JP2010029102A - alpha1,3-FUCOSYLTRANSFERASE - Google Patents

Abstract

<P>PROBLEM TO BE SOLVED: To provide a method for producing a protein to which a human sugar chain is added by an animal and vegetable protein production system for originally adding a nonhuman sugar chain by isolating and identifying α1,3-fucosyltransferase of Lepidoptera and Solanales related to the addition of the sugar chain to the protein, and suppressing the expression of the α1,3-fucosyltransferase in the Lepidoptera and the Solanales. <P>SOLUTION: The method for suppressing the activity of the α1,3-fucosyltransferase includes a step of introducing a DNA for suppressing the activity of the α1,3-fucosyltransferase in the Lepidoptera into a cell, and a step of expressing the DNA in the cell. <P>COPYRIGHT: (C)2010,JPO&INPIT

Description

  The present invention relates to a DNA encoding α1,3-fucosyltransferase and a method for producing a protein to which a human sugar chain is added in animals and plants using the α1,3-fucosyltransferase.

  Currently, gene manipulation techniques such as gene recombination techniques play a major role in the life science field. For example, it is possible to modify various cells by genetic manipulation, such as transgenic mice and transgenic rice, and add new or useful traits.

  It has been studied for a long time to produce glycoproteins for use in humans by using non-human organisms as production hosts using such genetic manipulation techniques. First, Escherichia coli has been used as a production host from the viewpoint of management and ease of establishment of an expression body. However, Escherichia coli as a prokaryote has a function of adding a sugar chain to a protein. Therefore, there was a fundamental problem that a protein with a human-type sugar chain could not be produced. Therefore, plant bodies, plant cells, insect cells or the like having a function of adding a sugar chain to a protein are now considered as production hosts.

  However, glycoproteins produced by plants or insects often do not show the original activity / function of the glycoprotein in the human body. This is because the sugar chain addition mechanism of plants and insects is different from that of humans, and the sugar chain structure of glycoprotein differs accordingly between plants and insects and humans. For example, when a glycoprotein is produced using plants and insects as production hosts, the protein often has antigenicity to humans.

  This antigenicity is attributed to the sugar chain portion containing α1,3-core fucose of the glycoprotein. This α1,3-linkage is formed by adding fucose to a glycoprotein by α1,3-fucosyltransferase derived from plants or insects. Therefore, in order to avoid such antigenicity, inactivation of α1,3-fucosyltransferase is desired.

  Specifically, the sugar chain portion of the glycoprotein has a structure in which sugar is added to the core structure, and differs depending on the species. Coupling of fucose to an N-acetylglucosamine residue present at the reducing end of the core structure is one form of glycosylation, α1,3-bond in plants, and α1,6 in mammals such as humans and mice. -Bonds, both α1,3- and α1,6-linkages have been found in insects.

  Among these, in plants, Non-patent Document 1 and Patent Document 1 disclose a method for isolating and identifying α1,3-fucosyltransferase in mungbean (Vigna radiata) and suppressing its expression.

  In addition, in insects, non-patent document 2 discloses that α1,3-fucosyltransferase is isolated and identified in Drosophila melanogaster.

JP 2002-536978 Gazette J Biol Chem 1999 Jul 30; 274 (31): 21830-9 J Biol Chem 2001 Jul 27; 276 (30): 28058-67.

  The present invention has been made in view of such a situation, and isolates and identifies lepidoptera and eggplant α1,3-fucosyltransferase involved in protein glycosylation, and lepidoptera and eggplants. An object of the present invention is to provide a method for producing a protein having a human sugar chain added thereto in an animal or plant protein production system that originally adds a non-human sugar chain by suppressing the expression of the α1,3-fucosyltransferase. .

  The present invention relates to genes involved in glycoprotein production in Lepidoptera and Solanum protein production systems. The gene encoding a protein having α1,3-fucosyltransferase activity is any place on the chromosome as a gene encoding an enzyme that adds fucose to an N-acetylglucosamine residue in the lepidopteran and eggplant protein production systems. Is expected to exist. The present inventors have clarified the region of existence and attempted to isolate it as a single gene.

  First, the present inventors performed a genome database search of silkworms using an amino acid sequence containing an active motif of α-1,3-fucosyltransferase A derived from Drosophila as a source. In addition, candidate genome sequences were selected from the search results, and regions containing exons were further cloned to obtain silkworm α-1,3-fucosyltransferase candidate genes.

  The present inventors also identified a highly homologous genomic sequence from tomato cDNA using the gene sequence of Arabidopsis α-1,3-fucosyltransferase as a source, and designated it as a tomato α-1,3-fucosyltransferase candidate gene.

  Thereafter, as a result of intensive studies, the present inventors have suppressed the α1,3-fucosyltransferase activity of lepidoptera and eggplants when producing glycoproteins for humans using lepidoptera or solanaceous plants. Thus, it was found that a protein to which a human-type sugar chain was added was obtained, and the present invention was completed. Specifically, the present invention has the following configuration.

[1] A DNA encoding a protein having lepidopteran α1,3-fucosyltransferase activity.
[2] In the DNA of [1], the DNA encodes a protein having a silkworm α1,3-fucosyltransferase activity.
[3] DNA according to [1], wherein the DNA according to any one of (a) to (d) below:
(A) DNA encoding a protein consisting of the amino acid sequence set forth in SEQ ID NO: 1,
(B) DNA containing the coding region of the base sequence set forth in SEQ ID NO: 2;
(C) a protein comprising an amino acid sequence in which one or more amino acids are substituted, deleted, added, and / or inserted in the amino acid sequence described in SEQ ID NO: 1, and the amino acid sequence described in SEQ ID NO: 1 DNA encoding a protein having the same function as the protein consisting of
(D) a DNA that hybridizes under stringent conditions with a DNA comprising the nucleotide sequence set forth in SEQ ID NO: 2, and which encodes a protein having a function equivalent to that of the protein comprising the amino acid sequence set forth in SEQ ID NO: 1 DNA to do.
[4] DNA encoding a protein having α1,3-fucosyltransferase activity of the order of eggplant.
[5] In the DNA of [4], the DNA encodes a protein having α1,3-fucosyltransferase activity of tomato.
[6] DNA according to [4], wherein the DNA according to any one of (e) to (h) below:
(E) DNA encoding a protein consisting of the amino acid sequence set forth in SEQ ID NO: 3;
(F) DNA containing the coding region of the base sequence set forth in SEQ ID NO: 4;
(G) a protein comprising an amino acid sequence in which one or more amino acids are substituted, deleted, added, and / or inserted in the amino acid sequence set forth in SEQ ID NO: 3, and the amino acid sequence set forth in SEQ ID NO: 3 DNA encoding a protein having the same function as the protein consisting of
(H) a DNA that hybridizes under stringent conditions with a DNA comprising the nucleotide sequence set forth in SEQ ID NO: 4, and which encodes a protein having the same function as the protein comprising the amino acid sequence set forth in SEQ ID NO: 3 DNA to do.
[7] DNA according to any one of (i) to (iii) below, which suppresses α1,3-fucosyltransferase activity in Lepidoptera:
(I) DNA encoding RNA complementary to the transcription product of DNA of any one of [1] to [3],
(Ii) DNA encoding an RNA having a ribozyme activity that specifically cleaves the transcription product of the DNA according to any one of [1] to [3],
(Iii) DNA encoding RNA having RNAi activity that specifically cleaves the transcription product of DNA according to any one of [1] to [3].
[8] DNA according to any of (iv) to (vi) below, which suppresses α1,3-fucosyltransferase activity in the order of eggplant;
(Iv) DNA encoding RNA complementary to the transcription product of DNA according to any one of [4] to [6],
(V) DNA encoding an RNA having a ribozyme activity that specifically cleaves the transcription product of the DNA of any one of [4] to [6],
(Vi) DNA encoding RNA having RNAi activity that specifically cleaves the transcription product of DNA according to any one of [4] to [6].
[9] A recombinant vector comprising the DNA of any one of [7] or [8].
[10] A transformed cell transformed with the recombinant vector of [9].
[11] A transformant obtained from the transformed cell of [10].
[12] A transformant which is a descendant or clone of the transformant of [11].
[13] A propagation material for the transformant according to any one of [11] and [12].
[14] A method for producing a transformant according to any one of [11] or [12], comprising the step of introducing the DNA of [7] into a lepidopteran-derived egg, and the egg into which the DNA has been introduced Selecting a transformed animal from the resulting animal body.
[15] A method for producing a transformant according to any one of [11] or [12], the step of introducing the DNA of [8] into a cell derived from a solanaceous eye, and a plant having the cell, Selecting a transformed plant.
[16] A method for suppressing α1,3-fucosyltransferase activity, the step of introducing the DNA of any one of [7] or [8] into a cell, and the step of expressing the DNA in the cell And a method comprising:
[17] A recombinant protein obtained by introducing a vector containing a DNA encoding a target protein into a transformed cell or transformant containing the DNA according to any one of [7] or [8] and expressing the vector.
[18] A method for producing a protein according to [17], comprising the steps of culturing a transformed cell or transformant containing the DNA according to any of [7] or [8], and the transformed cell or trait Recovering the recombinant protein from the transformant or the culture supernatant thereof.
[19] A recombinant protein obtained by infecting a transformed cell or transformant containing the DNA according to [7] with a baculovirus in which a DNA encoding the target protein is incorporated.
[20] A method for producing a protein according to [19], comprising the step of infecting a transformed cell or transformant containing the DNA according to [7] with a baculovirus incorporating a DNA encoding the protein of interest. And a step of recovering the recombinant protein expressed in the transformed cell or transformant.
[21] A recombinant protein obtained from an animal or plant obtained by crossing a transformant containing the DNA of any one of [7] or [8] with a transformant containing a DNA encoding the target protein .
[22] A pharmaceutical composition comprising the protein according to any one of [17], [19] or [21] and a pharmaceutically acceptable carrier.

  The α1,3-fucosyltransferase of the present invention is an enzyme that adds fucose to an N-acetylglucosamine residue present at the reducing end of the sugar chain core structure through an α1,3-linkage. By isolating and identifying the gene encoding the enzyme and further suppressing the expression of the gene, it has become possible to stably produce glycoproteins to which human-type sugar chains have been added. By this new technique, a lepidopteran or solanaceous plant can be used to produce a protein to which a human sugar chain is added.

(Embodiment 1)
First, an embodiment of the present invention according to Lepidoptera will be described.

  Examples of the Lepidoptera include Papilionidae, Nymphalidae, Noctuidae, Sphingidae, Bombycidae, etc. This includes silkworms. In the protein production, lepidopteran cells such as Spodoptera frugiperda and Tichoplusia ni are used as a host.

  Below, the example of the silkworm which is the larva of the silkworm among these is demonstrated.

(1) DNA encoding the α1,3-fucosyltransferase of the present invention
As used herein, “α1,3-fucosyltransferase” is an enzyme that adds a fucose residue to a reducing terminal acetylglucosamine residue that is generated upon addition of a sugar chain after the synthesis of the protein portion of a glycoprotein. This enzyme has a function of linking fucose with α1,3-linkage to N-acetylglucosamine closest to the peptide chain of the asparagine-linked sugar chain of glycoprotein using GDP-fucose as a sugar donor.

  The present invention provides a DNA encoding α1,3-fucosyltransferase involved in the sugar chain structure of a protein.

Specifically, the DNA encoding the α1,3-fucosyltransferase of the present invention is:
(A) DNA encoding a protein consisting of the amino acid sequence set forth in SEQ ID NO: 1,
(B) DNA containing the coding region of the base sequence set forth in SEQ ID NO: 2;
(C) a protein comprising an amino acid sequence in which one or more amino acids are substituted, deleted, added, and / or inserted in the amino acid sequence described in SEQ ID NO: 1, and the amino acid sequence described in SEQ ID NO: 1 DNA encoding a protein having the same function as the protein consisting of
(D) a DNA that hybridizes under stringent conditions with a DNA comprising the nucleotide sequence set forth in SEQ ID NO: 2, and which encodes a protein having a function equivalent to that of the protein comprising the amino acid sequence set forth in SEQ ID NO: 1 DNA to
Is included.

