JP6200134B2 - Detection method of ketium, indicam and clade - Google Patents

Description

The present invention relates to a method for detecting Chaetomium Indy cam clade (Chaetomium indicum clade).

Fungi Chaetomium (Chaetomium) genus, which is a kind of filamentous fungi, are known to be involved in widely distributed in nature, food and beverage spoilage. Of these, one of the genus Ketomium, Chaetomium funicola, is known as the causative agent of food and beverage accidents. In addition, it is clear that Chaetomium indicum is included in the same clade (Ketmium indicum clade) as Ketomium funicola.
In food and beverage production, sterilization is performed not only on the contents (food and beverage itself) and its raw materials, but also on production devices, production environments, packaging containers, and the like. The contents and their raw materials are sterilized by heating, and various sterilization methods such as sterilization by chemicals have been proposed for the production environment, production equipment, packaging containers and the like. The aseptic filling method is one that sterilizes the production environment, production equipment, packaging containers, etc. using peracetic acid, etc., and fills the heat-sterilized contents to ensure commercial sterility of the product. is there.
Here, ketmium funicola is known to have resistance to peracetic acid, which is one of the bactericides used in the aseptic filling method, and in the production of foods and beverages that are sterilized and sterilized using peracetic acid.・ Funicola is positioned as the most important harmful fungus. Therefore, the detection of ketium indicum clades, including ketium funicola and ketium indicum that is molecularly related to ketmium funicola, is extremely important.

The detection method of ketmium, indicam clade, and the identification method from other species are mainly morphological classification using culture. Since this method requires culturing until morphological characteristics can be confirmed, it requires a long period of at least 14 days. In addition, since morphological identification requires extremely high expertise, it is impossible to deny the risk that identification results differ depending on the judge. Furthermore, there are cases where damaged cells lose their morphogenic ability due to heating, chemicals, etc., and these cells do not form a characteristic morphology even after long-term culture, so the accuracy of detection and identification results There was a problem.
In this way, morphological methods that require a long time to detect fungi and have a problem with the accuracy of discrimination results from other species include hygiene management of food and drink, ensuring freshness of raw materials, and distribution From the viewpoint of constraints, it is not always satisfactory. Therefore, it has been demanded to establish a detection method that solves the problems of the conventional quickness and accuracy.

  Patent Document 1 describes a method of detecting a genus Ketomium by amplifying a specific region of an 18S rRNA gene in the genomic DNA of the genus Ketomium containing a ketium indicam clade. However, although the method described in Patent Document 1 can detect fungi belonging to the genus Ketomium at the genus level, it cannot detect only ketium, indicam, and clade among the fungi belonging to the genus Ketomium.

JP 2007-174903 A

Unlike the hot pack filling method, the aseptic filling method for food and drink does not heat the packaging container, so the packaging container is not required to have heat resistance. Therefore, by introducing an aseptic filling method that sterilizes the manufacturing environment, manufacturing equipment, packaging containers, etc. using peracetic acid or hydrogen peroxide, it becomes possible to reduce the thickness of the packaging containers, reduce production costs, Reduction of transportation costs and CO ₂ emission can be realized. Therefore, rapid and accurate detection of ketomium funicola and its related species that are resistant to peracetic acid and are harmful in the aseptic filling method is strongly desired particularly in the food and beverage industry.
Furthermore, the peracetic acid resistance of fungi including Ketomium funicola varies greatly depending on the species, that is, the hazard in the aseptic filling method. Therefore, in order to perform a quick and accurate risk assessment of harmful bacteria in the food and beverage industry, it is important to quickly and accurately detect ketium funicola and related species.

  The present invention quickly and accurately detects ketium indicum clades including ketium funicola, which is considered a harmful fungus in the food and beverage industry, and ketium indicum contained in the same clade as ketmium funicola. Another object of the present invention is to provide a method that can be distinguished from other types of fungi. Another object of the present invention is to provide oligonucleotides, oligonucleotide pairs and detection kits applicable to this method.

  As mentioned above, one of the factors that make it difficult to detect ketium, indicam, and clade is that the PCR method using known primers has low specificity for ketium, indicam, and results in false positives and false negatives. The point that is likely to become. This is because the ketium indicam clade gene database is currently fragile, and the gene region conserved in fungi belonging to the ketium indicam clade has not been accurately analyzed. It was thought that this was because it was difficult to design a highly sensitive primer for detecting fungi belonging to Cam Clade quickly and accurately.

  In view of such a problem, the present inventors have intensively studied to search for a new DNA region that can rapidly and accurately detect fungi belonging to the ketium, indicam, and clade. Specifically, the present inventors have identified an internal transcription spacer (Internal Transcribed Spacer, hereinafter) between 18S rDNA and 28S rDNA of Ketomium funicola and Ketomium indicum contained in the Ketomium indicum clade. In the present specification, an extensive study was performed using a molecular phylogenetic method based on the base sequence of the region (also referred to as “ITS”). As a result, there is a site (hereinafter also referred to as “variable site”) having a specific base sequence that can be clearly distinguished from those of other fungi in the ITS region of Ketmium indicam clade. I found out. We also found that ketium, indicam, and clade can be detected quickly and accurately by targeting these variable sites. The present invention has been completed based on these findings.

The present invention relates to a method for detecting a ketium indicam clade, wherein a ketium indicam clade is detected using an oligonucleotide pair consisting of the following oligonucleotides (a) and (b).
(A) An oligonucleotide represented by the nucleotide sequence set forth in SEQ ID NO: 1, or one or several bases deleted, substituted, inserted or added in the nucleotide sequence set forth in SEQ ID NO: 1, and ketmium indyne Oligonucleotide (b) that can be used for detection of cam clade (b) an oligonucleotide represented by the nucleotide sequence set forth in SEQ ID NO: 2, or one or several bases deleted or substituted in the nucleotide sequence set forth in SEQ ID NO: 2, Oligonucleotides inserted or added and can be used to detect ketium, indicum, and clade

The present invention also relates to an oligonucleotide selected from the group consisting of the oligonucleotides (a) and (b) or an oligonucleotide pair consisting of the oligonucleotides (a) and (b).
The present invention also relates to a ketium indicum clade detection kit comprising the oligonucleotide or the oligonucleotide pair.

