JP2009171934A - Gene mutation involved in growth of black-haired japanese cattle - Google Patents

Abstract

<P>PROBLEM TO BE SOLVED: To provide a method for judging the meat character of bovine black-haired Japanese cattle, characterized by detecting the mutation of a bovine ghrelin receptor gene. <P>SOLUTION: The relationship between the mutation of a ghrelin receptor gene at its base level and a gain character such as carcass weight is statistically examined using 1,285 heads of black-haired Japanese cattle indirect test bovine population with environmental effect considered. As a result, it has been found that the combination of a single-base substitution site (the seventh site from a translation initiation point) present in the 5'-nontranslation domain and double-base replication (microsatellite) number mutation, i.e. haplotype, is significantly related to pre-slaughtered weight, body weight at the end of test, body weight increment per day on average, ribs meat thickness and subcutaneous fat thickness character. <P>COPYRIGHT: (C)2009,JPO&INPIT

Description

  The present invention relates to a method for determining a meat trait of Japanese bovine black cattle characterized by detecting a mutation on a ghrelin receptor gene in cattle.

  Japanese black hair is one of the precious genetic resources that Japan is proud of in the world, and is an excellent and high quality animal protein resource. In the future, the global food crisis is feared, and in order to improve the food self-sufficiency ratio in Japan, further improvements in the production of Japanese black meat are required. Furthermore, although identification of genes related to gain and its mutation analysis have progressed due to recent advances in molecular biological analysis techniques and bovine genome research, identification of effective genes related to gain and their mutations in Japanese black cattle In addition, the use of the genetic variation at the production site is extremely limited.

  There are reports on growth hormone gene mutations (GH1: c.457C> G, c.593C> T, chromosome 19) regarding genes and their mutations affecting carcass weight gain traits in Japanese black cattle (Patent Document 1). In addition, the microsatellite DNA polymorphism is used to study the region determination on the chromosome of the locus that affects the carcass weight and other gain traits in Japanese black cattle (chromosome number: 4, 5, 14) The gene has not yet been identified and its mutation has not been elucidated (Non-Patent Documents 1 and 2).

  On the other hand, the new hormone “ghrelin” produced in the stomach and has the effects of promoting feeding and releasing growth hormone exerts its function through the ghrelin receptor expressed in the hypothalamic arcuate nucleus, pituitary growth hormone-releasing cells, and the like. Rats in which gene expression of the ghrelin receptor is suppressed are clearly suppressed in growth. Furthermore, in humans, a relationship has been pointed out between mutations in the ghrelin receptor gene and feeding regulation traits such as obesity (Non-Patent Documents 3 and 4). In chickens, the relationship between growth hormone polymorphisms (SNPs) and fat accumulation has been pointed out (Non-patent Document 5).

Prior art document information related to the invention of the present application is shown below.
Senkoku, Mitsuhashi, patent application number CA2441938 Journal of Animal Science, 82, 3415-3420, 2004 Animal Genetics, 37,51-54, 2006 Miyasaka K., et al. J Neural Transm. 113 (9): 1279-85, 2006 Baessler A., et al. Diabetes. 54 (1): 259-67, 2005 Lei M., et al., Poult Sci. 86 (5): 835-42, 2007

The present invention has been made in view of such circumstances, and its purpose is to determine meat production traits of Japanese bovine black cattle characterized by detecting mutations in the ghrelin receptor gene in cattle. It is to provide a way to do.
As described above, the relationship between the growth of rats and human obesity with the ghrelin receptor gene has been pointed out. No research or technical development related to traits has been reported so far.
Therefore, the present invention clarifies the mutation of the ghrelin receptor gene in Japanese black hair, statistically relates to the carcass weight weight gain trait of Japanese black hair, etc. The purpose is to clarify the gene type. In addition, when typing this gene, it is required to be a technique that can easily determine the genotype.

The inventors of the present invention have intensively studied to solve the above problems.
First, the promoter region of the ghrelin receptor gene, 5 'untranslated region, exon 1 region, exon 2 region, intron 1 region, 3' untranslated region base substitution mutation and 5 'untranslated region 2 bases in Japanese black hair Mutations in the number of repeats (microsatellite) were analyzed, and mutations in the number of double base repeats (microsatellite) in the 5 ′ untranslated region, exon 1 region, and 5 ′ untranslated region were found. Such an example has not been reported so far. This locus is on the first chromosome and is different from the conventionally reported growth hormone locus.

In addition, when the relationship between the mutation at the base level of the ghrelin receptor gene and the carcass weight isotope trait was statistically examined using 1,285 black-haired Japanese indirect test cattle population considering environmental effects, A combination of a single base substitution site (position -7 from the translation start point) present in the 5 ′ untranslated region and a double base repeat (microsatellite) number mutation, ie, haplotype is carcass weight, pre-slaughter weight, body weight at the end of the test, 1 We found significant associations with traits of daily mean weight gain, rose thickness, and subcutaneous fat thickness.
The mutation at the base level of the ghrelin receptor gene in the Japanese black cattle of the present invention affects the gain trait. Individuals with heterozygous haplotypes for carcass weight have a 3% increase in carcass weight compared to homozygous haplotypes for normal effects. Individuals with homozygous haplotypes for carcass weight The carcass weight can be expected to increase by about 5% compared to individuals with homozygous haplotypes with normal effects.
The frequency of ghrelin receptor genes that have a positive effect on gain traits is estimated to be about 0.2 in the Japanese black population. Therefore, there is much room for increasing the frequency of this excellent gene.

More specifically, the present invention provides the following [1] to [20].
[1] A method for determining a meat trait of Japanese bovine black cattle characterized by detecting a mutation on a ghrelin receptor gene in a test cow, comprising the following steps (a) to (d) Comprising the steps of:
(A) a step of extracting DNA from a cow to be tested (b) a step of amplifying a DNA fragment containing a polymorphic site in the extracted DNA (c) analyzing the amplified DNA fragment and detecting a polymorphism The step of determining the meat trait based on the detected mutation in the steps (d) and (c) [2] The meat trait is the amount of meat produced, Method.
[3] The target trait for determining a meat trait is any of carcass weight, weight before slaughter, body weight at the end of the test, average daily weight gain, rose thickness, subcutaneous fat thickness, estimated yield, 1] or the determination method according to [2].
[4] The method according to any one of [1] to [3], wherein the polymorph is a microsatellite polymorph.
[5] The method according to [4], wherein a microsatellite polymorphism is detected at a polymorphic site corresponding to positions 2,429 to 2,472 in the base sequence described in SEQ ID NO: 1.
[6] When the number of allele repeats of at least one of homologous chromosomes is 19, 21, 22, 23, 24, 26, 29 or 33 in the step (d) according to [1], the amount of meat produced The method according to [4], wherein it is determined that there is a large amount.
[7] The method according to [4], wherein in the step (b) according to [1], the base sequence is amplified by a PCR method.
[8] The method according to [4], wherein in the step (c) according to [1], the microsatellite polymorphism is detected by determining the length of the amplified DNA fragment.
[9] The method according to [4], wherein in the step (c) according to [1], the microsatellite polymorphism is detected by determining a base sequence of the amplified DNA fragment.
[10] The method according to any one of [1] to [3], wherein the polymorphism is a single nucleotide polymorphism.
[11] When the base type at position -7 from the translation start point of the bovine ghrelin receptor gene in the polymorphic site is A compared to the case where C is C The method according to [10], wherein it is determined that the amount of meat produced is large.
[12] When the base type at position -7 from the translation start point of the bovine ghrelin receptor gene at the polymorphic site is C (compared to the case where the base type is A at position 2,697) is A The method according to [10], wherein it is determined that the amount of meat produced is small.
[13] The method according to [10], wherein in the step (b) according to [1], the base sequence is amplified by a PCR method.
[14] The method according to [10], wherein the presence of a single nucleotide polymorphism is detected by detecting a restriction fragment length polymorphism (RFLP) in the step (c) according to [1]. .
[15] The method according to [14], wherein a single nucleotide polymorphism at position -7 (position 2,697 in the nucleotide sequence described in SEQ ID NO: 1) is detected using the restriction enzyme MspI.
[16] The method according to [10], wherein in the step (c) according to [1], a single nucleotide polymorphism is detected by determining a base sequence of the amplified DNA fragment.
[17] In the step (c) according to [1], the single nucleotide polymorphism is detected with a probe that specifically hybridizes to DNA containing the single nucleotide polymorphism site. The method described.
[18] It specifically hybridizes to DNA containing a polymorphic site at position -7 (position 2,697 in the nucleotide sequence described in SEQ ID NO: 1) from the start of translation of the bovine ghrelin receptor gene, and has a chain length of at least 15 nucleotides Having a probe.
[19] A primer oligonucleotide for amplifying DNA containing the polymorphic site described in (a) or (b) below.
(A) Polymorphic site at position 2,697 in the base sequence described in SEQ ID NO: 1 (b) Polymorphic site corresponding to the sequence from positions 2,429 to 2,472 in the base sequence described in SEQ ID NO: 1 [20] [18 ] A kit for determining the meat traits of Japanese bovine black hair, comprising the probe according to [19] or the primer according to [19].