  As used herein, “an amino acid sequence in which one or more amino acids are substituted, deleted, added, and / or inserted” refers to substitution or the like as long as a protein comprising the amino acid sequence does not lose a desired function. The number of amino acids to be performed is not limited. For example, the number of substituted amino acids is 30 or less, preferably 10 or less, more preferably 5 or less, and particularly preferably 3 or less.

  In addition, “stringent conditions” in the present specification refers to hybridization reaction conditions performed for isolating DNA encoding a homologous gene, and this hybridization reaction is performed according to a method known to those skilled in the art. It can be carried out.

  Examples of the “DNA that hybridizes under stringent conditions” include DNA having a certain degree of homology with the base sequence of DNA used as a probe, for example, 70% or more, preferably 80% or more, more preferably 90%. % Or more, even more preferably 95% or more, and most preferably 98% or more DNA having homology.

  As long as “DNA encoding α1,3-fucosyltransferase” according to the present specification encodes “α1,3-fucosyltransferase”, the form thereof is not limited, and cDNA, genomic DNA, chemically synthesized DNA And DNA having an arbitrary base sequence based on the degeneracy of the genetic code.

  Preparation of genomic DNA and cDNA can be performed by those skilled in the art using conventional means. For genomic DNA, for example, genomic DNA is extracted from silkworms, a genomic library (plasmid, phage, cosmid, BAC, PAC, etc. can be used as vectors) is developed, It can be prepared by carrying out colony hybridization or plaque hybridization using a probe prepared based on DNA encoding fucosyltransferase (for example, DNA described in SEQ ID NO: 2). It is also possible to prepare a primer specific for DNA encoding α1,3-fucosyltransferase and perform PCR using this primer. In addition, for example, cDNA is synthesized based on mRNA extracted from silkworms, and inserted into a vector such as a plasmid or phage to create a cDNA library. It can be prepared by performing hybridization or plaque hybridization, or by performing PCR.

  By using this DNA, it is possible to produce glycoproteins to which human-type sugar chains are added in Lepidoptera. Here, the “human-type sugar chain” means a sugar chain in which a fucose residue due to an α1,3-linkage does not exist in the N-acetylglucosamine residue present in the reducing end portion of the sugar chain core structure.

(2) DNA that suppresses α1,3-fucosyltransferase activity of the present invention
The present invention also provides a DNA that suppresses the activity of α1,3-fucosyltransferase of Lepidoptera. Specifically, such DNA includes
(I) DNA encoding RNA complementary to a transcript of DNA encoding Lepidoptera α1,3-fucosyltransferase;
(Ii) DNA encoding RNA having ribozyme activity that specifically cleaves a transcript of DNA encoding Lepidoptera α1,3-fucosyltransferase;
(Iii) DNA encoding RNA having RNAi activity that specifically cleaves a transcript of DNA encoding Lepidoptera α1,3-fucosyltransferase,
Is included.

  The DNA of (i) is a DNA encoding an antisense RNA, the DNA of (ii) is a DNA having catalytic activity, and the DNA of (iii) encodes an endogenous α1,3-fucosyltransferase. DNA that encodes a dsRNA (double-stranded RNA) complementary to the transcription product of the DNA.

  Further, “suppressing α1,3-fucosyltransferase activity” includes suppression of transcription of DNA and suppression of translation into protein. Also included is a decrease in expression as well as complete cessation of DNA expression.

  This DNA can suppress fucose α1,3-bond to the N-acetylglucosamine residue present at the reducing end of the sugar chain core structure in Lepidoptera.

(3) Recombinant vector of the present invention The present invention also provides a recombinant vector comprising the suppression DNA described in (2).

  The vector for introducing the DNA for suppression is not particularly limited as long as the transgene can be expressed in the cell. For example, a vector having a promoter (eg, actin promoter) for constitutive gene expression in insect cells, or a vector having a promoter (eg, heat shock promoter) whose activity is induced by an external stimulus, Also good. The suppression DNA of the present invention can be inserted into a vector by a known method, for example, by a ligase reaction using a restriction enzyme site.

  In the vector, various markers may be used in order to confirm whether the transgene has been introduced into the host cell or whether it has been reliably expressed in the host cell. For example, when silkworm is used as a host cell, a marker gene such as jellyfish-derived green fluorescent protein (GFP) may be incorporated. In this case, a promoter sequence such as 3xP3 is incorporated upstream of the marker gene, and the marker gene is expressed by its action. In addition, when E. coli is used, a drug resistance gene such as kanamycin or ampicillin may be incorporated as a marker gene.

  The vector into which the DNA for suppression is inserted can be introduced into cells by methods known to those skilled in the art such as polyethylene glycol method, electroporation method, Agrobacterium method, particle gun method and the like.

  The host cell into which the vector of the present invention is introduced is not particularly limited, and various host cells can be used depending on the purpose. For example, bacterial cells (such as E. coli), fungal cells (such as yeast), insect cells (such as silkworms), animal cells (such as CHO), plant cells, and the like.

  With this recombinant vector, the DNA for suppression can be efficiently expressed in cells.

(4) The transformed cell, the transformant, the propagation material of the present invention, and the method for producing the transformant The present invention also includes the suppression DNA described in (2) or the recombinant vector described in (3). Transformed cells introduced, transformants created from the transformants, transformants that are descendants or clones of the transformants, propagation materials for these transformants, and methods for producing these transformants I will provide a. Specifically, this method
(A1) a step of introducing a DNA for suppression into an egg derived from Lepidoptera,
(A2) comprising a step of selecting a transgenic animal from an animal body produced from an egg into which the DNA has been introduced.

  Here, the transformed cell of the present invention is not particularly limited as long as it is a cell or a collection of cells into which a suppressor DNA or a recombinant vector has been introduced and can reproduce an animal that is a transformant. The transformed cell of the present invention is, for example, an egg.

  Transformed cells into which the recombinant vector has been introduced can be selected using various methods depending on the predetermined marker gene introduced into the vector. For example, when GFP is introduced as a marker gene, transformed cells can be selected by detecting the fluorescence of the expressed GFP protein. In addition, when a drug resistance gene is introduced as a marker gene, it may be cultured in a known selection medium having a suitable selection drug.

  The DNA introduced into the transformed cells and transformants can be confirmed by methods known to those skilled in the art, such as hybridization and PCR, or by analyzing the DNA sequence of insects.

  Moreover, it becomes possible to obtain offspring from this transformant by sexual reproduction or asexual reproduction by introducing the DNA for suppression into the chromosome of the transformant. Furthermore, it becomes possible to mass-produce the transformant by obtaining a propagation material (eg, egg) from this transformant or its progeny or clone.

(5) Method for suppressing α1,3-fucosyltransferase activity of the present invention The present invention also provides a method for suppressing α1,3-fucosyltransferase activity using the DNA for suppression described in (2). Specifically, this method
(B1) a step of introducing a DNA for suppression into the cell,
(B2) expressing the suppressive DNA in the cell,
It consists of.

  The “step of introducing DNA into cells” can be performed using various methods known to those skilled in the art such as electroporation method and particle gun method. By the method (5) as described above, a vector containing the suppressor DNA in a state in which the suppressor DNA can be expressed is introduced into the cell, and therefore, α1,3-fucosyltransferase activity can be effectively suppressed.

(6) Recombinant protein of the present invention and production method thereof The present invention also provides a recombinant protein to which a human-type sugar chain is added. This protein is obtained by introducing and expressing a vector containing DNA encoding the target protein into the transformed cell described in (4). Further, this protein may be obtained by infecting the transformed cell described in (4) with a baculovirus in which a DNA encoding the target protein is incorporated. Furthermore, this protein is a recombinant protein obtained from an animal or plant obtained by crossing the transformant described in (4) with a transformant containing a DNA encoding the target protein. Also good.

The present invention also provides a method for producing the above recombinant protein. Specifically, this method
(C1) a step of infecting a transformed cell or a transformant containing a vector containing a suppressor DNA with a baculovirus incorporating a DNA encoding a target protein,
(C2) a step of recovering the recombinant protein expressed in the cell or transformant. Furthermore, this method
(D1) a step of culturing a transformed cell containing the vector containing the suppression DNA described in (2),
(D2) The method may comprise a step of recovering the recombinant protein from the cell or its culture supernatant.

  The recombinant protein obtained by this method is any protein to which a human-type sugar chain has been added. That is, it is a protein that does not have an α1,3-linkage of fucose to an N-acetylglucosamine residue present at the reducing end of the sugar chain core structure.

(7) Pharmaceutical Composition of the Present Invention The present invention also provides a pharmaceutical composition comprising the recombinant protein described in (6) and a pharmaceutically acceptable carrier. This carrier is suitable for delivery in the animal body, for example, surfactants, excipients, colorants, flavoring agents, preservatives, stabilizers, relaxants, suspending agents, isotonic agents, fluidity. Including, but not limited to, accelerators and the like, other commonly used carriers can be appropriately used. Specific examples include lactose, starch, mannitol, polyvinyl pyrrolidone, gelatin, polyvinyl acetal diethylaminoacetate, sucrose, corn starch and the like.

  Examples of the present invention will be described in detail below.

Example 1.1 Cloning of Silkworm α1,3-Fucose Transferase A homology search was performed using the KAIKO BLAST database of the National Institute of Agrobiological Sciences. For the search, the amino acid sequence (Asp354-Met390) containing the active motif of Drosophila-derived α-1,3-fucosyltransferase A was used as a source.

  About the base sequence which showed the high homology by the database search, the exon area | region was estimated by the GENSCAN program (http://genes.mit.edu/GENSCAN.html) analysis.

  A region containing exons was amplified and cloned by PCR using genomic DNA as a template. PCR was performed using KOD Plus polymerase (TOYOBO) under the conditions shown in FIG.

  As a result of searching the KAIKOBLAST database, a genomic sequence showing high homology with the Drosophila-derived FucTA active motif region was found (FIG. 2), and further, GENSCAN analysis showed that it encodes an exon corresponding to full-length FucT. It was done.

  As for the FucT candidate gene, a region containing exons was subjected to PCR amplification from genomic DNA. As a result, amplification of a DNA fragment corresponding to the target sequence was confirmed (FIG. 3).

Example 1.2 Preparation of silkworm transformation vector for RNAi (1) Construction of plasmid pBac [UAS-A3i-SV40, 3xP3egfp] for RNAi A3 short2-RE (with P50 silkworm genome DNA as a template and primers) 5'-GGGGTCTAGAGCTAGCCGGTCCGGGCCAACAGGTGAGCTCATCGATTCTGGACTATGCACTTCGTCTCTCGGCCGGTGGGCCGTTATCGACCGTTATCTG-3 ') and A3 short2r-ER (5'-GGGGTCTAGAGTCGACGGCCTACATGGCCACTAGTCTTCTCTCTGAAACAGAACAAAGTCATTCGTCAGATAACGGTCGATAACGGCCCACCGGCC By PCR using AGA-3 ') and was amplified first intron region comprising a first part of the second exon of silkworm actin 3 gene. The obtained DNA fragment was treated with Xba1 and inserted into the Bln1 site of the plasmid pBlue (UAS) (Sakudoh et al., Proc Natl Acad Sci USA 104, 8941-8946, 2007) (FIG. 4A). The obtained plasmid was purified and treated with Xho1 and BamH1 to excise a region containing UAS, A3 intron, and polyA signal of S40, and plasmid pBacMCS (Uchino et al., J. Insect Biotechnol, Sericol. 75, 89-97, 2006) was inserted into the recognition sequence site of the same restriction enzyme (FIG. 4A). Using the plasmid pBac [3xP3-EGFP] (Horn et al., 2000) as a template at the EcoR1 site of this plasmid, 3xP3-EGFP. 13U19-EcoRI (5'-ggggatattcGCTTCGGTTTATATGAGAC-3 ') and 3xP3-EGFP. A pBac [UAS-A3i-SV40, 3xP3egfp] was generated by inserting a 3xP3-EGFP fragment amplified by PCR using 1352L21-EcoRI (5'-ggggaattcTGAGTTTGGACAAACCACAAC-3 ') as a primer and treating with EcoR1. (FIG. 4B). The base sequence of each obtained plasmid was determined by an ABI automatic sequencer.