  The detection method of the present invention can quickly and accurately detect ketium indicum clade, which is one of the causative bacteria of food and beverage contamination accidents, and distinguish it from fungi of other genera. Moreover, the oligonucleotide, oligonucleotide pair, and detection kit of the present invention can be suitably applied to the above method.

It is a figure which shows the molecular phylogenetic tree of the genus Ketomium produced based on the base sequence of the ITS area | region of the genus Ketomium. It is an electrophoretic diagram of the PCR product amplified using the oligonucleotide of said (a) and (b) in an Example. It is an electrophoretic diagram of the PCR product amplified using the oligonucleotide of said (a) and (b) in an Example. It is an electrophoretic diagram of the PCR product amplified using the oligonucleotide of said (a) and (b) in an Example.

  The present invention relates to a specific partial base sequence of the ITS region existing between 18S rDNA and 28S rDNA of ketmium indicum clade (including ketium funicola and ketodium indicum), that is, ketium present in this region.・ Detection of ketium, indicam clade using a pair of oligonucleotides that can hybridize under stringent conditions to the base sequence part (variable part) specific to indicame clade. This is a method for detecting quickly and accurately at the clade level. Here, the “variable site” is a site where base mutations are likely to accumulate in the base sequence of the ITS region, and the base sequence of this site is greatly different from other bacterial species.

In the present invention, “ketomium funicola” is a kind of basidiomycete, which is a peracetic acid-resistant fungus with many reports of detection from acidic foods, dairy products, and sweet foods. The top hairs are partly bristled or branched.
In the present specification, the “peracetic acid resistant fungus” is a bacterial species that has an accident report of aseptically filled foods or beverages or a bacterial species that can cause an accident of aseptically filled foods and beverages, and 1000 ppm peracetic acid sterilization (40 ° C., 1 minute) refers to fungi that survive the treatment. Specifically, even with peracetic acid sterilization under the above conditions, fungi that cannot secure 6D sterilization (sterilization that reduces the initial bacterial count to 1/1000000), which is sterilization that ensures commercial sterility in the food industry. Point to. The present inventors measured D value (sterilization unit necessary for reducing the initial number of bacteria to 1/10) by sterilizing peracetic acid (40 ° C., 1 minute) with 1000 ppm of NBRC6555 strain. As a result, the D value was 0.2D. That is, ketmium funicola did not reduce the initial bacterial count to 1/1000000 even after 1000 ppm peracetic acid sterilization (40 ° C., 1 minute), and was less than 6D.

In the present invention, “Ketmium indicam” is a kind of basidiomycete, and the top coat of the husk of Ketomium indicam is all branched.
In the molecular phylogenetic tree of fungi belonging to the genus Ketomium created based on the base sequence of the ITS region shown in FIG. 1, the clade containing ketium funicola contains ketium indicam, and these two species are phylogenetic (Asgari B, Zare R., The genus Chaetomium in Iran, a phylogenic study including six new species., Mycologia, 2011, vol. 103 (4), p. 863-). 882).

In the present specification, “clade” is a close relationship based on a molecular phylogenetic tree created using a molecular phylogenetic method for the nucleotide sequence of a ketium fungus DNA (preferably an ITS region). It means the species group of the related genus Ketomium.
There is no restriction | limiting in particular as the preparation method of the said molecular phylogenetic tree, It can create by a normal method. For example, using neighbor-joining method, maximum parsimony, maximum likelihood estimation, Bayesian method, unweighted pair group method with Arithmetic mean can do. In the present invention, it is preferable to create a molecular phylogenetic tree using the neighborhood joining method. In the present invention, it is preferable to create a molecular phylogenetic tree based on the base sequence of the ITS region of the genus Ketomium.

  In this specification, “stringent conditions” include, for example, Molecular Cloning-A LABORATORY MANUAL THIRD EDITION [Joseph Sambrook, David W., et al. Russell., Cold Spring Harbor Laboratory Press], for example, 6 × SSC (composition of 1 × SSC: 0.15 M sodium chloride, 0.015 M sodium citrate, pH 7.0), 0.5% Examples include conditions in which a solution containing SDS, 5 × Denhart and 100 mg / mL herring sperm DNA is incubated with a probe at 65 ° C. for 8 to 16 hours and hybridized.

The detection method of the present invention is characterized by using an oligonucleotide pair represented by a nucleic acid corresponding to a variable site in the base sequence of the ITS region of Ketmium indicam clade.
The inventors determined the partial base sequence of the ITS region of Ketomium indicum clade including Ketomium funicola and Ketomium indicum, and analyzed the genetic distance between the species and the homology of the base sequence . That is, the base sequence of the ITS region was determined by sequencing, and the matching base region was examined by alignment analysis. As a result, in the base sequence of the ITS region, the conserved property was high in the same clade but the conserved property of the base sequence was low between different groups, and a variable site having a unique base sequence was found by the clade. At this variable site, the ketium indicum clade has a unique base sequence. Therefore, this region is useful as a genetic indicator for detecting ketium indicam clade quickly and accurately at the clade level.

The detection method of the present invention uses an oligonucleotide pair comprising the following oligonucleotides (a) and (b).

(A) An oligonucleotide represented by the nucleotide sequence set forth in SEQ ID NO: 1, or one or several bases deleted, substituted, inserted or added in the nucleotide sequence set forth in SEQ ID NO: 1, and ketmium indyne Oligonucleotide (b) that can be used for detection of cam clade (b) an oligonucleotide represented by the nucleotide sequence set forth in SEQ ID NO: 2, or one or several bases deleted or substituted in the nucleotide sequence set forth in SEQ ID NO: 2, Oligonucleotides inserted or added and can be used to detect ketium, indicum, and clade

By detecting and identifying a ketium indicam clade at the clade level using the oligonucleotide pair, it becomes possible to detect a ketium indicam clade.

