JP2009235044A - ENDOTHELIN-1 mRNA EXPRESSION INHIBITOR, MATRIX METALLOPROTEASE-9 mRNA EXPRESSION INHIBITOR, COLLAGEN PRODUCTION PROMOTER, PROFILAGGRIN PRODUCTION PROMOTER, FILAGGRIN PRODUCTION PROMOTER AND AQUAPORIN 3 mRNA EXPRESSION PROMOTER - Google Patents

Abstract

<P>PROBLEM TO BE SOLVED: To provide an endothelin-1 mRNA expression inhibitor, matrix metalloprotease-9 mRNA expression inhibitor, collagen production promoter, profilaggrin production promoter, filaggrin production promoter and aquaporin 3 mRNA expression promoter, containing natural extracts. <P>SOLUTION: The endothelin-1 mRNA expression inhibitor, matrix metalloprotease-9 mRNA expression inhibitor, collagen production promoter, profilaggrin production promoter, filaggrin production promoter or aquaporin 3 mRNA expression promoter, contains extracts from butcher's broom as active ingredients. <P>COPYRIGHT: (C)2010,JPO&INPIT

Description

  The present invention relates to an endothelin-1 mRNA expression inhibitor, a matrix metalloprotease-9 mRNA expression inhibitor, a collagen production promoter, a profilagrin production promoter, a filaggrin production promoter, and an aquaporin 3 mRNA expression promoter.

  Spots, buckwheat, skin pigmentation after sunburn, etc. occur as a result of markedly increased production of melanin due to activation of pigment cells (melanocytes) present in the skin. It has become one of the troubles.

  Conventional whitening agent development has been focused on tyrosinase, the rate-limiting enzyme for melanin production. Recently, alpha-melanocyte is produced as a cytokine that is produced from epidermal keratinocytes after UV-B irradiation and activates melanocytes. Stimulating hormone (α-MSH), endothelin-1 (ET-1), nitric oxide (NO), and the like are known, and the production of melanin is suppressed by blocking the information transmission system involved in these and whitening. Various agents that lead to the effect have been actively developed.

  In patients with cardiovascular diseases (for example, myocardial infarction, hypertension, ischemic heart disease, etc.) or renal diseases (for example, acute renal failure, etc.), blood endothelin-1 (ET-1) concentration increases. Since it is known that, by inhibiting excessive secretion of endothelin-1 (ET-1), that is, by suppressing the increase in the expression of endothelin-1 mRNA, the prevention / treatment effect of these diseases can be expected. Conceivable.

  Based on this idea, chamomile extract, artea extract (see Non-Patent Document 1) and the like are known as herbal medicines that inhibit the action of endothelin-1 (ET-1) on melanocytes, and epidermal keratinocytes are known. As herbal medicines that suppress endothelin-1 (ET-1) production from cucumber, diu extract (see Non-patent Document 1), β-glycyrrhetinic acid stearyl (see Patent Document 1) and the like are known.

  The skin is composed of the stratum corneum, epidermis, basement membrane and dermis. The basement membrane exists in the epidermis dermis boundary part, and plays an important role not only to connect the epidermis and dermis but also to maintain skin function (see Non-Patent Document 2). The main skeleton of the basement membrane has a network structure made of type IV collagen. Various glycoproteins mainly composed of laminin 5 exist at the boundary between the basement membrane and the epidermis and connect the basement membrane and the epidermis. In young skin, the basement membrane works to maintain the homeostatic interaction of the epidermis and dermis, ensuring moisture retention, flexibility, elasticity, and the like. Maintained.

  However, when there is an influence of certain external factors such as ultraviolet irradiation, excessive drying of the air, excessive skin washing, etc., or when aging progresses, type IV collagen, which is a main component of the basement membrane, and laminin 5 causes decomposition and alteration, and the basement membrane structure is destroyed (see Non-Patent Document 3). As a result, the skin's moisturizing function and elasticity are lowered, and the keratin begins to exfoliate abnormally, so the skin loses its tension and gloss, and exhibits aging symptoms such as roughness and wrinkles. As described above, changes associated with skin aging, that is, wrinkles, dullness, disappearance of texture, decrease in elasticity, and the like, are associated with a decrease in basement membrane components and a change in basement membrane structure.