According to the present invention, a region on a gene related to the meat traits of Japanese black varieties is clarified, and the meat traits of Japanese black cultivars can be determined without imposing an excessive burden on those skilled in the art.
The present invention is widely used in the field of animal husbandry as an effective genetic marker in selection of candidate bulls for genetic improvement of gain traits such as carcass weight in Japanese black cattle, and selection of fattening calves on the production site. Expected to be used. Further, the selection of candidate bulls has a feature that can further enhance the effect of the direct test.
The microsatellite region associated with gain trait in the 5 ′ untranslated region of the bovine ghrelin receptor gene found by the present invention is not found in this region of other species. Therefore, by combining the microsatellite polymorphism and the single nucleotide polymorphism of the present invention, it has become possible to more efficiently determine the increased trait of Japanese black species even when compared with other species.

[Embodiment of the Invention]
The present inventors have clarified the mutation of the ghrelin receptor gene in Japanese black hair, statistically correlated with the carcass weight isoenzyme of Japanese black hair, and have a good effect on the growth of Japanese black hair The genotype that brings about The present invention is based on these findings.

  The present invention includes (a) a step of extracting DNA from a cow to be examined, (b) a step of amplifying a DNA fragment containing a polymorphic site in the extracted DNA, and (c) analyzing the amplified DNA fragment. Detecting a mutation on the ghrelin receptor gene for a test cow, comprising a step of determining a meat trait based on the detected mutation in the steps of (d) and (c). It is related with the method of determining the meat production character of Japanese black cattle characterized by this.

  The bovine ghrelin receptor gene in the present invention encodes a G protein-coupled receptor having a seven-transmembrane structure, and is expressed mainly in the hypothalamic arcuate nucleus, pituitary growth hormone-releasing cells, etc. It is a receptor gene necessary for the transmission of ghrelin signal secreted from. The base sequence of the bovine ghrelin receptor gene and its peripheral sequence is shown in SEQ ID NO: 1.

  Such sequences can be obtained by those skilled in the art by public genetic data banks, for example, NCBI accession number NW — 001493715. In the base sequence disclosed in NW — 001493715, the bovine ghrelin receptor gene according to the present application and its peripheral sequence (SEQ ID NO: 1) are portions corresponding to positions 756,821 to 763,282.

The cow to which the determination of meat production traits in the present invention is applied is a beef cattle, preferably a Japanese black breed.
In the present invention, “meat traits” refers to a criterion for objectively evaluating the amount of meat produced or the quality of meat in beef cattle. The target traits for determining the meat production traits are: test start age, test start body weight, test start body height, test end body weight, test end body height, average daily weight gain, pre-slaughter body weight, carcass weight, loin core area , Rose thickness, subcutaneous fat thickness, estimated yield, intermuscular fat thickness, BMS number (fat crossing number), etc. are preferred as meat traits that can determine superiority or inferiority by the gene mutation found in the present invention. Includes carcass weight, weight before slaughter, body weight at the end of the test, average daily weight gain, rose thickness, subcutaneous fat thickness, and estimated yield.
A person skilled in the art can easily measure meat production traits with reference to known methods and literature. For example, refer to Wagyu Registration Practical Indispensable (2005 edition, National Wagyu Registration Committee, Chapter 7 Meat Production Capacity Test of Bulls, Part 2 Articles of Incorporation, Regulations Class III bulls test method) Can do.

  Further, in the present invention, “determining meat traits” means that the meat traits of the beef cattle to be tested are significant compared to the meat traits of individuals not having a mutation in the bovine ghrelin receptor gene. Is to determine whether or not it has an excellent trait. The individual having a mutation in the bovine ghrelin receptor gene in the present invention is 2 to 10%, preferably 2 to 2 in each target trait for determining the meat trait compared to the meat trait of the individual not having the mutation. It shows an increase in meat production of about 5%, more preferably about 2-4%.

The first aspect of the “polymorph” in the present invention includes a microsatellite polymorph.
A microsatellite sequence refers to a repetitive sequence composed of repeating short unit sequences existing on the genome. The microsatellite sequence at a specific position on the genome may have a different number of repeats depending on the individual, and there are polymorphisms.
Examples of the microsatellite polymorphism of the present invention include polymorphisms at polymorphic sites corresponding to positions 2,429 to 2,472 in the nucleotide sequence set forth in SEQ ID NO: 1.
The type and the number of units of the repetitive sequence of the microsatellite sequence of the present invention vary depending on the individual. Preferably, the number of microsatellite 2 base (TG or TC) repeats in at least one chromosome among homologous chromosomes is 15, 19 respectively. , 21, 22, 23, 24, 26, 29, or 33, more preferably, when the number of repeats is 19, it can be determined that the meat trait is excellent.

  The method of the present invention includes (a) a step of extracting DNA from a cow to be examined. DNA extraction can be performed by those skilled in the art by a known method. First, a DNA sample is prepared from a cow. The DNA sample can be prepared from, for example, various bovine tissues, blood, and semen samples, but is not particularly limited thereto. These samples may be commercially available or may be collected by themselves. Extraction of DNA from cattle can be performed by those skilled in the art using generally known methods such as the phenol / chloroform method or a commercially available genomic DNA extraction kit.

  Next, in the method of the present invention, (b) a step of amplifying a DNA fragment containing a polymorphic site in the extracted DNA is performed. The amplification of the DNA can be performed, for example, by performing PCR using a DNA sample as a template, using a primer that hybridizes to the DNA fragment containing the polymorphic site of the present invention. For those skilled in the art, PCR can be performed by appropriately selecting optimal conditions for the reaction conditions and the like based on experiments or experience. Usually, PCR can be easily carried out using a commercially available reagent kit containing a reaction solution and a heat-resistant polymerase, a commercially available PCR device, and the like. The DNA region to be amplified by PCR is not particularly limited as long as it is a DNA region containing the polymorphic site of the present invention, but is a DNA containing a portion corresponding to positions 2,429 to 2,472 in the base sequence described in SEQ ID NO: 1. A region is preferred.

  The primer used in the PCR of the present invention is an oligonucleotide that specifically hybridizes under stringent conditions with a base sequence containing a portion corresponding to positions 2,429 to 2,472 in the base sequence set forth in SEQ ID NO: 1. There is no particular limitation. Here, “specifically hybridize” means normal hybridization conditions, preferably stringent hybridization conditions (for example, Sambrook et al., Molecular Cloning, Cold Spring Harbor Laboratory Press, New York, USA, In the condition described in the second edition 1989), it means that cross-hybridization does not occur significantly with DNA encoding other proteins.

  Hybridization conditions can be appropriately selected by those skilled in the art. An example is 25% formamide, 50% formamide under more severe conditions, 4 × SSC, 50 mM Hepes pH 7.0, 10 × Denhardt's solution, 20 μg / ml denatured in a hybridization solution containing denatured salmon sperm DNA at 42 ° C. After overnight prehybridization, a labeled probe is added and hybridization is performed by incubating overnight at 42 ° C. The cleaning solution and temperature conditions for the subsequent cleaning are about 1xSSC, 0.1% SDS, 37 ° C, more severe conditions are about 0.5xSSC, 0.1% SDS, 42 ° C, and more severe conditions are about 0.2xSSC. , 0.1% SDS, about 65 ° C. ”. Thus, isolation of DNA having high homology with the probe sequence can be expected as the conditions for washing hybridization are more severe. However, combinations of the above SSC, SDS, and temperature conditions are exemplary, and those skilled in the art will understand the above or other factors that determine the stringency of hybridization (eg, probe concentration, probe length, hybridization reaction). It is possible to achieve the same stringency as above by appropriately combining the time and the like.

A primer oligonucleotide sequence capable of amplifying the microsatellite sequence used in the present invention can be appropriately designed by those skilled in the art based on the sequence information of DNA serving as a template. Preferred is an oligonucleotide comprising 15 consecutive bases complementary to DNA comprising a portion corresponding to positions 2,429 to 2,472 in the nucleotide sequence set forth in SEQ ID NO: 1 or DNA which is the complementary strand thereof. In PCR, when a DNA region containing the microsatellite sequence is amplified, a pair of oligonucleotides set so as to sandwich the microsatellite sequence is usually used. Oligonucleotides comprising the nucleotide sequences set forth in SEQ ID NOs: 2, 3, 22, and 23 (FIGS. 1 to 3) are the most preferred examples of the oligonucleotide of the present invention.
The oligonucleotide of the present invention does not need to be completely complementary to the DNA region as long as the DNA region containing the microsatellite sequence can be amplified. For example, even an oligonucleotide having a substitution mutation to other bases on the 5 'end side or about several bases, or an arbitrary base added to the 5' end side, can be used as the oligonucleotide of the present invention. Is considered possible.
The above-mentioned oligonucleotides of the present invention can be easily obtained by those skilled in the art by using a commercially available oligonucleotide synthesizer or a synthetic oligonucleotide contract service.

  The primer of the present invention can be further modified. For example, a fluorescent substance or a primer labeled with a binding affinity substance such as biotin or digoxin can also be used in the method of the present invention.