The variable site in the base sequence of the ITS region of Ketmium indicam clade will be described based on the base sequence described in SEQ ID NO: 3. The base sequence described in SEQ ID NO: 3 shows the partial base sequence of the ITS region present between 18S rDNA and 28S rDNA of the Ketomium funicola NBRC30059 strain.
The oligonucleotide (a) (also referred to herein as Cfu2F) and the oligonucleotide (b) (also referred to herein as Cfu2R) are each at position 166 of the nucleotide sequence set forth in SEQ ID NO: 3. It is an oligonucleotide capable of hybridizing under stringent conditions to the region up to position 185 and the region from position 530 to position 549. The present inventors have found that these regions are variable regions with low conserved base sequences between clades, and that the base sequences of these regions are the base sequences inherent to ketmium, indicum, and clade. .
Therefore, using the oligonucleotides (a) and (b), ketium indicum clade can be detected quickly and accurately at the clade level. Specifically, it can be used as a primer specific for ketium, indicum, and clade if it is designed so that 5 bases or more of the 3 ′ end of the primer, which is the direction of DNA extension by polymerase, hybridize to this region. Yes, detection by PCR using these primers becomes possible. In addition, the probe designed to hybridize to this region for 10 bases or more specifically hybridizes with the partial base sequence of the ITS region of the ketium indicamm clade. It becomes possible to detect a clade.

In the present invention, using the oligonucleotides (a) and (b), the presence of a nucleic acid (preferably the variable site) represented by any of the following base sequences (c) and (d) is confirmed. It is preferable to do.
(C) the nucleotide sequence of the ITS region described in SEQ ID NO: 3 or its complementary sequence (d) 1 or several (preferably 1-25, more preferably 1-20) in the nucleotide sequence described in SEQ ID NO: 3, More preferably 1-15, particularly preferably 1-10, most preferably 1-5) bases are deleted, substituted, inserted or added and can be used for detection of ketium, indicum clade. 70% or more (preferably 80% or more, more preferably 85% or more, more preferably 90% or more, still more preferably 95% or more, particularly preferably 97%) with respect to the base sequence described in SEQ ID NO: 3. The nucleotide sequence having the above homology and usable for the detection of ketium, indicum, clade, or a complementary sequence thereof

The oligonucleotides (a) and (b) used in the detection method of the present invention are preferably oligonucleotides represented by the nucleotide sequence set forth in SEQ ID NO: 1 or 2. In addition, the oligonucleotide used in the detection method of the present invention has 70% or more homology to the base sequence described in SEQ ID NO: 1 or 2 if it can be used for detection at the clade level of ketium, indicam, and clade. It may be an oligonucleotide represented by a base sequence or a complementary sequence thereof, preferably having a homology of 80% or more, more preferably 85% or more, and homology of 90% or more. More preferably, the homology is 95% or more. In addition, the oligonucleotide that can be used in the present invention has one or several, preferably 1 to 5, more preferably 1 to 4, more preferably 1 to 1 nucleotide sequences in SEQ ID NO: 1 or 2. Also included are oligonucleotides that have three, more preferably one or two, particularly preferably one base deletions, substitutions or insertions and can be used for the detection of ketium indicum clade at the clade level. Is done. An appropriate base sequence may be added to the base sequence described in SEQ ID NO: 1 or 2.
The base sequence homology is calculated by the Lipman-Pearson method (Science, 1985, 227, p. 1435) or the like. Specifically, using the homology analysis (Search homology) program of genetic information processing software Genetyx-Win (software development), the parameter Unit size to compare (ktup) is set to 2 and the calculation is performed. Can do.

  The binding mode of the oligonucleotide may be not only a phosphodiester bond existing in a natural nucleic acid but also a phosphoramidate bond, a phosphorothioate bond, or the like.

  The oligonucleotide can be prepared by a usual synthesis method such as chemical synthesis using, for example, an automatic DNA synthesizer. It is also possible to excise directly from a gene of ketmium, indicam, or clade using a restriction enzyme or the like, or to clone and isolate and purify the gene and then excise it using a restriction enzyme or the like. It is preferable to prepare by chemical synthesis because it is easy to operate and can obtain a certain quality of oligonucleotide in a large amount and at low cost.

  There is no particular limitation as a method for confirming the presence of the nucleic acid represented by the partial base sequence of the ITS region of Ketomium indicum clade using the oligonucleotide pair, and detecting Ketomium indicum clade at the clade level, It can be performed by commonly used genetic engineering techniques such as sequencing, hybridization, PCR, real-time PCR, and LAMP.

  The oligonucleotide for detection of the present invention can be used as a nucleic acid probe and / or a nucleic acid primer.

The nucleic acid probe can be prepared by labeling the oligonucleotide with a label. The label is not particularly limited, and usual labels such as radioactive substances, enzymes, fluorescent substances, luminescent substances, antigens, haptens, enzyme substrates, insoluble carriers and the like can be used. The labeling method may be end labeling, labeling in the middle of the sequence, or labeling on a sugar, phosphate group, or base moiety. As a means for detecting such a label, for example, when the nucleic acid probe is labeled with a radioisotope, it is labeled with a chemiluminescent substance such as autoradiography, and when it is labeled with a fluorescent substance, such as a fluorescence microscope. In some cases, analysis using a photosensitive film, digital analysis using a CCD camera, and the like can be given. The oligonucleotide labeled in this way is hybridized with the nucleic acid extracted from the test object by a conventional method under stringent conditions, and then the label of the hybridized detection oligonucleotide is measured. Can detect ketium, indicam, and clade at the clade level. As a method for measuring the label of the nucleic acid probe hybridized with the nucleic acid, a usual method (FISH method, dot blot method, Southern blot method, Northern blot method, etc.) can be used.
The oligonucleotide can also be used as a capture probe by binding to a solid support. In this case, a sandwich assay can be performed with a combination of a capture probe and a labeled nucleic acid probe, or a target nucleic acid can be captured using the label as an indication.