  Recent studies have pointed out the involvement of matrix metalloproteinases (MMPs) as factors that induce this change. Among these MMPs, MMP-9, an enzyme belonging to the gelatinase group, is known as an enzyme that degrades type IV collagen and laminin 5 which are main components of the basement membrane, but its expression and activity are irradiated with ultraviolet rays. It has been clarified that it increases significantly due to ultraviolet rays, causes a decrease in the basement membrane component due to ultraviolet rays, changes in the structure of the basement membrane, and causes major factors such as the formation of wrinkles and sagging in the skin (see Non-Patent Document 4).

  Therefore, it is desired to develop a substance that improves skin function by suppressing a decrease in basement membrane components and a structural change of the basement membrane by suppressing an increase in expression of MMP9 mRNA.

  Based on such an idea, examples of those having a matrix metalloprotease inhibitory action include black ganoderma extract (see Patent Document 2), extract from chestnut astringent skin fermented product (see Patent Document 3), and the like. ing.

  The epidermis and dermis of the skin are composed of epidermal cells, fibroblasts, and extracellular matrices such as elastin, hyaluronic acid, and collagen that are outside these cells and support the skin structure. In young skin, the proliferation of fibroblasts is active, and the interaction between skin tissues such as fibroblasts and collagen keeps homeostasis, ensuring moisture retention, flexibility, elasticity, etc. It is maintained in a fresh state with its tension and gloss.

  However, when there is an influence of certain external factors such as irradiation of ultraviolet rays, significant drying of air, excessive skin washing, etc., or when aging progresses, the production amount of collagen, which is a main component of the extracellular matrix, is increased. It causes a decrease in elasticity due to cross-linking. As a result, the skin retains its moisturizing function and elasticity, and the keratin begins to exfoliate abnormally. Therefore, the skin loses its tension and gloss, and exhibits an aging phenomenon such as rough skin and wrinkles. As described above, changes associated with skin aging, that is, wrinkles, dullness, disappearance of texture, decrease in elasticity, and the like are associated with a decrease / denaturation of dermal matrix components such as collagen. Therefore, it is considered that skin aging can be prevented and / or improved by promoting collagen production in dermal fibroblasts.

  Conventionally, as a herbal medicine having a collagen production promoting action, a quince extract (see Patent Document 4) is known.

  An amino acid which is a main component of natural moisturizing factors (NMF) is produced by degrading filaggrin derived from keratohyalin granules in the stratum corneum. This filaggrin is expressed as profilagrin in epidermal keratinocytes existing in the granule layer immediately below the stratum corneum. It is then phosphorylated immediately, accumulated in keratohyalin granules, decomposed to filaggrin through dephosphorylation and hydrolysis, transferred to the stratum corneum, increased the efficiency of keratin filament aggregation, and is involved in the internal construction of keratinocytes It is known (see Non-Patent Document 5).

  In recent years, it has been known that this filaggrin is very important and indispensable for moisture retention of the skin, and that the synthetic power of filaggrin is reduced by conditions such as drying, and the amount of amino acids in the stratum corneum is reduced ( Non-patent document 6).

  Therefore, in the epidermal keratinocytes, it is expected that by promoting the production of filaggrin through promoting the production of profilagrin, thereby increasing the amount of amino acids in the stratum corneum, the water environment of the stratum corneum can be essentially improved. Has been.

  As what has such a profilagulin production promotion effect and a filaggrin production promotion effect, for example, a liquorice extract (refer patent document 5), the liquiritin known as flavanone glycoside contained in a natural plant (refer patent document 6) For example, a plant extract or yeast extract belonging to the genus Citrus (see Patent Document 7) or the like is known as one having profilaggrin and filaggrin protein production promoting action.

  In skin cells, it is known that aquaporins, known as water channels, are expressed on the cell membrane and play a role of taking in low-molecular substances such as interstitial water into cells.

  In humans, the presence of 13 types of aquaporins (AQP0 to AQP12) is known. In epidermal cells, AQP3 is mainly present, and it is considered to play a role of taking in low-molecular compounds such as glycerol and urea involved in water retention action in addition to water.

However, AQP3 decreases with aging, and it has been suggested that this contributes to a decrease in water retention function. Therefore, by promoting the expression of AQP3, the water retention capacity and barrier function due to aging, etc. Can be controlled (see Non-Patent Document 7). Based on such a concept, for example, tocopheryl retinoate (see Patent Document 8), an extract obtained from a Nozenhalen plant (see Patent Document 9) and the like are known as having AQP3 expression promoting action.
JP 2004-300048 A JP 2005-298391 A JP 2004-352634 A JP 2002-226323 A JP 2002-363054 A JP 2003-146886 A JP 2001-261568 A JP 2006-290873 A JP 2004-168732 A "Fragrance Journal", 2000, Vol.28, No.9, p.65-71 Marinkovich MP et al., “J. Cell. Biol.”, 1992, Vol.199, p.695-703 Lavker et al., “J. Invest. Dermatol.”, 1979, Vol. 73, p.59-66. Gary J. Fisher et al., “Nature”, 1996, Vol.379, No.25, p.335 "Fragrance Journal Extra Edition", 2000, Vol.17, p.14-19 “Arch. Dermatol. Res.”, 1996, Vol.288, p.442-446 "Fragrance Journal", 2006, Vol.34, No.10, p.19-23

