides (a) and (b) can amplify a part of the nucleic acid represented by the base sequence (e) or (f) by a polymerase chain reaction method, and detect Aspergillus ochraceus The oligonucleotide or the oligonucleotide pair according to <10>, which can function as a nucleic acid primer.
<12> The oligonucleotides (c) and (d) can be hybridized to the nucleic acid represented by the base sequence (g) or (h), respectively, and a nucleic acid probe for detecting Aspergillus westagechiae The oligonucleotide or oligonucleotide pair according to <8> or <9>, which can function as a nucleic acid primer.
<13> The oligonucleotides (c) and (d) can amplify a part of the nucleic acid represented by the base sequence (g) or (h) by a polymerase chain reaction method, and detect Aspergillus westaziciae The oligonucleotide or oligonucleotide pair according to <12>, which can function as a nucleic acid primer.
<14> An detection kit for Aspergillus ochraceus and Aspergillus westagechiae comprising the oligonucleotide or oligonucleotide pair according to any one of <8> to <13>.

<15> Use of the oligonucleotides (a) and (b) as a nucleic acid primer for detecting Aspergillus ochraceus.
<16> Use of the oligonucleotides (a) and (b) for the production of a nucleic acid primer for detecting Aspergillus ochraceus.
<17> A method of using the oligonucleotides (a) and (b) as nucleic acid primers for detecting Aspergillus ochraceus.
<18> Use of the oligonucleotides (c) and (d) as a nucleic acid primer for detecting Aspergillus westaziciae.
<19> Use of the oligonucleotides (c) and (d) for the production of a nucleic acid primer for detecting Aspergillus westaziciae.
<20> A method of using the oligonucleotides (c) and (d) as nucleic acid primers for detecting Aspergillus westaziciae.

  EXAMPLES Hereinafter, although this invention is demonstrated further in detail based on an Example, this invention is not limited to this.

Test Example 1 Preparation of molecular phylogenetic tree of fungi belonging to the genus Aspergillus By the following method, various fungi belonging to the genus Aspergillus (Aspergillus ochraceus, Aspergillus westaziciae, Aspergillus mereus, Aspergillus affinis, Aspergillus cretensis ( Aspergillus cretensis ) Neo Petro My Seth Murikatasu (Neopetromyces muricatus), Aspergillus Aurikomasu (Aspergillus auricomus), Aspergillus Neoburigeri (Aspergillus neobridgeri), Aspergillus Roseo globulomer suspension (Aspergillus roseoglobulosus), Aspergillus Sarufureusu (Aspergillus sulphureus), Aspergillus Burigeri (Aspergillus bridgeri ), Aspergillus persii ( Aspergillus persii ), Aspergillus sclerothiolam ( Aspergillus sc lerotiorum), Aspergillus Elegance (Aspergillus elegans), Aspergillus Suteini (Aspergillus steynii), Aspergillus shoe de Elegance (Aspergillus pseudoelegans), Aspergillus Inshurikora (Aspergillus insulicola), Aspergillus okra Theo peta I folder Mi (Aspergillus ochraceopetaliformi), and The base sequence of the β-tubulin gene of Aspergillus robustus was determined.

DNA was extracted from microbial cells cultured in potato dextrose agar (PDA) slant medium (medium, manufactured by Difco) at 25 ° C. for 3 days in the dark using Gen Toru-kun (trade name, manufactured by Takara Bio Inc.).
Using the extracted DNA as a template, Bt2a primer (5′-GGTAACCAAATCGGTGCTGCTTTC-3 ′: SEQ ID NO: 7) and Bt2b primer (5′-ACCCTCAGTGTAGTGACCCTTGGC-3 ′: SEQ ID NO: 8) were used (Glass and Donaldson, Appl., Environ , Microbiol., 61, p. 1323-1330, 1995), and PuRe Taq ™ Ready-To-Go PCR Beads (GE Health Care UK LTD). The amplification conditions were 35 cycles at a denaturation temperature of 95 ° C., an annealing temperature of 59 ° C., and an extension temperature of 72 ° C. The PCR product was purified using Auto Seg ™ G-50 (Amersham Pharmacia Biotech). Furthermore, the PCR product was purchased from BigDye terminator Ver. 3.1 (trade name, manufactured by Applied Biosystems) was used for labeling, and electrophoresis was performed using ABI PRISM 3130 Genetic Analyzer (Applied Biosystems). For determination of the base sequence from the fluorescence signal during electrophoresis, the software 'ATGC Ver. 4 ′ (Genetyx) was used.