Next, in the present invention, (c) a step of analyzing the amplified DNA fragment and detecting a polymorphism is performed. Those skilled in the art can analyze the amplified DNA fragment by various methods.
For example, the DNA fragment can be analyzed by determining the base sequence of the amplified DNA fragment. Those skilled in the art can easily determine the base sequence of the amplified DNA fragment using a DNA sequencer or the like. Further, by determining the base sequence, the kind and number of alleles contained in the microsatellite sequence can be determined in the amplified DNA fragment.

  In the detection of the microsatellite sequence, a method of detecting indirectly without determining the base sequence can be used in addition to the method of detecting directly by determining the base sequence as described above. A typical example of the indirect method is SSLP (Simple Sequence Length Polymorphism) method (Nucleic Acids Res. 1989; 17: 6463, Genomics. 1994; 19: 137). This method is based on the fact that the length (number of bases) of microsatellite present in the genome differs depending on the type of cattle, and PCR is performed by setting primers that sandwich the microsatellite. This is a method for detecting the difference in length of DNA fragments.

  In this method, first, a DNA sample is prepared from cattle, and then PCR is performed using the DNA sample as a template, using a primer that hybridizes to DNA containing the microsatellite site of the present invention. Next, the DNA amplified by PCR is separated on a gel, and the chain length of the separated DNA is analyzed. The difference in the chain length of the DNA separated on the gel can be detected as a difference in band pattern after electrophoresis of the DNA fragment. If one of the primers used for PCR is fluorescently labeled, the DNA fragment after electrophoresis can be analyzed using software (eg, GeneScan software, Genotyper software (Applied Biosystems)).

  After analyzing the DNA fragment, the analysis results of the cows to be tested are compared. The analysis result of the amplified DNA fragment specifically refers to the determined base sequence, the type and number of alleles contained in the determined microsatellite sequence in the amplified DNA fragment of the bovine subject to be tested. Or the length of a DNA fragment.

  Next, the present invention includes a step of determining meat traits based on the detected mutation in the steps (d) and (c). Specifically, in at least one of the homologous genes, the number of allele repeats contained in the microsatellite sequence is 15, 19, 21, 22, 23, 24, 26, 29 or 33, preferably 19. In this case, it can be determined that the meat traits are excellent.

As the second aspect of the “polymorphism” in the present invention, a single nucleotide polymorphism can be mentioned.
The “single nucleotide polymorphic site” of the present invention is not particularly limited as long as it is a polymorphism present in the bovine ghrelin receptor gene or a DNA region in the vicinity of the gene. Specifically, as a polymorphic site used in the method of the present invention, position -7 (position 2,697 in the base sequence described in SEQ ID NO: 1) or position +70 (SEQ ID NO :) from the translation start point of the bovine ghrelin receptor gene. And a polymorphic site corresponding to the polymorphic site at position 2,773 in the base sequence described in FIG.

  In a preferred embodiment of the present invention, the mutation of the base species at the polymorphic site described above is A compared with the case where the base species at position -7 (position 2,697 in the base sequence described in SEQ ID NO: 1) is C. When it is, it can be determined that there are many meat traits. On the other hand, when the base species at position -7 (position 2,697 in the base sequence described in SEQ ID NO: 1) is C, it can be determined that the amount of meat produced is small.

  The base type of the single nucleotide polymorphism site shown above may indicate a base type on the complementary strand side with respect to the sequence shown in the sequence listing, but if the sequence before and after described in this specification is used, It is easy for those skilled in the art to confirm the difference, and when performing detection, the other result can be determined inevitably by examining either the plus strand or the minus strand.

  A person skilled in the art can determine the base type in the single nucleotide polymorphic site of the present invention by various methods. For example, it can be carried out by directly determining the base sequence of DNA containing the single nucleotide polymorphic site of the present invention.

  In this method, as in the case of detecting the above-described microsatellite polymorphism, (a) a step of extracting DNA from the cow to be examined, (b) a DNA fragment containing the polymorphic site in the extracted DNA A step of amplifying the signal is performed.

  Next, in this method, (c) the amplified DNA fragment is analyzed to detect a polymorphism. Those skilled in the art can easily determine the base sequence of the isolated DNA using a DNA sequencer or the like.

  Various methods for determining the base type of a polymorphic site whose base variation has been clarified in advance are known. The method for determining the base species of the present invention is not particularly limited. For example, TaqMan PCR method, AcycloPrime method, MALDI-TOF / MS method and the like have been put to practical use as analysis methods applying the PCR method. Invader and RCA methods are known as methods for determining base types that do not depend on PCR. Furthermore, the base species can be determined using a DNA array. Any of the methods described herein can be applied to the determination of the base type of the polymorphic site in the present invention.

  In addition, the base species can be determined using the PCR-SSP method. The PCR-SSP method is a method for determining an SNP type by performing an extension reaction using an allele-specific primer on a PCR product. In the case of single nucleotide polymorphism analysis at position 2,697 in the nucleotide sequence set forth in SEQ ID NO: 1 of the present invention, a 198 base pair portion including the single nucleotide polymorphism portion at position 2,697 is first amplified by the first PCR. . Next, using this first PCR product as a template, reverse primer labeled with 5'FAM fluorescent dye is sized for each allele so that the single nucleotide polymorphism at position 2,697 is located at the 3 'end of the primer. (A allyl: 14 bases; C allyl: 17 bases). As the forward primer, the same primer as in the first PCR can be used (FIG. 5). Using these three types (forward primer primer: 1 type; reverse primer primer: 2 types), the second PCR (PCR-SSP) is performed. The genotype can be easily determined by discriminating the peak pattern of the PCR product with a sequencer.

  All of these methods have been developed for genotyping a large amount of samples at high speed. With the exception of MALDI-TOF / MS, it is usually necessary to prepare a labeled probe or the like in any way for either method. On the other hand, a method for determining a base type that does not rely on a labeled probe has been performed for a long time. As one of such methods, for example, a method using restriction fragment length polymorphism (RFLP), a PCR-RFLP method and the like can be mentioned.

  RFLP utilizes the fact that a restriction enzyme recognition site mutation or a base insertion or deletion in a DNA fragment caused by restriction enzyme treatment can be detected as a change in the size of the fragment produced after the restriction enzyme treatment. If there is a restriction enzyme that recognizes the base sequence containing the polymorphism to be detected, the base of the polymorphic site can be known by the principle of RFLP.

  In the present invention, a single nucleotide polymorphism at position -7 (position 2,697 in the nucleotide sequence described in SEQ ID NO: 1) can be detected using the restriction enzyme Msp I (FIG. 6). Similarly, a single nucleotide polymorphism at position +70 (position 2,773 in the base sequence described in SEQ ID NO: 1) can be detected using the restriction enzyme Tth111 I.

  Alternatively, a CAPS (Cleaved Amplifeid Polymorphic Sequence) marker or a primer can be used to introduce a mutation and a dCAPS (derived CAPS) marker that creates a restriction enzyme site. The dCAPS marker is a technique of creating a restriction enzyme site on a PCR product by causing a mismatch between a PCR primer and DNA of a template (Japanese Patent Laid-Open No. 2003-259898).

  As a method that does not require a labeled probe, a method for detecting a difference in base using a change in the secondary structure of DNA as an index is also known. PCR-SSCP utilizes the fact that the secondary structure of single-stranded DNA reflects the difference in its nucleotide sequence (Cloning and polymerase chain reaction-single-strand conformation polymorphism analysis of anonymous Alu repeats on chromosome 11. Genomics 1992 Jan 1; 12 (1): 139-146., Detection of p53 gene mutations in human brain tumors by single-strand conformation polymorphism analysis of polymerase chain reaction products. Oncogene. 1991 Aug 1; 6 (8): 1313- 1318., Multiple fluorescence-based PCR-SSCP analysis with postlabeling., PCR Methods Appl. 1995 Apr 1; 4 (5): 275-282.). The PCR-SSCP method is performed by dissociating the PCR product into single-stranded DNA and separating it on a non-denaturing gel. Since the mobility on the gel varies depending on the secondary structure of the single-stranded DNA, if there is a difference in base at the polymorphic site, it can be detected as a difference in mobility.

  Other examples of methods that do not require a labeled probe include denaturant gradient gel electrophoresis (DGGE method). The DGGE method is a method in which a mixture of DNA fragments is run in a polyacrylamide gel having a concentration gradient of a denaturing agent, and the DNA fragments are separated depending on the instability of each. When a mismatched unstable DNA fragment migrates to a certain denaturant concentration in the gel, the DNA sequence around the mismatch is partially dissociated into single strands due to its instability. The mobility of a partially dissociated DNA fragment becomes very slow and can be separated from the mobility of a complete double-stranded DNA without a dissociated portion.

  In addition, the DNA species can be used to determine the base species (Cell engineering separate volume “DNA microarray and the latest PCR method”, Shujunsha, published 2000.4 / 20, pp97-103 “SNP analysis using oligo DNA chip”, Sabae. Shinichi). In the DNA array, sample DNA (or RNA) is hybridized to a large number of probes arranged on the same plane, and the hybridization to each probe is detected by scanning the plane. Since responses to many probes can be observed simultaneously, for example, a DNA array is useful for analyzing a large number of polymorphic sites simultaneously.