  In the detection method of the present invention, it is preferable to perform hybridization using an oligonucleotide pair consisting of the oligonucleotides (a) and (b) as a nucleic acid probe in order to detect ketium indicum clade.

  In order to detect ketium, indicum, and clade in a specimen, an oligonucleotide pair consisting of the oligonucleotides (a) and (b) is labeled as a nucleic acid probe, and the obtained nucleic acid probe is used as DNA or RNA. And the label of the hybridized probe may be detected by an appropriate detection method. Since the above-mentioned nucleic acid probe specifically hybridizes with a variable site in the base sequence of the ITS region of the ketium indicam clade, the ketium indicam clade in the specimen can be detected quickly and accurately at the clade level. Can do. As a method for measuring the label of the nucleic acid probe hybridized with DNA or RNA, a usual method (FISH method, dot blot method, Southern blot method, Northern blot method, etc.) can be used.

In the detection method of the present invention, in order to detect ketium indicum clade, a part of the nucleic acid represented by the nucleotide sequence of the ITS region of ketomium indicum clade is amplified using the oligonucleotide pair, It is preferable to confirm the presence or absence of an amplification product. The method for amplifying a DNA fragment is not particularly limited, and polymerase chain reaction (PCR) method, real-time PCR method, LCR (Ligase Chain Reaction) method, SDA (Strand Displacement Amplification) method, NASBA (Nucleic Acid Sequence-based Amplification) method Ordinary methods such as RCA (Rolling-circle amplification) method and LAMP (Loop mediated isothermal amplification) method can be used. In the present invention, the PCR method is preferably used.
In the present invention, the case of carrying out an amplification reaction by PCR and detecting ketium, indicam, and clade will be described in detail. However, the present invention is not limited to these.

In the present invention, from the oligonucleotides (a) and (b) (preferably, the oligonucleotide represented by the base sequence described in SEQ ID NO: 1 and the oligonucleotide represented by the base sequence described in SEQ ID NO: 2) PCR is performed using the oligonucleotide pair as a nucleic acid primer, and is represented by a partial base sequence (preferably one of the base sequences of (c) and (d) above) of the ITS region of Ketodium indicum clade It is preferable to amplify a part of the nucleic acid, confirm the presence or absence of the amplification product, and detect at the clade level of ketium, indicam, and clade. Here, the “ketium indicum clade” in the present invention has a partial nucleotide sequence of the ITS region described in SEQ ID NO: 3 as well as a nucleotide sequence described in SEQ ID NO: 3, regardless of taxonomic classification. Or a sequence having a homology of 70% or more (preferably 80% or more, more preferably 85% or more, more preferably 90% or more, further preferably 95% or more, particularly preferably 97% or more) 1 or several (preferably 1 to 25, more preferably 1 to 20, more preferably 1 to 15, particularly preferably 1 to 10, most preferably 1 to 5) in the base sequence described in No. 3. Of the ITS region includes a base sequence in which a base) is deleted, substituted, inserted or added. The base sequence homology is calculated by the Lipman-Pearson method (Science, 1985, 227, p. 1435). Specifically, using the homology analysis (Search homology) program of genetic information processing software Genetyx-Win (software development), the parameter Unit size to compare (ktup) is set to 2 and the calculation is performed. Can do.
The oligonucleotides (a) and (b) can amplify a nucleic acid represented by any one of the base sequences (c) and (d) or a part thereof by PCR, and clade a ketium indicum clade. It can function as a nucleic acid primer for rapid and accurate detection at the level. Therefore, the oligonucleotide pair consisting of the oligonucleotides (a) and (b) can be used as an oligonucleotide pair for detection of ketium, indicum, and clade.

The PCR conditions are not particularly limited as long as the target DNA fragment can be amplified to a detectable level.
For example, when PCR is performed using an oligonucleotide pair consisting of the oligonucleotides of (a) and (b) as a nucleic acid primer, a preferable PCR condition is a heat denaturation reaction in which a double-stranded DNA is made into a single strand. An annealing reaction for hybridizing the primer pair to the single-stranded DNA at 50 ° C. or higher and 98 ° C. or lower and 10 seconds or shorter and 60 seconds or shorter (preferably 52 ° C. or higher, more preferably 54 ° C. or higher) 60 ° C. or lower (preferably For 5 seconds or more (preferably 10 seconds or more) and 120 seconds or less (preferably 60 seconds or less) at 58 ° C. or less, more preferably 56 ° C. or less. This is performed for 60 seconds or less, and the cycle is performed for 30 cycles or more and 35 cycles or less.

In the present invention, confirmation of gene fragments can be performed by a usual method. Examples include a method for confirming the presence or absence of a band corresponding to the size of the amplified gene by electrophoresis on the amplified product, a method for measuring the amount of amplified product over time, and a method for decoding the base sequence of the amplified product. The present invention is not limited to these methods. In the present invention, a method of performing electrophoresis after gene amplification treatment and confirming the presence or absence of a band corresponding to the size of the amplified gene is preferable. In the present invention, the amplification product can be detected by a usual method. For example, a method of incorporating nucleotides labeled with a radioactive substance during an amplification reaction, a method of using a primer labeled with a fluorescent substance, or the like, and fluorescence intensity is increased by binding to DNA such as ethidium bromide between two amplified DNA strands. Although the method etc. which put in the fluorescent substance which becomes strong are mentioned, this invention is not limited to these methods. In the present invention, a method in which a fluorescent substance whose fluorescence intensity is increased by binding to DNA between the amplified DNA double strands is preferable.
When a specimen contains a fungus to be detected, PCR is performed using the oligonucleotide pair of the present invention as a primer set, and when the obtained PCR product is electrophoresed, a DNA fragment of a specific size is confirmed. Specifically, a PCR product obtained using an oligonucleotide pair consisting of the oligonucleotides (a) and (b) as a nucleic acid primer when the sample contains either or both of ketmium, indicam, and clade As a result of electrophoresis, a DNA fragment having a size of about 350 bp is confirmed. By performing such an operation, it can be confirmed whether or not the detection target fungus is contained in the specimen.