  Base sequence of β-tubulin gene of each fungus determined by sequencing analysis, and obtained from DNA data bank of Japan (DDBJ: http://www.ddbj.nig.ac.jp/Welcome-j.html) Based on the base sequence information of the β-tubulin gene of each fungus, phylogenetic analysis was performed using Clustal X (http://www.clustal.org/). Based on the phylogenetic analysis results, a molecular phylogenetic tree was created using the software NJ-plot. The created molecular phylogenetic tree is shown in FIG.

  As shown in FIG. 1, it can be seen that Aspergillus meleus is a highly related bacterial species to Aspergillus ochraceus. Aspergillus meleus and Aspergillus affinis are found to be very closely related to Aspergillus westaziciae. Furthermore, it can be seen that Aspergillus ochraceus and Aspergillus westazikiae are closely related to each other.

Test Example 2 Analysis of partial base sequence of β-tubulin gene specific to Aspergillus ochraceus and Aspergillus westaziciae Base sequences of various Aspergillus fungi determined by the above method and known β-tubulin genes of various fungi Based on the information, alignment analysis was performed using Clustal W (http://clustalw.ddbj.nig.ac.jp/top-j.html). In the base sequence region of the β-tubulin gene of Aspergillus ochraceus and Aspergillus westaziciae, the 3 ′ end is a sequence specific to Aspergillus ochraceus and Aspergillus westaziciae, respectively, and the GC content is approximately 30 to 80%. Thus, a partial region satisfying the four conditions that the possibility of self-annealing is low and the Tm value is approximately 55 to 65 ° C. was examined. As a result, a base sequence specific to Aspergillus ochraceus (Aoch_F2: aggatcatcttcgataccttag (SEQ ID NO: 1), Aoch_R1: ctttgtacggggcgtttcga (SEQ ID NO: 2)) was determined. In addition, base sequences specific to Aspergillus westagechiae (Awes_F1: tggcagtctgggctatctga (SEQ ID NO: 3), Awes_R2: gggcgtttcggataggtgaag (SEQ ID NO: 4)) were determined.

Example 1
(1) Primer design Based on the nucleotide sequence specific to Aspergillus ocraceus determined in Test Example 2, a primer (Aoch_F2 primer) and sequence consisting of an oligonucleotide represented by the nucleotide sequence described in SEQ ID NO: 1 A primer (Aoch_R1 primer) composed of an oligonucleotide represented by the base sequence described in No. 2 was designed, and synthesis was requested from Hokkaido System Science Co., Ltd. (desalted refined product, 0.2 μmol scale) and purchased.

(2) Preparation of specimens The strains described in Tables 1 to 4 were used as fungi used for evaluating the effectiveness of the designed primer, that is, Aspergillus ochraceus and its related bacteria, and living environment bacteria. Regarding these strains, strains stored by the Center for Fungal Medicine, Chiba University and managed by IFM numbers were obtained and used.
Each strain was cultured at 25 ° C. for 3 days using a potato dextrose medium (trade name: Pearl Core Potato Dextrose Agar, manufactured by Eiken Chemical Co., Ltd.).

  Each cultured cell was collected using a platinum loop, and a genomic DNA solution was extracted and purified using a genomic DNA preparation kit (Gentori-kun (trade name) manufactured by Takara Bio Inc.). The concentration of the DNA solution was adjusted to 2 ng / μL.

(3) Detection of Aspergillus ocraceus 2 μL of the genomic DNA solution prepared above as a DNA template, 2 μL each of the Aoch_F2 primer and Aoch_R1 primer adjusted to 2 pmol / μL, 19 μL of sterile distilled water, and Pure Taq ^™ Ready-To -Go PCR Beads (trade name, manufactured by GE Healthcare) were put into a tube to prepare a 25 μL PCR solution.
The PCR solution was subjected to gene amplification using an automatic gene amplification apparatus thermal cycler DICE (trade name, Takara Bio Inc.). PCR conditions were 95 ° C for 10 minutes, (i) 95 ° C for 1 minute heat denaturation reaction, (ii) 59 ° C for 1 minute annealing reaction, and (iii) 72 ° C for 1 minute extension reaction. 30 cycles were performed, and the reaction solution was held at 72 ° C. for 10 minutes.