  The present invention includes endothelin-1 mRNA expression inhibitory action, matrix metalloprotease-9 mRNA expression inhibitory action, collagen production promoting action, profilagulin production promoting action, filaggrin production promoting action and aquaporin 3 mRNA expression promoting action among highly safe natural products. An endothelin-1 mRNA expression inhibitor, a matrix metalloproteinase-9 mRNA expression inhibitor, a collagen production promoter, a profilagrin production promoter, a filaggrin production promoter, and an aquaporin 3 mRNA expression promoter. The purpose is to provide.

  In order to solve the above problems, the endothelin-1 mRNA expression inhibitor, the matrix metalloproteinase-9 mRNA expression inhibitor, the collagen production promoter, the profilagrin production promoter, the filaggrin production promoter, and the aquaporin 3 mRNA expression promoter according to the present invention include Butcher's Bloom. It contains an extract as an active ingredient.

  According to the present invention, Butcher's Bloom extract endothelin-1 mRNA expression inhibitor, matrix metalloprotease-9 mRNA expression inhibitor, collagen production promoter, profilagrin production promoter, filaggrin production promoter, and aquaporin 3 mRNA expression promotion are effective ingredients. It is possible to provide an endothelin-1 mRNA expression inhibitor, a matrix metalloproteinase-9 mRNA expression inhibitor, a collagen production promoter, a profilaggrin production promoter, a filaggrin production promoter, and an aquaporin 3 mRNA expression promoter that are contained and are excellent in safety. it can.

The present invention will be described below.
The endothelin-1 mRNA expression inhibitor, the matrix metalloproteinase-9 mRNA expression inhibitor, the collagen production promoter, the profilagrin production promoter, the filaggrin production promoter and the aquaporin 3 mRNA expression promoter of the present invention comprise Butcher's Bloom extract as an active ingredient. contains.

  Here, in the present invention, the “extract” is an extract obtained using Butcher's Bloom as an extraction raw material, a diluted or concentrated solution of the extract, a dried product obtained by drying the extract, or a crude product thereof. Both products and purified products are included.

The extraction raw material used in the present invention is Butcher's Bloom.
Butcher's Bloom (Scientific name: Ruscus aculeatus L., also known as Nagiikada) is a perennial evergreen shrub belonging to the genus Nagiidaa, distributed in southern Europe, North Africa, etc. on the Mediterranean coast, and is easily obtained from these regions be able to. Examples of the constituent part of Butcher's bloom that can be used as the extraction raw material include a leaf part, a flower part, a bark part, a branch part, a rhizome part, or a mixture of these parts, and a rhizome part is preferable.

  It has endothelin-1 mRNA expression inhibitory action, matrix metalloprotease-9 mRNA expression inhibitory action, collagen production promoting action, profilagulin production promoting action, filaggrin production promoting action or aquaporin 3 mRNA expression promoting action contained in the extract from the above extraction raw material Although details of the substance are unknown, extracts having these actions can be obtained from the above-mentioned raw materials for extraction by an extraction method generally used for extraction of natural products.

  For example, after drying the extraction raw material as necessary, it is pulverized as it is or using a crusher, and subjected to extraction with an extraction solvent, thereby inhibiting endothelin-1 mRNA expression, matrix metalloproteinase-9 mRNA expression, An extract having a collagen production promoting action, a profilagulin production promoting action, a filaggrin production promoting action or an aquaporin 3 mRNA expression promoting action can be obtained. Drying may be performed in the sun or using a commonly used dryer. Moreover, after performing pretreatment, such as degreasing, with a nonpolar solvent such as hexane, it may be used as an extraction raw material. By performing a pretreatment such as degreasing, the extraction material can be efficiently extracted with a polar solvent.

  As the extraction solvent, it is preferable to use a polar solvent, and examples thereof include water and hydrophilic organic solvents. These are used alone or in combination of two or more at room temperature or a temperature below the boiling point of the solvent. It is preferable.