In the present invention, the partial nucleotide sequence of the ITS region of the subject is determined using the oligonucleotide pair, and whether or not the partial nucleotide sequence is included in any of the nucleotide sequences (c) and (d). By confirming, the presence of the nucleic acid represented by any of the base sequences (c) and (d) above can be confirmed, and ketmium, indicum, and clade can be detected at the clade level. That is, the detection method of the present invention analyzes and determines the partial base sequence of the ITS region possessed by the subject, compares the determined base sequence with one of the base sequences (c) and (d), and matches the results. Alternatively, based on the difference, the presence of the nucleic acid represented by any one of the base sequences (c) and (d) is confirmed, and the clade level of ketium, indicum, and clade is detected. For example, PCR is performed using an oligonucleotide pair consisting of the oligonucleotides (a) and (b) as a primer to amplify a part of the nucleic acid represented by any one of the base sequences (c) and (d). Then, the presence or absence of the amplification product is confirmed, the base sequence of the amplification product obtained is compared with any of the base sequences (c) and (d), and either of the base sequences (c) and (d) The presence of the nucleic acid represented by If the base sequence of the amplification product is included as part of the nucleic acid represented by any of the base sequences (c) and (d), the microorganism contained in the sample is identified as a ketium, indicum clade. be able to. In this way, the ketium indicum clade can be detected quickly and accurately.
The method for analyzing and determining the base sequence is not particularly limited, and a commonly used technique of RNA or DNA sequencing can be used.
Specific examples include electrophoresis such as Maxam-Gilbert method and Sanger method, mass spectrometry, hybridization method and the like. Examples of the Sanger method include a method of labeling a primer or a terminator by a radiation labeling method, a fluorescence labeling method, or the like.

  In the present invention, the primer used in the amplification reaction can be chemically synthesized based on the designed sequence or purchased from a reagent manufacturer. Specifically, it can be synthesized using an oligonucleotide synthesizer or the like. Moreover, what was refine | purified using the adsorption column, the high performance liquid chromatography, and the electrophoresis method after a synthesis | combination can also be used. In addition, an oligonucleotide having a base sequence in which one to several bases are substituted, deleted, inserted or added can be synthesized using a conventional method.

There is no restriction | limiting in particular as a test substance used in this invention, Food / beverage products itself, the raw material of food / beverage products, an isolated microbial cell, a cultured cell, food / beverage products, or the packaging container of the raw material etc. can be used.
The method for preparing genomic DNA from a sample is not particularly limited as long as DNA having a sufficient purity and quantity can be obtained even in an unpurified state for detecting ketium, indicam, and clade. It can also be used after pretreatment such as extraction, concentration and purification. For example, it can be used after treatment with phenol and chloroform, or purification using a commercially available extraction kit to increase the purity of the nucleic acid. In addition, DNA obtained by reverse transcription of RNA in a subject can also be used.

  The ketmium indicum clade detection kit of the present invention contains the oligonucleotide and / or oligonucleotide pair of the present invention as a nucleic acid probe or a nucleic acid primer. In addition to the nucleic acid probe and the nucleic acid primer, the kit of the present invention includes a label detection substance, a buffer solution, a nucleic acid synthase (DNA polymerase, RNA polymerase, reverse transcriptase, etc.), an enzyme substrate (dNTP, rNTP, etc.) depending on the purpose. ) And other substances commonly used for detecting fungi. The kit of the present invention may contain a positive control (positive control) for confirming that detection is possible with the oligonucleotide or oligonucleotide pair of the present invention. Examples of the positive control include genomic DNA containing a region amplified by the method of the present invention.

  By the method of the present invention, it is possible to rapidly and accurately detect ketmium indicum clades at once. As described above, ketium funicola and ketmium indicam included in the ketium indicam clade are highly homologous in phylogeny. Therefore, it is very useful in the field of phylogenetics to be able to collectively detect fungi belonging to a group that forms a single-system branch group that is molecularly stable.

  Among the ketium indicam clades, ketium funicola is a peracetic acid-resistant fungus that has been frequently reported for detection from acidic foods, dairy products, and sweet foods. Here, “peracetic acid-resistant fungi” are bacterial species that have reported accidents of aseptically filled foods and beverages or bacterial species that can cause accidents in aseptically filled foods and beverages and are sterilized with 1000 ppm peracetic acid (40 ° C., 1 minute) ) Refers to fungi that survive in processing. Specifically, even by peracetic acid sterilization under the above conditions, it is possible to ensure 6D sterilization (sterilization that reduces the initial bacterial count to 1/1000000), which is sterilization that ensures commercial sterility in the food industry in Japan. It refers to fungi that cannot be done. Of the ketmium indicam clades, only ketium funicola has been reported to have been detected as a harmful fungus at the production site of food or beverage. Therefore, for example, when a mold accident occurs in foods and beverages that use peracetic acid sterilization to sterilize the manufacturing environment, the present invention can be used to quickly and accurately detect harmful bacteria, that is, ketium funicola. It becomes possible.

  The present invention further discloses the following detection method, oligonucleotide or oligonucleotide pair, ketium indicum clade detection kit, use, and method for the above-described embodiments.