  In addition to the above method, an allele specific oligonucleotide (ASO) hybridization method can be used to detect a base at a specific site. An allyl-specific oligonucleotide (ASO) is composed of a base sequence that hybridizes to a region where a polymorphic site to be detected is present. When ASO is hybridized to sample DNA, the hybridization efficiency decreases if a mismatch occurs at the polymorphic site due to the polymorphism. Mismatches can be detected by Southern blotting or a method that uses the property of quenching by intercalating a special fluorescent reagent into the hybrid gap. Mismatches can also be detected by the ribonuclease A mismatch cleavage method. In the present invention, in the base sequence set forth in SEQ ID NO: 1, it hybridizes to DNA containing the polymorphic site described in either the polymorphic site corresponding to the polymorphic site at position 2,697 or 2,773, and at least 15 Oligonucleotides having a nucleotide chain length can be used as probes used in hybridization methods.

  The oligonucleotide specifically hybridizes to DNA containing any one of the polymorphic sites of the present invention. Here, “specifically hybridize” means normal hybridization conditions, preferably stringent hybridization conditions (for example, Sambrook et al., Molecular Cloning, Cold Spring Harbor Laboratory Press, New York, USA, In the condition described in the second edition 1989), it means that cross-hybridization does not occur significantly with DNA encoding other proteins. If the specific hybridization is possible, the oligonucleotide is added to a DNA base sequence encoding a plant-derived protein having a function of controlling seed dormancy of the plant in a gene to be detected or a DNA region in the vicinity of the gene. On the other hand, it need not be completely complementary.

  Next, the present invention includes a step of determining meat traits based on the detected mutation in the steps (d) and (c). In the present invention, as described above, the mutation of the base species at the polymorphic site is A in comparison with the case where the base species at position -7 (position 2,697 in the base sequence described in SEQ ID NO: 1) is C. In some cases, it can be determined that there are many meat traits. On the other hand, when the base species at position -7 (position 2,697 in the base sequence described in SEQ ID NO: 1) is C, it can be determined that the amount of meat produced is small.

  The present invention also includes a method for determining the meat traits of Japanese black cattle by simultaneously detecting a plurality of the microsatellite polymorphisms of the present invention and the single nucleotide polymorphisms of the present invention. The combination of mutations is not particularly limited, but as an example of a preferred embodiment of the present invention, the number of allele repeats contained in the microsatellite sequence is 19 in at least one of the homologous genes. It is possible to determine that the meat trait is excellent when it has any or all of the single nucleotide polymorphisms.

The present invention provides a primer for amplifying a region containing the polymorphic site of the present invention, and a probe that hybridizes to a DNA region containing the polymorphic site.
In the present invention, the primer for amplifying a region containing a polymorphic site also includes a primer that can initiate complementary strand synthesis toward the polymorphic site using DNA containing the polymorphic site as a template. The primer can also be expressed as a primer for providing a replication origin on the 3 ′ side of the polymorphic site in DNA containing the polymorphic site. The interval between the region where the primer hybridizes and the polymorphic site is arbitrary. For the interval between the two, a suitable number of bases can be selected according to the analysis method of the base at the polymorphic site. For example, in the case of a primer for analysis using a DNA chip, the primer can be designed so as to obtain an amplification product having a length of 20 to 500, usually 50 to 200 bases, as a region containing a polymorphic site. A person skilled in the art can design a primer according to the analysis method based on the base sequence information about the surrounding DNA region including the polymorphic site. The base sequence constituting the primer of the present invention can be appropriately modified as well as a base sequence completely complementary to the genomic base sequence.

  In addition to the base sequence complementary to the genomic base sequence, an arbitrary base sequence can be added to the primer of the present invention. For example, in a primer for a polymorphism analysis method using a type IIs restriction enzyme, a primer to which a recognition sequence for a type IIs restriction enzyme is added is used. Such a primer with a modified base sequence is included in the primer of the present invention. Furthermore, the primer of the present invention can be modified. For example, a fluorescent substance or a primer labeled with a binding affinity substance such as biotin or digoxin is used in various genotyping methods. Primers having these modifications are also included in the present invention.

  Specific examples of the primer of the present invention include (a) the polymorphic site at position 2,697, or the polymorphic site at position 2,773 in the base sequence described in SEQ ID NO: 1, or (b) described in SEQ ID NO: 1. Primer oligonucleotides for amplifying a DNA containing a polymorphic site corresponding to the sequence from position 2,429 to position 2,472 in the nucleotide sequence are included, but the primer of the present invention is not limited thereto. An example of such a primer is the primer set forth in SEQ ID NOs: 2-31.

  On the other hand, in the present invention, a probe that hybridizes to a region containing a polymorphic site refers to a probe that can hybridize to a polynucleotide having a base sequence of a region containing a polymorphic site. More specifically, a probe containing a polymorphic site in the base sequence of the probe is preferable as the probe of the present invention. Alternatively, depending on the base analysis method at the polymorphic site, the probe may be designed so that the end of the probe corresponds to a base adjacent to the polymorphic site. Therefore, although the polymorphic site is not included in the base sequence of the probe itself, a probe including a base sequence complementary to the region adjacent to the polymorphic site can also be shown as a desirable probe in the present invention.

  In other words, a probe capable of hybridizing to the polymorphic site of the present invention on genomic DNA or a site adjacent to the polymorphic site is preferred as the probe of the present invention. In the probe of the present invention, modification of the base sequence, addition of the base sequence, or modification is allowed in the same manner as the primer. For example, a probe used for the Invader method is added with a base sequence unrelated to the genome constituting the flap. Such a probe is also included in the probe of the present invention as long as it hybridizes to a region containing a polymorphic site. The base sequence constituting the probe of the present invention can be designed according to the analysis method based on the base sequence of the DNA region surrounding the polymorphic site of the present invention in the genome.

  The primer or probe of the present invention can be synthesized by any method based on the base sequence constituting it. The length of the base sequence complementary to the genomic DNA of the primer or probe of the present invention is usually 15 to 100, generally 15 to 50, preferably 15 to 30. A technique for synthesizing an oligonucleotide having the base sequence based on the given base sequence is known. Furthermore, in the synthesis of the oligonucleotide, any modification can be introduced into the oligonucleotide using a nucleotide derivative modified with a fluorescent dye or biotin. Alternatively, a method of binding a fluorescent dye or the like to a synthesized oligonucleotide is also known.

  As a specific example of the probe of the present invention, as described above, the polymorphism described in any of the polymorphic sites corresponding to the polymorphic site at position 2,697 or 2,773 in the nucleotide sequence set forth in SEQ ID NO: 1. A probe that hybridizes to a region containing a type site and has a chain length of at least 15 nucleotides.

Furthermore, the present invention also provides a bovine ghrelin receptor mutant protein in which the base species at position 2,773 in the base sequence set forth in SEQ ID NO: 1 is G.
Another embodiment of the test agent of the present invention is an identification reagent containing an antibody that specifically recognizes bovine ghrelin receptor mutant protein. The antibody is not particularly limited as long as it can be used in the method of the present invention, and examples thereof include a polyclonal antibody and a monoclonal antibody. The antibody may be labeled as necessary.

  Antibodies that recognize bovine ghrelin receptor mutant proteins can be prepared by methods known to those skilled in the art. For example, a polyclonal antibody can be obtained as follows. A serum is obtained by immunizing a small animal such as a rabbit with a recombinant bovine ghrelin receptor mutant protein expressed in a microorganism such as Escherichia coli or a partial peptide thereof as a bovine ghrelin receptor mutant protein or a fusion protein with GST. This is prepared by, for example, purification using ammonium sulfate precipitation, protein A, protein G column, DEAE ion exchange chromatography, an affinity column coupled with bovine ghrelin receptor mutant protein or synthetic peptide, or the like. In the case of a monoclonal antibody, for example, a bovine ghrelin receptor mutant protein or a partial peptide thereof is immunized to a small animal such as a mouse, and the spleen is removed from the mouse and ground to separate the cells. A myeloma cell is fused with a reagent such as polyethylene glycol, and a clone producing an antibody that binds to a bovine ghrelin receptor mutant protein is selected from the resulting fused cells (hybridoma). Subsequently, the obtained hybridoma is transplanted into the abdominal cavity of the mouse, and ascites is collected from the mouse, and the obtained monoclonal antibody is obtained by, for example, ammonium sulfate precipitation, protein A, protein G column, DEAE ion exchange chromatography, bovine ghrelin receptor. It can be prepared by purification using an affinity column coupled with a mutant protein or a synthetic peptide.

  The present invention also provides a reagent (test agent) for use in the method for determining the meat traits of the Japanese bovine Japanese black cattle of the present invention. The reagent of the present invention includes the primer, probe and / or antibody of the present invention. In the determination of meat traits of Japanese bovine Japanese black cattle, primers, probes and / or antibodies for amplifying DNA containing the polymorphic site described in any of the polymorphic sites of the present invention are used.

  The reagent of the present invention includes, for example, various enzymes, enzyme substrates, buffers, sterilized water, physiological saline, vegetable oil, in addition to primers, probes and / or antibodies which are active ingredients, depending on the method for determining the base species. , Surfactants, lipids, solubilizers, protein stabilizers (such as BSA and gelatin) and preservatives can be combined. As the enzyme, enzymes necessary for various analysis methods exemplified as the above-mentioned base species determination method such as DNA polymerase, DNA ligase, or IIs restriction enzyme can be shown. As the buffer solution, a buffer solution suitable for maintaining the activity of the enzyme used for these analyzes is appropriately selected. Furthermore, as the enzyme substrate, for example, a substrate for complementary strand synthesis is used.