  Examples of water that can be used as the extraction solvent include pure water, tap water, well water, mineral spring water, mineral water, hot spring water, spring water, fresh water, and the like, and those subjected to various treatments. Examples of the treatment applied to water include purification, heating, sterilization, filtration, ion exchange, osmotic pressure adjustment, buffering, and the like. Therefore, the water that can be used as the extraction solvent in the present invention includes purified water, hot water, ion-exchanged water, physiological saline, phosphate buffer, phosphate buffered saline, and the like.

  Examples of hydrophilic organic solvents that can be used as extraction solvents include lower aliphatic alcohols having 1 to 5 carbon atoms such as methanol, ethanol, propyl alcohol, and isopropyl alcohol; lower aliphatic ketones such as acetone and methyl ethyl ketone; 1,3-butylene. Examples thereof include polyhydric alcohols having 2 to 5 carbon atoms such as glycol, propylene glycol and glycerin.

  When using the liquid mixture of 2 or more types of polar solvents as an extraction solvent, the mixing ratio can be adjusted suitably. For example, when using a mixed solution of water and a lower aliphatic alcohol, it is preferable to mix 1 to 90 parts by volume of a lower aliphatic alcohol with respect to 10 parts by volume of water. When using a mixed solution, it is preferable to mix 1 to 40 parts by volume of a lower aliphatic ketone with 10 parts by volume of water, and when using a mixed solution of water and a polyhydric alcohol, water 10 It is preferable to mix 10 to 90 parts by volume of a polyhydric alcohol with respect to the volume part.

  The extraction treatment is not particularly limited as long as the soluble component contained in the extraction raw material can be eluted in the extraction solvent, and can be performed according to a conventional method. For example, the extraction raw material is immersed in an extraction solvent 5 to 15 times (mass ratio) of the extraction raw material, the soluble components are extracted at room temperature or under reflux, and then filtered to remove the extraction residue. A liquid can be obtained. The obtained extract is diluted, concentrated, dried, purified, etc. according to a conventional method in order to obtain a diluted or concentrated solution of the extract, a dried product of the extract, or a crude purified product or a purified product thereof. Processing may be performed.

  Purification can be performed by, for example, activated carbon treatment, adsorption resin treatment, ion exchange resin treatment, or the like. The obtained extract can be used as it is as an active ingredient of a glutathione production promoter, but a concentrate or a dried product is easier to use.

  Since Butcher's Bloom extract has a unique odor, it can be purified for the purpose of decolorization, deodorization, etc. within a range that does not cause a decrease in its physiological activity, but it is incorporated into skin cosmetics etc. In some cases, it is not used in large quantities, so there is no practical problem even if it is not purified.

  The Butchers Bloom extract obtained as described above has an endothelin-1 mRNA expression inhibitory action, a matrix metalloproteinase-9 mRNA expression inhibitory action, a collagen production promoting action, a profilagulin production promoting action, a filaggrin production promoting action and an aquaporin 3 mRNA expression promoting action. Therefore, using these actions, endothelin-1 mRNA expression inhibitor, matrix metalloproteinase-9 mRNA expression inhibitor, collagen production promoter, profilagrin production promoter, filaggrin production promoter and aquaporin 3 mRNA expression promotion It can be used as an active ingredient of an agent.

  Butcher's Bloom extract uses its endothelin-1 mRNA expression inhibitory action to prevent or treat diseases caused by increased expression of endothelin-1 mRNA (for example, prevention of cardiovascular diseases such as myocardial infarction and hypertension). -It can also be used as an active ingredient in therapeutic agents.

  The endothelin-1 mRNA expression inhibitor, the matrix metalloproteinase-9 mRNA expression inhibitor, the collagen production promoter, the profilagrin production promoter, the filaggrin production promoter or the aquaporin 3 mRNA expression promoter of the present invention comprises only Butcher's Bloom extract. It may be a formulation of Butcher's Bloom extract.

  Butcher's Bloom extract is used in any dosage form such as powder, granule, tablet, liquid, etc. according to a conventional method using a pharmaceutically acceptable carrier such as dextrin and cyclodextrin and any other auxiliary agent. It can be formulated. In this case, as an auxiliary agent, for example, an excipient, a binder, a disintegrant, a lubricant, a stabilizer, a flavoring / flavoring agent, and the like can be used. The Butchers Bloom extract can be used by blending with other compositions (for example, skin cosmetics, etc.), and can also be used as an ointment, a liquid for external use, a patch, and the like.