<1> A method for detecting a ketium indicum clade, wherein a ketium indicum clade is detected using an oligonucleotide pair consisting of the oligonucleotides (a) and (b) below.
(A) One or several oligonucleotides (preferably 1 to 5, more preferably 1 to 4, more preferably 1) in the oligonucleotide represented by the base sequence described in SEQ ID NO: 1 or the base sequence described in SEQ ID NO: 1. Are oligonucleotides that have 1 to 3, more preferably 1 or 2, particularly preferably 1) bases deleted, substituted, inserted or added and can be used for detection of ketium, indicum clade, Alternatively, the homology with the nucleotide sequence of SEQ ID NO: 1 is 70% or more (preferably 80% or more, more preferably 85% or more, further preferably 90% or more, particularly preferably 95% or more) and An oligonucleotide that can be used for detection of indicame clade (b) an oligonucleotide represented by the nucleotide sequence of SEQ ID NO: 2, or 1 or several (preferably 1 to 5, more preferably 1 to 4, more preferably 1 to 3, still more preferably 1 or 2), particularly preferably 1 in the base sequence described in column number 2 ) Nucleotides deleted, substituted, inserted or added and can be used for detection of ketium indicum clade, or a homology with a nucleotide sequence of SEQ ID NO: 2 of 70% or more (preferably Is 80% or more, more preferably 85% or more, still more preferably 90% or more, particularly preferably 95% or more) and can be used for detection of ketmium, indicum clade

<2> The detection method according to <1>, wherein the ketium indicum clade includes ketium funicola and ketmium indicum.
<3> In order to perform detection, a part of the nucleic acid represented by the partial base sequence of the ITS region existing between 18S rDNA and 28S rDNA of Ketodium indicum clade is amplified using the oligonucleotide pair. Then, the detection method according to <1> or <2>, wherein the presence or absence of an amplification product is confirmed, and detection of ketium, indicam, and clade is performed.
<4> A nucleic acid represented by a partial base sequence of the ITS region of Ketmium indicam clade by performing a polymerase chain reaction using an oligonucleotide pair comprising the oligonucleotides of (a) and (b) as a nucleic acid primer The method according to <3>, wherein a part of the product is amplified, the presence or absence of an amplification product is confirmed, and ketium, indicam, and clade are detected.
<5> The method according to any one of <1> to <4>, wherein the partial base sequence of the ITS region of the ketmium indicum clade is any of the following base sequences (c) and (d): Detection method.
(C) one or several (preferably 1 to 25, more preferably 1 to 20) of the partial base sequence of the ITS region described in SEQ ID NO: 3 or its complementary sequence (d) the base sequence described in SEQ ID NO: 3 And more preferably 1-15, particularly preferably 1-10, most preferably 1-5) bases are deleted, substituted, inserted or added and used for detection of ketium, indicum clade. 70% or more (preferably 80% or more, more preferably 85% or more, still more preferably 90% or more, still more preferably 95% or more, particularly preferably 97% to the base sequence described in SEQ ID NO: 3. % Or more) and can be used for the detection of ketium, indicum, or a complementary sequence thereof.

<6> An oligonucleotide pair selected from the group consisting of the oligonucleotides (a) and (b), or an oligonucleotide pair consisting of the oligonucleotides (a) and (b).

<7> The oligonucleotide or oligonucleotide pair according to <6>, wherein the oligonucleotide is a nucleic acid probe or a nucleic acid primer.
<8> The oligonucleotide or the oligonucleotide pair according to <6> or <7>, wherein the ketium indicum clade includes ketium funicola and ketium indicum.
<9> The oligonucleotides (a) and (b) can be hybridized to the nucleic acid represented by any one of the base sequences (c) and (d), respectively. The oligonucleotide or oligonucleotide pair according to any one of <6> to <8>, wherein the oligonucleotide or oligonucleotide pair can function as a nucleic acid probe or nucleic acid primer for detecting.
<10> The oligonucleotides (a) and (b) can amplify a part of the nucleic acid represented by any one of the base sequences (c) and (d) by the polymerase chain reaction method. The oligonucleotide or oligonucleotide pair according to <9>, which can function as a nucleic acid primer for detecting a cam clade.

<11> A ketmium indicum clade detection kit comprising the oligonucleotide or oligonucleotide pair according to any one of <6> to <10>.

<12> Use of the oligonucleotides (a) and (b) as a nucleic acid primer for detecting ketium, indicam, and clade.
<13> Use of the oligonucleotides (a) and (b) above for the production of a nucleic acid primer for detection of ketmium, indicam, and clade.
<14> A method in which the oligonucleotides (a) and (b) are used as nucleic acid primers for detecting ketium, indicum, and clade.

  EXAMPLES Hereinafter, although this invention is demonstrated further in detail based on an Example, this invention is not limited to this.

The method of creating the following fungal molecular phylogenetic tree belonging to Test Example 1 Chaetomium sp fungi various (Chaetomium-Gurobosamu (Chaetomium globosum belonging to Chaetomium spp.), Chaetomium, Kuruentamu (Chaetomium cruentum), Chaetomium Ann Dura Chu ram (Chaetomium Undulatulum ), Chaetomium, Subafin (Chaetomium subaffine), Chaetomium, Rekutangura (Chaetomium rectangulare), Chaetomium, Eratamu (Chaetomium elatum), Chaetomium-interrupter arm (Chaetomium interruptum), Chaetomium, Megarokarupamu (Chaetomium megalocarpum), Chaetomium Grande (Chaetomium grande), Chaetomium, Hisuparikamu (Chaetomium hispanicum), Chaetomium-Funikora, Chaetomium Indy cam, Chaetomium-A Toro Blanc Neum (Chaetomium atrobrunneum), Chaetomium-two Gurikora (Chaetomium nigricolor), Chaetomium, Muroramu (Chaetomium murorum), Chaetomium, Kurisupatamu (Chaetomium crispatum), to determine the nucleotide sequence of the ITS region of Chaetomium-thermophilus (Chaetomium thermophilum), etc.).