  After PCR, 2.5 μL was taken from the PCR solution, mixed well with the loading buffer, and subjected to electrophoresis (100 V, 30 minutes) using a 2% agarose gel. After completion of electrophoresis, the agarose gel was immersed in ethidium bromide solution to stain the DNA, and the presence or absence of the amplified DNA fragment was confirmed. The results are shown in FIGS. The numbers in the figure indicate that the samples were reacted using DNA extracted from the samples with corresponding sample numbers in the table. 2 shows an electrophoretic diagram for the fungal sample shown in Table 1, FIG. 3 shows an electrophoretic diagram for the fungal sample shown in Table 2, and FIG. 4 shows the fungal sample shown in Table 3. An electropherogram is shown, and FIG. 5 shows an electrophorogram for the fungal samples shown in Table 4. As a molecular weight marker, EZ Load 100bp molecular Ruler (trade name, manufactured by BIO RAD) was used.

  As a result, in the sample containing Aspergillus ochraceus genomic DNA, a gene fragment was confirmed at a size of about 330 bp. On the other hand, gene fragments were not confirmed in samples containing Aspergillus genus fungi other than Aspergillus ochraceus and genomic DNA of living environment bacteria. Therefore, according to the present invention, Aspergillus ochraceus can be specifically detected at the species level.

Example 2
(1) Primer design Primer (Awes_F1 primer) and sequence consisting of the oligonucleotide represented by the base sequence described in SEQ ID NO: 3 based on the base sequence site specific to Aspergillus westazicia determined in Test Example 2 A primer (Awes_R2 primer) composed of an oligonucleotide represented by the base sequence described in No. 4 was designed, and synthesis was requested from Hokkaido System Science (Demineralized product, 0.2 μmol scale) and purchased.

(2) Preparation of specimens The strains described in Tables 5 to 8 were used as fungi used for evaluating the effectiveness of the designed primer, that is, Aspergillus westaziciae and its related bacteria, and living environment bacteria. Regarding these strains, strains stored by the Center for Fungal Medicine, Chiba University and managed by IFM numbers were obtained and used.
Each strain was cultured at 25 ° C. for 3 days using a potato dextrose medium (trade name: Pearl Core Potato Dextrose Agar, manufactured by Eiken Chemical Co., Ltd.).

  Each cultured cell was collected using a platinum loop, and a genomic DNA solution was extracted and purified using a genomic DNA preparation kit (Gentori-kun (trade name) manufactured by Takara Bio Inc.). The concentration of the DNA solution was adjusted to 2 ng / μL.

(3) Detection of Aspergillus westaziciae 2 μL of the genomic DNA solution prepared above as a DNA template, 2 μL of Awes_F1 and Awes_R2 primers adjusted to 2 pmol / μL, 19 μL of sterilized distilled water, and Pure Taq ^™ Ready-To -Go PCR Beads (trade name, manufactured by GE Healthcare) were put into a tube to prepare a 25 μL PCR solution.
The PCR solution was subjected to gene amplification using an automatic gene amplification apparatus thermal cycler DICE (trade name, Takara Bio Inc.). PCR conditions were 95 ° C for 10 minutes, (i) 95 ° C for 1 minute heat denaturation reaction, (ii) 59 ° C for 1 minute annealing reaction, and (iii) 72 ° C for 1 minute extension reaction. 30 cycles were performed, and the reaction solution was held at 72 ° C. for 10 minutes.

  After PCR, 2.5 μL was taken from the PCR solution, mixed well with the loading buffer, and subjected to electrophoresis (100 V, 30 minutes) using a 2% agarose gel. After completion of electrophoresis, the agarose gel was immersed in ethidium bromide solution to stain the DNA, and the presence or absence of the amplified DNA fragment was confirmed. The results are shown in FIGS. The numbers in the figure indicate that the samples were reacted using DNA extracted from the samples with corresponding sample numbers in the table. 6 shows an electrophoretic diagram for the fungal sample shown in Table 5, FIG. 7 shows an electrophoretic diagram for the fungal sample shown in Table 6, and FIG. 8 shows the fungal sample shown in Table 7. FIG. 9 shows an electropherogram for the fungal samples shown in Table 8. As a molecular weight marker, EZ Load 100bp molecular Ruler (trade name, manufactured by BIO RAD) was used.