  The endothelin-1 mRNA expression inhibitor, the matrix metalloproteinase-9 mRNA expression inhibitor, the collagen production promoter, the profilagrin production promoter, the filaggrin production promoter, or the aquaporin 3 mRNA expression promoter of the present invention are optionally endothelin. -1 mRNA expression inhibitory action, matrix metalloproteinase-9 mRNA expression inhibitory action, collagen production promoting action, profilagulin production promoting action, filaggrin production promoting action or other natural extract having aquaporin 3 mRNA expression promoting action as an active ingredient Can be used.

  The administration method of the endothelin-1 mRNA expression inhibitor, matrix metalloprotease-9 mRNA expression inhibitor, collagen production promoter, profilagrin production promoter, filaggrin production promoter or aquaporin 3 mRNA expression promoter of the present invention is generally transdermally administered. Oral administration and the like can be mentioned, and a method suitable for the prevention / treatment or the like may be appropriately selected depending on the type of the disease. In addition, the dosage of the endothelin-1 mRNA expression inhibitor, matrix metalloprotease-9 mRNA expression inhibitor, collagen production promoter, profilagrin production promoter, filaggrin production promoter or aquaporin 3 mRNA expression promoter of the present invention is also a type of disease. The dose may be increased or decreased appropriately depending on the severity, individual differences among patients, administration methods, administration periods, and the like.

  The endothelin-1 mRNA expression inhibitor of the present invention suppresses endothelin-1 production through the endothelin-1 mRNA expression-suppressing action of Butcher's Bloom extract, and causes spots, buckwheat, skin darkness (skin pigmentation) and the like. Can be prevented and improved. Furthermore, the endothelin-1 mRNA expression inhibitor of the present invention can prevent, treat or improve cardiovascular diseases such as myocardial infarction and hypertension through the endothelin-1 mRNA expression inhibitory action of the Butcher's Bloom extract. However, the endothelin-1 mRNA expression inhibitor of the present invention can be used for all uses other than these uses, which are meaningful for exerting an endothelin-1 mRNA expression inhibitory action.

  Since the matrix metalloproteinase-9 mRNA expression inhibitor of the present invention can suppress the expression of matrix metalloproteinase-9 mRNA through the matrix metalloproteinase-9 mRNA expression inhibitory action of the Butcher's Bloom extract, It is possible to prevent and improve skin aging symptoms. However, the matrix metalloprotease-9 mRNA expression inhibitor of the present invention can be used for all purposes that are meaningful for exhibiting the matrix metalloprotease-9 mRNA expression inhibitory action in addition to these uses.

  The collagen production promoter of the present invention can promote collagen production through the collagen production promoting action of the Butchers Bloom extract. Thereby, the production amount of collagen in the skin tissue increases, and skin aging symptoms such as wrinkles, dullness, disappearance of texture, and decrease in elasticity can be prevented and improved. However, the collagen production promoter of the present invention can be used for all uses other than these uses that are meaningful for exerting a collagen production promoting effect.

  The profilaggrin production promoter of the present invention promotes the production of profilaggrin in cells through the profilaggrin production promoting action of Butcher's Bloom extract, increases the amount of filaggrin obtained by hydrolysis of profilagrin, and the skin Thus, it is possible to improve the moisture retention ability of the skin, thereby maintaining the elasticity of the skin and preventing / improving skin aging, dry skin, wrinkles, rough skin, and the like. However, the profilaggrin production promoter of the present invention can be used for all purposes that are meaningful for exerting a profilagrin production promoting action in addition to these uses.

  The filaggrin production promoter of the present invention can promote the production of filaggrin in cells through the filaggrin production promoting action of the Butcher's Bloom extract, and can improve the skin moisturizing ability, whereby the elasticity of the skin Can prevent and improve skin aging, dry skin, wrinkles, rough skin, and the like. However, the filaggrin production promoter of the present invention can be used for all purposes that are meaningful for exerting the filaggrin production promoting action in addition to these uses.

  The aquaporin 3 mRNA expression promoter of the present invention can promote the expression of aquaporin 3 mRNA through the aquaporin 3 mRNA expression promoting action of the Butcher's bloom extract, and therefore can improve the water retention capacity and barrier function of the skin. As a result, skin aging symptoms such as skin dryness, wrinkle formation and reduced elasticity can be prevented or improved. However, the aquaporin 3 mRNA expression promoter of the present invention can be used for all purposes other than these uses that are significant for exerting the aquaporin 3 mRNA expression promoting action.