(2) Insertion of sequence for fucose transferase RNAi into pBac [UAS-A3i-SV40, 3xP3egfp] Using fucose transferase gene cloned in Example 1.1 as a template, PCR was carried out using the following primer combinations: A vector was constructed in which the DNA fragment was inserted in the reverse direction into the plasmid pBac [UAS-A3i-SV40, 3xP3egfp] for RNAi.
Fut1f (NheI): 5′-gaGCTAGCTTAATGTTCATTCATTTTTTTTATATATATA-3 ′
Fut1r (CpoI): 5'-aaaCGGaCGGAGTTTTATGTAATGACAGTTAGTTTTT-3 '
Fut2f (SpeI): 5′-ggACTTAGTAGTTTTATGTAATGACAGTTAGTTTTT-3 ′
Fut2r (SfiI): 5′-aaGGCCtacatGGCCCTTAATGTTTATTCATTTTTTTTATATATATA-3 ′
Fut3f (NheI): 5′-gaGCTAGCTTTTATAAACAAGCCCCATAAGAATCAATC-3 ′
Fut3r (CpoI): 5'-aaaCGGaCCGTGGGGCTTGTTTAAATAATAAACATTTACC-3 '
Fut4f (SpeI): 5'-ggACTTAGTTGGGGCTTGTTATAATAATAAACAATTTACC-3 '
Fut4r (SfiI): 5′-aaGGCCtacatGGCCTAAAACAGCCCCATAAGAATCAATC-3 ′
That is, 3 constructs in which a PCR-amplified DNA fragment is inserted between NheI-CpoI and SpeI-SfiI of pBac [UAS-A3i-SV40, 3xP3egfp] as shown in Table 1 below, and the transcript has a hairpin structure. A variety was created (Fig. 5).

  The base sequence of each obtained plasmid was determined by an ABI automatic sequencer.

Example 1.3 Preparation of transgenic silkworm The plasmid obtained in Example 1.2 was purified and buffered for injection together with the helper plasmid pHA3PIG (Tamura et al., Nature Biotechnology 18, 81-84, 2000). An injection solution was prepared by dissolving in (5 mM KCl / 0.5 mM phosphate buffer pH 7.0) so that each plasmid DNA was 200 μg / ml. This solution was injected into silkworm eggs of w1-pnd strain within 8 hours after egg laying. As a result, transgenic silkworms were obtained for two of the three types of constructs (Table 2). Among these, systematization was performed for those in which the full length of fucose transferase was inserted in the reverse direction. As a result, three lines were created. These strains are crossed with a GAL4 strain (Tan et al., Proc. Nati. Acad. Sci. USA 102, 11751-711756, 2005) having a promoter upstream of the cytoplasmic actin gene of silkworm, and F1 eggs are collected. Stored at 5 ° C. After transferring the eggs to 25 ° C., individuals having a fucose transferase hairpin RNA and GAL4 gene were selected by observing the embryos with a fluorescence stereomicroscope equipped with a filter for detecting GFP and DsRed. The obtained individuals were reared up to 5 years old and used for infection of NPV as larvae for RNAi.

Example 1.4 Expression and purification of glycoproteins in transgenic silkworms (1) Expression of glycoproteins Recombinant baculoviruses expressing the influenza protein hemagglutinin (HA), a glycoprotein, were prepared by the existing method (J. Virol. Methods). .98 (1): 1-8, 2001). 50 μl of HA-expressing baculovirus (4.77 × 10 6 PFU / ml) diluted 100-fold with PBS was injected into α1,3-fucosyltransferase-inhibited transgenic silkworms and non-transgenic control silkworms on the second day of age 5 . Each was fed with an artificial feed for salmon as food and reared at 23 ° C., and the insects were collected 5 days after infection.

(2) Purification of glycoprotein Infected recovered silkworms (20 heads) were mixed with 300 ml of grinding buffer (40 ml of 500 mM Tris pH 8.0, 0.75 g of EDTA · 2Na, 1.6 g of benzamidine, and 0.1 g of sodium persulfate). 5 g was added and the volume was increased to 1000 ml), and homogenate and sonication were performed. The grinding buffer was further added to adjust the liquid volume to 360 ml, and 40 ml of 20% Triton X100 was added thereto, followed by stirring at room temperature for 30 minutes. Next, protamine sulfuric acid was added to 0.1% and the mixture was stirred and allowed to stand at 4 ° C. for 15 minutes. Centrifugation was performed at 3,000 rpm for 15 minutes, and the supernatant was filtered through filter paper to obtain an HA extracted sample.

  Fetuin (SIGMA) was bound to CNBr-Sepharose FF (GE Healthcare Bioscience) according to the attached instructions. About 20 ml of Sepharose FF bound with Fetuin was packed into a column and equilibrated with 20 mM Tris pH 8.0 containing 0.1% Triton X100. The HA extracted sample was applied to the column at a flow rate of 0.8 ml / min, and then the non-adsorbed components were washed away with the equilibration buffer. Wash with 10 mM borate buffer pH 10.0 containing 0.1% Triton X100, and elute HA with 100 mM borate buffer pH 10.0 containing 0.1% Triton X100 at an absorbance of 280 nm. The peak was collected.

  15% PEG 6000 was added to the column eluate, and the mixture was stirred for 15 minutes, centrifuged at 10,000 × g for 10 minutes, and the supernatant was discarded. 20 mM Tris pH 8.0, 150 mM NaCl was added to dissolve the precipitate to obtain a purified sample.

Example 1.5 Analysis of sugar chain structure of transgenic silkworm-expressed glycoprotein 1.5.1 Excision of sugar chain from purified glycoprotein (1) The desalted HA protein was freeze-dried and completely dried.

  (2) 1.0 ml of anhydrous hydrazine (Tokyo Chemical Industry) was added and heated at 100 ° C. for 10 hours.

  (3) After the reaction, the reaction solution was transferred into acetone, allowed to stand for 20 minutes, and then centrifuged at 12,000 rpm at 4 ° C. for 15 minutes.

  (4) The supernatant was discarded, and the resulting pellet was lyophilized to completely remove acetone.

  (5) To the dried pellet, 3 ml of saturated aqueous sodium hydrogen carbonate solution and 120 μl of acetic anhydride (Wako) were added and mixed well, and allowed to stand at room temperature for 20 minutes.

  (6) DOWEX 50 × 2 (Muromachi Chemical Industries), which had been adjusted to pH 2.0 in advance, was added while checking with a pH test paper until the pH of the sample reached 2.0. The resin and the solution were separated using a column filled with glass wool, washed with 5 volumes of dH2O, and all the eluate was collected in an eggplant type flask.

(7) A TSK gel TOYO PERAL HW-40 (TOSOH) gel filtration column (2.5 ×) which was added with an appropriate amount of 1-butanol to the eluate, concentrated with an evaporator, and pre-equilibrated with 0.1N aqueous ammonia. The eluate was fractionated into 40 fractions by 80 drops (about 4 ml). Fractionation was performed with a 2128 Fraction collector (Bio-Rad).
(8) After thoroughly stirring each fraction, take 100 μl, mix well with 100 μl of 5% phenol, mix with 400 μl of concentrated sulfuric acid, collect the fraction containing sugar chains, and add an appropriate amount of 1-butanol. In addition, after concentrating with an evaporator, it was further concentrated by freeze-drying.

1.5.2 Pyridylamino (PA) conversion of sugar chain (1) A PA-forming reagent (2.76 g / ml 2-aminopyridine acetic acid solution) was added to the lyophilized sample so that the sample was sufficiently immersed, and 1 Heated for hours.

  (2) To a sample cooled to room temperature, add a dimethylamine-borane solution (195 mg / ml dimethylamine borate (Wako) acetic acid solution) in an equal amount to the PA reagent added in the previous section and mix well. Heated for minutes.

  (3) After cooling at room temperature, an equal amount of dH2O to the sample was added and mixed well, and the TSK gel TOYO PERAL HW-40 (TOSOH) gel filtration column (2. The eluate was fractionated into 40 fractions by 80 drops (about 4 ml). Fractionation was performed with a 2128 Fraction collector (Bio-Rad).

  (4) The fluorescence intensity (Ex: 320 nm, Em: 400 nm) of each fraction is measured with an F-2000 type fluorescence spectrophotometer (HITACHI), the fraction containing the sugar chain is recovered, and an appropriate amount of 1-butanol is added. Concentrated with an evaporator.

1.5.3 Analysis of PA sugar chain by high performance liquid chromatography (HPLC) (1) The purified sugar chain was fractionated by HPLC using an ODS column, and each fraction was fractionated by HPLC using an amide column. .

  (2) For the analysis, a HITACHI HPLC system having a HITACHI FL Detector L-7480 and a NANOSPACE SI-1 (SHISEIDO) having a fluorescence detector were used.

(3) For purification and analysis with an ODS column in the HITACHI HPLC system, a Cosmosil 5C18-AR-II (6.0 × 250 mm, nakarai quest) column was used. A prepared PA sugar chain or a commercially available PA sugar chain was used as a sample. The analysis conditions are shown below.
Solvent A: 0.02% TFA (trifluoroacetic acid)
Solvent B: 20% acetonitrile / 0.02% TFA
Gradient: 0% → 4% acetonitrile (5min → 40min)
[0% → 20% solvent B]
Flow rate: 1.2 ml / min
Analysis time: 50min
Detection: Fluorescence (Ex: 310 nm, Em: 380 nm)
Column temp. : 30 ° C

(4) Asahipak NH2P-50 (4.6 × 250 mm, Showa Denko) column was used as the purification and analysis column by the amide column. A sample was prepared by adding an equal amount of acetonitrile to the prepared PA sugar chain or a commercially available PA sugar chain. The analysis conditions are shown below.
Solvent A: 80% acetonitrile
Solvent B: 20% acetonitrile
Gradient: 74% → 50% acetonitrile (5min → 25min)
[10% → 50% solvent B]
Flow rate: 0.7 ml / min
Analysis time: 40 min
Detection: Fluorescence (Ex: 310 nm, Em: 380 nm)
Column temp: 30 ° C
1.5.4 Mass spectrometry by MALDI-TOF-MS (1) Mass spectrometry of sugar chains contained in each fraction fractionated by HPLC was performed using MALDI-TOF-MS, and the sugar chain was determined from the obtained molecular weight. The structure was estimated. All the molecular weights of the sugar chains were judged to be Na-added types. In addition, HPLC using the above-described ODS column was performed for each fraction, and the peak that appeared was compared with that of a standard sugar chain having a structure estimated by mass spectrometry.

  (2) Autoflex (BRUKER DALTONICS) was used for MALDI-TOF-MS analysis. The reflector positive mode was set, and the pressure of N 2 gas was measured under a vacuum of about 1800 to 2000 mbar and 3.0 × e−6 or less. 10 mg of 2,5-dihydroxybenzoic acid (Sigma) was dissolved in 1 ml of a mixed solution of dH 2 O: acetonitrile = 1: 1 to obtain a matrix reagent. The PA reagent was dissolved in dH2O and mixed with an equal amount of matrix reagent. Of these, 2 μl was spotted on a target, dried at room temperature and crystallized for analysis.

1.5.5 Exoglycosidase treatment (1) In order to analyze the sugar chain structure more accurately, N-acetylglucosamine having N-acetylglucosamine at the non-reducing end is N-acetylglucosaminidase, and α-D-having mannose. After treatment with mannosidase, analysis was performed by HPLC using an amide column or ODS column, and compared with a standard sugar chain having a post-enzymatic reaction structure, a matched sugar chain was identified.

  (2) For the high mannose type sugar chain (Man 9 to Man 5) which is a standard sugar chain, a PA sugar chain having a known structure sold in TaKaRa was used.

  (3) α-D-mannosidase (Jack bean; Sigma) treatment was carried out under a 50 mM sodium acetate buffer solution (pH 4.0) containing 10 mM Zn (COOH) 2 and 120 mU α-D-mannosidase, 37 3 days at C. The enzyme reaction was stopped by boiling for 3 minutes, centrifuged at 4 ° C. and 12000 rpm for 10 minutes, and then the supernatant was subjected to HPLC. The elution time of the sample sugar chain was compared with the elution time of a known standard sugar chain, and the sugar chain structure was identified.