A potato dextrose (PDA medium, manufactured by Difco) agar slope medium, stored by The Centraalbureau voor Schimmelcultures and managed by the CBS number, stored by the National Institute of Technology and Evaluation and managed by the NBRC number And the strains stored by The CABI Bioscience Fungal Reference Collection and controlled by IMI number are dark-cultured at 25 ° C for 7 days. From various bacterial cells, Gen Toru-kun (trade name, manufactured by Takara Bio Inc.) Was used to extract DNA.
PCR amplification of the target site was performed using PuRe Taq ™ Ready-To-Go PCR Beads (GE Health Care UK LTD) as primers, ITS4 (5'-tcctccgcttattgatatg-3 ': SEQ ID NO: 4), and ITS1 ( 5'-tccgtaggtgaacctgcgg-3 ': SEQ ID NO: 5) or ITS5 (5'-ggaagtaaaagtaacaagg-3': SEQ ID NO: 6) (White T.J., Bruns TD, Lee S.B., Taylor J.W. , Amplification and direct sequencing of fungal ribosomal DNA for phylogenetics; Innis M.A., Gelfan D.H., Sninsky J.J., White T.J. (eds), PCR Protocols: A Guide to the Methods and Application San Diego: Academic Press, p. 315-322, 1990). Amplification conditions were heat denaturation: 95 ° C. for 1 minute, annealing at 55 ° C. for 1 minute, extension reaction at 72 ° C. for 1 minute, and 35 cycles. The PCR product was purified using Auto Seg ™ G-50 (Amersham Pharmacia Biotech), and labeling was performed using BigDye terminator Ver. Using 3.1 (trade name, Applied Biosystems), electrophoresis was performed with ABI PRISM 3130 Genetic Analyzer (Applied Biosystems). For determination of the base sequence from the fluorescence signal during electrophoresis, the software 'ATGC Ver. 4 ′ (Genetyx) was used.
Various ketomic fungi determined by the sequencing method and various ketomic fungi and related fungi obtained from the DNA data bank of Japan (DDBJ: http://www.ddbj.nig.ac.jp/Welcome-j.html) (Chirabia-Aurantiaka (Thielavia aurantiaca), Chirabia - Arenaria (Thielavia arenaria), Chirabia-Kuwaitenshisu (Thielavia kuwaitensis), Chirabia - Minuta (Thielavia minuta), Chirabia terrestris (Thielavia terrestris), Chirabia-Terikora (Thielavia terricola) And alignment using Clustal W (http://clustalw.ddbj.nig.ac.jp/top-j.html) based on partial nucleotide sequence information of ITS region of Thielavia tortuosa etc. Analyzes were performed, and analysis by the neighbor-joining method was performed using NJ-Prot to create a molecular phylogenetic tree. The created molecular phylogenetic tree is shown in FIG.

  As shown in Fig. 1, it was revealed that ketium funicola and ketium indicam are included in the same ketium indicame clade (Asgari B, Zare R., The genus Chaetomium in Iran, a phylogenic study including six new species., Mycologia, 2011, vol. 103 (4), p. 863-882).

Test Example 2 Analysis of Partial Base Sequence of ITS Region Specific to Ketomium, Indicum, and Cladal Based on the base sequence information of various genus fungus species determined by the above method and known ITS region of various fungi Alignment analysis was performed using W (http://clustalw.ddbj.nig.ac.jp/top-j.html), and nucleotide sequences specific to ketium funicola and ketmium indicam (Cfu2F: accaaactcttgaatttaca (sequence No. 1), Cfu2R: caacctttgggtaccttcga (SEQ ID NO: 2)) was determined.

Example (1) Primer design Primer (Cfu2F primer) comprising an oligonucleotide represented by the nucleotide sequence of SEQ ID NO: 1 based on the nucleotide sequence specific to the ketium indicum clade determined above ) And a primer (Cfu2R primer) composed of an oligonucleotide represented by the base sequence shown in SEQ ID NO: 2 was designed, and a synthesis request was made to Sigma-Aldrich Japan (desalted product, 0.02 μmol scale) for purchase.

(2) Preparation of specimens The fungi used in the evaluation of the effectiveness of the designed primer, namely, ketium, indicam clade and other genus ketium, and fungi reported in accident cases in food and drink, etc. The strains described in 1-3 were used. These strains are stored by the Chiba University Research Center for Fungal Medicine and controlled by the IFM number, stored by the National Institute of Technology and Evaluation and managed by the NBRC number, and stored by The Centraalbureau voor Schimmelcultures. We obtained and used the strains managed by the CBS number, the strains managed by the Fermentation Research Institute and managed by the IFO number, and the strains managed by the Fermentation Research Institute and managed by the IFO number. .
Each strain was cultured under optimal conditions. As for the culture conditions, potato dextrose medium (trade name: Pearl Core potato dextrose agar medium, manufactured by Eiken Chemical Co., Ltd.) was used for 7 days at the optimum temperature of each bacterium.

  Each cultured cell was collected using a platinum loop, and a genomic DNA solution was prepared using a genomic DNA preparation kit (PrepMan ultra (trade name) manufactured by Applied Biosystems). The concentration of the DNA solution was adjusted to 5 ng / μL.

(3) Detection of ketmium indicam clade 1 μL of the genomic DNA solution prepared above as a DNA template, 13 μL of Pre Mix Taq (trade name, manufactured by Takara Bio Inc.) and 10 μL of sterile distilled water were mixed, and Cfu2F primer (20 pmol / μL) 0.5 μL and Cfu2R primer (20 pmol / μL) 0.5 μL were added to prepare a 25 μL PCR solution.
The PCR reaction solution was subjected to gene amplification using an automatic gene amplification apparatus thermal cycler DICE (Takara Bio). PCR reaction conditions include 35 cycles of (i) heat denaturation reaction at 95 ° C for 1 minute, (ii) annealing reaction at 55 ° C for 1 minute, and (iii) extension reaction at 72 ° C for 1 minute. Cycled.