  The endothelin-1 mRNA expression inhibitor, matrix metalloprotease-9 mRNA expression inhibitor, collagen production promoter, profilagrin production promoter, filaggrin production promoter or aquaporin 3 mRNA expression promoter of the present invention are suitable for humans. Although applied, as long as each effect is exhibited, it can also be applied to animals other than humans.

  Hereinafter, although a test example is shown and this invention is demonstrated concretely, this invention is not restrict | limited to the following test example at all. In this test example, a lyophilized product of Butchers Bloom extract (product name, manufactured by Maruzen Pharmaceutical Co., Ltd.) was used as the Butchers Bloom extract (Sample 1).

[Test Example 1] Endothelin-1 mRNA expression inhibitory action test The Butcher's Bloom extract (Sample 1) was tested for endothelin-1 mRNA expression inhibitory action as follows.

Normal human epidermis keratinocyte (NHEK) in normal human epidermis keratinocyte growth medium (EpiLife-KG2) in an 80 cm ² flask at 37 ° C., 5% CO ₂ -95% air The cells were precultured under the above conditions and cells were collected by trypsin treatment.

EpiLife-KG2 was used to seed 40 × 10 ⁴ cells / 2 mL / dish in 35 mm dishes (FALCON) and cultured overnight at 37 ° C. and 5% CO ₂ -95% air. After 24 hours, the culture solution was discarded, 1 mL of HEPES buffer was added, UV-B irradiation (50 mJ / cm ² ) was performed, and then the test sample dissolved in EpiLife-KG2 to the required concentration (sample 1, sample concentration is shown in the table below) 2 mL was added to each petri dish and cultured at 37 ° C. under 5% CO ₂ -95% air for 24 hours. After culturing, the culture solution is discarded, and total RNA is extracted with ISOGEN (Nippon Gene, Cat. No. 311-02501), and the amount of each RNA is measured with a spectrophotometer so that it becomes 200 ng / μL. Total RNA was prepared.

  Using this total RNA as a template, the expression levels of mRNA for endothelin-1 and GAPDH as an internal standard were measured. Detection was performed by real-time 2 Step RT-PCR reaction using TaKaRa SYBR PrimeScript RT-PCR Kit (Perfect Real Time, code No. RR063A) using a real-time PCR device Smart Cycler (Cepheid). The expression level of endothelin-1 mRNA is the value of GAPDH based on the total RNA preparation prepared from cells cultured without UV irradiation / sample addition, UV irradiation / sample addition and UV irradiation / sample addition, respectively. Then, the correction values were calculated, and the correction values for UV irradiation / no sample addition and UV irradiation / sample addition when the correction value for UV non-irradiation / no sample addition was 100 were calculated. From the obtained results, the endothelin-1 mRNA expression inhibition rate (%) was calculated by the following formula.

mRNA expression suppression rate (%) = {(A−B) − (A−C)} / (A−B) × 100
In the formula, A represents “correction value when no UV irradiation is performed and no sample is added”, B represents “correction value when UV irradiation is performed and no sample is added”, and C is “correction value when UV irradiation is performed and sample is not added”. Represents.
The results are shown in Table 1.

  As shown in Table 1, it was confirmed that the Butcher's bloom extract has an excellent endothelin-1 mRNA expression inhibitory action, and particularly has an excellent endothelin-1 mRNA expression inhibitory action at a low concentration (1 μg / mL).

[Test Example 2] Matrix metalloproteinase-9 mRNA expression inhibitory action test The Butcher's Bloom extract (Sample 1) was tested for MMP-9 mRNA expression inhibitory action as follows.

Normal human epidermis keratinocyte (NHEK) in normal human epidermis keratinocyte growth medium (EpiLife-KG2) in an 80 cm ² flask at 37 ° C., 5% CO ₂ -95% air The cells were precultured under the above conditions and cells were collected by trypsin treatment.

EpiLife-KG2 was used to seed 40 × 10 ⁴ cells / 2 mL / dish in 35 mm dishes (FALCON) and cultured overnight at 37 ° C. and 5% CO ₂ -95% air. After 24 hours, the culture solution was discarded, 1 mL of HEPES buffer was added, UV-B irradiation (50 mJ / cm ² ) was performed, and then the test sample dissolved in EpiLife-KG2 to the required concentration (Sample 1, sample concentration: 1 μg / mL) 2 mL was added to each petri dish, and cultured for 24 hours under conditions of 37 ° C., 5% CO ₂ -95% air. After culturing, the culture solution is discarded, and total RNA is extracted with ISOGEN (Nippon Gene, Cat. No. 311-02501), and the amount of each RNA is measured with a spectrophotometer so that it becomes 200 ng / μL. Total RNA was prepared.