  (4) N-acetyl-β-D-glucosaminidase (Diplococcus pneumoniae; Seikagaku Kogyo) treatment is performed under 50 mM sodium acetate buffer (pH 4.0) containing 1 mU of N-acetyl-β-D-glucosaminidase. 3 days at 37 ° C. The enzyme reaction was stopped by boiling for 3 minutes, centrifuged at 4 ° C. and 12,000 rpm for 10 minutes, and the supernatant was subjected to HPLC. The elution time of the sample sugar chain was compared with the elution time of a known standard sugar chain, and the sugar chain structure was identified.

1.5.6 Sugar chain structure analysis of HA protein expressed in control (non-transgenic) silkworm PA-linked sugar chains were fractionated into 10 fractions using an ODS column (FIG. 6), and each fraction was fractionated using an amide column (FIG. 7). Each fraction collected was subjected to mass spectrometry using MALDI-TOF-MS, and the sugar chain structure contained in each fraction was estimated (Table 3).

なお、表中に記していないフラクションにはＭＡＬＤＩ−ＴＯＦ−ＭＳによる糖鎖の存在を示すピークが存在しない、又は、考えられる糖鎖の分子量と一致していないためにＮ−結合型糖鎖が存在しないと判断した。表３中に記したフラクションでは、その質量分析結果から予想された糖鎖構造をもとに、ＯＤＳカラムを用いたＨＰＬＣによりスタンダード糖鎖と各フラクションのピークの位置を比較した。更に、非還元末端が、Ｎ−アセチルグルコサミンのものは、Ｎ−アセチルグルコサミニダーゼにより、マンノースのものはマンノシダーゼで消化を行い、ＯＤＳカラム、アミドカラムによりピークの溶出位置をスタンダード糖鎖と比較し、ピークが一致したものを糖鎖として構造を同定した（表４）。

In the fractions not shown in the table, there is no peak indicating the presence of sugar chains by MALDI-TOF-MS, or N-linked sugar chains are not present because they do not match the molecular weight of the possible sugar chains. Judged not to exist. For the fractions listed in Table 3, the standard sugar chain and the position of the peak of each fraction were compared by HPLC using an ODS column based on the sugar chain structure predicted from the mass analysis results. Furthermore, N-acetylglucosamine with a non-reducing end is digested with N-acetylglucosaminidase, and mannose is digested with mannosidase, and the elution position of the peak is compared with a standard sugar chain using an ODS column or an amide column. The structure was identified using the matched one as a sugar chain (Table 4).

フラクションごとのアミドカラムを用いたＨＰＬＣによるピーク面積を基にして、糖鎖の構造ごとの存在率を算出した（表４）。

Based on the peak area by HPLC using an amide column for each fraction, the abundance of each sugar chain structure was calculated (Table 4).

1.5.7 Sugar chain structure analysis of HA protein expressed in FucT-suppressed transgenic silkworm PA-modified sugar chains were fractionated into 9 fractions using an ODS column (FIG. 8), and each fraction was fractionated using an amide column ( FIG. 9). Each fraction collected was analyzed in the same manner as in the previous section, and the sugar chain structure was identified (Table 5) and the abundance rate for each type of sugar chain was calculated (Table 6).

  As a result of the experiment, 43.9% of the control was fucosylated, whereas the FucT-inhibited silkworm was 16.02%, which is markedly inhibited by fucosylation and compared to α1,6 fucosylation. It was also found that the rate of fucosylation of α1,3 was low.

Example 1.6 RNAi against silkworm α1,3-fucose transferase using dsRNA
(1) Preparation of dsRNA The sequence of the fucosyltransferase gene was roughly divided into six, and primers for amplifying each were designed (FIG. 10). In addition, a T7 RNA polymerase promoter (TAATACGACTCACTATAGG) added to the 5 ′ side was also designed at the same time. PCR was carried out using KOD plus (Toyobo) with a vector obtained by cloning fucosyltransferase as a template. The composition and reaction conditions were set as follows.
Composition × 10 Buffer 5 μl
2 mM dNTPs 5 μl
25 mM MgSO4 2 μl
Primer Mix 3 μl (15 pmol each)
Template 1 μl (10 ng vector)
KOD + 1μl
DW 33μl
50 μl total
Reaction conditions 1, 94 ° C. 2 min
2, 94 ° C 15 sec
3, 45 ℃ 30sec
4, 68 ℃ 30sec
30 cycle reaction

  For the PCR product, dsRNA was prepared using T7 RiboMAX Express RNAi System (Promega). The method followed the instructions attached to this kit.

(2) Transfection into silkworm cultured cells 80 μl of TC-100 was diluted with 20 μl of dsRNA. To this was added 100 μl of Lipofectamine 2000 diluted 50 times with TC-100 and allowed to stand for 5 minutes after stirring, and allowed to stand for 20 minutes after mixing. Thereafter, 800 μl of TC-100 was added to obtain a dsRNA solution. 5.1 × 10 5 cells of BmN were cultured for 4 days, the medium was discarded, and after rinsing once with TC-100, a dsRNA solution was added, and cultivation was started at 27 ° C. As a negative control, an experimental group not using dsRNA was also prepared. After 5 hours, the medium was changed to TC-100 (FBS +), and the cells were collected 44 hours after transfection.

(3) Measurement of amount of α1,3-fucosyltransferase RNA by real-time PCR method Total RNA was extracted from the collected cells using Isogen-LS (Nippon Gene). The method followed the instructions for use. The extracted RNA was dissolved in 42 μl of DW, and 3 μl of Cloned DNase I (TaKaRa) and 5 μl of attached 10 × Buffer were added thereto and reacted at 37 ° C. for 30 minutes. Thereafter, phenol / chloroform treatment and isoproprecipitation were performed, and the dried RNA was dissolved in 50 μl of DW. 1 μl of this was taken, 8 μl of Reaction Mix of iScript cDNA Synthesis Kit (BIO-RAD) and 2 μl of enzyme were added, and the total volume was adjusted to 40 μl by DW. Reaction was performed at 25 ° C. for 5 minutes → 42 ° C. for 30 minutes → 85 ° C. for 5 minutes to prepare cDNA. For real-time PCR, iQ SYBR Green Supermix (BIO-RAD) was used. As an internal standard, an actin A3 gene was used, and primers (TCACTGAGGGCTCCCCTGAAC, TACAGCGAGAGCACGCGCTTG) and primers for amplifying the fucosyltransferase gene (GCTTGTTTGAAGATTCCGTTCG, GGGCAGTTGTTAATGCCTTTTTGG) were used as experiments. The reverse-transcribed sample was diluted 10 times with DW to prepare a dilution series of 100% to 0.01% (× 1 to × 10000). For each experimental group, 40 μl of Supermix and 4 μl of 10 pmol / μl primer and 2 μl of sample were added to make a total volume of 80 μl with DW. After stirring, 20 μl was dispensed into the reaction plate. The reaction plate was set in a Chromo4 real-time PCR analysis system (BIO-RAD), and the reaction and fluorescence measurement were performed under the following conditions.
1, 95 ° C 3min
2, 95 ° C 15 sec
3, 60 ℃ 45sec
4, Read
50 cycle reaction

  As a result of the experiment, although there were variations in the effect, an inhibitory effect was observed with a plurality of dsRNAs, and it was shown that RNAi occurs even with a short gene sequence of about 200 bp (FIG. 11).

(Embodiment 2)
Next, an embodiment of the present invention relating to the eyelet will be described.

  Examples of the solanaceous plant include Solanasae, Polemonaceae, Convolvuleae, Menyanthaceae, etc., and include tobacco, tomato, Shibazakura, sweet potato, Asaza and the like.

  Below, the example of the tomato (Solanum lycopersicum) in this is demonstrated.

(1) DNA encoding the α1,3-fucosyltransferase of the present invention
As used herein, “α1,3-fucosyltransferase” is an enzyme that adds a fucose residue to a reducing terminal acetylglucosamine residue that is generated upon addition of a sugar chain after the synthesis of the protein portion of a glycoprotein. This enzyme has a function of linking fucose with α1,3-linkage to N-acetylglucosamine closest to the peptide chain of the asparagine-linked sugar chain of glycoprotein using GDP-fucose as a sugar donor.

  The present invention provides a DNA encoding α1,3-fucosyltransferase involved in the sugar chain structure of a protein.

Specifically, the DNA encoding the α1,3-fucosyltransferase of the present invention is:
(E) DNA encoding a protein consisting of the amino acid sequence set forth in SEQ ID NO: 3;
(F) DNA containing the coding region of the base sequence set forth in SEQ ID NO: 4;
(G) a protein comprising an amino acid sequence in which one or more amino acids are substituted, deleted, added, and / or inserted in the amino acid sequence set forth in SEQ ID NO: 3, and the amino acid sequence set forth in SEQ ID NO: 3 DNA encoding a protein having the same function as the protein consisting of
(H) a DNA that hybridizes under stringent conditions with a DNA comprising the nucleotide sequence set forth in SEQ ID NO: 4, and which encodes a protein having the same function as the protein comprising the amino acid sequence set forth in SEQ ID NO: 3 DNA to
Is included.

  As used herein, “an amino acid sequence in which one or more amino acids are substituted, deleted, added, and / or inserted” refers to substitution or the like as long as a protein comprising the amino acid sequence does not lose a desired function. The number of amino acids to be performed is not limited. For example, the number of substituted amino acids is 30 or less, preferably 10 or less, more preferably 5 or less, and particularly preferably 3 or less.

  In addition, “stringent conditions” in the present specification refers to hybridization reaction conditions performed for isolating DNA encoding a homologous gene, and this hybridization reaction is performed according to a method known to those skilled in the art. It can be carried out.

  Examples of the “DNA that hybridizes under stringent conditions” include DNA having a certain degree of homology with the base sequence of DNA used as a probe, for example, 70% or more, preferably 80% or more, more preferably 90%. % Or more, even more preferably 95% or more, and most preferably 98% or more DNA having homology.

  As long as “DNA encoding α1,3-fucosyltransferase” according to the present specification encodes “α1,3-fucosyltransferase”, the form thereof is not limited, and cDNA, genomic DNA, chemically synthesized DNA And DNA having an arbitrary base sequence based on the degeneracy of the genetic code.

  Preparation of genomic DNA and cDNA can be performed by those skilled in the art using conventional means. For genomic DNA, for example, genomic DNA is extracted from a plant, a genomic library (plasmid, phage, cosmid, BAC, PAC, etc. can be used as vectors) is developed, and α1,3- It can be prepared by carrying out colony hybridization or plaque hybridization using a probe prepared based on DNA encoding fucosyltransferase (for example, DNA described in SEQ ID NO: 4). It is also possible to prepare a primer specific for DNA encoding α1,3-fucosyltransferase and perform PCR using this primer. In addition, for example, cDNA is synthesized based on mRNA extracted from a plant, and inserted into a vector such as a plasmid or phage to create a cDNA library. It can be prepared by performing hybridization or plaque hybridization, or by performing PCR.

  By using this DNA, it becomes possible to produce glycoproteins to which human-type sugar chains are added in the order of eggplant. Here, the “human-type sugar chain” means a sugar chain in which a fucose residue due to an α1,3-linkage does not exist in the N-acetylglucosamine residue present in the reducing end portion of the sugar chain core structure.

(2) DNA that suppresses α1,3-fucosyltransferase activity of the present invention
The present invention also provides a DNA that suppresses the activity of α1,3-fucosyltransferase of the order of eggplant. Specifically, such DNA includes
(Iv) DNA encoding RNA complementary to the transcription product of DNA encoding eggplant α1,3-fucosyltransferase;
(V) a DNA encoding an RNA having ribozyme activity that specifically cleaves a transcript of DNA encoding an eggplant α1,3-fucosyltransferase;
(Vi) DNA encoding RNA having RNAi activity that specifically cleaves a transcription product of DNA encoding eggplant α1,3-fucosyltransferase;
Is included.

  The DNA of (iv) is a DNA encoding an antisense RNA, the DNA of (v) is a DNA having a catalytic action, and the DNA of (vi) encodes an endogenous α1,3-fucosyltransferase. DNA that encodes a dsRNA (double-stranded RNA) complementary to the transcription product of the DNA.