  As a result, a gene fragment having a size of about 340 bp was confirmed in the sample containing genomic DNA of Aspergillus westaziciae. On the other hand, no gene fragment was confirmed in samples containing genomic DNA of Aspergillus spp. Other than Aspergillus westagechiae and living environment bacteria. Therefore, according to the present invention, Aspergillus westaziciae can be specifically detected at the species level.

From the above results, by using the oligonucleotide of the present invention, it is possible to confirm the presence of partial base sequences of β-tubulin genes of Aspergillus ochraceus and Aspergillus westagechiae, respectively, Aspergillus ochraceus and Aspergillus westagechiae Can be detected specifically at the species level. Therefore, according to the method of the present invention, it is possible to detect Aspergillus ochraceus and Aspergillus westagechiae each more quickly and more accurately at the species level as compared with the conventional method.
In addition, by using the oligonucleotide of the present invention, it is possible to detect each of Aspergillus ochraceus and Aspergillus westadichiae in a taxonomic manner, distinguishing them from closely related species of Aspergillus ochraceus and Aspergillus westadchiae It is.
Furthermore, by using the oligonucleotide of the present invention, it is possible to detect Aspergillus ochraceus and Aspergillus westagechiae, respectively, without causing false positive results.

Claims (14)

Aspergillus, using at least one oligonucleotide pair selected from the group consisting of the following oligonucleotide pair consisting of oligonucleotides (a) and (b) and the following oligonucleotide pair consisting of oligonucleotides (c) and (d): A method for detecting Aspergillus ochraceus and Aspergillus westadikiae, which detects each of Operaceus ( Aspergillus ochraceus ) and Aspergillus westerdijae at the species level.
(A) an oligonucleotide represented by the nucleotide sequence set forth in SEQ ID NO: 1, or one or several bases deleted, substituted, inserted or added in the nucleotide sequence set forth in SEQ ID NO: 1 and Aspergillus ocraceus Oligonucleotides that can be used to detect
(B) an oligonucleotide represented by the nucleotide sequence set forth in SEQ ID NO: 2, or one or several bases deleted, substituted, inserted or added in the nucleotide sequence set forth in SEQ ID NO: 2 and Aspergillus ocraceus Oligonucleotides that can be used to detect
(C) an oligonucleotide represented by the nucleotide sequence set forth in SEQ ID NO: 3, or one or several bases deleted, substituted, inserted or added in the nucleotide sequence set forth in SEQ ID NO: 3, and Aspergillus westaziciae Oligonucleotides that can be used to detect
(D) an oligonucleotide represented by the nucleotide sequence set forth in SEQ ID NO: 4, or one or several bases deleted, substituted, inserted or added in the nucleotide sequence set forth in SEQ ID NO: 4 and Aspergillus westaziciae Oligonucleotides that can be used to detect   The detection method according to claim 1, wherein Aspergillus ochraceus is detected at a species level using an oligonucleotide pair consisting of the oligonucleotides (a) and (b).   The detection method according to claim 1, wherein Aspergillus westagechiae is detected at the species level using an oligonucleotide pair consisting of the oligonucleotides (c) and (d).   A part of the nucleic acid represented by the base sequence of at least one β-tubulin gene selected from the group consisting of Aspergillus ochraceus and Aspergillus westagechiae using the at least one oligonucleotide pair for detection The detection method according to claim 1, wherein the presence or absence of an amplification product is confirmed, and each of Aspergillus ochraceus and Aspergillus westagechiae is detected at the species level.   The detection method according to claim 4, wherein a part of the nucleic acid represented by the base sequence of the β-tubulin gene is amplified by a polymerase chain reaction method. The detection method according to any one of claims 1 to 5, wherein the base sequence of the Aspergillus ochraceus β-tubulin gene is the following base sequence (e) or (f).
(E) The base sequence of the β-tubulin gene described in SEQ ID NO: 5 or its complementary sequence.