Furthermore, another embodiment of the reagent of the present invention is a reagent for determining a meat trait of Japanese bovine black cattle comprising a solid phase on which a nucleotide probe that hybridizes with the DNA containing the polymorphic site of the present invention is immobilized. It is.
These are used for examinations using the polymorphic site of the present invention as an index. These preparation methods can be carried out by methods known to those skilled in the art.

  A kit for determining meat traits of Japanese bovine black hair containing at least one reagent of the present invention is also included in the present invention. In addition to the substances described in any of the primers, probes or antibodies, the kit contains, for example, various reagents, reaction solutions, control samples, reaction vessels, operating instruments, etc. for use in the method of the present invention. Can be included.

EXAMPLES Hereinafter, the present invention will be described more specifically with reference to examples, but the present invention is not limited to these examples.
[Example 1] Detection of microsatellite allele confirmed in individuals excellent in meat traits such as growth and carcass weight (1) From translation start point in 5'-flanking region of genomic DNA sequence of ghrelin receptor gene Pay attention to the microsatellite in the range from upstream -275 bases (position 2,429 in FIG. 2) to -232 bases (position 2,472 in FIG. 2) (FIGS. 1 and 2). We examined 1,285 Japanese black cat genomic DNA. In the examination, a PCR primer was prepared from the base sequence information so that the microsatellite region could be amplified (FIG. 1). The PCR conditions were as follows.
1) Primer / F-Primer: F: 1320 (Fam modification)
SEQ ID NO: 2: 5'-gggCTgTgggTCACTCTgTC-3 '
・ R-primer: R: 1449
SEQ ID NO: 3: 5'-gAggATgCTTggAAAggAAA-3 '
Amplification product: 180 base pairs 2) PCR solution
(DNA polymerase used: TOYOBO KOD Plus)
Per sample:
10 X Buffer 2 μl
dNTP 2μl
MgSO4 1μl
Primer (F) (10 pmol/μl) 1μl
Primer (R) (10 pmol/μl) 1μl
KOD Plus (enzyme) 0.3μl (0.3U)
Distilled water 11.7μl
DNA sample 1 μl
20 μl total
3) PCR conditions
(1) 94 ℃ 2 min
(2) 94 ℃ 30 sec
62 ° C 45 sec
68 ℃ 30 sec
35 cycles
(3) 68 ℃ 1 min
(4) Hold at 4 ℃
Confirm amplification on 2.5% agarose gel with 1x TAE buffer.
After confirming PCR amplification, determine the amplification size with a sequencer from ABI.

(2) When the size of the amplified PCR product is determined by a DNA sequencer, nine types of mutations, ie, 164, 172, 176, 178, 180, 182, 186, 192, and 200 base pairs, that is, alleles are observed in the size. It was. From the sequence of the primer region, the number of 2-base (TG or TC) repeats of these allele microsatellite is 15, 19, 21, 22, 23, 24, 26, 29, and 33 times (Table 1). In addition, the allele frequency varies from 0.04% to 32%. The main alleles with a frequency of 10% or more were 172 (14.5%), 178 (15.0%), 180 (26.5%), and 182 (32%) (Table 1).

(3) The analyzed 1,285 Japanese black breeds are 117 breeding bulls used in the progeny verification project conducted by the Livestock Improvement Agency, and all have meat and meat quality traits data. Trait data are the age at the start of the test, the body weight at the start of the test, the body height at the end of the test, the body weight at the end of the test, the average weight gain per day, the body weight before slaughter, the carcass weight, the loin core area, the rose thickness, the subcutaneous fat thickness, the estimation The 14 traits are yield, intermuscular fat thickness, and BMS No (fat crossing number) (Table 2).

(4) Allele combination of microsatellite DNA Allele types of 34 types were recognized in 1,285 heads, of which only one individual was observed in three types of 164/172, 176/186 and 176/200 types. (Table 3). Therefore, in the statistical analysis of the relationship between the allele type of microsatellite DNA and the trait, only one individual was excluded from the allele type, and data of 31 types of allyl type 1,282 individuals were used (Table 3).

(5) Analysis of variance was performed using the statistical model as one-way arrangement of trait data value = average value + microsatellite DNA type + error. As a result, body weight at the end of the test (significance level: P = 0.001267, 0.5% or less), daily average weight gain (significance level: P = 0.003953, 0.5% or less), weight before slaughter (significance level: P = 0.002256, 0.5 %) And carcass weight (significance level: P = 0.000456, 0.1% or less), statistically significant results were obtained (Table 4). Statistically significant results were also obtained for subcutaneous fat thickness (P = 0.011427, 5% or less), rose thickness (P = 0.014564, 5% or less), and estimated yield (P = 0.041535, 5% or less). It was. However, there was no statistically significant difference in other traits such as BMS.No. Therefore, it was found that this microsatellite DNA type has a strong influence on carcass weight, carcass weight at termination, weight before slaughter, and daily average weight gain (Table 4).

(6) When the average value of carcass weight and average daily weight gain for each microsatellite DNA type was examined, the average value of individuals having heterozygous or homozygous allele 172 was always higher than the overall average value (Table 5). ). In addition, the average value of the carcass weight and the average daily weight gain of the individual having the heterozygous or homozygous allele 192 tended to exceed the overall average value (Table 5). Therefore, it has been clarified that allyl 172 and allyl 192, especially allyl 172, have an effect of improving meat productivity, and particularly allyl 172 has a remarkable effect.

(7) In order to clarify this result, it is conveniently divided into “allele 172” and “other than allele 172”, and the statistical model is expressed as: trait data value = mean value + microsatellite DNA type (“allyl172 / Allyl 172 ”,“ Allyl 172 / Allyl 172 ”and“ Allyl 172 / Allyl 172 ”) + Analysis of variance was performed as a one-way configuration of error. In this analysis, “carcass weight”, “body weight at the end”, “weight before slaughter”, and “daily average weight gain”, which were significantly different from each other by analysis of variance with various microsatellite DNA types, were analyzed. As a result, it was found that all of the above four traits had a significant probability of 0.005% or less, and that there was clearly a statistical difference between the three types of microsatellite DNA types (Table 6).

(8) The average values of “carcass weight”, “daily average weight gain”, “body weight at the end of test”, and “weight before slaughter” of 935 individuals without “Allyl 172” were 349.2 kg and 0.90 kg, respectively. , 593.4kg, 589.0kg, 323 individuals with heterozygous "Allyl 172" average values of 36 individuals, 360.6kg, 0.94kg, 610.6kg, 605.2kg, and 24 individuals with "Allyl 172" homozygous The average values of were 366.8 kg, 0.96 kg, 618.7 kg, and 614.0 kg (Table 7).

  The difference in the average value of each trait was 11.4 each between an individual not having “Allyl 172” (Allyl type: 0 in Table 7) and an individual having “Allyl 172” in a hetero type (Allyl type: 1 in Table 7). kg (3.3%), 0.035 (3.9%), 17.1 kg (2.9%), 16.2 kg (2.8%). In addition, 17.6 kg (4.9%), 0.058 each between individuals who do not have “Allyl 172” (Allyl type: 0 in Table 7) and those who have “Allyl 172” in homotype (Allyl type: 2 in Table 7) (6.2%), 25.2 kg (4.1%), and 25.0 kg (4.1%). Furthermore, 6.2 kg (1.7%), 0.023 (2.4%), 8.1 kg each between individuals having “Allyl 172” as heterozygous individuals (Allyl type in Table 7: 1) and those having “Allyl 172” as homozygous (1.3%) and 8.8 kg (1.4%).

  Therefore, the average value of individuals having “Allyl 172” in a hetero form is 11.4 kg (3.3%) in carcass weight and 0.035 kg in daily average weight gain from the average value of individuals without “Allyl 172” ( 3.9%), the weight at the end of the test was 17.1 kg (2.9%), and the body weight before sacrifice was 16.2 kg (2.9%). In addition, the average value of individuals having “Allyl 172” in homo form is 17.6 kg (4.9%) in carcass weight, 0.058 kg (6.2% in average daily weight), compared with the average value of individuals having no “Allyl 172”. %), The body weight at the end of the test was 25.2 kg (4.1%), and the weight before sacrifice was 25.0 kg (4.1%). The average value of individuals with “Allyl 172” in the homozygous form is 6.2 kg (1.7%) in carcass weight and 0.023 kg (2.4% in average daily weight) than the average value of individuals with “Allyl 172” in the heterozygous form. %), The body weight at the end of the test was 8.1 kg (1.3%), and the body weight before slaughter was 8.8 kg (1.4%). These results revealed that the positive effect of “Allyl 172” on carcass weight, average daily weight gain, body weight at the end of the test, and body weight before slaughter was additive (Table 7).