  Further, “suppressing α1,3-fucosyltransferase activity” includes suppression of transcription of DNA and suppression of translation into protein. Also included is a decrease in expression as well as complete cessation of DNA expression.

  This DNA can suppress the α1,3-bond of fucose to the N-acetylglucosamine residue present at the reducing end of the sugar chain core structure in the order of the eggplant.

(3) Recombinant vector of the present invention The present invention also provides a recombinant vector comprising the suppression DNA described in (2).

  The vector into which the DNA for suppression is inserted is not particularly limited as long as the transgene can be expressed in the cell. For example, it may be a vector having a promoter (for example, cauliflower mosaic virus 35S promoter) for constitutive gene expression in plant cells, or a vector having a promoter whose activity is induced by an external stimulus. The suppression DNA of the present invention can be inserted into a vector by a known method, for example, by a ligase reaction using a restriction enzyme site.

  In the vector, various markers may be used in order to confirm whether the transgene has been introduced into the host cell or whether it has been reliably expressed in the host cell. For example, when E. coli is used as a host cell, a gene for selecting transformed E. coli (for example, a drug resistance gene such as kanamycin or ampicillin) may be incorporated as a marker gene. Examples of vectors other than E. coli include insect cell-derived expression vectors, plant-derived expression vectors, and retrovirus-derived expression vectors.

  The vector into which the DNA for suppression is inserted can be introduced into cells by methods known to those skilled in the art, such as polyethylene glycol method, electroporation method, Agrobacterium method, particle gun method and the like.

  The host cell into which the vector of the present invention is introduced is not particularly limited, and various host cells can be used depending on the purpose. For example, bacterial cells (such as E. coli), fungal cells (such as yeast), insect cells (such as silkworms), animal cells (such as CHO), plant cells, and the like.

  With this recombinant vector, the DNA for suppression can be efficiently expressed in cells.

(4) The transformed cell, the transformant, the propagation material of the present invention, and the method for producing the transformant The present invention also includes the suppression DNA described in (2) or the recombinant vector described in (3). Transformed cells introduced, transformants created from the transformants, transformants that are descendants or clones of the transformants, propagation materials for these transformants, and methods for producing these transformants I will provide a. Specifically, this method
(E1) a step of introducing a suppressive DNA into a cell derived from a solanaceous eye,
(E2) comprising a step of selecting a transformed plant from a plant having the cells.

  Here, the transformed cell of the present invention is not particularly limited as long as it is a cell or a collection of cells into which a suppressor DNA or a recombinant vector has been introduced and can regenerate a plant as a transformant. The transformed cells of the present invention include, for example, callus, leaf sections, protoplasts and the like.

  Transformed cells into which the recombinant vector has been introduced can be selected using various methods depending on the predetermined marker gene introduced into the vector. For example, when a drug resistance gene is introduced as a marker gene, it is necessary to culture in a known selection medium having a suitable selection drug according to a predetermined drug resistance gene introduced into the vector. is there. As a result, transformed cultured cells can be obtained.

  Various methods known to those skilled in the art can be adopted as a method for producing a transformant from a transformed cell, depending on the type of the cell. For example, in the case of a tomato, callus may be formed in a medium containing a predetermined drug, and rooting may be confirmed, and then acclimatized to culture soil.

  The DNA introduced into the transformed cells and transformants can be confirmed by methods known to those skilled in the art, such as hybridization and PCR, or by analyzing the DNA base sequence of plants.

  In addition, by introducing a suppressor DNA into the chromosome of the transformant described above, it is possible to obtain offspring from this transformant by sexual reproduction or asexual reproduction. Furthermore, the transformant can be mass-produced by obtaining a propagation material (eg, seed, fruit, strain, callus, etc.) from the transformant or its progeny or clone.

(5) Method for suppressing α1,3-fucosyltransferase activity of the present invention The present invention also provides a method for suppressing α1,3-fucosyltransferase activity using the DNA for suppression described in (2). Specifically, this method
(F1) introducing a DNA for suppression into the cell,
(F2) comprising the step of expressing the DNA for suppression in the cell.

  The “step of introducing DNA into cells” can be performed using various methods known to those skilled in the art such as electroporation method and particle gun method. By the method (5) as described above, a vector containing the suppressor DNA in a state in which the suppressor DNA can be expressed is introduced into the cell, and therefore, α1,3-fucosyltransferase activity can be effectively suppressed.

(6) Recombinant protein of the present invention and method for producing the same The present invention also provides a recombinant protein to which a human-type sugar chain is added. This protein is obtained by introducing and expressing a vector containing DNA encoding the target protein into the transformed cell described in (4). This protein is a recombinant protein obtained from an animal or plant obtained by crossing the transformant described in (4) with a transformant containing a DNA encoding the target protein. Also good.

The present invention also provides a method for producing the above recombinant protein. Specifically, this method
(G1) a step of culturing a transformed cell containing the vector containing the suppression DNA described in (2),
(G2) a step of recovering the recombinant protein from the cell or the culture supernatant thereof.

  The recombinant protein obtained by this method is any protein to which a human-type sugar chain has been added. That is, it is a protein that does not have an α1,3-linkage of fucose to an N-acetylglucosamine residue present at the reducing end of the sugar chain core structure.

(7) Pharmaceutical Composition of the Present Invention The present invention also provides a pharmaceutical composition comprising the recombinant protein described in (6) and a pharmaceutically acceptable carrier. This carrier is suitable for delivery in the animal body, for example, surfactants, excipients, colorants, flavoring agents, preservatives, stabilizers, relaxants, suspending agents, isotonic agents, fluidity. Including, but not limited to, accelerators and the like, other commonly used carriers can be appropriately used. Specific examples include lactose, starch, mannitol, polyvinyl pyrrolidone, gelatin, polyvinyl acetal diethylaminoacetate, sucrose, corn starch and the like.

  Hereinafter, the present invention will be described in detail with reference to examples.

Example 2.1 Cloning of tomato α1,3-fucosyltransferase 2.1.1 cDNA preparation and RACE (rapid amplification of cDNA ends)
Freeze 0.5 g of the true leaves of the self-propagating fixed line of the tomato variety “Timely” (Takii seedling) with liquid nitrogen, grind it with a mortar and pestle, and follow the protocol using EASYPrep RNA (Takara Bio). Extraction was performed. Of these, 100 ng of total RNA was subjected to SMART RACE cDNA Amplification Kit (Clontech), and cDNA was prepared according to the attached protocol. In addition, 3′-RACE PCR and 5′-RACE PCR were performed using the prepared cDNA as a template.

For 3'-RACE PCR primers, use Universal Pro- mers A Mix and yama1 attached to the kit, and for 5'-RACE PCR primers use Universal Pro- mers A Mix and yama2 attached to the kit. The PCR reaction was performed according to the protocol.
For all these reactions, TaKaRa PCR Thermal Cycler GP (Takara Bio) was used.
Universal Providers A Mix:
Long5'-CTAATACGACTCACTATAGGGCAAGCAGTGGTATCAACGCAGAGGT-3 '
Short5'-CTAATACGACTCACTATAGGGC-3 '
yama1: 5′-CCATGGGGCTTGGAGGAGTGTGTT-3 ′
yama2: 5′-AACCACTCCTCCAGCCCCCCATGG-3 ′
yama1 and yama2 were prepared with reference to the partial sequence AW618836 isolated from Lycopersicon pennellii.

2.1.2 Cloning of RACE PCR product and transformation of Escherichia coli For cloning of RACE PCR product, TOPO TA Cloning Kit (Invitrogen life technologies) was tested, and pCR2.1-TOPO vector and PCR reaction solution were mixed according to the protocol. Then, a ligation reaction was performed. Next, E. coli TOP10 (genotype: F-mcrA Δ (mrr-hsdRMS-mcrBC) φ80lacZΔM15 ΔlacX74 recA1 araD139 Δ (ara-leu) 7697 galU galK rpsL (StrR) pendG1G1G1G1N1G1G1 2 μl of the reaction solution was added and allowed to stand on ice for 5 minutes, and then immersed in warm water at 42 ° C. for 40 seconds to carry out transformation treatment of E. coli TOP10. 500 μl of the SOC medium attached to the kit was added and left at 37 ° C. for 1 hour, and then applied to the surface of an LB solid medium (50 mg / l kanamycin added) dispensed in a sterile petri dish having a diameter of 9 cm. Cultured for ~ 24 hours. A single colony formed on the medium was transferred to a 3 ml LB liquid medium (50 mg / l kanamycin added) with a toothpick and cultured at 37 ° C. for 16 hours.

2.1.3 Extraction of plasmid DNA Transfer the E. coli culture grown in LB liquid medium to a 1.5 ml centrifuge tube and collect it in two portions at 15,000 rpm using a desktop centrifuge MTX-150 (TOMY). Fungus. Thereafter, Wizard Plus SV Miniprep (Promega) was tested, and plasmid DNA was extracted according to the protocol.

2.1.4 The sequence of the PCR product that was sequence-cloned was tested using BigDye Terminator v3.1 Cycle Sequencing Kit (Applied Biosystems), and 1 μg of each plasmid DNA was used as a template and M13FW or M13RV was used as a primer, and cycled according to the protocol. A sequence reaction was performed. In addition, after ethanol precipitation of the reaction solution, 10 μl formamide was added, the tube was boiled, and ABI PRISM 3100 Genetic Analyzer (Applied Biosystems) or ABI PRISM 3130 Genetic Analyzer (Applied Biosystems) was determined.
M13FW: 5′-TGTAAAACGAGCGCCAGT-3 ′
M13RV: 5'-CAGGAAACAGCTATGACC-3 '

2.1.5 Nested PCR
In order to clone the full length of the tomato α1,3-fucosyltransferase gene, yama3, yama4 at the end of the reading frame (Open Reading Frame) analogized from the gene sequences obtained by 5′-RACE PCR and 3′-RACE PCR , Yama5 and yama6 were prepared, and yama3 and yama4 were used for the 1st PCR, and yama5 and yama6 were used for the 2nd PCR.

  1st PCR was performed using 1 μl of the cDNA reaction solution prepared in the above-mentioned SMART RACE cDNA Amplification Kit (Clontech) as a template in the section 2.1.1, and then 2nd PCR using 1 μl of the reaction solution diluted 100 times as a template. Went.

For both 1st PCR and 2nd PCR, KOD-Plus- (TOYOBO) was adjusted to 0.2 μl and primer adjusted to 20 μM, 1 μl each, and the buffer attached to the polymerase and dNTPs were adjusted to a predetermined concentration. The reaction was carried out with TaKaRa PCR Thermal Cycler GP (Takara Bio) at a volume of 20 μl. The PCR reaction conditions were 30 cycles of 96 ° C. 10 seconds-54 ° C. 30 seconds-68 ° C. 3 minutes after preheating 96 ° C. 3 minutes for both 1st PCR and 2nd PCR.
yama3: 5'-GATACGCCAAAACCCCCTCTCCAGTATCCT-3 '
yama4: 5'-GAACCCACAAAAAACTACTATAGTCATAGC-3 '
yama5: 5'-CCAAGAAATTCAAGAAATCCGCTTGTTCTC-3 '
yama6: 5′-GCTAGAACTACTATATTCATGAGTATGGGAAG-3 ′

2.1.6 Cloning of nested PCR product and transformation of Escherichia coli For cloning of nested PCR product, Zero Blunt TOPO PCR Cloning Kit (Invitrogen life technologies) was tested, and pCR-BluntII-TOPO vector and PCR reaction solution according to the protocol. And ligation reaction was performed. Next, E. coli TOP10 (genotype: F-mcrA Δ (mrr-hsdRMS-mcrBC) φ80lacZΔM15 ΔlacX74 recA1 araD139 Δ (ara-leu) 7697 galU galK rpsL (StrR) pendG1G1G1G1N1G1G1 2 μl of the reaction solution was added and allowed to stand on ice for 5 minutes, and then immersed in warm water at 42 ° C. for 40 seconds to carry out transformation treatment of E. coli TOP10. 500 μl of the SOC medium attached to the kit was added and left at 37 ° C. for 1 hour, and then applied to the surface of an LB solid medium (50 mg / l kanamycin added) dispensed in a sterile petri dish having a diameter of 9 cm. Cultured for ~ 24 hours. A single colony formed on the medium was transferred to a 3 ml LB liquid medium (50 mg / l kanamycin added) with a toothpick and cultured at 37 ° C. for 16 hours.