Using this total RNA as a template, the expression levels of MMP-9 and GAPDH, which is an internal standard, were measured. Detection was performed by real-time 2 Step RT-PCR reaction using TaKaRa SYBR PrimeScript RT-PCR Kit (Perfect Real Time, code No. RR063A) using a real-time PCR device Smart Cycler (Cepheid). The expression level of MMP-9 mRNA is the value of GAPDH based on the total RNA preparation prepared from cells cultured without UV irradiation / sample addition, UV irradiation / sample addition and UV irradiation / sample addition, respectively. Then, the correction value was calculated, and the correction values for UV irradiation / no sample addition and UV irradiation / sample addition when the correction value for UV non-irradiation / no sample addition was 100 were calculated. From the obtained results, the MMP-9 mRNA expression inhibition rate (%) was calculated by the following formula. In addition, the following were used as a primer for MMP-9.
F: acgcacgacgtcttccagta
R: caactcactccgggaactca

mRNA expression suppression rate (%) = {(A−B) − (A−C)} / (A−B) × 100
In the formula, A represents “correction value when no UV irradiation is performed and no sample is added”, B represents “correction value when UV irradiation is performed and no sample is added”, and C is “correction value when UV irradiation is performed and sample is not added”. Represents.

  As a result of the test described above, the MMP-9 mRNA expression suppression rate of the Butchers Bloom extract was 42.6%. From this, it was confirmed that Butcher's Bloom extract has an excellent MMP-9 mRNA expression inhibitory action.

[Test Example 3] Collagen production promoting action test The Butcher's Bloom extract (Sample 1) was tested for collagen production promoting action as follows.

Human normal fibroblasts (NB1RGB) were cultured using Dulbecco's MEM medium containing 10% FBS, and then cells were collected by trypsin treatment. The collected cells were diluted with Dulbecco's MEM medium containing 10% FBS to a cell density of 1.6 × 10 ⁵ cells / mL, then seeded at 100 μL per well on a 96-well microplate, and cultured overnight. After completion of the culture, the medium was removed, and 200 μL of each sample dissolved in Dulbecco's MEM medium containing 0.25% FBS (sample 1, sample concentration is shown in Table 2 below) was added to each well and cultured for 3 days. After culture, the amount of type I collagen in the medium of each well was measured by ELISA. In the same manner, the culture was carried out without adding the sample solution, and the amount of type I collagen was measured. From the obtained measurement results, the collagen production promotion rate (%) was calculated based on the following formula.

Collagen production promotion rate (%) = A / B × 100
In the formula, A represents “amount of type I collagen when a sample is added”, and B represents a “amount of type I collagen when no sample is added”.
The results are shown in Table 2.

  As shown in Table 2, it was confirmed that the Butchers Bloom extract has an excellent collagen production promoting action. In particular, it was confirmed that when the sample concentration is in the range of 100 to 200 μg / mL, it has a significant collagen production promoting effect.

[Test Example 4] Profilaggrin / filaggrin production promoting action test The butcher's bloom extract (sample 1) was tested for the profilagline / filaggulin production promoting action as follows.

Normal human newborn skin epidermal keratinocytes (NHEK) were cultured in normal human epidermal keratinocyte medium (KGM) in an 80 cm ² flask under conditions of 37 ° C. and 5% CO ₂ -95% air. Cells were collected. The obtained cells were adjusted to a cell density of 1.5 × 10 ⁵ cells / mL in the same medium, seeded on a 6-well collagen-coated plate by 2 mL, and incubated at 37 ° C., 5% CO ₂ -95% air. For 3 days. After culturing, the medium was replaced with ₂ mL of KGM containing the sample dissolved in 0.5% DMSO (Sample 1, see Table 3 below for sample concentration), and 5 cm under the conditions of 37 ° C, 5% CO ₂ -95% air. Cultured for days. After completion of the culture, total protein was prepared by a conventional method.

<Western blotting>
The sample adjusted to 10 μg / row was developed by SDS-PAGE and transferred to a PVDF membrane. After blocking with PBS (-) containing 5% skim milk, anti-human filaggrin monoclonal antibody (Harbor Bio-Products), biotin-labeled anti-mouse Ig (Whole Ab, Amersham Biosciences) and streptavidin-peroxidase conjugate The body (CALBIOCHEM) was diluted 1000 times with PBS (-) containing 0.1% Tween20 and 0.3% skim milk, and reacted sequentially, and ECL Western blotting detection reagents and analysis system (Amersham Biosciences) Profilaggrin and filaggrin were detected by luminescence. The detected band was quantitatively measured with KODAK 1D Image Analysis Software EDAS290 Version3.5.