(9) Three types of allyl combinations, namely (1) "Allyl 172" / "Allyl 172" (2) "Allyl 172" / "Other than Allyl 172" (3) "Other than Allyl 172" / "Other than Allyl 172" The difference in the average value between allyl types was tested by the Scheffe method to determine which of the samples had a statistical difference (Table 8). As a result, in all four traits of “carcass weight”, “daily average weight gain”, “weight at end”, and “weight before slaughter”, “Allyl 172” / “Except allele 172” and “Except allele 172” / There was always a statistically significant difference between “other than Allyl 172” at a level of 0.01% or less. Also, between “Allyl 172” / “Allyl 172” and “Except Allyl 172” / “Except Allyl 172”, “Average daily weight gain” is statistically significant at 5% significance level, and “Carcass weight” is The values were close to the 5% significance level, and the “body weight at the end” and “weight before slaughter” were statistically significant at the 10% level. Therefore, it was clarified that the individuals having one or more “allyl 172” and the individuals not having any “allyl 172” are clearly superior in all four traits.

[Example 2] Relationship between single nucleotide polymorphism (SNP) analysis and meat traits (1) Mutations such as single nucleotide substitution (SNP) exist in ghrelin receptor gene regions other than microsatellite regions, and haplotypes It is possible that this SNP mutation has an influence on meat quality traits. Therefore, it was examined whether a mutation at the base level exists in the ghrelin receptor gene other than the microsatellite portion.
To examine mutations at the base level, 5 'flanking region including 5' UTR region other than microsatellite region, 5 'untranslated region, exon 1 portion, intron region, exon 2 portion, 3' flanking region ( Nine primer sets covering the base sequence of the 3′UTR portion) and about 6.4 kilobase pairs were prepared, amplified by PCR, and the base sequence was determined (FIGS. 2 and 3). In examining base substitution mutations in the entire gene region, it is not realistic in terms of time, cost and labor to carry out with all the head samples having trait data for all nine regions. Therefore, microsatellite is regarded as a mutation marker, and alleles 172, allyl 180 and allyl 182 which are the major microsatellite alleles of Japanese black hair are homozygous (1 individual, 2 individuals, 2 individuals total 5 individuals) and excellent A base sequence of about 6.4 kb of the ghrelin receptor gene was determined using a total of 8 individuals of 3 heterozygous 172 individuals (allylic: 172/180, 172/192, 172/200).
The PCR conditions were as follows for all primer sets.
1) Primer The positions and sequences of the F-primer and R primer of each primer set are shown in FIGS. 2 and 3 and SEQ ID NOs: 4 to 23, respectively.
2) PCR solution
(DNA polymerase used: Takara LA Taq)
Per sample:
2 X GC Buffer I 10μl
dNTP Mixture (2.5mM each) 3.2μl
Primer (F) (10 pmol/μl) 1μl
Primer (R) (10 pmol/μl) 1μl
Takara LA Taq (5U / μl) 0.2μl (1U)
Distilled water 3.6μl
Genomic DNA sample (10ng / μl) 1μl
20 μl total
3) PCR conditions
(1) 94 ℃ 4 min
(2) 94 ℃ 30 sec
60 ℃ 45 sec
72 ℃ 60 sec
35 cycles
(3) 72 ℃ 2 min
(4) Hold at 4 ℃
Amplification was confirmed on a 2.5% agarose gel with 1 × TAE buffer.
After confirming PCR amplification, the PCR amplification product was purified on a Sephadex plate, and this was used as a template for BigDye Terminator v3.1 Cycle sequencing Kit (Applied Biosystems) by the Dye Terminator method. The primer used was the same primer as that used for PCR amplification, and the nucleotide sequence was determined from both sides.
For polymorphic bases, the sequence waveform data was used to calculate the accuracy (quality value) of each base, assemble and detect polymorphic bases using Phred / phrap / PolyPhred software and SEQUENCHER (Genecodes) software. The polymorphic base detected by the software was always checked visually, and the polymorphic waveform was clearly adopted as the polymorphic base.

(2) Detection of polymorphic bases in the ghrelin receptor gene region:
Table 9 shows the results of determination of the total nucleotide sequence of the microsatellite type and the ghrelin receptor gene of about 6.4 kb for eight Japanese black breeds. In this gene region, 20 polymorphic bases were found among 8 individuals. The breakdown of the region in which the polymorphic base was recognized was 2 5 ′ flanking regions, 1 5 ′ untranslated region, 3 exon 1 regions, and 14 intron 1 regions. No polymorphic bases were found in exons 2 and 3 ′ untranslated regions. In addition, one of 20 polymorphic bases (position 4,689) was an insertion / deletion of 4 bases.

Among these 20 polymorphic bases, polymorphic bases that form linkage disequilibrium haplotypes with the microsatellite type and are consistent with the effects of microsatellite alleles are located in the 5 'untranslated region and are located at the macrosatellite locus. It was a single nucleotide polymorphism at position 2,697 in SEQ ID NO: 1 (allyl: A, C) in the vicinity. This position is the seventh position (-7th position) upstream of the translation start point (FIG. 4). From these results, it was inferred that the major microsatellite alleles formed haplotypes 172-2, 180-C, 182-C, 192-A, and 200-C, respectively.

(3) Haplotype construction with microsatellite in the ghrelin receptor gene region:
Next, whether these results can be said for the analyzed sample 1,285 individuals as a whole, the single nucleotide polymorphism at position 2,697 was analyzed in 1,285 individuals.
The analysis method was based on the PCR-SSP method suitable for typing a large number of samples (SSP: Sequence Specific Primer). Separately, single nucleotide polymorphism analysis at position 2,697 can also be performed by the RFLP method.
(A) PCR-SSP method conditions:
In the PCR-SSP method, an extension reaction is performed on an PCR product using an allele-specific primer to determine the SNP type. In the case of this single nucleotide polymorphism analysis, a 198 base pair portion including the single nucleotide polymorphism portion at position 2,697 is first amplified by the first PCR. Next, using this first PCR product as a template, 5'FAM fluorescent dye-labeled R-primer is placed for each allele so that the single nucleotide polymorphism at position 2,697 is located at the 3 'end of the primer. Change size (A allele: 14 bases; C allyl: 17 bases)
Make it. The F-primer is the same primer as the first PCR.
Using these three types (F-primer: 2 types; R-primer: 1 type), the second PCR (PCR-SSP) is performed. As shown in FIGS. 5 and 7, the A allele is a 106 base pair product and the C allele is a 109 base pair product, and the genotype can be easily determined by discriminating the peak pattern of the PCR product with a sequencer.
(1) First PCR primer
F-primer: ACTCTTTTGCGCCTAACTAAGGA (SEQ ID NO: 24)
R-primer: CTCGTCAGTCAGCGAGTCATT (SEQ ID NO: 25)
PCR product size: 198 bp
(2) PCR reaction solution
QIAGEN multi Kit 5.0μl
10μM GhrelinR_F3 0.5μl
10μM GhrelinR_R3 0.5μl
Sterile distilled water 3.0 μl
DNA 2.0 μl
11.0μl total
(3) PCR conditions
(℃) Time Cycle (s)
94 15min 1
94 15sec 35
60 30sec
72 90sec
72 30min 1
10 ∞
Add 70 μl of sterile distilled water to the PCR product, and use it as a template for PCR reaction for PCR-SSP reaction.
(4) PCR-SSP reaction primer
C-allyl R-primer of single nucleotide polymorphism at position 2,697
(FAM) CATTCCACATGCTGCCG (SEQ ID NO: 26)
PCR product size: 109 bp
Single nucleotide polymorphism A allyl R-primer at position 2,697
(FAM) TCCACATGCTGCCT (SEQ ID NO: 27)
PCR product size: 106bp
(5) PCR reaction solution
QIAGEN multi Kit 5.0μl
1μM GhrelinR_SNP-7_C_3 0.4μl
1μM GhrelinR_SNP-7_A_3 1.2μl
Sterile distilled water 2.4μl
PCR Product 1.0μl
Total 10.0μl
(6) PCR conditions
(℃) Time Cycle (s)
94 15min 1
94 15sec 35
60 30sec
72 90sec
72 30min 1
10 ∞
Confirm the amplification size of the PCR-SSP product using an ABI sequencer in the usual way. The result appears as waveform data, and the polymorphism is determined by the length of the fragment. As an example, the result of determining the SNP at position 2,697 is shown in FIG.