2.1.7 Sequence of full-length tomato α1,3-fucosyltransferase The plasmid was extracted and sequenced as described above in sections 2.1.3 and 2.1.4, and the full-length α1,3-fucosyltransferase gene was obtained. The sequence was performed. The sequence of the full-length tomato α1,3-fucosyltransferase gene is shown in FIG. At that time, in addition to the two types of primers, M13FW and M13RV, four types of primers, yama7, yama8, yama9 and yama10, prepared by primer walking were used.
yama7: 5'-CAATCTTTGTATAATTCTTG-3 '
yama8: 5'-GATATCATGGCTCCAGTAC-3 '
yama9: 5'-CATCTGATGCCCTTCAAAGC-3 '
yama10: 5'-CATTTCGTATAGTTGAAG-3 '

Example 2.2 Preparation of RNAi tomato transgenic vector 2.2.1 Preparation of RNAi-derived vector Tomato α1,3-fucosyltransferase gene to suppress the expression of tomato endogenous α1,3-fucosyltransferase gene An RNAi-inducing vector having the inverted repeat base sequence was prepared.

(1) Subcloning of sequence for vector construction A full-length tomato α1,3-fucosyltransferase gene was used as a template for inverted repeat base sequence, ATG500 was both yama11 and yama12 primers, and ATG600 fragments were both yama13 and yama14. Amplified by PCR with primers. As polymerase, 0.2 μl of KOD-Plus- (TOYOBO) and 1 μl of primer adjusted to 20 μM, respectively, further adjust the buffer and dNTPs attached to the polymerase to a predetermined concentration, and the final reaction volume of 20 μl. The reaction was carried out using TaKaRa PCR Thermal Cycler GP (Takara Bio). PCR reaction conditions were preheat 96 ° C. for 3 minutes, followed by 30 cycles of 96 ° C. for 10 seconds-60 ° C. for 30 seconds-68 ° C. for 1 minute.

The above-mentioned Zero Blunt TOPO PCR Cloning Kit (Invitrogen life technologies) was tested in the section 2.1.6, and the PCR products of ATG500 and ATG600 were cloned, and the sections described in the sections 2.1.3 and 2.1.4. Plasmid extraction and sequence confirmation were performed as described above.
yama11: 5′-GTCTAGACCCAAGAAATTCAAGAATCCCGCT-3 ′
yama12: 5'-GGAATTCGAAATTGGTTCCAAACTTACAT-3 '
yama13: 5′-GGAATTCTGTTGTCTCCAGCATATAGATTG-3 ′
yama14: 5′-GGAGCTCCCAAGAAATTCAAGAATCCCCT-3 ′

(2) Preparation of inverted repeat base sequence After digesting ATG600 fragment with EcoRI and XbaI and digesting pUC19 (Accession No. M77789) with EcoRI and XbaI, both fragments were digested with DNA Ligation Kit (Takara Bio) according to the protocol. Ligation was performed, and E. coli TOP10 was transformed in the same manner as in section 1.2. In addition, a single colony formed on an LB solid medium (added with 50 mg / l ampicillin) was transferred to a 3 ml LB liquid medium (added with 50 mg / l ampicillin) with a toothpick and cultured at 37 ° C. for 16 hours.

  Next, after digesting the ATG500 fragment with EcoRI and digesting pUC19 inserted with the ATG600 fragment with EcoRI, both fragments were ligated with DNA Ligation Kit (Takara Bio). Made a conversion.

  Furthermore, in order to select a colony on which the target fragment was formed, a single colony on LB solid medium (50 mg / l ampicillin added) was scraped off at the tip of a toothpick and directly immersed in a PCR reaction solution to form a PCR template. Direct PCR was performed. The reaction conditions were preheat 96 ° C. for 3 minutes, followed by 35 cycles of 96 ° C. 10 seconds-60 ° C. 30 seconds-72 ° C. 1 minute. Using both the aforementioned yama11 and yama14 primers, 1 μl each of the primers adjusted to TaKaRa EX Taq (Takara Bio) at 0.2 μl and 20 μM, and the buffer attached to the polymerase and dNTPs to a predetermined concentration The final reaction volume was adjusted to 20 μl, and the reaction was performed with TaKaRa PCR Thermal Cycler GP (Takara Bio). Thereafter, as a result of 1% agarose gel electrophoresis, colonies in which a band of about 1100 bp was confirmed were selected, and plasmids were extracted.

(3) Production of RNAi induction vector for transgenics, pBI121-FucTRNAi Replacing the tomato endogenous α1,3-fucosyltransferase gene with the inverted repeat base sequence (about 1100 bp) and the GUS gene of pBI121 (Accession No. AF4857873) By doing so, the RNAi induction vector for transgenics, pBI121-FucTRNAi was produced (FIG. 13).

  PUC19 inserted with ATG500 fragment and ATG600 fragment was digested with XbaI, SacI and HindIII, pBI121 was digested with XbaI, SacI and SnaBI, and both reaction solutions were ethanol precipitated and ligated with DNA Ligation Kit (Takara Bio). E. coli TOP10 was transformed in the same manner as in 2.1.2. A single colony on an LB solid medium (added with 50 mg / l kanamycin) was scraped off with a tip of a toothpick and directly immersed in a PCR reaction solution to obtain a PCR template, and colony direct PCR was performed. As in the above section (2), both the yama11 and yama14 primers were tested, and the polymerase was adjusted to 0.2 μl of TaKaRa EX Taq (Takara Bio), 1 μl of each primer adjusted to 20 μM, and further attached to the polymerase. The buffer and dNTPs were adjusted to a predetermined concentration, and the final reaction volume was 20 μl, and the reaction was performed with TaKaRa PCR Thermal Cycler GP (Takara Bio). Thereafter, colonies in which a band of about 1100 bp was confirmed as a result of 1% agarose gel electrophoresis were selected, and an RNAi induction vector (pBI121-FucTRNAi) was extracted.

2.2.2 Transformation of Agrobacterium pBI121-FucTRNAi was introduced into Agrobacterium tumefaciens LBA4404 strain (Clontech) in order to introduce the desired gene fragment into plants.

  LBA4404 cultured in 3 ml of LB liquid medium supplemented with 10 mg / l rifampicin and 250 mg / l streptomycin at 30 ° C. for 48 hours was collected in the same manner as in Section 2.1.3, and after removing the supernatant, pBI121-FucTRNAi extract Suspend in 15 μl and immediately treat the tube with liquid nitrogen for 5 minutes. Thereafter, treatment with warm water of 37 ° C. for 15 minutes and liquid nitrogen for 5 minutes was repeated three times, 500 μl of LB medium was added, and the mixture was allowed to stand at 30 ° C. for 3 hours. The treated liquid was spread on LB solid medium supplemented with 10 mg / l rifampicin, 250 mg / l streptomycin and 50 mg / l kanamycin, and cultured at 30 ° C. for 3 days to confirm single colonies.

Example 2.3 Production of transgenic tomato 2.3.1 Aseptic seeding of tomato Tomato varieties “Timely” (Takii seedling) self-propagating fixed lines were tested, and the tomatoes were made in a non-woven bag (3 cm × 3 cm). Twenty-five seeds were subdivided, stapled, and sterilized for 15 minutes in a sterilized plant box (Wako) with 50 ml of 1% antiformin added with one drop of tween20. Thereafter, the seeds were washed three times with 100 ml of sterilized water, and the seeds taken out from the bag were arranged on a 30 ml 1 / 2MS medium dispensed in a plant box (Wako), and 9-10 days in a culture room at 25 ° C. for 16 hours. Left to stand.
1 / 2MS medium:
2.2 g / l MURASHIGE AND SKOOG BASAL MADIUM (SIGMA Cat. No. M5519),
15 g / l sucrose,
0.8% Agar
pH 5.8

2.3.2 Preculture The cotyledons of seedlings 9 to 10 days after aseptic seeding are cut into approximately 5 mm squares and sectioned on an ST-1 medium that is dispensed about 30 ml into a sterile petri dish 2 cm deep and 9 cm in diameter. Was placed. The lid was fixed with Parafilm (Hitech), and allowed to stand for 24 hours in a culture room at 25 ° C. for 16 hours.
ST-1 medium:
4.4 g / l MURASHIGE AND SKOOG BASAL MADIUM (SIGMA Cat. No. M5519),
30 g / l sucrose,
1mg / l trans-Zeatin
0.8% Agar
pH 5.8

2.3.3 Co-culture The culture solution of LBA4404 into which pBI121-FucTRNAi was introduced was adjusted to OD600 = 0.1 with water or LB medium, and the precultured tomato slices were immersed. Then, about 2 ml feeder cell was apply | coated on the ST-1 culture medium used by preculture, the sterile filter paper was set | placed from it, and the section | seat was placed by turning over. It was wrapped in aluminum foil and co-cultured for 3 days in the dark at 25 ° C.
Feeder cell: Tobacco suspension cell BY-2 was suspended and cultured in TS-1 medium (about 100 rpm) and subcultured by adding 0.5 ml of suspended cells to 40 ml of fresh TS-1 medium every week.
TS-1 medium:
4.4 g / l MURASHIGE AND SKOOG BASAL MADIUM (SIGMA Cat. No. M5519),
30 g / l Sucrose, 0.01 mg / l thiamine HCl, 1 mg / l myo-inositol, 1.7 mg / l KH2PO4,
0.2 mg / l 2,4-D, pH 5.8

2.3.4 Selection culture Sections after co-culture were transplanted onto ST-1 medium supplemented with 200 mg / l carbenicillin and 50 mg / l kanamycin, the lid was fixed with surgical tape, and 2 in a culture room at 25 ° C. for 16 hours. Let stand for a week.

2.3.5 Subculture Cultured sections were transplanted onto a new ST-1 medium supplemented with 200 mg / l carbenicillin and 50 mg / l kanamycin, and allowed to stand in a culture room at 25 ° C. for 16 hours. Thereafter, the section in which callus was formed during the culture and the shoots were elongated was transplanted into a plant box on MS medium supplemented with 100 mg / l relacillin and 50 mg / l kanamycin.

In addition, shoots extending 2 cm or more in the plant box were cut out and transplanted onto MS medium supplemented with 100 mg / l relacillin and 50 mg / l kanamycin to confirm the presence or absence of rooting.
MS medium:
4.4 g / l MURASHIGE AND SKOOG BASAL MADIUM (SIGMA Cat. No. M5519),
30 g / l Sucrose, 0.8% Agar, pH 5.8

2.3.6 Confirmation of transgene When shoots rooted in kanamycin-added medium extend to about 10 cm, total DNA is extracted according to Edwards et al. (1991) Nucleic Acids Research 19 (6): 1349, and PCR template It was. yama15 and yama16 were used as primers for detection of selection markers. TaKaRa EX Taq (Takara Bio) was 0.2 μl for the polymerase, 1 μl each of the primers adjusted to 20 μM, and a buffer attached to the polymerase, dNTPs, was specified. The final reaction volume was adjusted to 20 μl, and the reaction was carried out with TaKaRa PCR Thermal Cycler GP (Takara Bio). The reaction conditions were preheat 96 ° C. for 3 minutes, followed by 35 cycles of 96 ° C. 10 seconds-60 ° C. 30 seconds-72 ° C. 1 minute. Then, acclimatization was performed about the strain | stump | stock in which the band of about 800 bp was confirmed as a result of 1% agarose gel electrophoresis.
yama15: 5'-GGGATCCATGATTGAACAAGATG-3 '
yama16: 5′-GGGATCCTCAGAAGAACTCGTC-3 ′

2.3.7 Acclimation For shoots that have been confirmed to have been introduced by PCR, place them in a 10.5 cm plastic pot containing vermiculite and Nippi Horticulture soil in a greenhouse for recombinant plants. Acclimatization was performed by gradually lowering the humidity. In addition, after acclimatization, strains that grew vigorously were transplanted into 18 cm vinyl pots.