(F) A nucleotide sequence in which one or several bases are deleted, substituted, inserted or added in the nucleotide sequence set forth in SEQ ID NO: 5 and can be used for detection of Aspergillus ochraceus, or a complementary sequence thereof. The detection method according to any one of claims 1 to 5, wherein the base sequence of the β-tubulin gene of Aspergillus westagechiae is the following base sequence (g) or (h).
(G) The base sequence of the β-tubulin gene described in SEQ ID NO: 6 or its complementary sequence.
(H) A nucleotide sequence in which one or several bases are deleted, substituted, inserted or added in the nucleotide sequence set forth in SEQ ID NO: 6 and can be used for detection of Aspergillus westagechiae, or a complementary sequence thereof. Oligonucleotide selected from the group consisting of the following oligonucleotides (a) to (d), an oligonucleotide pair consisting of the following oligonucleotides (a) and (b), or an oligonucleotide consisting of the following oligonucleotides (c) and (d) versus.
(A) an oligonucleotide represented by the nucleotide sequence set forth in SEQ ID NO: 1, or one or several bases deleted, substituted, inserted or added in the nucleotide sequence set forth in SEQ ID NO: 1 and Aspergillus ocraceus An oligonucleotide that can be used to detect ( Aspergillus ochraceus ).
(B) an oligonucleotide represented by the nucleotide sequence set forth in SEQ ID NO: 2, or one or several bases deleted, substituted, inserted or added in the nucleotide sequence set forth in SEQ ID NO: 2 and Aspergillus ocraceus An oligonucleotide that can be used to detect ( Aspergillus ochraceus ).
(C) an oligonucleotide represented by the nucleotide sequence set forth in SEQ ID NO: 3, or one or several bases deleted, substituted, inserted or added in the nucleotide sequence set forth in SEQ ID NO: 3, and Aspergillus westaziciae An oligonucleotide that can be used to detect ( Aspergillus westerdijkiae ).
(D) an oligonucleotide represented by the nucleotide sequence set forth in SEQ ID NO: 4, or one or several bases deleted, substituted, inserted or added in the nucleotide sequence set forth in SEQ ID NO: 4 and Aspergillus westaziciae An oligonucleotide that can be used to detect ( Aspergillus westerdijkiae ).   9. The oligonucleotide or oligonucleotide pair of claim 8, wherein the oligonucleotide is a nucleic acid probe or a nucleic acid primer. The oligonucleotides (a) and (b) can be hybridized to the nucleic acid represented by the following base sequence (e) or (f), respectively, and used as a nucleic acid probe or nucleic acid primer for detecting Aspergillus ochraceus 10. Oligonucleotide or oligonucleotide pair according to claim 8 or 9, which is functional.
(E) The base sequence of the β-tubulin gene described in SEQ ID NO: 5 or its complementary sequence.
(F) A nucleotide sequence in which one or several bases are deleted, substituted, inserted or added in the nucleotide sequence set forth in SEQ ID NO: 5 and can be used for detection of Aspergillus ochraceus, or a complementary sequence thereof.   The oligonucleotides (a) and (b) can amplify a part of the nucleic acid represented by the base sequence (e) or (f) by the polymerase chain reaction method, and are used as nucleic acid primers for detecting Aspergillus ochraceus The oligonucleotide or pair of oligonucleotides of claim 10, which is functional. The oligonucleotides (c) and (d) can each be hybridized to a nucleic acid represented by the following base sequence (g) or (h), and used as a nucleic acid probe or nucleic acid primer for detecting Aspergillus westagechiae 10. Oligonucleotide or oligonucleotide pair according to claim 8 or 9, which is functional.
(G) The base sequence of the β-tubulin gene described in SEQ ID NO: 6 or its complementary sequence.
(H) A nucleotide sequence in which one or several bases are deleted, substituted, inserted or added in the nucleotide sequence set forth in SEQ ID NO: 6 and can be used for detection of Aspergillus westagechiae, or a complementary sequence thereof.   The oligonucleotides (c) and (d) can amplify a part of the nucleic acid represented by the base sequence (g) or (h) by the polymerase chain reaction method, and serve as nucleic acid primers for detecting Aspergillus westagechiae 13. The oligonucleotide or oligonucleotide pair of claim 12, which is functional. An Aspergillus ochraceus ( Aspergillus ochraceus ) and Aspergillus westerdijkiae detection kit comprising the oligonucleotide or oligonucleotide pair according to any one of claims 8 to 13.