(B) RFLP method Perform twice (nested) PCR, digest with restriction enzyme MspI (recognition site: C! CGG), and determine the SNP type from the cut DNA fragment pattern.
(1) First PCR primer (PCR product: 583 bp)
F-primer bGhrR / FP (1484) / OD1: CTTTCCAAgCATCCTCCCTgAg (SEQ ID NO: 28)
R-primer bGhrR / RP (2067) / OD1: gAAgCAgATggCgAAgTAgCg (SEQ ID NO: 29)
(2) DNA polymerase used in PCR solution: KOD plus
Per sample (total 20μl)
2 μl of 10X KOD buffer
dNTP (2.5 mM) 2 μl
MgSO4 (25mM) 1μl
F-primer (10 pmol/μl) 1μl
R-Primer (10 pmol/μl) 1μl
KOD Plus (enzyme) 0.3μl
Sterile distilled water 11.7 μl
DNA sample (10-50μg / ml) 1μl
20 μl total
(3) First PCR conditions
(i) 94 ℃ 2 min. 1 cycle
(ii) 94 ℃ 30 sec 30 cycles
60 ℃ 45 sec
68 ℃ 30 sec
(iii) 68 ℃ 60 sec 1 cycle
(iv) 4 ℃ keep (1) 94 ℃ 4 min
(4) Second PCR (PCR product: 191 bp)
Primer:
FP (2SNRF2666) -01: CAgTCgCgTCCCTgAACC (SEQ ID NO: 30)
RP (2SNRF2856) -02: CACgCAggTggCTgTgAC (SEQ ID NO: 31)
1 μl of DNA sample diluted 100 with distilled water from the first PCR product
(5) PCR solution DNA polymerase used: KOD plus
Per sample (total 20μl)
2 μl of 10X KOD buffer
dNTP (2.5 mM) 2 μl
MgSO4 (25mM) 1μl
F-primer (10 pmol/μl) 1μl
R-primer (10 pmol/μl) 1μl
KOD Plμs (enzyme) 0.3μl
Sterile distilled water 11.7 μl
DNA sample (100-fold dilution of the first PCR) 1μl
20 μl total
(6) Second PCR
(i) 94 ℃ 2 min. 1 cycle
(ii) 94 ℃ 30 sec 35 cycles
61.5 ℃ 45 sec
68 ℃ 30 sec
(iii) 68 ℃ 60 sec 1 cycle
(iv) 4 ℃ keep
(7) RFLP with MspI: 5 μl of second PCR product per sample
10XT buffer 2μl
0.1% BSA 2μl
MspI (restriction enzyme) 10 U / μl 0.5 μl
Sterile distilled water 10.5μl
20 μl total
Digest at 37 ° C for 1 hour.

(C) Results
The band pattern is determined by 15% acrylamide gel electrophoresis. The ANP of SNP has a band pattern of 112, 49, 21, 17 bp. Also. The C allele of SNP has a 112, 35, 21, 17, 14 bp band pattern (FIGS. 6 and 8).

  Table 10 shows the results of analyzing the 1,697 single nucleotide polymorphism in 1,285 samples. Of the 34 types of microsatellite types, 32 types had a one-to-one correspondence with the 2,697 position single nucleotide polymorphism, but 178/180 types were A / C and C / C types, and 180/182 types were A / C. And C / C type. Furthermore, from these genotype combinations, haplotypes of microsatellite and single nucleotide polymorphism at position 2,697 were constructed (Table 11). As shown in Table 11, allyl 172 formed a major haplotype (172-A) with allyl A. Other major haplotypes included 178-A, 180-C, and 182-C, and minor haplotypes included 176-A, 186-A, 192-A, and 200-C. In addition, 164-A, 178-C, and 182-A exist as very minor haplotypes, and 178-C and 182-A were presumed to be recombinants of 178-A and 182-C, which are the major haplotypes, respectively. . In addition, the frequency of allele A of the 2,697 single nucleotide polymorphism was 37.2%, and the frequency of allyl C was 62.8% (Table 11).

  As shown in Table 11, allyl A having a single nucleotide polymorphism at position 2,697 forms a major haplotype with microsatellite allyl 172 and allyl 178, and microsatellite allyl 192, allyl 186, allyl 176 and Formed a minor haplotype with a low frequency of appearance. Therefore, we used the same sample as the microsatellite type effect on the possibility that the 2,697 position single nucleotide polymorphism (SNP) affects meat traits and that allyl A has a more desirable effect than allyl C. Statistically examined.

(4) Statistical study on the relationship between SNP 2,697 and meat traits:
Statistical analysis and analysis of variance were performed for statistical analysis of the relationship between SNP 2,697 and meat traits, with the statistical model as one-way arrangement of trait data value = mean value + SNP type 2,697 + error (Table 12, Table 13).
As a result of statistical analysis, the average values of `` carcass weight '', `` average daily weight gain '', `` body weight at the end of test '', `` weight before slaughter '' of 174 AA individuals are 355.4 kg, 0.924 kg, 604.25 kg, respectively , 598.97kg, the average value of 609 AC type is 355.24kg, 0.917kg, 602.50kg, 597.84kg, and the average value of 502 CC type individuals is 347.80kg, 0.902kg, 590.76kg, 586.27kg Yes, AA type> AC type> CC type in all four traits (Table 12). In addition, according to the mean variance analysis of these three genotypes, the F values for each of the four traits between carcass weight, average daily weight gain, body weight at the end of the test, and body weight before slaughter were 6.466 (significant level: 0.5% or less), 3.967. (Significance level: 5% or less), 7.056 (significance level: 0.5% or less), 6.700 (significance level: 0.5% or less), and the effect of the difference in average values among the three alleles of AA, AC and CC types Was statistically significant (Table 13).

(5) Further, when the SNP genotype, AA type, AC type, and CC type were tested for differences in mean values of the four traits using the Scheffe method, the three traits were carcass weight, body weight at the end of the test, and body weight before slaughter. All were statistically significant between AC type and CC type (significance 0.5% or less) and between AA type and CC (significance 5% or less). Further, the average daily weight gain was statistically close between AC type and CC type and between AA type and CC type (significance probability 5-8%) (Table 14).

  From the above, the effect of SNP at position 2,697 on these four traits (AA type> AC type> CC type) is statistically significant, but the significance value is divided into microsatellite other than allyl 172 and allyl 172. Therefore, the effect of this SNP on the four meat characteristics was estimated to be smaller than that of the microsatellite.

(6) Next, the effects on the 4 traits of carcass weight, average daily weight gain, body weight at the end of the test, and body weight before sacrifice were as follows: microsatellite (Allyl 172 and other alleles) and SNP (Allyl A) at position 2,697 And allele C), statistical analysis and analysis of variance based on a combination of haplotypes focusing on both genotypes were performed. That is, the microsatellite type was divided into allele 172 and other alleles, and the 2,697-position SNP was divided into allele A and allele C, and statistical analysis and analysis of variance were performed on 1,285 head trait data (Table 15, Table 15). 16). In the statistical model, analysis of variance was performed by using one-way arrangement of character data value = average value + haplotype type + error.

(7) As a result of statistical analysis, the combined frequency of the six haplotypes is 24 out of 1,285 172-A / 172-A types, 172-A / 172 other than -A96, other than 172-A / 172-C228 Head, other than 172 -A / 172 other -A54, other than 172 -A / 172 other -C381 and other than 172 -C / 172 other -C502 head, haplotype frequency is 172-A: other than 0.144, 172 -A: Except 0.228 and 172 -C: 0.628 (Table 15). The frequency of haplotype 172-A was 0.144, which was almost the same as the frequency of allyl 172 when focusing on microsatellite: 0.1449 (Table 1).

  The average values of “carcass weight”, “daily weight gain”, “body weight at the end of test”, and “weight before slaughter” of the six haplotype combinations are always 172-A / 172-A> 172-A / Other than -A> 172-A / Other than 172 -C> Other than 172 -A / Other than 172 -C> Other than 172 -C / Other than 172 -C> Other than 172 -A / Other than 172- When the haplotype was “A”, there was always a tendency that the average value of the trait was high (Table 16).

  In addition, according to the analysis of variance of the average value of the combined type of these six haplotypes (Table 17), the F value for each of the four traits among the carcass weight, the average daily weight gain, the body weight at the end of the test, and the body weight before slaughter is 6.694 Significance level: 0.001% or less), 6.242 (significance level: 0.001% or less), 6.596 (significance level: 0.001% or less), 6.129 (significance level: 0.005% or less), the average value among the combination types of the six haplotypes The effect of the difference was statistically very significant (Table 17). These significant probabilities were clearly smaller than the analysis focusing on microsatellite (Table 4) and the analysis focusing on the 2,697 SNP (Table 13). Moreover, it was almost the same as the significance (Table 6) of the analysis of variance of the 3 microsatellite type divided into allele 172 and allele 172. Therefore, it was found that the microsatellite type and the 2,697-position SNP haplotype combined type had a greater effect on these four traits of meat than the microsatellite type alone or the 2,697-position SNP type.

(8) Next, the test of the difference of the average value among these 6 types of haplotypes was performed by the Scheffe method, and it was examined which haplotype type had a statistically significant difference. As a result, as shown in Table 18, in the four traits between carcass weight, average daily weight gain, body weight at the end of the test, and body weight before slaughter, other than 172-A / 172-A, except 172-A / 172-C There was a statistically significant difference between this group and those other than 172-A / except 172-A, other than 172-C / other than 172-C (significance level: 0.5% to 10% level). That is, it was shown that an individual having the “172-A” haplotype in a hetero form is superior to those having no “172-A” haplotype in these four traits. Since the “172-A” haplotype / homotype has a small number of 24 cases, it seems statistically not significantly different from any other type. Therefore, it was found that when the microsatellite does not have 172 alleles, the meat quality 4 trait decreases even if the SNP is AA homotype. From the above, it was speculated that the microsatellite type is the most important for the effect on these four traits, and that the excellent effect of SNP allyl A at position 2,697 is expressed under allyl 172.

(9) Based on the above, the microsatellite-2,697 SNP haplotypes of the ghrelin receptor gene are “carcass weight”, “average daily weight gain”, “weight at the end of assay”, “weight before slaughter”. It was also statistically significant, and it was found that the “172-A” haplotype had a statistically clearly superior effect over the other haplotypes.