Example 2.4 Detection of tomato α1,3-fucosyltransferase gene by RT-PCR Sampling was carried out from 22 transformants cultivated in a greenhouse for recombinant plants. RNA was extracted, and cDNA was prepared using a Cloned AMV First-Strand cDNA Synthesis kit (Invitrogen life technologies).

For each sample, 100 ng of total RNA was used as a template, 50 ng and 1 ng of Random Hexamers attached to the kit and yama17 complementary to the α1,3-fucosyltransferase gene were added, respectively, and a reverse transcription reaction was performed according to the protocol. The temperature condition is 50 ° C. for 30 minutes—55 ° C. for 15 minutes—60 ° C. for 15 minutes—65 ° C. for 15 minutes, 1 μl of this reaction solution is used as a template for PCR, and yama3 and yama12 are tested to transcribe α1,3-fucosyltransferase gene. Check the amount. For the polymerase, TaKaRa EX Taq (Takara Bio) was adjusted to 0.2 μl and 1 μl each of the primers adjusted to 20 μM, the buffer attached to the polymerase and dNTPs were adjusted to a predetermined concentration, and the final reaction volume was 20 μl. The reaction was carried out using TaKaRa PCR Thermal Cycler GP (Takara Bio). The reaction conditions were preheat 96 ° C. for 3 minutes and then 40 cycles of 96 ° C. 10 seconds-62 ° C. 30 seconds-72 ° C. 1 minute. Thereafter, as a result of 1% agarose gel electrophoresis (FIG. 14), a strain in which a band of about 560 bp was not confirmed or a thin strain was subjected to sugar chain analysis of all proteins.
yama17: 5'-TGTTGTTCTCAGCATAGATTTG-3 '

Example 2.5 Preparation of sugar chain from transgenic tomato No. of wild-type tomato and transformant tomato About 40 g of leaves of 1,9,14 were frozen with liquid nitrogen, crushed in a mortar, and the sample was thawed and centrifuged at 4 ° C., 12,000 rpm for 15 minutes. A sufficient amount of ice-cooled acetone was added to the supernatant, and the mixture was allowed to stand in ice and centrifuged at 4 ° C., 12,000 rpm for 20 minutes to precipitate glycoprotein (about 500 mg). After freeze-drying the obtained pellet, a sufficient amount of anhydrous hydrazine (Nacalai tesque) was added and mixed, and the sugar chain was cut out by incubating at 100 ° C. for 10 hours.

  The hydrazine degradation product after the reaction was added to excess ice-cooled acetone, and after standing, the pellet obtained by centrifugation at 4 ° C., 12,000 rpm for 20 minutes was dried. To the pellet, 2 ml of saturated sodium hydrogen carbonate (Wako) and 80 μl of acetic anhydride (Wako) were added and mixed, and N-acetylation was performed at room temperature. Next, an ion exchange resin Dowex 50 × 2 (Muromachi Chemical Industry) equilibrated with 1N HCl was added to the sample until the pH of the sample was close to 2, followed by desalting. The resin and the solution were separated by filtration on glass wool, and the sample was concentrated using an evaporator. The concentrated sample was subjected to column chromatography using a TSK gel Toyopearl HW-40 (Tosoh) column (2.5 × 30 cm) equilibrated with 0.1N aqueous ammonia. A fraction containing a sugar was selected from each fraction of a sample fractionated by 4 ml by Model 2128 Fraction Collector (Bio-Rad) using a phenol / sulfuric acid method. The fraction containing sugar was collected, concentrated using an evaporator, and lyophilized.

After lyophilization, an appropriate amount of a PA reagent (prepared by mixing 200 μl of acetic acid (Wako) to 552 mg of 2-aminopyridine (Wako)) was added and incubated at 90 ° C. for 1 hour. After cooling at room temperature, an equal amount of a reducing reagent (prepared by mixing 200 μl of acetic acid with 39 mg of dimethylaminoborane (Wako)) was added and incubated at 80 ° C. for 40 minutes. When the reaction was stopped, an equal amount of dH2O was added. The obtained PA sample was subjected to column chromatography using a TSK gel Toyopearl HW-40 (Tosoh) column (2.5 × 30 cm) equilibrated with 0.1N aqueous ammonia. Measure fluorescence intensity at 320 nm excitation and 400 nm fluorescence using fluorescence spectrophotometer (F-2000 Fluorescence Spectrophotometer, Hitachi) for each fraction of sample collected in 4 ml fractions using Model 2128 Fraction Collector (Bio-Rad) did. Fractions containing PA sugar chains were collected from the results after fluorescence intensity measurement, and concentrated using an evaporator. Each PA sugar chain was further purified using Cellulose Cartridge loaded with Cellulose in a column 1), and the purified fraction was further subjected to centrifugal drying, and concentrated and dried.
1) Shimizu Y, Nakata M, Kuroda Y, Tsutsumi F, Kojima N, and Mizuchirichi T-3 (2001) Rapid and simple preparation of N-linked oligosaccharic.

Example 2.6 Analysis of glycoprotein sugar chain of transgenic tomato 2.6.1 High performance liquid chromatography (HPLC) analysis The analysis was performed using a HITACHI HPLC system with HITACHI FL Detector L-7480. During the reverse phase HPLC (RP-HPLC) analysis, the column was a Cosmosil 5C18-P (6 × 250 mm; Nacalai tespue) column. The solvent used in reverse phase HPLC and the gradient at each time are shown below.
solventA: 0.02% Trifluoroacetic Acid
solventB: 20% Aceticitile / 0.2% Trifluoroacetic Acid
Gradient: 0 → 20 → 0% solventB (5 → 40 → 41min)
Flow rate: 1.2 ml / min
Detection: Fluorescence (Ex; 310 nm, Em; 380 nm)
Column temp. : 30 ° C

During normal phase HPLC (SF-HLC) analysis, an Asahipak NH2P-50 (4.6 × 250 mm; Showa denko) column was used. The solvent used in normal phase HPLC and the gradient at each time are shown below.
solventA: 80% Acetenatorile
solventB: 20% Acetenatorile
Gradient: 10 → 50 → 10% solventB (5 → 25 → 26 min)
Flow rate: 0.7 ml / min
Detection: Fluorescence (Ex; 310 nm, Em; 380 nm)
Column temp. : 30 ° C

  Each peak was collected, the molecular weight was measured by MALDI-TOF-MS analysis, and the estimated sugar chain structure of each peak was analyzed.

2.6.2 Mass spectrometry by MALDI-TOF-MS MALDI-TOF MS analysis was performed using autoflex (BRUKER DALTONICS). The laser intensity was 1800 to 2000 mbar. The data was obtained under a vacuum of 3.0 × e-7 or less. Dissolve 10 mg of 2,5-dihydroxybenzoic acid (Sigma) in a mixed solution of dH2O: acetontrile = 1: 1 as a matrix reagent, mix the PA reagent sugar chain dissolved in dH2O with an equal amount of matrix reagent, 2 μl of the solution was placed on a target, dried at room temperature and crystallized, and then reflector mode analysis was performed.

2.6.3 Glycosidase Digestion N-acetyl-β-glucosaminidase (Diplococcus pneumoniae, Roche Diagnostics KK) digestion was performed using 50 μl of enzyme solution (10 pmol PA-glycosylated, 3 mU N-acetyl-β-glucosaminidase. 50 mM sodium acetate buffer solution (pH 4.0) containing was incubated at 37 ° C. for 3 days. In addition, digestion with α-mannosidase (jack bean, Sigma) was performed using 37 μl of 50 μl enzyme solution (10 pmol PA-glycosylated, 10 μU α-mannosidase, 50 mM sodium acetate buffer (pH 4.0) containing 10 mM zinc acetate). This was performed by incubating at 3 ° C. for 3 days. Each enzyme reaction was stopped by boiling for 5 minutes, centrifuged at 4 ° C., 12,000 rpm for 5 minutes, and the supernatant was subjected to SF-HPLC. Furthermore, the PA sugar chain confirmed to be digested was subjected to RP-HPLC, and the elution position of the enzyme reaction product was compared with a known PA sugar chain (Takara) to determine each structure.

2.6.4 Transformant No. 1
Transformant No. The sugar chain structure of one leaf soluble protein was performed. Transformant No. The sugar chain separated from one leaf and converted to PA was fractionated into 10 fractions using an ODS column (FIG. 15), and each fraction was fractionated using an amide column (FIG. 16). Each fraction collected was subjected to mass spectrometry by MALDI-TOF-MS, and the sugar chain structure contained in each fraction was estimated. Note that the fractions (1-a, 1-b, 1-c, 2-d, 3-1, 3-2, 3-3, 3-a, 3-b, 4-c, 5-a, 5-b, 5-d, 5-e, 5-f, 5-g, 6-d, 7-a, 7-b, 7-d) have peaks due to MALDI-TOF-MS. It was judged that there was no sugar chain because it did not exist or did not match the molecular weight of a possible sugar chain. Based on the sugar chain structure predicted from the mass spectrometry results, the position of the standard sugar chain and the peak were compared by HPLC using an ODS column. Further, when the non-reducing end is N-acetylglucosamine, digestion is performed with N-acetylglucosaminidase (derived from Diplococcus pneumomoae), and mannose is digested with α-mannosidase (derived from jack bean). The elution position was compared with the standard sugar chain, and the structure with the peak matched was identified as the sugar chain. 2-b, 2-c and 8-a are M3X, 5-c is Gn2M3FX, 6-a is M2FX, 6-b is GnM3FX, 7-c and 8-b are GnM3X (A), 9-a is Gn2M3X 10-b was determined to contain GnM3X (B). For the sugar chains considered to be Man3FucXylGclNAc type 2 sugar chains (M3FX), Man3XylGclNAc type 2 sugar chains (M3X), and high mannose type, the elution positions of the ODS column and amide column were compared with the corresponding standard sugar chains [4-a (M3FX), 4-d (M9), 6-c (M6B), 8-a (M3X)]. It was judged that the fraction that did not coincide with the peak of the sugar chain having the sugar chain structure estimated from the molecular weight did not contain an N-linked sugar chain (2-e, 4-b, 7-e, 8-b, 10-a). Based on the peak area by HPLC using an amide column for each fraction, the abundance for each sugar chain structure was calculated (FIG. 17).