  As a result, the profilaggrin production promoting effect of the sample was evaluated using the value obtained by adding the net intensity (band intensity) of profilagrin and filaggrin in 10 μg of the protein prepared from each of the cells cultured with and without the sample added. The profilaggrin production promotion rate (%) was calculated based on the following formula.

Profilaggrin production promotion rate (%) = A / B × 100
In the above formula, A represents “Net intensity at the time of sample addition (total value of profilagrin and filaggrin)” and B represents “Net intensity at the time of no sample addition (control)”.
The test results are shown in Table 3.

  As shown in Table 3, it was confirmed that the Butchers Bloom extract has an excellent profilagline production promoting action. Moreover, it was confirmed that the profilaggrin production promoting action of Butcher's Bloom extract depends on the concentration of the extract. In addition, since filaggrin is produced by hydrolysis of profilagrin in vivo, Butcher's Bloom extract having a profilagrin production promoting action promotes the production of profilagrin, and the amount of profilagrin in the cell By increasing the amount of filaggrin, the amount of filaggrin can also be increased, and as a result, it is considered to have a filaggrin production promoting action.

[Test Example 5] Aquaporin 3 mRNA expression promoting action test The Butcher's Bloom extract (Sample 1) was tested for aquaporin 3 (AQP3) mRNA expression promoting action as follows.

Normal human neonatal keratinocytes (NHEK) in an 80 cm ² flask in a growth medium (Epilife-KG2) for long-term culture of normal human epidermal keratinocytes (Epilife-KG2) at 37 ° C., 5% CO ₂ -95% air The cells were precultured under the above conditions and cells were collected by trypsin treatment.

Cells collected using EpiLife-KG2 were seeded in a 35 mm petri dish (manufactured by FALCON) at 40 × 10 ⁴ cells / 2 mL / dishlet and cultured overnight at 37 ° C. and 5% CO ₂ -95% air. . After 24 hours, the culture solution was discarded, and 2 mL each of the samples dissolved in Epilife-KG2 to the required concentration (Sample 1, see Table 4 below for sample concentration) was added to each dish, 37 ° C., 5% CO ₂ -95% The cells were cultured for 24 hours under air conditions. After culturing, the culture solution is discarded, and total RNA is extracted with ISOGEN (Nippon Gene, Cat. No. 311-02501), and the amount of each RNA is measured with a spectrophotometer so that it becomes 200 μg / mL. Total RNA was prepared.

  Using this total RNA as a template, the expression levels of AQP3 (aquaporin3) and the internal standard GAPDH mRNA were measured. Detection was performed by real-time 2-step RT-PCR reaction using TaKaRa SYBR PrimeScript RT-PCR kit (Perfect Real Time, code No. RR063A) using a real-time PCR device Smart Cycler (Cepheid). The expression level of AQP3 was determined based on the total RNA preparation prepared from the cells cultured with “no sample added” and “added sample”, respectively, and a correction value was obtained from the GAPDH value. The correction value of “sample addition” when the correction value was 100 was calculated. From the obtained results, the AQP3 mRNA expression promotion rate (%) was calculated by the following formula.

AQP3 mRNA expression promotion rate (%) = A / B × 100
In the above formula, A represents “correction value when sample is added”, and B represents “correction value when sample is not added”.
The results are shown in Table 4.

  As shown in Table 4, it was confirmed that the Butchers Bloom extract has an excellent AQP3 mRNA expression promoting action.

  Endothelin-1 mRNA expression inhibitor, matrix metalloproteinase-9 mRNA expression inhibitor, collagen production promoter, profilagrin production promoter, filaggrin production promoter and aquaporin 3 mRNA expression promoter of the present invention are skin aging, dry skin, wrinkles , Can greatly contribute to prevention or improvement of rough skin.

Claims (6)

  An endothelin-1 (ET-1) mRNA expression inhibitor comprising a Butcher's bloom extract as an active ingredient.   A matrix metalloproteinase-9 (MMP-9) mRNA expression inhibitor comprising a Butcher's bloom extract as an active ingredient.   A collagen production promoter comprising Butcher's Bloom extract as an active ingredient.   A profilagulin production promoter comprising Butcher's Bloom extract as an active ingredient.   A filaggrin production promoter comprising Butcher's Bloom extract as an active ingredient.   An aquaporin 3 (AQP3) mRNA expression promoter comprising Butcher's Bloom extract as an active ingredient.