  After PCR, 2 μL was taken from the PCR solution, mixed well with 0.5 μL of loading buffer (Nucleic Acid sample loading buffer 5 × (manufactured by BIO RAD)), and electrophoresed using a 2% agarose gel (135V, For 20 minutes). After completion of electrophoresis, the agarose gel was stained with SYBR Safe DNA gel stain in 1 × TAE (Invitrogen), and the presence or absence of the amplified DNA fragment was confirmed. The results are shown in FIGS. The numbers in the figure indicate that the samples were reacted using DNA extracted from the samples with corresponding sample numbers in the table. 2 shows an electrophoretic diagram for the fungal sample shown in Table 1, FIG. 3 shows an electrophoretic diagram for the fungal sample shown in Table 2, and FIG. 4 shows the fungal sample shown in Table 3. An electropherogram is shown. As a molecular weight marker, EZ Load 100bp molecular Ruler (trade name, manufactured by BIO RAD) was used.

  As a result, a gene fragment having a size of about 350 bp was confirmed in the sample containing the genomic DNA of ketmium indicum clade containing ketium funicola or ketmium indicum. On the other hand, gene fragments were not confirmed in samples containing genus Ketomium other than those other than ketmium, indicam, and clade and other fungal genomic DNAs widely detected in food production environments. Therefore, according to the present invention, the ketium indicum clade can be specifically detected at the clade level.

  From the above results, by using the oligonucleotide of the present invention, it is possible to confirm the presence of a partial base sequence in the ITS region of the ketium indicam clade and to specifically detect the ketium indicam clade at the clade level. I understand that I can do it. Therefore, according to the method of the present invention, it is possible to collectively detect ketium indicum clades more quickly and more accurately than in the conventional method.

Claims (10)

Following (a) and using a pair of oligonucleotides consisting of an oligonucleotide of (b) to detect the Chaetomium Indy cam clade (Chaetomium indicum clade), a Chaetomium Indiana cam clade detection methods, Chaetomium, In order to detect indicum clade, the oligonucleotide pair is used to detect the nucleic acid represented by the partial base sequence of the Internal Transcribed Spacer region existing between 18S rDNA and 28S rDNA of ketium indicum clade. A method that amplifies a part, confirms the presence or absence of amplification products, and detects ketium, indicam, and clade .
(A) an oligonucleotide represented by the base sequence set forth in SEQ ID NO: 1, or one base is deleted, substituted, inserted or added in the base sequence set forth in SEQ ID NO: 1 and ketmium indicum Oligonucleotide that can be used for clade detection (b) An oligonucleotide represented by the nucleotide sequence set forth in SEQ ID NO: 2, or one base is deleted, substituted, inserted or added in the nucleotide sequence set forth in SEQ ID NO: 2 Oligonucleotides that can be used to detect ketmium, indicame, and clade It said Chaetomium Indy cam clade contains Chaetomium-Funikora (Chaetomium funicola) and Chaetomium Indiana cam (Chaetomium indicum), the detection method of claim 1, wherein. The polymerase chain reaction method was performed using the oligonucleotide pair consisting of the oligonucleotides (a) and (b) as a nucleic acid primer, and the nucleic acid represented by the partial base sequence of the Internal Transcribed Spacer region of Ketomium Indicum Clade The detection method according to claim 1 or 2 , wherein a part is amplified, the presence or absence of an amplification product is confirmed, and detection of ketium, indicam, and clade is performed. Said Chaetomium Indy cam clade partial base sequence of the Internal Transcribed Spacer region is one of the following nucleotide sequence (c) and (d), the detection process of any one of claims 1-3.
(C) A partial base sequence of the Internal Transcribed Spacer region described in SEQ ID NO: 3 or its complementary sequence (d) One or several bases are deleted, substituted, inserted or added in the base sequence described in SEQ ID NO: 3 Base sequence that can be used for detection of cadmium and indicamm clade, or its complementary sequence An oligonucleotide pair consisting of the following oligonucleotides (a) and (b):
(A) an oligonucleotide represented by the base sequence set forth in SEQ ID NO: 1, or one base is deleted, substituted, inserted or added in the base sequence set forth in SEQ ID NO: 1 and ketmium indicum Oligonucleotide that can be used for detection of clade ( Chatotomium indicum clade) (b) Oligonucleotide represented by the nucleotide sequence set forth in SEQ ID NO: 2, or one base is deleted or substituted in the nucleotide sequence set forth in SEQ ID NO: 2 , Inserted or added and can be used to detect Chaetomium indicum clade 6. The oligonucleotide pair of claim 5 , wherein the oligonucleotide is a nucleic acid primer. It said Chaetomium Indy cam clades Chaetomium-Funikora (Chaetomium funicola) and Chaetomium, including Indy cam (Chaetomium indicum), according to claim 5 or 6 oligonucleotide pair described. The oligonucleotides (a) and (b) can hybridize to the nucleic acid represented by any of the following base sequences (c) and (d), respectively, and detect ketium, indicum, and clade. The oligonucleotide pair according to any one of claims 5 to 7 , which can function as a nucleic acid primer.
(C) A partial base sequence of the Internal Transcribed Spacer region described in SEQ ID NO: 3 or its complementary sequence (d) One or several bases are deleted, substituted, inserted or added in the base sequence described in SEQ ID NO: 3 Base sequence that can be used for detection of cadmium and indicamm clade, or its complementary sequence The oligonucleotides (a) and (b) can amplify a part of the nucleic acid represented by any one of the base sequences (c) and (d) by the polymerase chain reaction method, and the ketmium indicum clade The oligonucleotide pair according to claim 8 , which can function as a nucleic acid primer for detecting. Any one of claims including oligonucleotide pairs Chaetomium Indiana cam clade of claims 5 ~ 9 (Chaetomium indicum clade) detection kit.