2.6.5 Transformant No. 9
Transformant No. Nine leaf soluble protein sugar chain structures were performed. Transformant No. The sugar chain separated from 9 leaves and converted to PA was fractionated into 10 fractions using an ODS column (FIG. 15), and each fraction was fractionated using an amide column (FIG. 18). Each fraction collected was subjected to mass spectrometry by MALDI-TOF-MS, and the sugar chain structure contained in each fraction was estimated. Note that the fractions (1-a, 1-b, 1-c, 1-d, 1-e, 2-d, 2-f, 3-1, 3, 2, 3-c, 3-d, 4-b, 4-c, 4-d, 4-e, 5-a, 5-b, 5-e, 5-f, 5-g, 6-b, 6-f, 7- a, 7-d, 8-c, 9-b, 9-c, 10-a, 10-c, 10-d) no peak due to MALDI-TOF-MS, or possible sugar chain Since it did not agree with the molecular weight, it was judged that there was no sugar chain. Based on the sugar chain structure predicted from the mass spectrometry results, the position of the standard sugar chain and the peak were compared by HPLC using an ODS column. Further, as above, digestion was performed with N-acetylglucosaminidase (derived from Diplococcus pneumomoae) and α-mannosidase (derived from jack bean), and the peak elution position was compared with the standard sugar chain using an ODS column and an amide column. The structure was identified using sugar as a sugar chain. It was determined that 5-c contained Gn2M3FX, 6-a contained M2FX, 6-d contained GnM3FX, 9-a contained Gn2M3X, and 10-b contained GnM3X. For the sugar chain considered to be Man3FucXylGclNAc type 2 sugar chain (M3FX), Man3XylGclNAc type 2 sugar chain (M3X), and high mannose type, the elution position of the ODS column and amide column was compared with the corresponding standard sugar chain [2-a (M3X), 2-b (M3X), 4-a (M3FX), 6-e (M6B), 8-d (M5A)]. It was determined that the fraction that did not coincide with the peak of the sugar chain having the sugar chain structure estimated from the molecular weight did not contain an N-linked sugar chain (2-e, 2-f, 3-a, 3-b, 5-d, 6-c, 7-b, 7-c, 7-e). Based on the peak area by HPLC using an amide column for each fraction, the abundance of each sugar chain structure was calculated. (Fig. 17)

2.6.6 Transformant No. 14
Transformant No. The sugar chain structure of one leaf soluble protein was performed. Transformant No. The sugar chain separated from one leaf and converted to PA was fractionated into 7 fractions using an ODS column (FIG. 15), and each fraction was fractionated using an amide column (FIG. 19). Each fraction collected was subjected to mass spectrometry by MALDI-TOF-MS, and the sugar chain structure contained in each fraction was estimated. Note that the fractions (1-a, 1-d, 2-c, 3-b, 4-1, 4-d, 4-e, 5-a, 5-b, 5-e, 5-f, 5-g, 6-e, 6-f, 7-a, 7-e, 7-f) does not have a peak due to MALDI-TOF-MS, or the molecular weight of a possible sugar chain It was judged that there was no sugar chain because they did not match. Based on the sugar chain structure predicted from the mass spectrometry results, the position of the standard sugar chain and the peak were compared by HPLC using an ODS column. Further, in the same manner as above, digestion was performed with N-acetylglucosaminidase (derived from Diplococcus pneumomoae) and α-mannosidase (derived from jack bean), and the peak elution positions were compared with standard sugar chains using an ODS column and an amide column. The structure was identified using sugar as a sugar chain. It was determined that 3-a includes GnM3FX, 5-c includes Gn2M3FX, 6-b includes M2FX, 6-c includes GnM3FX, and 7-b includes M3X. In addition, for the sugar chain considered to be Man3FucXylGclNAc type 2 sugar chain (M3FX) and high mannose type, the elution positions of the ODS column and the amide column were compared with the corresponding standard sugar chains [3-c (M8A), 4-a ( M3FX), 4-c (M7A), 5-d (M7B), 6-d (M6B), 7-d (M5A)]. It was determined that the fraction that did not coincide with the peak of the sugar chain having the sugar chain structure estimated from the molecular weight did not contain an N-linked sugar chain (1-b, 1-c, 2-a, 2-b, 2-d, 4-b, 6-a, 7-c). Based on the peak area by HPLC using an amide column for each fraction, the abundance of each sugar chain structure was calculated. (Fig. 17)

2.6.7 Wild-type tomato The sugar chain structure of the soluble protein of wild-type tomato leaves was performed. The sugar chains separated from the leaves of wild-type tomatoes and converted to PA were fractionated into 9 fractions using an ODS column (FIG. 15), and each fraction was fractionated using an amide column (FIG. 20). Each fraction collected was subjected to mass spectrometry by MALDI-TOF-MS, and the sugar chain structure contained in each fraction was estimated. In addition, the fractions (1-a, 1-b, 1-c, 2-a, 3-a, 3-c, 4-c, 4-d, 5-b, 5-d, not shown in the table) 5-e, 5-f, 5-g, 6-c, 6-d, 6-e, 7, 8-a, 8-c, 8-d, 9) have peaks due to MALDI-TOF-MS. It was judged that there was no sugar chain because it did not exist or did not match the molecular weight of a possible sugar chain. Based on the sugar chain structure predicted from the mass spectrometry results, the position of the standard sugar chain and the peak were compared by HPLC using an ODS column. Further, as above, digestion was performed with N-acetylglucosaminidase (derived from Diplococcus pneumomoae) and α-mannosidase (derived from jack bean), and the peak elution position was compared with the standard sugar chain using an ODS column and an amide column. The structure was identified using sugar as a sugar chain. It was determined that 5-c contained Gn2M3FX, 6-a contained M2FX, and 6-b contained GnM3FX. For the sugar chains considered to be Man3FucXylGclNAc type 2 sugar chains (M3FX), Man3XylGclNAc type 2 sugar chains (M3X), and high mannose type, the elution positions of the ODS column and amide column were compared with the corresponding standard sugar chains [4-a (M3FX), 5-a (M3FX), 8-b (M3X)]. It was judged that the fraction that did not coincide with the peak of the sugar chain having the sugar chain structure estimated from the molecular weight did not contain an N-linked sugar chain (2-b, 2-c, 3-b, 4-b). Based on the peak area by HPLC using an amide column for each fraction, the abundance for each sugar chain structure was calculated (FIG. 17).

As a result of the experiment, 93.2% of wild-type tomatoes, transformant No showing no transcriptional repression
. 14, fucose was added to 78.2% of the sugar chains, whereas transformant No1. 23.4%, no. It was found that 9 showed a marked suppression of fucose addition at 31.4% (FIG. 21).

FIG. 1 shows the cloning conditions for silkworm α1,3-fucosyltransferase. FIG. 2 is a view showing a silkworm genome sequence showing high homology with the active motif region of Drosophila-derived fucosyltransferase A. FIG. 3 is a diagram showing PCR amplification of exon regions of silkworm α1,3-fucosyltransferase candidate genes using silkworm genomic DNA as a template. FIG. 4A is a diagram showing a method for preparing a plasmid for RNAi of silkworm α1,3-fucosyltransferase. FIG. 4B is a view showing a method for preparing a silkworm α1,3-fucosyltransferase RNAi plasmid. FIG. 5 is a diagram showing a vector for silkworm α1,3-fucosyltransferase RNAi. FIG. 6 is a diagram showing purification using a reverse phase column of a PA protein sugar chain derived from HA protein expressed in a control silkworm. FIG. 7 is a diagram showing purification using an amide column of a PA protein sugar chain derived from HA protein expressed in a control silkworm. FIG. 8 is a diagram showing purification using a reverse phase column of a HA protein-derived PA sugar chain expressed in an α1,3-fucosyltransferase-inhibited silkworm. FIG. 9 is a diagram showing purification using an amide column of a PA protein sugar chain derived from HA protein expressed in a fucosyltransferase-inhibited silkworm. FIG. 10 is a diagram showing primers for amplifying the Kaikofucosyltransferase gene. FIG. 11 is a diagram showing a comparison of RNAi effects of each dsRNA in silkworms. FIG. 12 shows the full-length gene sequence of tomato α1,3-fucosyltransferase. FIG. 13 is a diagram showing a vector for RNAi of tomato α1,3-fucosyltransferase. FIG. 14 is a diagram showing detection of α1,3-fucosyltransferase gene from transformed tomato by RT-PCR. FIG. 15 is a diagram showing analysis of a transformant and a wild-type PA-glycan by reverse phase HPLC. FIG. 16 shows transformant no. It is a figure which shows the analysis by normal phase HPLC of PA-ized sugar chain derived from No. 1. FIG. 17 is a diagram showing the results of sugar chain structure analysis. FIG. 18 shows transformant no. It is a figure which shows the analysis by normal phase HPLC of PA-ized sugar chain derived from 9. FIG. 19 shows transformant no. It is a figure which shows the analysis by normal phase HPLC of PA-ized sugar chain derived from 14. FIG. 20 is a diagram showing analysis by PA of a PA sugar chain derived from wild-type tomato. FIG. 21 is a diagram showing the results of sugar chain structure analysis.

Claims (22)

  A DNA encoding a protein having α1,3-fucosyltransferase activity of Lepidoptera. In the DNA of claim 1,
The DNA encodes a protein having silkworm α1,3-fucosyltransferase activity. The DNA of claim 1,
DNA according to any one of (a) to (d) below:
(A) DNA encoding a protein consisting of the amino acid sequence set forth in SEQ ID NO: 1,
(B) DNA containing the coding region of the base sequence set forth in SEQ ID NO: 2;
(C) a protein comprising an amino acid sequence in which one or more amino acids are substituted, deleted, added, and / or inserted in the amino acid sequence described in SEQ ID NO: 1, and the amino acid sequence described in SEQ ID NO: 1 DNA encoding a protein having the same function as the protein consisting of
(D) a DNA that hybridizes under stringent conditions with a DNA comprising the nucleotide sequence set forth in SEQ ID NO: 2, and which encodes a protein having a function equivalent to that of the protein comprising the amino acid sequence set forth in SEQ ID NO: 1 DNA to do.   A DNA encoding a protein having the activity of α1,3-fucosyltransferase of an eggplant. In the DNA of claim 4,
The DNA encodes a protein having tomato α1,3-fucosyltransferase activity. The DNA according to claim 4, wherein
DNA according to any of (e) to (h) below;
(E) DNA encoding a protein consisting of the amino acid sequence set forth in SEQ ID NO: 3;
(F) DNA containing the coding region of the base sequence set forth in SEQ ID NO: 4;
(G) a protein comprising an amino acid sequence in which one or more amino acids are substituted, deleted, added, and / or inserted in the amino acid sequence set forth in SEQ ID NO: 3, and the amino acid sequence set forth in SEQ ID NO: 3 DNA encoding a protein having the same function as the protein consisting of
(H) a DNA that hybridizes under stringent conditions with a DNA comprising the nucleotide sequence set forth in SEQ ID NO: 4, and which encodes a protein having the same function as the protein comprising the amino acid sequence set forth in SEQ ID NO: 3 DNA to do. DNA according to any one of (i) to (iii) below, which suppresses α1,3-fucosyltransferase activity in Lepidoptera:
(I) DNA encoding RNA complementary to the transcription product of DNA according to any one of claims 1 to 3,
(Ii) a DNA encoding an RNA having a ribozyme activity that specifically cleaves the transcript of the DNA according to any one of claims 1 to 3;
(Iii) DNA encoding RNA having RNAi activity that specifically cleaves the transcription product of DNA according to any one of claims 1 to 3. DNA according to any one of (iv) to (vi) below, which suppresses α1,3-fucosyltransferase activity in the order of eggplant;
(Iv) DNA encoding RNA complementary to the transcription product of DNA according to any one of claims 4 to 6,
(V) a DNA encoding an RNA having a ribozyme activity that specifically cleaves the transcript of the DNA according to any one of claims 4 to 6;
(Vi) DNA encoding RNA having RNAi activity that specifically cleaves the transcription product of DNA according to any one of claims 4 to 6.   A recombinant vector comprising the DNA according to claim 7 or 8.   A transformed cell transformed with the recombinant vector according to claim 9.   A transformant obtained from the transformed cell according to claim 10.   The transformant which is a descendant or clone of the transformant of Claim 11.   The propagation material of the transformant according to any one of claims 11 and 12. A method for producing the transformant according to claim 11, comprising:
Introducing the DNA of claim 7 into lepidopteran eggs;
Selecting a transformed animal from an animal body produced from an egg into which the DNA has been introduced. A method for producing the transformant according to claim 11, comprising:
A step of introducing the DNA according to claim 8 into a cell derived from a solanaceous eye;
Selecting a transformed plant from a plant having the cell. A method for inhibiting α1,3-fucosyltransferase activity comprising:
Introducing the DNA according to claim 7 or 8 into a cell;
A step of expressing the DNA in the cell.   A recombinant protein obtained by introducing and expressing a vector containing DNA encoding a target protein into a transformed cell or transformant containing the DNA according to claim 7 or 8. A method for producing the protein of claim 17, comprising:
Culturing a transformed cell or transformant comprising the DNA according to claim 7 or 8, and
Recovering the recombinant protein from the transformed cell or transformant or culture supernatant thereof.   A recombinant protein obtained by infecting a transformed cell or transformant containing the DNA according to claim 7 with a baculovirus in which a DNA encoding the target protein is incorporated. A method for producing the protein of claim 19, comprising:
Infecting a transformed cell or transformant containing the DNA of claim 7 with a baculovirus incorporating a DNA encoding the protein of interest;
Recovering the recombinant protein expressed in the transformed cell or transformant.   A recombinant protein obtained from an animal or plant obtained by crossing a transformant containing the DNA according to claim 7 and a transformant containing DNA encoding the target protein.   A pharmaceutical composition comprising the protein according to any one of claims 17, 19 and 21, and a pharmaceutically acceptable carrier.

Images