(10) The following hypothesis can be considered as to why microsatellite 172 alleles have superior effects on four traits such as carcass weight than other alleles.
That is, in the nucleus, the ghrelin receptor gene is transcribed into mRNA including the microsatellite TG repeat site in the 5 'UTR, becomes splice out of intron 1 and becomes mature mRNA, and then the mature mRNA moves into the cytoplasm. The translation initiation codon site binds to ribosomal RNA, which is the site of protein synthesis. Translation factors involved in translation bind to the binding between mature mRNA and ribosomal RNA, and translation begins. The translation efficiency is affected by the TG repeat repeat structure encoded by the microsatellite sequence upstream of the codon as the 5'UTR of mRNA, and the three-dimensional structure of mRNA is affected, and allele 172 has 19 TG repeats. mRNA is synthesized ghrelin receptor with higher transcription efficiency than allyl 178, allyl 180, allyl 182, allyl 192, allyl 200 with TG repeat number of 22, 23, 24, 29, and 33 each. It is assumed that protein production will increase.

(11) Whether or not allyl A of the SNP at position 2,697 shows an effect superior to allele C in four traits such as carcass weight is considered as follows.
The SNP position at positions 2,697 is a region that is always transcribed into mRNA as a 5 'untranslated region. The translation start point from -3 to +4 is called Kozak sequence, and the consensus sequence is (-3) ACC AUG C (+4) (AUG is the translation start codon of methionine). This Kozak sequence is an important sequence that initiates translation through the interaction of mRNA and ribosomal RNA during translation. Among these sequences, A (adenine) at position -3 and C (cytosine) at position +4 are particularly important, and it is known that the efficiency of translation changes when base substitution occurs at this site. The translation start position 2,697 is close to the -3 position, which is particularly important in the Kozak sequence, and allyl A (adenine) and allyl C (cytosine) at the 2,697 SNP position differ in purine and pyrimidine due to their base structures. Therefore, the translation efficiency of mRNA transcribed from the ghrelin receptor gene by this substitution of allyl A and allyl C is that of the “172-A” haplotype having 19 TG repeats of the microsatellite coding portion described above. It is speculated that translation efficiency is further improved by allyl A in the three-dimensional structure of mRNA. Therefore, growth hormone-releasing cells such as the pituitary gland of individuals with this “172-A” haplotype have an increased number of ghrelin receptor molecules, resulting in increased sensitivity to ghrelin, and the same ghrelin stimulation. The growth hormone secretion amount is 172-A / 172-A, except 172-A / 172-A> 172-A / 172-C group> other than 172-A / 172-C-other than 172-C / Other than 172-C> Other than 172-A / Other than 172-A group is considered. Therefore, individuals with 172-A haplotype have higher growth hormone secretion than those without, which may have a positive effect on gain traits such as carcass weight.

(12) The frequency of the 172-A haplotype is about 0.144 in the Japanese black population, and if we focus on this haplotype and use it for mating, it will be “average daily weight gain”, “weight at the end of the test”, “sacrifice” The improvement of meat production traits of "pre-weight" can be seen. The extent can be estimated at about 3% per 172-A haplotype.

(13) The microsatellite region associated with the gain trait in the 5 ′ untranslated region of the bovine ghrelin receptor gene is not found in this region of other species (FIG. 9). Therefore, by combining the microsatellite polymorphism and the single nucleotide polymorphism, it becomes possible to more efficiently determine the increased traits of Japanese black species even when compared with other species.

It is a figure which shows the position of a microsatellite and a primer in a bovine ghrelin receptor gene 5 'flanking region (SEQ ID NO: 1, 2,204 to 2,703). It is a figure which shows the ghrelin receptor gene base sequence (SEQ ID NO: 1) and the mutation site of the present invention. It is a continuation of FIG. 2-1. It is a continuation of FIG. It is a continuation of FIG. It is a continuation of FIG. It is a continuation of FIG. It is a figure which shows the genomic structure of a ghrelin receptor gene, and the position of a primer set. From the 5 'flanking region amplified by primer set 04 (SEQ ID NOs: 10 and 11) and from the translation initiation store detected in most of exon 1 (584 base pairs, SEQ ID NOs: 1, 2,561 to 3,144) It is a figure which shows the single nucleotide polymorphism (SNPs) in the upstream 7 base (-7th position) and the downstream (+70 position) exon 1. It is a figure which shows the position of the primer used by PCR-SSP method. It is a figure which shows the recognition site | part of SNPs (downward arrow) and restriction enzyme MspI in 2,679 position of sequence number 1. It is a figure which shows the result of having determined SNPs in the 2,679 position of sequence number 1 by PCR-SSP method. It is a photograph which shows the result of having determined SNPs in 2,679 position of sequence number 1 by RFLP method. It is a figure which shows the sequence of 900 bases (bovine) and 856 bases (human, rat, and mouse) upstream from the translation start point in the 5 'flanking region of bovine, human, rat, and mouse ghrelin receptor genes. Cattle (parts from positions 1,804 to 2,703 of SEQ ID NO: 1), human (parts from positions 1,799 to 2,667 of AF369786, SEQ ID NO: 32), rat (positions 18,254,417 to 18,255,272 of NW_047621.1, SEQ ID NO: 33), Mouse (positions 11,609,174 to 11,610,029 of NT — 162143.3, SEQ ID NO: 34). The black line indicates the microsatellite array.

Claims (20)

A method for determining meat traits of Japanese bovine Japanese black cattle characterized by detecting a mutation on a ghrelin receptor gene for a test cow, comprising the following steps (a) to (d): Including methods.
(A) a step of extracting DNA from a cow to be tested (b) a step of amplifying a DNA fragment containing a polymorphic site in the extracted DNA (c) analyzing the amplified DNA fragment and detecting a polymorphism The step of determining the meat traits based on the detected mutation in the steps (d) and (c)   The method according to claim 1, wherein the meat trait is the amount of meat produced.   The target trait for determining a meat production trait is any one of carcass weight, weight before slaughter, body weight at the end of the test, daily average weight gain, rose thickness, subcutaneous fat thickness, and estimated yield. 2. The determination method according to 2.   The method according to claim 1, wherein the polymorph is a microsatellite polymorph.   Detecting a microsatellite polymorphism at a polymorphic site corresponding to -275 bases to -232 bases from the translation start point of the bovine ghrelin receptor gene (positions 2,429 to 2,472 in the base sequence described in SEQ ID NO: 1). The method according to claim 4, characterized in that:   In the step (d) according to claim 1, when the number of allele repeats of at least one of homologous chromosomes is 19, 21, 22, 23, 24, 26, 29 or 33, The method according to claim 4, characterized in that it is determined.   The method according to claim 4, wherein in step (b) according to claim 1, the amplification of the base sequence is performed by a PCR method.   5. The method according to claim 4, wherein in step (c) according to claim 1, the microsatellite polymorphism is detected by determining the length of the amplified DNA fragment.   The method according to claim 4, wherein the microsatellite polymorphism is detected by determining the base sequence of the amplified DNA fragment in the step (c) according to claim 1.   The method according to any one of claims 1 to 3, wherein the polymorphism is a single nucleotide polymorphism.   In the polymorphic site, when the base species at position -7 from the translation start point of the bovine ghrelin receptor gene (position 2,697 in the base sequence described in SEQ ID NO: 1) is A compared to C, The method according to claim 10, wherein it is determined that the amount of meat is large.   In the polymorphic site, when the base species at position -7 from the translation start point of the bovine ghrelin receptor gene (position 2,697 in the base sequence described in SEQ ID NO: 1) is C compared to when it is A, The method according to claim 10, wherein the amount of meat is determined to be small.   The method according to claim 10, wherein in step (b) according to claim 1, amplification of the base sequence is performed by PCR.   The method according to claim 10, wherein the presence of a single nucleotide polymorphism is detected by detecting a restriction fragment length polymorphism (RFLP) in the step (c) according to claim 1.   The method according to claim 14, wherein a single nucleotide polymorphism at position -7 (position 2,697 in the nucleotide sequence described in SEQ ID NO: 1) is detected using a restriction enzyme MspI.   The method according to claim 10, wherein in step (c) according to claim 1, single nucleotide polymorphism is detected by determining the base sequence of the amplified DNA fragment.   The method according to claim 10, wherein in the step (c) according to claim 1, the single nucleotide polymorphism is detected by a probe that specifically hybridizes to DNA containing the single nucleotide polymorphism site. .   A probe that specifically hybridizes to DNA containing a polymorphic site at position -7 (position 2,697 in the nucleotide sequence described in SEQ ID NO: 1) from the translation start point of the bovine ghrelin receptor gene and has a chain length of at least 15 nucleotides . Primer oligonucleotide for amplifying DNA containing the polymorphic site described in the following (a) or (b).
(A) a polymorphic site at position 2,697 in the base sequence described in SEQ ID NO: 1 (b) a polymorphic site corresponding to the sequence from positions 2,429 to 2,472 in the base sequence described in SEQ ID NO: 1   A kit for determining the meat traits of Japanese bovine Japanese black cattle comprising the probe according to claim 18 or the primer according to claim 19.